Patent application title:

Retroviral Vector Particles and Methods for their Generation and Use

Publication number:

US20140227786A1

Publication date:
Application number:

14/164,850

Filed date:

2014-01-27

Abstract:

The present invention relates to methods of host cell transduction utilising ecotropic retroviral vector particles. The retroviral vector particle may comprise an envelope of Friend murine leukaemia virus, in particular the envelope encoded by molecular clone PVC-211 and the host cell may be engineered to recombinantly express the Rec1 receptor. The retroviral vector particles and methods of the invention can be used to introduce expressible polynucleotide sequences of interest into host cells with high efficiency. This results in protein production methods with higher yield (mg/L) and a reduction in manufacturing costs that could be used in a range of applications including for example, the production of therapeutic proteins, vaccines and antibodies.

Inventors:

Assignee:

Interested in similar patents?

Get notified when new applications in this technology area are published.

Classification:

C12N15/86 »  CPC main

Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor; Recombinant DNA-technology; Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression; Vectors or expression systems specially adapted for eukaryotic hosts for animal cells Viral vectors

C07K16/00 »  CPC further

Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies

Description

FIELD OF THE INVENTION

The present invention describes methods for the generation of retroviral vector particles facilitating enhanced gene transfer efficiency upon transduction of host cells. In particular, the present invention relates to methods for retroviral transduction using ecotropic murine leukaemia virus (MLV)-derived vector particles and methods for modifying host cells to further increase gene transfer efficiency.

BACKGROUND

Over the last decade, the research work of many pharmaceutical and biotechnology companies has focused on the generation of biological products using recombinant DNA technology. Such biopharmaceutical products include e.g. enzymes, synthetic hormones, vaccines, monoclonal antibodies, cytokines. Whilst simple proteins can be produced using bacterial cultures, more complex proteins with a requirement for carbohydrate modification, e.g. glycosylation, assembly of different subunits, correct folding and functionality need to be produced in mammalian cells. Mammalian cell cultures are traditionally used for the production of glycosylated recombinant protein products and commonly used cell lines include, Chinese hamster ovary (CHO) cells, 293 Human embryonic Kidney (HEK) cells, COS cells, Baby Hamster Kidney (BHK) cells, PER.C6® and mouse myeloma cell lines such as NS0 or Sp2/0.

Since recombinant proteins for the therapy of human diseases need to have natural folding and post-translational modification and because they need to remain pharmacologically active for a defined shelf-life, supply of recombinant proteins for clinical studies and therapy requires the development of a highly reproducible and controlled production process. Such a process should ensure high quality and stability of the product in accordance with the quality obligations of the regulatory authorities at an acceptable cost of goods.

Mammalian cell lines, which allow the production of therapeutic proteins, are required to have high productivities and stable phenotypic and genotypic product expression profiles. The introduction of genetic information into a host cell genome by the process of DNA transfection is acknowledged to be an inefficient process. Therefore the present invention addresses this problem by utilising a method of retroviral transduction to achieve highly efficient transfer of genetic information into the genome of host cells. A current method of retroviral expression of recombinant proteins in the only industry approved production cell line utilises a pantropic vector with the ability to infect all species and therefore requires a Bio safety level 2 (BSL2) system (Bleck, 2005). This is a potential safety concern for the generation of therapeutic proteins resulting in higher costs during production to ensure staff safety and comply with the associated regulations. These drawbacks can be overcome by the use of an ecotropic retrovirus vector particle as described in the present invention, which has a restricted host cell infectivity and can therefore be used without safety concerns, resulting in lower production costs.

SUMMARY OF THE INVENTION

An embodiment of the present invention provides a method for transducing a host cell utilising a retroviral vector particle. The retroviral vector particle can comprise or be pseudotyped with an envelope of an ecotropic murine leukaemia virus (MLV) or a portion of the envelope that enables the pseudotyped retroviral vector particle to retain the host range and infectivity conferred by the full length envelope. Preferably the envelope is from Friend murine leukaemia virus (Fr-MLV), and more preferably the envelope is from a variant of Fr-MLV known as PVC-211 MLV. The envelope of PVC-211 (encoded by the nucleic acid of SEQ ID No: 1) displays the host range and infectivity of the native retrovirus (e.g. ecotropic MLV or Fr-MLV) but has not been used before for the generation of retroviral vector particles for the transduction of host cells. Since an ecotropic MLV envelope is used, the infectivity of the retroviral vector particle is limited to the same species and therefore these retroviral vector particles can only infect rodent species. Hence use of these retroviral vector particles in laboratory work requires only BSL 1 conditions, resulting in negligible safety concerns and significantly reduced costs, when compared to working under BSL2 conditions for example.

Host cells previously resistant to transfection or transduction with a retroviral vector particle comprising a wild type envelope (wtEnv) of Moloney murine leukaemia virus (Mo-MLV) show susceptibility or increased susceptibility to transduction when the retroviral vector particle comprises a Fr-MLV envelope. Preferably, the Fr-MLV envelope is from PVC-211. As such, the present invention provides a method for conferring or increasing susceptibility of a host cell to transduction comprising use of a retroviral vector particle comprising an envelope of Fr-MLV. In a preferred embodiment, the envelope of Fr-MLV is encoded by molecular clone PVC-211 (SEQ ID No: 1) or a fragment thereof, which when expressed has the same function as the full length PVC-211 envelope protein.

In one embodiment, said PVC-211 functional fragment effects transfection or transduction of a retroviral vector particle comprising an envelope of an ecotropic MLV into a host cell (e.g. a rodent cell). In one embodiment, said host cell is a host cell (e.g. a rodent cell) that is not (or is only poorly) susceptible to transfection or transduction with a retroviral vector particle comprising a wtEnv of Mo-MLV. In one embodiment, a functional fragment comprises a nucleotide sequence that has at least 80% (e.g. at least 85%, at least 90%, at least 92%, at least 94%, at least 96%, at least 98%, at least 99%) sequence identity to a nucleotide sequence consisting of at least 1500 contiguous nucleotides (eg. at least 1600 contiguous nucleotide, at least 1700 contiguous nucleotides, at least 1800 contiguous nucleotides, at least 1900 contiguous nucleotides, at least 2000 contiguous nucleotides) of SEQ ID NO: 1.

Use of a retroviral vector particle of the invention (e.g. comprising an envelope of PVC-211) results in much higher transduction efficiencies than the use of a retroviral vector particle comprising a wild type envelope of Mo-MLV.

Transduction efficiency can be further increased by the recombinant expression of the receptor for ecotropic MLV known as Rec1 (SEQ ID No: 32) or a functional fragment of this receptor sequence, in the target host cell. By expression of this receptor, host cells that were previously resistant to infection by ecotropic MLV particles become permissive to infection.

In one embodiment, expression of said Rec1 functional fragment in a host cell effects (e.g. facilitates or enhances) transfection or transduction of a retroviral vector particle comprising an envelope of an ecotropic MLV into said host cell (e.g. a rodent cell). In one embodiment, said host cell is a host cell (e.g. a rodent cell) that is not (or is only poorly) susceptible to transfection or transduction with a retroviral vector particle comprising a wtEnv of Mo-MLV. In one embodiment, a functional fragment comprises an amino acid sequence that has at least 80% (e.g. at least 85%, at least 90%, at least 92%, at least 94%, at least 96%, at least 98%, at least 99%) sequence identity to an amino acid sequence consisting of at least 400 contiguous amino acid residues (eg. at least 450 contiguous amino acid residues, at least 500 contiguous amino acid residues, at least 550 contiguous amino acid residues, at least 600 contiguous amino acid residues) of SEQ ID NO: 32.

The present invention therefore provides a method for increasing transduction efficiency comprising transducing a host cell with a retroviral vector particle comprising an ecotropic envelope of MLV, wherein the host cell recombinantly expresses the Rec1 receptor. Preferably the host cell is a hamster cell, more preferably the host cell is a Chinese hamster ovary (CHO) cell. Preferably the envelope of MLV is from a Fr-MLV, more preferably the envelope is encoded by molecular clone PVC-211 (SEQ ID No: 1) or a functional fragment thereof. The present invention demonstrates very high levels of transduction efficiency due to the synergistic effect resulting from the transduction of a host cell recombinantly expressing the Rec1 receptor with a retroviral vector particle comprising the envelope of PVC-211. The retroviral vector particles of the present invention can therefore be utilised to provide protein production methods with higher yields and a reduction in manufacturing costs, which could be used in a range of applications including for example, the production of therapeutic proteins, vaccines and antibodies. It has been demonstrated for the present invention that protein can be produced at a concentration of at least 1 mg/L in host cells recombinantly expressing the Rec1 receptor, transduced with a retroviral vector particle comprising the envelope of PVC-211.

In a further embodiment, the present invention provides a retroviral packaging cell for producing a retroviral vector particle comprising:

a) an envelope construct comprising a promoter operably linked to an envelope coding sequence of a Fr-MLV, wherein the envelope of Fr-MLV is encoded by molecular clone PVC-211 (SEQ ID NO: 1) or a functional fragment thereof; and
b) a packaging construct comprising a promoter operably linked to a nucleotide sequence encoding a retroviral gag and pol.

In addition to the envelope and packaging constructs, the packaging cell may also comprise a retroviral transfer vector. The transfer vector may comprise the components of a retroviral 5′ LTR, a retroviral packaging sequence distal to the 5′ LTR and a retroviral 3′ LTR. In addition, the transfer vector may also comprise an internal ribosome entry site (IRES) and/or a marker gene such as a fluorescent protein, for example, GFP. Furthermore, the transfer vector may also comprise a heterologous nucleotide sequence, which encodes a protein of interest.

In an embodiment of the present invention, the packaging cell and transfer vector as described above can be coexpressed in a host cell under conditions effective to produce a retroviral vector particle. Suitable host cells can be selected from any mammalian or human cell line.

The retroviral vector particle generated by the above method can be used to transduce a target host cell so that the nucleotide sequence coding for a protein of interest is integrated into the host cell genome and the protein encoded by the gene is subsequently expressed by the host cell. Preferably the host cell is a hamster cell, more preferably a CHO cell.

Methods according to the present invention may be used to transduce host cells to produce a protein of interest. The transduced host cells are cultured under conditions so that a protein encoded by the gene of interest is expressed and then the expressed protein can be isolated from the culture and purified. The concentration of purified protein produced is preferably at a level of 1 mg/L or more.

The retroviral vector particle may encode at least one gene of interest, preferably at least two genes of interest. Preferably two genes of interest comprise an immunoglobulin heavy chain and an immunoglobulin light chain. However, in an alternative embodiment two genes of interest may be located on separate retroviral vector particles so that one retroviral vector particle comprises a gene that codes for an immunoglobulin heavy chain and another retroviral vector particle comprises a gene that code for an immunoglobulin light chain.

DESCRIPTION OF THE FIGURES

FIG. 1 shows schematic designs of expression constructs that can be used in the present invention. The drawings depict the schematic design of expression cassettes in a standard DNA cloning backbone (closed black line), containing the ampicilin-resistance gene (AmpR) and the bacterial origin of replication (ori). All non-retroviral expression vectors shown (FIGS. 1a to f) contain a polyadenylation signal (polyA signal; black and white dashed box), an internal ribosome entry site (IRES; black box), a synthetic intron (black and white dotted box), and a promoter driving the expression of the transgene inserted 5′ of the synthetic intron. In FIGS. 1(a) to 1(e), the promoter is derived from human cytomegalovirus (CMV; white arrow). In FIG. 1(f), the promoter originates from the murine phospho-glycerol kinase housekeeper gene (Ppgk; grey dashed box).

FIG. 1a: The construct pIRES-puro contains the reporter gene puromycin-resistance (puroR) flanked by the restriction-sites for XmaI and XbaI. This parental vector does not encompass any other transgene. The multiple cloning site 3′ of the CMV-promoter includes unique restriction-sites for ClaI, NotI, EcoRI and BamHI in the multiple cloning site (MCS) for convenient insertion of an open reading frame (coding region) of choice.

FIG. 1b: pRec1-I-puro is derived from pIRES-puro and was modified by the insertion of the coding region of the receptor of ecotropic murine leukaemia virus (MLV) Rec1 using the restriction-sites NotI and BamHI.

FIG. 1c: pPVC-211 Env-I-puro was constructed by insertion of the envelope coding region of the molecular clone PVC-211 of ecotropic MLV into the recipient vector pIRES-puro using the sites in the MCS for NotI and EcoRI.

FIG. 1d: pwtEnv-I-puro was generated as for pPVC-211 Env-I-puro above, but encompasses the envelope coding region of wild type ecotropic MLV.

FIG. 1e: In contrast to FIGS. 1c and 1d, pIRES-bleo served as the recipient vector for the generation of the packaging construct pGP-I-bleo. In this vector, the selectable marker gene bleomycin-resistance (bleoR) is flanked by the restriction-sites XbaI and XmaI which allows for the controlled selection of transfected and bleomycin-resistant cells that will also express the structural genes of gag/pol of MLV (gag-pol (MLV)) inserted into the MCS employing NotI and EcoRI.

FIG. 1f: pPpgk-I-puro contains the murine phospho glycerol kinase gene promoter (Ppgk promoter) flanked by the restriction-sites MluI and ClaI replacing the CMV-promoter in the afore-mentioned constructs. The puromycin-resistance gene serves as a selectable marker (puroR).

FIG. 1g: Schematic illustration of the retroviral transfer vectors MigR1 and its derivates MigR1Ppgk and MigR1Pvκ. The parental vector MigR1 encompasses the flanking long terminal repeats (5′ and 3′ LTR), the packaging signal (psi/Ψ) required for the packaging of mRNA-transcripts of the transfer vector into MLV-derived vector particles, an internal ribosome entry site (IRES) and the reporter gene of green fluorescence protein (GFP). Unique restriction-sites for BglII and XhoI 5′ of the IRES are indicated and were used for the insertion of the promoter of the murine phospho glycerol kinase gene (Ppgk) or the human promoter of the variable kappa chain genes (Pvκ). A black arrow indicates the position of the stop codon of the reporter gene.

FIG. 1h: Nucleotide sequence of the pIRES-puro construct (1-5021 base pairs (bp)), shown in FIG. 1a. The vector components are at the positions as indicated in FIG. 1h and as listed herein: CMV promoter (230-820 bp), Multiple cloning site (MCS; 909-971 bp), Synthetic intron (974-1269 bp), IRES (1295-1881 bp), puromycin resistance gene (1888-2487 bp), poly A signal (2489-2773 bp) and ampicillin resistance gene (4087-4603 bp).

FIG. 1i: Nucleotide sequence of the MigR1 vector (6231 bp), shown schematically in FIG. 1g. The vector components are at the positions as indicated in FIG. 1h and as listed herein: 5′LTR (1-400 bp), IRES (1437-2012), GFP (2025-2744), 3′LTR (3050-3550) and ampicillin resistance gene (5362-4505).

FIG. 1j: The construct MigR1Ppgk-VEGF121-6xHIS-I-puro contains the murine Ppgk promoter flanked by the restriction sites for BgIII and XhoI. This promoter drives the expression of the human variant of VEGF121, flanked by the restriction sites NotI and EcoRI, which harbours a His-tag consisting of six histidine residues at the C-terminus, and the puromycin resistance gene. An IRES located between both genes couples their expression from the same mRNA transcript. This transcript is flanked by 5′ and 3′ LTRs.

FIG. 2a: Schematic illustration of the standard experimental procedure to test retroviral vector particle-mediated transduction of target cells. The retroviral vector components; envelope construct, packaging construct and transfer vector encoding the reporter gene GFP are transiently transfected into HEK cells. Two days post transfection, cell-free viral vector particle-containing supernatants are harvested and subjected to spin-infection of target cells. Upon continuous culture for at least one additional day, cells are analyzed for the expression of the reporter gene GFP using fluorescence-activated cell sorting (FACS).

FIG. 2b: FACS-analysis of transduced murine 1624-5 pre-B and Chinese hamster ovary CHO-S cells using MLV-based vector particles displaying the envelope wtEnv of ecotropic MLV (Mo-MLV). Untransduced cells served as negative controls (NC). The expression of the transduced reporter gene GFP is detected.

FIG. 3: FACS-analysis of transduced murine 1624-5 pre-B cells, CHO-S cells and CHO-S cell transfectants, expressing the recombinant receptor of ecotropic MLV Rec1 (CHO-S Rec1-I-puro). MLV-based vector particles displaying the envelope wtEnv of ecotropic MLV were used. Untransduced cells served as negative controls (NC). The expression of the transduced reporter gene GFP is detected.

FIG. 4: FACS-analysis of the expression of the reporter gene GFP in transduced murine 1624-5 pre-B cells, CHO-S cells and CHO-S cell transfectants, expressing the recombinant receptor of ecotropic MLV Rec1 (CHO-S Rec1-I-puro). MLV-based vector particles displaying either the envelope wtEnv of ecotropic MLV, or the envelope of the molecular clone PVC-211 were used, as indicated. Untransduced cells served as negative controls (NC).

FIG. 5: Comparison of GFP reporter gene expression in transduced CHO-S cells using different MigR1-based retroviral expression vectors. MLV-based vector particles displaying the envelope wtEnv of ecotropic MLV or the envelope of the molecular clone PVC-211 were used. Untransduced cells served as negative controls (NC). The transfer vectors MigR1, MigR1Ppgk and MigR1Pvκ were employed as indicated.

FIG. 6: FACS-analysis of murine preB cell line 1624-5, CHO-S, CHO-S Rec1-I-puro, non-permissive human fibrosarcoma HT1080 and HT1080 Rec1-I-neo cells expressing the recombinant ecotropic receptor of MLV for the expression of the reporter gene GFP. MLV-based vector particles displaying the envelope wtEnv of ecotropic MLV or the envelope of the molecular clone PVC-211 were used as indicated. Untransduced cells served as negative controls (NC).

FIG. 7: FACS-analysis of the expression of the reporter gene GFP in different CHO-derived transduced cell lines, (a) CHO-S, (b) CHO-K1, (c) and CHO T-REx™, in the presence or absence of recombinant expression of the ecotropic receptor Rec1 (Rec1-I-neo). MLV-based vector particles displaying either the envelope wtEnv of ecotropic MLV, or the envelope of the molecular clone PVC-211 were used, as indicated. Untransduced cells served as negative controls (NC).

FIG. 8: Comparison of transduction efficiency with untreated or concentrated retroviral vector particle-containing cell culture supernatants, analysed by FACS for the expression of the transduced reporter gene GFP. Particles were concentrated using ultra-filtration. MLV-based vector particles either displaying the envelope wtEnv of ecotropic MLV, or the envelope of the molecular clone PVC-211 were used, as indicated. Untransduced cells served as negative controls (NC).

FIG. 9: FACS-analysis for the expression of the transduced reporter gene GFP using titrated vector containing supernatants in (a) 1624-5 cells, (b) CHO-S cells and (c) CHO-S Rec1-I-puro. Cells were exposed to vector preparations with similar multiplicity of infection (MOI) using different dilutions (undiluted, 1/10 and 1/100) and different envelopes. MLV-based vector particles displaying the envelope wtEnv of ecotropic MLV or the envelope of the molecular clone PVC-211 were used. Untransduced cells served as negative controls (NC).

FIG. 10: Transduction efficiencies (% GFP positive cells) using serial dilutions of retroviral vector particle containing cell culture supernatant in 1624-5 target cells using different vector component expression constructs for transient HEK-based packaging cell and vector particle generation as indicated. MigR1Ppgk served as a transfer vector in all three cases.

FIG. 11: Transduction efficiencies (% GFP positive cells) using serial dilutions of retroviral vector particle containing cell culture supernatant in 1624-5 target cells using VPack-vector component system (grey) for transient HEK-based packaging cell and vector particle generation or the stable packaging cell lines PVC-VPC 50/30 (black) and PVC-VPC 40/20 (dashed) as indicated. MigR1 served as a transfer vector in all three cases.

FIG. 12: Transduction efficiencies (% GFP positive cells) using different dilutions of retroviral vector particle containing cell culture supernatant in 1624-5 and CHO-S target cells from the stable packaging cell line PVC-VPC 40/20 as indicated. Vector particle-containing supernatants were employed for transduction either undiluted (1/1) or diluted 1/10 as indicated. MigR1Zeo served as a transfer vector.

FIG. 13: Comparison of transduction efficiencies of MLV-based vector particles either displaying the envelope wtEnv of ecotropic MLV or the envelope of the molecular clone PVC-211 on BHK cells and BHK cells expressing the recombinant receptor of ecotropic MLV Rec1 (BHK Rec1-I-puro), as indicated. Transduction efficiencies were analyzed by FACS for the GFP reporter gene. Untransduced cells served as negative controls (NC).

FIG. 14: Utilization of MLV vector particles displaying the PVC-211 envelope for the generation of highly efficient protein producer cell lines. (a) Schematic illustration of the retroviral transfer vector pMigR1Ppgk-VEGF121-6xHis-I-puro. The promoter of the murine Ppgk (dashed arrow, flanked by restriction sites of BglII and XhoI) drives the expression of the human variant of VEGF121, which harbours a His-tag consisting of six histidine residues at the C-terminus (VEGF121-6xHis; dark grey box) and the puromycin-resistance gene (puroR; light grey box). An IRES (white box) located between both genes couples their expression from the same mRNA transcript. This transcript is flanked by LTRs (white arrows) at the 5′- and 3′-ends. The packaging signal (psi/ψ) facilitates the packaging of the mRNA into MLV-based particles. (b) Western Blot-analysis of supernatants of puromycin-resistant VEGF121-6xHis producer cell lines. The apparent molecular weight of 19.4 kD and the signal of detected VEGF121-6xHis proteins (arrow) are indicated.

FIG. 15: Shown in FIG. 15a is the construct pMigR1-EnhP-146B7-Vh-sCg-IRES-GFP containing the murine kappa intron enhancer element (κiE) and the murine Vkappa promoter (Pvκ). This promoter drives the expression of the heavy chain of an anti-IL-15 antibody 146B7 comprising the Vh coding region, flanked by the restriction sites for HindIII and Eco47III, and the IgH constant region (sCg). An IRES located between the 146B7-Vh-sCg and the GFP gene couples their expression from the same mRNA transcript. This transcript is flanked by 5′ and 3′ LTRs.

FIG. 15b shows the construct pMigR1-EnhP-146B7-Vk-Ck-IRES-bcl2 containing the murine kappa intron enhancer element (κiE) and the murine Vkappa promoter (Pvκ). This promoter drives the expression of the light chain of an anti-Il-15 antibody 146B7 comprising the Vk coding region, flanked by the restriction sites for HindIII and EcoRI, and the kappa constant region (Ck). An IRES located between the 146B7-Vk-Ck and the bcl2A gene couples their expression from the same mRNA transcript. This transcript is flanked by 5′ and 3′ LTRs.

FIG. 16: Comparison of transduction efficiencies 72h after transduction of MLV-based vector particles displaying the envelope of the molecular clone PVC-211 on CHO-S cells (negative control) and CHO-S cells expressing the recombinant receptor of ecotropic MLV Rec1 (CHO-S Rec1-neo), as indicated. Transduction efficiencies of retroviral particles coding for recombinant antibody heavy chain were analyzed by FACS for GFP reporter gene expression. 63% of the target cells were transduced.

FIG. 17: This figure shows the construct pMigR1-EnhP-146B7-Vh-sCg-IRES-Vk-Ck, a bicistronic vector containing the murine kappa intron enhancer element (κiE) and the murine Vkappa promoter (Pvκ). This promoter drives the expression of the heavy and light chain of an anti-Il-15 antibody 146B7. An IRES located between the 146B7-Vh-sCg and the 146B7-Vk-Ck couples their expression from the same mRNA transcript. This transcript is flanked by 5′ and 3′ LTRs.

FIG. 18: This figure confirms the expression of anti IL-1β B cell receptor (BCR) on the cell surface of CHO-S Rec1-hygro target cells. After co-transduction with retroviral vectors 14% (Row B, right hand column) of the co-transduced CHO-S Rec1-hygro target cells expressed BCRs on their surface as indicated by GFP and RPE double positive cells. Row A shows the negative control of untransduced CHO-S Rec1-hygro cells. Row B shows CHO-S Rec1-hygro cells co-transduced with the transfer vectors pMigR1-EnhP-SK48E26-Vh-sCg-IRES-GFP and pMigR1-EnhP-SK48E26-Vk-Ck-IRES-bcl2.

TERMINOLOGY

Retroviral vector particle: A retroviral vector particle is a replication deficient retroviral particle that contains two copies of retroviral RNA (the transcript of the transfer vector), usually containing expression cassettes for a gene of interest. A retroviral vector particle is generated upon expression of helper virus constructs such as a packaging construct (providing the structural proteins Gag and Pol) and an envelope construct (providing the structural protein Env), wherein the constructs may or may not include a packaging signal, or a packaging construct providing all three structural proteins combined on one construct without a packaging signal, together with a transfer vector in one cell in a stable or transient fashion. A retroviral vector particle can be used to target delivery of a gene of interest encoded on the vector once only into target cells, a process called transduction.

A replication competent full-length retroviral genome is not used for the generation of retroviral vector particles and therefore the particles do not transfer full-length retroviral genomes and do not establish productive infection resulting in the generation of new infectious retroviral particles upon transduction into permissive or susceptible cells. Retroviral vector particles upon target cell entry deliver only transfer vector mRNA (the vector particle genome) comprising the long terminal repeats (LTRs) and the packaging signal psi (ψ), in addition to other nucleic acid sequences of choice, for example, reporter genes, IRES and/or coding regions of a gene of interest.

Retroviral vector particles can be derived from all members of the retrovirus family including Lentivirus, Spumavirus and Onco-retrovirus.

Retrovirus envelope proteins or Env proteins: the retroviral proteins found on the surface of the virion. The env gene typically encodes the envelope proteins/envelope of retroviruses. The native retroviral env gene product is generally a polyprotein precursor (in MLV it is referred to as gp85, a precursor protein) that is proteolytically cleaved during transport to yield two polypeptides. These two proteolytic cleavage products are (1) the surface protein (also referred to as SU protein and gp70) and (2) the transmembrane protein, TM or pl5E. The SU protein is responsible for recognizing and binding to cellular receptors. The TM protein is involved in mediating the fusion of viral and cellular membranes necessary for virion entry and infection of the target cell.

Pseudotyped retrovirus: a retroviral vector comprising a heterologous envelope protein i.e. an envelope protein derived from a different retrovirus or virus.

Packaging cell/Packaging cell line: an engineered cell/cell line that does not produce a replication-competent retroviral genome but which provides the structural and functional Gag, Pol and Env proteins required for packaging of a replication-defective retroviral vector for the production of retroviral vector particles in the cell culture supernatant of the packaging cell/cell line.

Transfecting/Transfection: In the context of eukaryotic cells this is the process of introducing nucleic acid sequences into eukaryotic cells, usually associated with using chemical and/or physical methods.

Transforming/Transformation: In the context of eukaryotic cells this is the process of immortalizing a cell for the establishment of a continuously proliferating cell line.

Transducing: The process of delivering retroviral genomes into vertebrate host cells via the use of retroviral vector particles. For this, a packaging cell line, expressing structural proteins for viral particles (Gag, Pol and Env) is transfected with a recombinant viral vector construct comprising the regulatory elements for packaging of the viral vector construct into a retroviral vector particle. The produced retroviral vector particles can be used to transduce host cells leading to the stable integration of the retroviral vector encoded genetic information into the host cell genome.

Vector/Construct: A nucleic acid sequence which can be used to clone and to amplify genetic sequences and which allows the shuttling of genetic information between different organisms and species for further amplification and functional analysis.

DETAILED DESCRIPTION

Recombinant proteins can be produced in various expression systems such as prokaryotic (e.g. E. coli), eukaryotic (e.g. yeast, insect, vertebrate, mammalian), and in vitro expression systems.

Most commonly used methods for the large-scale production of protein-based biologics rely on the introduction of genetic material into host cells (production cells) by transfection of DNA vectors. While this leads to a transient expression of recombinant proteins, the transfected DNA vectors are rapidly degraded or get diluted upon culture of the production cells. Therefore, it is necessary to screen or to select for those host cells into which the transfected vector is stably maintained. However, only a small percentage of transfected cells will have integrated the foreign genetic material into their genome and so the process of identifying stable, high expressing cell lines is normally laborious and time consuming.

An alternative method for the insertion of genetic material into cells is the process of transduction, which utilises a viral vector. This process can result in almost 100% cell infectivity without severely affecting cell viability and some viruses can integrate into the host cell genome enabling stable expression of the foreign genetic material. A number of different viruses are commonly used, which include retroviruses, lentiviruses, adenoviruses and adeno-associated viruses. An object of the present invention is to provide a retroviral expression system for efficient and safe gene transfer into host cells for the production of protein-based biologics and an associated increase in yield of expressed protein.

As mentioned above, recombinant proteins can be produced in various expression systems. Recent developments include platforms such as yeast and plants but there are a number of drawbacks associated with these expression systems that need to be overcome before such systems can be approved for the production of recombinant proteins for therapeutic use in humans. Processing of yeast glycoproteins for example is different to that of mammalian glycoproteins, giving high-mannose type N-glycosylation, which results in a short circulatory half live in vivo and the possibility of altered protein activity (Wildt & Gerngross, 2005). For plant expression systems, the shortcomings relate to poor protein yields, poor protein stability and laborious downstream processing of the plant-derived proteins (Fischer et al., 2004).

Traditionally, recombinant proteins applicable for the treatment of human disease, like antibodies, have been expressed in mammalian cells such as rodent or human cells. A number of expression systems from these species have been approved by regulatory authorities for the production of clinical-grade therapeutic protein. However, vertebrate and mammalian cell based expression systems using the above-mentioned stable transfection of DNA vectors require long-time frames to establish stably producing cell lines and clones, and an efficient and controlled genetic modification of such cells is often not trivial. These systems have therefore been the focus of most major developments to improve product yield and developmental time lines. Such developments include novel or modified genetic elements to improve transcription rate, high throughput screening concepts to obtain highly productive clones and host cell lines that grow to densities in serum-free chemically defined media that have achieved specific productivities of values about 50 pg/cell/day (Bergmann et al., 2007). For example, use of the CHO DG-44 high producer cell line (BI HEX® CHO; Boehringer Ingelheim) can result in a constant specific productivity of a monoclonal antibody of 55 pg/cell/day for 120 days in culture. This cell line combines an efficient vector system with novel genetic elements for high-level product expression and the enrichment of high producers (Bergmann et al., ibid).

A further mammalian expression system that is well known in the art utilises a robust viral promoter and selection via glutamine metabolism to provide rapid development of high-yielding and stable cell lines. In the absence of glutamine in the growth medium, the glutamine synthetase (GS) enzyme plays an essential role in the survival of mammalian cells in culture. Some mammalian cell lines, such as mouse myeloma lines, do not express sufficient GS to survive without added glutamine. With these cell lines, a transfected GS gene can function as a selectable marker by permitting growth in a glutamine-free medium (WO 91/006657 A1; WO 89/010404 A1; WO 86/005807 A1). Other cell lines, such as CHO cell lines, express sufficient GS to survive without exogenous glutamine. In these cases, the GS inhibitor, methionine sulphoximine, can be used to inhibit endogenous GS activity such that only transfectants with additional GS activity can survive (WO 87/004462 A1). Maximum expression levels attainable depend on the product but cell lines producing over 5 g/L of recombinant antibody have been created, with specific production rates in the range 15-65 pg/cell/day.

Whilst the above mammalian expression systems have focused on the improvement of recombinant product expression by the use of genetic elements such as strong promoters and selection systems, the present invention describes an approach to increase recombinant protein expression by transferring the gene of interest into a mammalian host cell in a highly efficient manner by utilising retroviral vector particles.

The tropism of a retrovirus or retroviral vector particle is determined by the Env proteins on the surface of the virion. However, in addition to the amino acid sequence of the Env protein, retroviral Env proteins also undergo glycosylation by cellular enzymes in the lumen of the rough endoplasmic reticulum that attach oligosaccharides to N-linked glycosylation sites. Such carbohydrate moieties play a role in glycoprotein biosynthesis, transport and stability, and may, for example, mask susceptible residues from proteolytic enzymes. Glycosylation may even reduce the immunogenicity of the protein by masking immunogenic three dimensional epitope structures (Elder et al., 1986).

Hamster cells, in particular Chinese hamster ovary (CHO) cells, are highly resistant to transduction of a retroviral vector pseudotyped by ecotropic MLV under normal conditions. In fact, the ecotropic glycoprotein-binding site appears to be masked or modified by the presence of an oligosaccharide side chain resulting from N-linked glycosylation-dependent modification of the receptor Rec1. This can be shown by treatment of CHO-K1 or BHK21 cells with the glycosylation inhibitor tunicamycin, which renders the cells sensitive to infection (Wilson & Eiden, 1991; Miller & Miller, 1992).

Masuda and colleagues have characterised a neuropathogenic variant, a molecular clone, of the Fr-MLV, termed PVC-211 (SEQ ID Nos: 1 & 2), which causes rapidly progressive neurodegenerative disease in susceptible rodents. This ecotropic MLV variant has been shown to infect cells (rat brain endothelial cells) that are resistant to infection by Fr-MLV and other ecotropic MLVs (Masuda et al., 1993). The rat brain cell tropism was shown to be attributable to two amino acid changes: Glu to Gly at position 116 and Glu to Lys at position 129 in the putative receptor-binding domain of the envelope SU protein (Masuda et al., 1996a). Further work by Masuda et al (1996b) determined an expanded host range in addition to the expanded cellular tropism of PVC-211 MLV, in which this variant was shown to be highly infectious for CHO-K1 cells and could also efficiently infect other cell lines derived from Chinese and Syrian hamsters.

Whilst the work of Matsuda and colleagues has shown the high infectivity of PVC-211, this virus strain has not been used before to alter the host cell tropism of replication incompetent viral particles. The present invention teaches for the first time the use of ecotropic retroviral particles that utilise the envelope protein of PVC-211 (SEQ ID No: 2). It is also possible that a portion of this protein (SEQ ID No: 2) may be used in the present invention, providing that on expression, a functional envelope protein is produced, which confers infectivity on the viral particles for rodent host cells. In addition, the present invention demonstrates that PVC-211 pseudotyped retroviral vector particles are infective for rodent cells but are not infective for cells of other non-rodent species, such as humans. In a preferred embodiment of the present invention, the rodent host cells are Chinese hamster ovary (CHO) cells, for example but not limited to, CHO-K1, CHO-S, CHO-T-REx™, CHO-GS, A2, A2H, CHO/dhFr-, GRL101, M1WT3, P22, RR-CHOK1, UT-1, XrS6 and other CHO cell lines that can be found in the cell collections of ECACC and/or ATCC.

Retroviral expression vectors are known in the art and have been used as a tool to transfer genes of interest into a wide variety of host cells. Bleck and colleagues have developed a system (GPEx®) that utilises replication-defective retroviral vectors derived from MLV that are pseudotyped with vesicular stomatitis virus G protein (VSV-G) to stably insert single copies of genes into dividing cells (Bleck, 2005). Since the envelope of VSV-G is used, these vectors are therefore pantropic and can infect all known species including humans. Whilst initially this may appear to be an advantageous feature of this system, the use of a pantropic virus also has drawbacks. For example, use of a pantropic virus in the laboratory means that Bio safety level (BSL) 2 conditions apply and work must be performed in laboratories that are of BSL2 standard. In addition, staff require special training to work with BSL2 level organisms.

The present invention, besides providing means for increasing retroviral transduction efficiency and increased protein yield utilises ecotropic retroviral particles, which means that host cell infectivity is restricted to rodent cells and therefore only BSL1 conditions i.e. standard laboratory conditions are required for work with these particles.

The retroviral vector particles and constructs for their manufacture of the present invention can be used to introduce gene sequences of interest into host cells for subsequent expression. The retroviral vector particles are enveloped virion particles that contain an expressible polynucleotide sequence and are capable of binding to and penetrating a target host cell to deliver the expressible sequence into the cell. The enveloped particle may have a wild type (wt) envelope of Moloney MLV (Mo-MLV; often written as just MLV) or may be pseudotyped with a wild type or engineered envelope protein from another viral species. Use of a non-native envelope protein can alter the host range and infectivity of the native retrovirus. The pseudotype envelope may be from a non-retroviral species or from a retroviral species. In a preferred embodiment of the present invention, the envelope protein is from MLV and is a variant of the Friend MLV (F-MLV), termed PVC-211 (Masuda et al., 1996a). Use of this envelope in retroviral vector particles, as described in the Examples has resulted in an increase in transduction efficiency of up to 13 fold when compared to retroviral vector particles utilising a wild type envelope.

The retroviral vector particles of the present invention can be used in a wide range of applications including, for example, protein production. Examples of such proteins include therapeutic proteins (cytokines, hormones, growth factors), vaccines and monoclonal antibodies.

Also encompassed by the present invention are a number of retroviral vector components, which contain the elements useful for producing a functional retroviral vector particle in a compatible host cell and packaging it into an expressible heterologous sequence. These components include an envelope construct, a packaging construct and a transfer vector and are described in more detail below.

The envelope construct may comprise a heterologous promoter operably linked to an envelope coding sequence. By the term ‘operably linked’, it is meant that the promoter is positioned in such a way that it can drive transcription of the recited coding sequences for the viral envelope. The envelope polypeptide is displayed on the viral surface and as discussed earlier is involved in the recognition and infection of host cells by a virus particle. The host range and specificity can be changed by modifying or substituting the envelope polypeptide, for example, with an envelope expressed by a different (heterologous) viral species by the process of pseudotyping (Yee et al., 1994). Common envelope polypeptides include VSV-G, HIV gp20, MLV (including native and modified forms), murine mammary tumour virus, gibbon ape leukaemia virus, Rous sarcoma virus, hepatitis viruses, influenza viruses. In an embodiment of the present invention, the envelope protein is from a Friend murine leukaemia virus (Fr-MLV). Preferably the envelope protein is from a variant strain of Fr-MLV known as PVC-211 (Kai & Furuta, 1984; Hoffman et al., 1992; Remington et al., 1992; Masuda et al., 1992; 1993; 1996;). A viral envelope protein can be modified or engineered to contain polypeptide sequences that allow the vector particle to target and infect host cells outside its normal range or more specifically limit transduction to a cell or tissue type. For example, the envelope protein can be joined in frame with targeting sequences, such as receptor ligands, antibodies (using an antigen-binding portion of an antibody or a recombinant antibody-type molecule, such as a single chain antibody), and polypeptide moieties or modifications thereof (e.g., where a glycosylation site is present in the targeting sequence) that, when displayed on the vector particle coat, facilitate directed delivery of the virion particle to a target cell of interest. Furthermore, envelope proteins can further comprise sequences that modulate cell function and/or mediate additional host-cell protein recognition. Modulating cell function with a transducing vector may increase or decrease transduction efficiency for certain cell types in a mixed population of cells. Examples include e.g. antibodies (e.g. single-chain antibodies that are specific for a cell-type) and essentially any antigen (including receptors) that is specific for such tissues as lung, liver, pancreas, heart, endothelial, smooth, breast, prostate, epithelial, vascular cancer, etc.

A promoter can be utilized to drive expression of the viral envelope coding sequence when operably linked to it. The promoter may be a constitutive promoter such as the promoter present in the 5′LTR or a heterologous promoter such as a promoter derived from human cytomegalovirus (CMV), murine phospho glycerin kinase (Ppgk) promoter, murine V-kappa gene promoter (Pvκ), β-actin promoter, EF-1α promoter, EF-1α-HTLV-1 hybrid promoter, ferritin promoters, inducible promoters, constitutive promoters, and other promoters mentioned herein. Inducible promoters, like the tetracycline-inducible promoter (Gossen & Bujard, 1992), may either upregulate or downregulate expression by addition or removal of tetracycline or other antibiotics and derivatives thereof, like doxycycline. Preferably the promoter used in a construct of the present invention is the CMV promoter.

In addition, the envelope construct can further comprise transcription termination signals, such as a polyA signal that is effective to terminate transcription driven by the promoter sequence. Any suitable polyA sequence can be utilized, e.g., sequences from beta globin (mammalian, human, rabbit, etc), thymidine kinase, bovine growth hormone, SV40, and many others.

The packaging construct may comprise sequences coding for structural proteins (e.g. gag precursor) and/or processing proteins (e.g. pol precursor). The Gag-Pol sequences can be native or modified Gag-Pol sequences. These modifications include chimeric Gag-Pol, where the Gag and Pol sequences are obtained from different viruses (e.g., different species, subspecies, strains) and/or where the sequences have been modified to improve transcription and/or translation and/or reduce recombination. In other embodiments of the present invention, the sequences coding for the gag and pol precursors can be separated and placed on different vector constructs. For these vector constructs, each sequence has its own expression signals, for example, additional promoter and enhancer sequences can be placed upstream of the gag/pol in order to increase, improve or enhance transcription of the gag/pol precursor. Examples of promoters include, mammalian promoters (e.g., constitutive, inducible, tissue-specific), CMV, RSV, LTR from other retroviral species and other promoters as mentioned above and below.

In addition, the packaging construct can further comprise transcription termination signals, such as a polyA signal that is effective to terminate transcription driven by the promoter sequence, as described above.

Although the components described above contain the envelope and gag-pol precursor on different constructs, they can, if desired, be placed on the same construct or utilise a separate construct for each protein.

The transfer vector may comprise the polynucleotide sequences, which are packaged into the transducing retroviral vector particles. The transfer vectors, when comprising 5′ LTR and 3′ LTR, can be used for the production of vector particles that are capable of integrating into the host genome. A suitable vector backbone, which can be used for the preparation of a transfer vector of the present invention, is that of the MigR1 vector (Pear et al., 1998; http://www.lablife.org/p?a=vdb_view&id=g2.531Ogh0E_Yc2k4vlr3OZM.EUaXE-; FIG. 1i; SEQ ID No: 43). The retroviral transfer vector may comprise one or more of the following elements, for example, a retroviral 5′ LTR, a packaging signal (psi/Ψ) distal to the 5′LTR and a retroviral 3′ LTR. At least one expressible heterologous polynucleotide sequence can be inserted into the transfer vector between the packaging sequence and the U5 region of the 3′ LTR.

Any suitable retroviral 5′ LTR can be used in the transfer vector including an LTR obtained from any retrovirus species, sub-species or strain. The retroviral 5′ LTR comprises signals utilized in gene expression, including enhancer, promoter, transcription initiation (capping), transcription terminator and polyadenylation. They are typically described as having U3, R, and U5 regions. The U3 region of the LTR contains enhancer, promoter and transcriptional regulatory signals, including RBEIII, NF-kB, SpI, AP-I and/or GABP motifs. The TATA box is located about 25 base pairs from the beginning of the R sequence, depending on the species and strain from which the 5′ LTR was obtained. A completely intact 5′ LTR can be used or a modified copy.

A packaging sequence (psi/Ψ) distal to the 5′ LTR can also be present in the transfer vector. This sequence, which is recognized by the nucleocapsid (NC) domain of the Gag, is utilized in cis to facilitate encapsulation of the heterologous sequence of interest into the transducing vector (Lever et al., 1989). The psi packaging sequence (Ψ) is relatively autonomous of neighbouring sequences and its position in the transfer vector can be determined routinely (Mann & Baltimore, 1985).

Furthermore, a primer binding site (PBS) can also be located downstream of the 5′ LTR.

The transfer vector can also include a retroviral 3′ LTR comprising U3, R and U5 regions. The 3′ LTR can be intact and native or it can be modified. Modifications can include those to produce an LTR that retains a minimal amount of functional activity e.g. transcriptional (promoter-enhancer) functional activity as seen with self-inactivating (SIN) vectors (Yu et al., 1986).

The transfer vector may also comprise an internal ribosome entry site (IRES) inserted for example between the packaging signal and the 3′LTR. Preferably the IRES is located between an expressible polynucleotide such as a reporter gene and/or a protein of interest. The use of an IRES element allows translation of multiple coding regions from a single promoter (Adam et al., 1991). When located between open reading frames in an RNA, IRES elements allow efficient translation of the downstream open reading frame by promoting entry of the ribosome at the IRES element followed by downstream initiation of translation. IRES elements from but not limited to poliovirus, encephalomyocarditis virus and swine vesicular disease virus can be used in retroviral vectors of the present invention.

An expressible heterologous polynucleotide sequence can be inserted into the transfer vector, for example, between the packaging sequence and the 3′ LTR. The expressible sequence is the sequence which is packaged into the viral transfer vector, and which is expressed by the host cells after transduction with retroviral vector particles. Any heterologous sequence of interest can be inserted into the transfer vector providing the sequence size is less than approximately 8-12 kb. Heterologous sequences that can be inserted include those coding for therapeutic proteins, enzymes, antibodies and fragments thereof, reporter genes, siRNA, anti-sense, microRNAs, aptamers, ribozymes, cell surface receptors, proteins involved in DNA repair, proteins involved in RNA synthesis, any gene inhibitory or silencing sequence and any sequence which is to be delivered to a host cell via a retroviral transducing vector.

The transfer vector may also comprise a selection marker. Selection markers, conferring resistance to antibiotics useful for the selection of mammalian cells, include, but are not limited to, e.g. genes for puromycin, neomycin, hygromcin B, mycophenolic acid, histidinol, bleomycin, zeomycin and phleomycin resistance. For the expression of multimeric proteins, like antibodies, encoded by separate retroviral constructs, it is preferable that expression of different polypeptide chains are linked to different selection markers, thereby allowing separate, sequential or double selection for the stable transduction of corresponding expression constructs.

The 5′ LTR can be operably linked to a polynucleotide sequence coding for a reporter or marker gene. Marker genes, allowing monitoring of retroviral transduction into host cells include, but are not limited to genes, conferring fluorescence to transduced cells, like e.g., but not limited to green fluorescent protein (GFP), enhanced green fluorescent protein (EGFP), yellow fluorescent protein (YFP), blue fluorescent protein (BFP) and red fluorescent protein (RFP). Alternatively, cell surface markers could be used such as CD4, CD7 or truncated variants thereof, CD34 or truncated variants thereof, or low affinity nerve growth factor receptor or truncated variants thereof. In a preferred embodiment the expression of these antibiotic selection markers, fluorescence markers or cell surface markers is coupled to the expression of the recombinant binding protein via an IRES, which in vertebrate cells allows the coupled co-expression of two genes from a single promoter element. However, the expression of a selection and/or marker gene from a separate expression cassette contained in the retroviral construct, driven by an additional promoter element is also encompassed by the present invention. For the expression of multimeric proteins, like immunoglobulins, from separate retroviral vectors, it is preferred that different binding protein chains are linked to different selection and/or screening markers, thereby allowing separate monitoring for the stable transduction of the different expression constructs.

In case the expression of the recombinant binding protein is driven by a separate promoter, as outlined above, any selection or screening marker gene can also be cloned downstream of the 5′LTR and downstream of the 5′LTR and ψ packaging signal, such that its expression is driven by the 5′LTR promoter.

To increase the flexibility of the transfer vector and to create a modular vector system, multiple cloning sites (MCS) can further be incorporated into the vector that facilitate the insertion of a heterologous sequences of interest. This MCS facilitates the introduction of, for example, any promoter, a single gene, two genes etc.

Any of the sequences which are present in the retroviral vector components of the present invention can be modified from their native form, e.g. to improve transcription, to improve translation, to reduce or alter secondary RNA structure, and/or to decrease recombination. Modifications include, e.g., nucleotide addition, deletion, substitution, and replacements. For example, coding sequences for gag and pol can be modified by replacing naturally occurring codons with non-naturally-occurring codons, e.g., to improve translation in a host cell by substituting them with codons that are translated more effectively in the host cell. The host cell can be referred to as a compatible cell, e.g. to indicate the sequence modification has its effect when the sequence is expressed in a particular host cell type. In addition, sequences can be modified to remove regulatory elements such as the packaging sequence. Sequences can also be altered to eliminate recombination sites.

The present invention also provides retroviral packaging systems for producing retroviral vector particles. A packaging system can comprise a plurality of constructs that are useful for manufacturing fully enveloped and functional retroviral vector particles. These include, for example, an envelope construct, a packaging construct and a transfer vector as described in detail above. The envelope construct and the packaging construct may be present as different constructs or together on the same construct such that the envelope protein and the gag-pol proteins are on the same construct. Such a construct is also known in the art as a helper construct.

A further embodiment of the present invention is a retroviral vector particle and a method of producing a retroviral vector particle. The retroviral vector components described above can be used transiently in host cells to produce vector particles. Examples of host cells that can be used to produce vector particles include any mammalian or human cell line or primary cell. Non-limiting examples include HEK 293, HT1080, NIH 3T3, Jurkat, and SupTlcells. Other examples include HeLa, VERO, L929, COS-1, COS-7, BHK, MRC-5, BAE-I, HEP-G2, NS0, U937, Namalwa, HL60, WEHI 231, YAC 1, U 266B1, SH-SY5Y and CHO (e.g. CHO-K1).

The present invention provides a method for producing a retroviral vector particle comprising, for example, transfecting a host cell with retroviral vector components (envelope construct, packaging construct and transfer vector) to produce a packaging cell line and culturing said transformed packaging cell under conditions effective to produce a retroviral vector particle. Any suitable transfection methods can be used in the vector particle manufacturing process including electroporation, calcium phosphate transfection, PEI polymer mediated transfection, fecturin or lipid-based transfection methods. A preferred transfection method uses the lipid transfection reagent FuGENE® 6 from Roche (Jacobsen et al., 2004). Cells can be co-transfected (i.e., using both helper and transfer vectors), or they can be transfected in separate steps, where each step involves the introduction of a different vector component. Alternatively, host cells can be stably transfected and selected for the expression of the helper vectors.

The cell line used to manufacture the retroviral vector particle can be modified to enhance vector particle production. For example sequences that code for cellular or viral enhancers can be engineered into cell lines (e.g. using additional plasmid vectors), to enhance the level of virus product, or sequences for cellular transactivator proteins including e.g. NF-κB, UV light responsive factors and T cell activation factors.

Cells are cultured under conditions effective to produce retroviral vector particles such as appropriate buffers, oxidizing agents, reducing agents, pH, co-factors, temperature, ion concentrations, suitable age and/or stage of cell (such as, in particular part of the cell cycle, or at a particular stage where particular genes are being expressed) where cells are being used, culture conditions (including cell media, substrates, oxygen, carbon dioxide, glucose and other sugar substrates, serum, growth factors, etc.).

The retroviral vector particle is preferably secreted into the cell culture medium where it can be recovered and optionally enriched or purified using centrifugation and/or filtration methods such as flow-through ultracentrifugation, high-speed centrifugation or tangential flow filtration.

The present invention also provides method of manufacturing polypeptides using retroviral vector particles such as those described herein. Generally the method comprises the steps of transducing a host target cell with a retroviral vector particle to form a transduced host cell, wherein the vector particle comprises an expressible heterologous polynucleotide coding for a heterologous polypeptide of interest, culturing the transduced host cell under conditions effective to produce the polypeptide of interest; isolating the polypeptide from the host cell e.g. from the culture medium when a polypeptide is secreted into the culture medium. The heterologous polynucleotide sequence coding for the polypeptide can comprise any further sequences necessary for transcription, translation and/or secretion into the medium (e.g. secretory sequences). Any host cell can be transduced in accordance with the present invention. In general, these host cells are capable of growth and survival when placed in either monolayer culture or in suspension culture in a medium containing the appropriate nutrient and growth factors, as described in more detail below. Typically, the cells are capable of expressing and secreting large quantities of a particular protein of interest into the culture medium. Examples of suitable mammalian host cells include, but are not limited to: CHO, bovine mammary epithelial cells, monkey kidney CV1 line transformed by SV40 (COS-7, ATCC CRL 1651), HEK 293 (Graham et al., 1977), baby hamster kidney cells (BHK, ATCC CCL 10), mouse sertoli cells (TM4; Mather et al., 1980), monkey kidney cells (CV1, ATCC CCL 70), African green monkey kidney cells (VERO-76, ATCC CRL-1587), human cervical carcinoma cells (HELA, ATCC CCL 2), canine kidney cells (MDCK, ATCC CCL 34), buffalo rat liver cells (BRL 3A, ATCC CRL 1442), human lung cells (W138, ATCC CCL 75), human liver cells (Hep G2, HB 8065), mouse mammary tumour (MMT 060562, ATCC CCL 51), TRI cells (Mather et al., 1982), MRC 5 cells, FS4 cells, rat fibroblasts (208F cells), a human hepatoma line (Hep G2) and MDBK cells, providing that these host cells express the Rec1 receptor either ectopically or recombinantly. In a preferred embodiment of the present invention, the host cell line is a rodent cell line, preferably CHO (including CHO-S, CHO-K1, CHO-GS, CHO DG44, CHO T-REx™, CHO/-DHFR etc) or the cell line BHK.

In a further embodiment of the present invention, the host cell is engineered to over express the ecotropic MLV receptor Rec1. This can be achieved by transfecting the host cell of choice with a vector particle comprising the gene coding for the Rec1 receptor (GenBank: M26687.1) or a portion of this coding sequence that results in the generation of a functional Rec1 receptor. The nucleic acid and amino acid sequences for Rec1 receptor are shown in the attached sequence listing and have SEQ ID Nos: 31 and 32, respectively. As a result, host cells that are resistant to infection by ecotropic MLV will become permissive to infection by this virus on expression of the Rec1 receptor.

Siess et al (1996) reported that over expression of Rec1 (mCAT-1) in CHO cells and exposure to non-infectious ecotropic MLV particles produced by a packaging cell line, resulted in cell syncytia formation and subsequent cell death. However, this has not been observed for CHO cells recombinantly expressing Rec1 when exposed to retroviral vector particles of the present invention.

In a preferred embodiment of the present invention, the host cells are transfected with a Rec1 receptor expression construct, so that the Rec1 receptor is recombinantly expressed.

Retroviral vector particles according to the present invention can be prepared routinely and as described above. In one embodiment, the envelope protein of the vector particle is selected for its ability to recognise a target host cell expressing the Rec1 receptor. In a preferred embodiment, the envelope protein is from PVC-211 MLV.

As shown in the Examples, an increase in transduction efficiency of over 100 fold can be achieved when transducing a host cell line expressing the Rec1 receptor with a retroviral vector comprising the PVC-211 MLV envelope. The Rec1 receptor may already be expressed by the host cells and/or the cell line can be engineered to express the Rec1 receptor. A method of the present invention utilises a host cell expressing the Rec1 receptor. A host cell engineered to over express the Rec1 receptor i.e. recombinant expression, is also encompassed within the present invention, for use in methods of the invention.

Any suitable or desired heterologous sequence can be expressed using a method of the present invention, including, e.g. but not limited to, vaccines, interferons, erythropoietin, Factor VIII, clotting factors, antibodies and fragments thereof (e.g., including single chain, Fab and humanized), insulin, chemokines, cytokines, growth factors, angiogenesis modulatory factors, apoptosis modulatory factors.

A preferred embodiment of the present application provides methods of producing antibodies. For example, methods are provided to produce monoclonal antibodies (e.g., human, mouse, and other mammalian types) without the need for hybridomas or animal models. In a non-limiting example (e.g. Example 16), two retroviral vector particles are engineered, one expressing the heavy antibody chain and the second expressing the light antibody chain. The constant areas of the genes are derived from the human (or other species if desired) immunoglobulin gene (e.g. IgG, IgH, IgM or other type of Ig), either allowing secreted (e.g. sIgH) or allowing membrane bound antibody expression. The variable areas of the genes can be modified or degenerated to create diversity. The degenerate sequence can be obtained by any suitable techniques that is known in the art and cloned into the retroviral transfer vector particle to create a library of vector particles that express either the heavy or light immunoglobulin molecules. The antibodies can be produced by transducing host cells with both vector particles to produce functional antibodies that contain both heavy and light chains, either simultaneously or sequentially, in any order. Alternatively, the heavy and light chains of an antibody can be cloned into the same retroviral vector particle by utilising a bicistronic vector (see Example 17).

To increase yield or expression levels of the protein of interest in host cells, the retroviral vector particles of the present invention can be used to transduce host cells multiple times. It is demonstrated in Examples 15 and 17 using host cells recombinantly expressing the Rec1 receptor, that transduction of host cells three times can result in a significant increase in protein yield compared to target cells transduced only once. Protein yields of up to 11.8 mg/L have been demonstrated (see Example 17) following three rounds of transduction. Also transduction of host cells either once or three times with retroviral vector particles of the invention results in increased protein yields compared to transfected host cells.

In addition to expressing the protein of interest, the retroviral vector particle can be engineered to facilitate production of the protein of interest, or to increase its yield. Such genes can code for other promoters, enhancers, locus control regions (LCRs), matrix attached region sequences (MARs), the woodchuck hepatitis virus posttranscriptional regulatory element (WRPE; Zufferey et al., 1999), insulators, oncogenes such as ras and myc, anti-apoptotic genes such as Bcl-2 and bcl-x (L), other cytostatic genes such as p21, p27, p53175P and p53 and differentiation factors such as CCAAT/enhancer-binding protein alpha.

Host cell lines can be cultured in a suitable culture media that provides a balance of buffering and osmoregulating substances, trace elements, amino acids, vitamins, lipids and nutrients required for long-term cultivation of mammalian cells in vitro. Traditionally cell culture medium was supplemented with calf or cattle serum; however many culture media are now available that are free of bovine components.

In the cell culture process, the host cells may be grown as either anchorage dependent or in suspension. In vitro systems for anchorage-dependent cells range from T-flasks and roller bottles through to fluidised or fixed bed bioreactors. Culture medium and aeration is provided continuously or at intervals by exchange of medium and gas or perfusion of the bioreactors. Alternatively, a suspension culture can be used which is often the culture process of choice for the production of therapeutic antibodies in large quantities. For low litre quantities, shake flasks or spinner vessel systems can be used and for larger quantities of up to 20,000 L, continuous stirred tank reactors are commonly used.

Standard cell cultivation can be by a batch process where a seed cell suspension and medium are added to the bioreactor at the start of the process and the cells are cultivated for a set period of time under suitable conditions without any further manipulations.

Alternatively, a fed-batch process or continuous perfusion fermentation can be used where specific cell culture additives are added during the cultivation period generally leading to enhanced cell growth, higher cell densities, less nutrient limitations and overall higher product yields. This process is commonly used for the manufacture of therapeutic antibodies.

Use of retroviral vector particles of the present invention can result in high levels of heterologous protein expression, e.g., from about 0.01 to 0.1 to 0.3 mg/ml to about 5-10 mg/ml, or more, of recombinant heterologous protein per ml of unprocessed culture media, when such proteins are secreted into the culture media.

To harvest products from mammalian cell cultures, methods such as filtration, centrifugation and adsorption can be used. Filtration separates the products from the host cells, cell debris and large particles and can be either a static or dynamic process. Tangential flow filtration (TFF) can be used to enhance the separation of cells and large particles. Centrifugation and adsorption (e.g. expanded bed adsorption) can be used as an alternative to membrane filtration or filter-based separation, respectively. Further downstream processing steps are required for the purification of the final product and these may include: ultra/diafiltration, affinity chromatography, hydroxyapatite chromatography, gel electrophoreisis, dialysis, virus clearance, hydrophobic interaction chromatography (HIC), ion exchange chromatography (IEC), cation exchange chromatography and/or anion exchange chromatography, depending on the polypeptide or antibody to be recovered.

In the following non-limiting examples, the present invention is explained in more detail.

EXAMPLES

Example 1

Cloning of Expression Vectors

The detailed cloning strategy of expression vectors for viral structural proteins and viral receptors of different designs that can be used in the present invention is described below. Also described are methods for the stable maintenance of these vectors in target cells and producer cells, using antibiotic resistance markers.

1.1 Construction of Parental Expression Vectors

As a starting point for the construction of expression vectors the commercially available vectors pIRESneo and pIRESbleo were used (BD-Clontech, Mountain View, Calif.). These parental vectors contain a neomycin and bleomycin resistance marker gene respectively, flanked by unique restriction sites for XbaI and XmaI. In addition, these vectors contain the CMV IE promoter driving expression of the gene of interest and the resistance gene. 3′ of the promoter a simple multiple cloning site (MCS) for insertion of genes of interest to be expressed is followed by a synthetic intron and an internal ribosome entry signal (IRES) located just 5′ of the respective resistance gene. The derivates of these vectors described below enable the selection of cells in culture expressing a gene of interest in the presence of respective antibiotics, since the coding regions for the gene of interest and the antibiotic resistance marker are located on one mRNA linked by an IRES. This mechanism is referred to as ‘geno-/phenotype-coupling’. The non-limiting example of the construction of the expression vector pIRESpuro is described below.

pIRESneo was digested using the restriction enzymes XbaI and XmaI. After electrophoresis of the plasmid DNA, the resultant XbaI-XmaI-DNA fragment of the vector backbone (pIRES) depleted of the resistance gene was extracted using NucleoSpin Extract II (Macherey-Nagel).

PCR for the puromycin resistance gene (puroR; SEQ ID Nos: 7 & 8) was performed under the following conditions. The reaction mixture consisted of 100 ng template (pMSCVpuro, Clontech), 5 μl Pfx buffer (10-fold), 1 μl Mg2SO4 (30 mM), 7 μl dNTP (2 mM), 0.7 μl Pfx (Invitrogen) and 1 μl of each primer (10 μM, nucleotide sequences are given below). Water was added to the reaction mixture to result in a total volume of 50 μl. Primers used for amplification of the puromycin resistance gene (puroR; SEQ ID Nos: 7 & 8) were:

5′-ATAACCCGGGATGACCGAGTACAAGCCCACGGTGC-3′
(Puro XmaI forward; SEQ ID No: 5)
and
5′-ATTATCTAGATCAGGCACCGGGCTTGCGGGTC-3′
(Puro XbaI reverse; SEQ ID No: 6).

The temperature conditions for puroR amplification were 95° C. for 3 minutes, followed by 25 cycles of 95° C. for 30 seconds, 58° C. for 30 seconds, 68° C. for 1 minute. The amplification was terminated after an additional 7 minutes at 68° C. After electrophoresis of the PCR products the amplicon was extracted as described and digested with XbaI and XmaI. Finally, the resulting XbaI-XmaI-digested puromycin resistance gene fragment was ligated into the above-mentioned pIRES fragment digested accordingly. The resultant vector pIRESpuro is shown in FIG. 1a, with the sequence depicted in FIG. 1h and SEQ ID No: 42. Further derivates of this vector were generated accordingly, only differing in the reporter gene. Primers used for the amplification of the other reporter genes were as follows: For the hygromycin resistance gene (hygro; SEQ ID Nos: 11 & 12)

5′-AATTAATCATGACCCGGGACCATGAAAAAGCCTGAACTCACCGCGA
C-3′
(BSPHI/XMAI HYGRO+; SEQ ID No: 9)
and
5′-AATTAAGTCGACGCGGCCGCTCTAGACTATTCCTTTGCCCTCGGAC
GAGTG-3′
(XBAI/SALI/NOTI HYGRO−; SEQ ID No: 10).

For the blasticidin resistance gene (bsr; SEQ ID Nos: 15 & 16):

5′-AATTAACCCGGGACCATGAAAACATTTAACATTTCTCAACAAGATC
TAG-3′
(BSR XMAI +; SEQ ID No: 13)
and
5′-AATTAAACTAGTTTAATTTCGGGTATATTTGAGTGGAATGAG-3′
(BSR SPEI −; SEQ ID No: 14).

Upon restriction and purification the resultant amplicons were inserted into the backbone as described above to give the constructs pIREShygro and pIRESbsr, respectively.

As will be appreciated by a person skilled in the art, the present invention can be performed using different expression vector designs containing other antibiotic resistance genes (e.g. hygromycin (SEQ ID Nos: 11 & 12), blasticidin (SEQ ID Nos: 15 & 16), bleomycin (SEQ ID Nos: 17 & 18), neomycin (SEQ ID Nos: 19 & 20), etc), other reporter genes such as fluorescence proteins (e.g. GFP (SEQ ID Nos: 21 & 22), YFP (SEQ ID Nos: 23 & 24), etc) and/or cell surface markers (e.g. truncated NGFR (SEQ ID Nos: 25 & 26), truncated CD7 (SEQ ID Nos: 27 & 28), etc).

1.2 Construction of Vectors for the Expression of the Ecotropic Murine Leukaemia Virus Receptor (Rec1).

Total RNA was isolated from murine 3T3 cells using TRICOL (Sigma) according to the manufacturers' instructions. 0.5 μg of RNA served as a template for RT-PCR using the OneStep RT-PCR kit (Qiagen) and 10 pmol each of the primers

5′-TTTAAGCGGCCGCATGGGCTGCAAAAACCTGCTCGGTC-3′
(eMLV-R NotI forward; SEQ ID No: 29)
and
5′-TTTAAGGATCCTCATTTGCACTGGTCCAAGTTGCTGTC-5′
(eMLV-R BamHI reverse; SEQ ID No: 30).

The temperature conditions were 50° C. for 30 minutes, 25 cycles of 95° C. for 1 minute, 60° C. for 15 seconds and 72° C. for 2 minutes. Final extension was performed at 72° C. for 5 minutes.

The resulting amplicon and the vectors pIRESbleo and pIRESneo were digested with NotI and BamHI. Ligation of the amplicon into both vectors resulted in the Rec1-expression vectors Rec1-I-neo and pRec1-I-bleo, respectively. Further Rec1-expression vectors containing different reporter genes were constructed by digestion of pRec1-I-neo and -bleo with NotI and BamHI and insertion of the Rec1 cDNA into respective recipient vectors digested accordingly. The genetic organization of pRec1-I-puro is shown in FIG. 1b. The nucleic acid and amino acid sequences for the Rec1 receptor have SEQ ID Nos: 31 & 32 respectively, as shown in the accompanying sequence listing.

1.3 Construction of Vectors Containing the Envelope Coding Region of Ecotropic Murine Leukaemia Virus Molecular Clone PVC-211.

The envelope coding region of PVC-211 (SEQ ID No: 1; GenBank: M93134.1 “env” gene; Masuda et al., 1992) was synthesised to include a stuffer sequence (5-TTAATTAATT-3′; SEQ ID No: 33), a NotI-restriction motif and a Kozak-sequence 5′ of the ATG-initiation codon and a EcoRI-restriction motif and a stuffer sequence (5′-TTAATT-3′), 3′ of the TAA-stop codon. Upon digestion with NotI and EcoRI the env gene was inserted into pIRESpuro and digested accordingly.

1.4 Construction of Vectors Containing the gag/pol Coding Region of Ecotropic Murine Leukaemia Virus (MLV)

The gag/pol coding region of ecotropic MLV (Mo-MLV; Shinnick et al., 1981; SEQ ID No: 36) was amplified by PCR using the primers:

5′-AATAAGCGGCCGCGCCGCCACCATGGGCCAGACTGTTACCACTCCC
TTAAG-3′
(Kozak Gag/Pol, SEQ ID No: 34)
and
5′-ATGAATTCTTAGGGGGCCTCGCGGGTTAACC-3′
(MLVgp RI rev, SEQ ID No: 35).

The reaction mix consisted of 50 ng template (Shinnick et al., 1981), 3 μl Pfx buffer (10-fold), 0.6 μl Mg2SO4 (30 mM), 4.5 μl dNTP (2 mM), 0.4 μl Pfx (Invitrogen), and 0.5 μl of each primer (10 μM). Water was added to the reaction mixture to result in a total volume of 30 μl. Temperature conditions were 94° C. for 3 minutes, 25 cycles of 94° C. for 30 seconds, 66° C. for 30 seconds, 68° C. for 6 minutes followed by a final extension at 68° C. for 10 minutes. After electrophoresis and extraction of the PCR products the DNA fragment was inserted into pSC-B (Stratagene). The resultant plasmid SC-Kozakgp was digested with NotI and EcoRI and upon electrophoresis and extraction inserted into pIRESbleo, previously digested according to Example 1.1. A schematic illustration of the genetic structure of this plasmid is shown in FIG. 1e.

1.5 Further Variants of Expression Vectors Utilizing the Murine Promoter of the Housekeeper Gene Phospho Glycerol Kinase (Ppgk)

As shown in FIG. 1a, the pIRES expression vectors harbour the human CMV IE promoter to facilitate gene of interest and reporter gene expression. Alternatively, derivatives were constructed, which utilize the murine promoter of the housekeeper gene phospho glycerol kinase (Ppgk; SEQ ID NO: 40). Murine Ppgk was amplified by PCR using the primers:

5′-AATTAAACGCGTTCGCGACAATTCTACCGGGTAGGGGAGGCGC-3′
(PGK MluI/NruI+; SEQ ID No: 38)
and
5′-AATTAAATCGATGGTGGCGGGATGCAGGTCGAAAG-3′
(PGK Cla−; SEQ ID No: 39).

The reaction mix contained 1 μl of both primers (10 pM), 4 μl HF-Buffer (5×), 2 μl dNTPs (2 mM), 0.2 μl of PHUSION polymerase (Finnzym) and 100 ng template of a plasmid encompassing the murine Ppgk (MigR1-Ppgk, described below) in a total volume of 20 μl. The PCR product was subjected to electrophoresis and extraction as described above and inserted into pSC-B (Stratagene) giving rise to the construct pSC-MluI/NruI-Ppgk-ClaI. This vector was digested with MluI and ClaI. The MluI-ClaI-DNA fragment was inserted into pIRESpuro containing the reporter puromycin resistance gene (puroR; SEQ ID Nos: 7 & 8). The resultant vector pPpgk-I-puro is shown in FIG. 1f. The nucleic acid sequence of murine Ppgk has SEQ ID No: 40.

1.6 Construction of MLV-Based Transfer Vectors Containing the Promoters of the Murine Phospho Glycerin Kinase (Ppgk) and Murine V-Kappa Gene Promoter (Pvκ)

All MLV-based transfer vectors described in the Examples of the present invention were either MigR1 (Pear et al., 1998; http://www.lablife.org/p?a=vdb_view&id=g2.531Ogh0E_Yc2k4vlr3OZM.EUaXE-; FIG. 1i; SEQ ID NO: 43), which drives expression exclusively using the MLV-promoter encompassed in the 5′LTR or were derivates thereof additionally containing the promoters of the murine phospho glycerol kinase (Ppgk) and/or murine V-kappa gene (Pvκ; SEQ ID No: 41) optionally with or without the murine kappa intron enhancer element (κiE; SEQ ID No: 48). As illustrated in FIG. 1g, the BglII-XhoI-fragments encompassing these murine promoters were inserted between the unique restriction motifs of XhoI and BglII, located 5′ of the internal ribosome entry site (IRES) and therefore driving the expression of the reporter gene GFP.

1.7 Construction of MLV-Based Transfer Vectors Containing the Promoters of the Murine Ppgk, a his-Tagged VEGF121 and a Puromycin Resistance Gene.

cDNA from human peripheral blood lymphocytes was generated using standard RT-PCR techniques (Sambrook et al, 2001). The cDNA served as a template for the amplification of the coding region of human vesicular endothelial growth factor variant 121 (VEGF121; SEQ ID No: 46) using PCR employing the proof-reader polymerase Pfx and the oligonucleotides VEGF121 Not Koz (SEQ ID No: 44):

5′-aataagcggccgcgccaccatgaactttctgctgtcttgggtgcat
tgg-3′
and
VEGF121 6xHis R1 rev (SEQ ID No: 45):
5′ataattgaattctcaatgatgatgatgatgatgatctccccgcctcg
gcttgtcacatttttcttgtc-3′.

The resultant amplicon harbouring recombinant restriction sites for NotI and EcoRI, a Kozak-sequence, and a His-tag was inserted first into the cloning vector pSC-B (Sratagene). The resultant vector was termed pSC-VEGF121-6xHis. Using DNA sequencing, accuracy of the inserted DNA fragment was shown. Subsequently, pSC-VEGF121-6xHis was digested using the restriction enzymes NotI and EcoRI and the VEGF variant coding region was inserted into the recipient vector pIRESgfp, previously digested accordingly, resulting in the vector pVEGF-huVEGF121-6xHis. From this vector, the region encoding the His-tagged VEGF121 variant was obtained by restriction digest employing the enzymes NotI and EcoRI. The plasmid pMigR1Ppgk-VEGF121-6xHis-I-puro depicted in FIG. 1j and FIG. 14a, was generated upon insertion of the coding region into the retroviral transfer vector pMigR1-Ppgk-I-puro, digested accordingly.

1.8 Construction of MLV-Based Transfer Vectors Containing an Anti IL-15 Antibody Heavy or Light Chain or Both

For the generation of the transfer vector pMigR1-EnhP-146B7-Vh-sCg-IRES-GFP (FIG. 15a), the coding sequence for the heavy chain of the anti-IL-15 antibody 146B7 (146B7 Vh, SEQ ID No: 49 and secretable IgH constant region (sCg), SEQ ID No: 51 (derived from joining by 210-503, 892-936, 1055-1384 and 1481-1803 of the human IGHG1 gene, Accession No: J00228)) was cloned into the HindIII and EcoRI sites of the MigR1 vector described in Example 1.6 above, containing the enhancer element xiE (SEQ ID No: 48) and the promoter Pvκ (SEQ ID No: 41).

The light chain transfer vector pMigR1-EnhP-146B7-Vk-Ck-IRES-bcl2 (FIG. 15b) was generated by cloning the coding sequence for the light chain (Vk-Ck) of anti-IL-15 antibody 146B7 (146B7 Vk, SEQ ID No: 53 and kappa constant region (Ck), SEQ ID No: 55 (bp 336-656 of the human IGKC gene, Accession No: J00241)) into the HindIII and EcoRI sites of the MigR1 vector, which is described in Example 1.6 above. The vector also contained the enhancer element κiE (SEQ ID No: 48) and the promoter Pvκ (SEQ ID No: 41). The murine bcl2A gene replaced the EGFP ORF in the MigR1 vector. The ORF of murine bcl2A (SEQ ID No: 63) was isolated and amplified from mouse spleen mRNA by RT-PCT using the following primers, designed and based on the published NCBI-Genbank sequences M16506 and L31532 and containing restriction enzyme recognition sites (in uppercase letters) for NheI and MluI:

5′-attGCTAGCatggcgcaagccgggagaacagggtatgataac-3′
(SEQ ID No: 61; binds to position 1821-53 of
M16506)
and
5′-cgcACGCGTcacttgtggcccaggtatgcacccagagtg-3′
(SEQ ID No: 62; binds to position 506-535 of
L31532).

For the construction of a bicistronic transfer vector containing an anti IL-15 antibody heavy and light chain, the EGFP ORF of the heavy chain transfer vector pMigR1-EnhP-146B7-Vh-sCg-IRES-GFP was replaced by the coding region for the light chain of 146B7 (Vk-Ck; described above) resulting in vector pMigR1-EnhP-146B7-Vh-sCg-IRES-Vk-Ck as is shown in FIG. 17.

1.9 Construction of MLV-Based Transfer Vectors Containing Heavy or Light Chains of Recombinant Human Anti-IL-1β B Cell Receptors

To construct the transfer vector pMigR1-EnhP-SK48E26-Vh-sCg-IRES-GFP, the Vh coding region of the Il-1β antibody SK48E26 (WO 95/01997; Young et al.; SEQ ID No: 57) was cloned into the HindIII and EcoRI site of vector pMigR1-EnhP-146B7-Vh-sCg-IRES-GFP, described in Example 1.8 above, replacing the 146B7-Vh coding region.

Similarly, to construct the transfer vector pMigR1-EnhP-SK48E26-Vk-Ck-IRES-bcl2, the Vk coding region of the IL-1β antibody SK48E26 (WO 95/01997; Young et al.; SEQ ID No: 59) was cloned into the HindIII and EcoRI site of vector pMigR1-EnhP-146B7-Vk-Ck-IRES-bcl2, described in Example 1.8 above, replacing the 146B7-Vk coding region.

1.10 Construction of MLV-Based Transfer Vectors Containing the Coding Regions for the Cytokines IL-6 and TNFα and the Chemokine CCL5

For the generation of the transfer vector pMigR1-EnhP-IL-6-IRES-GFP, the coding sequence for the cytokine IL-6 (SEQ ID No: 64; by 117-755 of human Il-6 Accession No: NM000600) could be cloned into the HindIII and EcoRI sites of the MigR1 vector, described in Example 1.6 above, which contains the enhancer element κiE (SEQ ID No: 48) and the promoter Pvκ (SEQ ID No: 41).

For the generation of the transfer vector pMigR1-EnhP-TNFα-IRES-GFP, the coding sequence for the pro-inflammatory cytokine TNFα (SEQ ID No: 65; by 170-871 of human TNFα Accession No: NM000594) could be cloned into the HindIII and EcoRI sites of the MigR1 vector, described in Example 1.6 above.

For the generation of the transfer vector pMigR1-EnhP-CCL5-IRES-GFP, the coding sequence for the chemokine (C-C motif) ligand 5 (CCL5) (SEQ ID No: 66; by 68-344 of human CCL5 Accession No: NM002985) could be cloned into the HindIII and EcoRI sites of the MigR1 vector, described in Example 1.6 above.

Example 2

Cultivation and Establishment of Cell Lines Stably Expressing the Receptor of Ecotropic MLV (Rec1)

All CHO cells (CHO-S (Invitrogen), CHO T-REx™ (Invitrogen), CHO-K1 (DSMZ)) and murine pre-B 1624-5 cells were expanded in IMDM supplemented with 10% FCS and 50 μM beta-mercapthoethanol. Human fibrosarcoma HT1080, HEK and BHK cells were cultured in DMEM supplemented with 10% FCS and L-Glutamine (2 mM). To establish cell lines stably expressing the ecotropic receptor Rec-1, CHO, BHK and HT1080 cells were seeded at a density of 1×105 cells in 2 ml of respective media in six-well tissue culture dishes (Nunc), 5 to 24 hours prior to transfection. 1 μg to 3 μg of the respective Rec1-encoding pIRES-variants were transfected (see FIG. 1b) using FuGENE®6 (Roche) following the manufacturers' instructions. Two days post transfection, transfected adherent cells were detached using 1 mM EDTA/PBS, suspended and seeded in 15 cm dishes. The following day antibiotic-containing media were applied to the cells. The concentrations of antibiotics used for the constructs is as indicated in the following cell line designations. For the generation of cell lines using pRec1-I-neo 400 μg/ml of G418 (neomycin; Invitrogen) was used for HT1080 cells, 750 μg/ml for CHO T-REx™ cells and 1 mg/ml for CHO-S and CHO-K1 cells. For the generation of cell lines using pRec1-I-puro, puromycin was used at 1 μg/ml for CHO T-REx™ cells, 5 μg/ml for CHO-K1 cells and 10 μg/ml for CHO-S cells and 1 μg/ml for BHK cells. After five to seven days resistant bulk populations were obtained.

Example 3

Generation of Ecotropic MLV Vector Particles and Transduction of Target Cells

For the generation of ecotropic MLV-based vector particles a triple co-transfection approach employing human embryonic kidney (HEK) cells was used. HEK cells were seeded at a density of 3×106 cells in 30 ml DMEM supplemented with 10% FCS and L-Glutamine (2 mM), in a 15 cm plastic tissue culture dish. Upon re-attachment of the cells to the bottom of the dish, 5 μg each of the transfer vector MigR1, the packaging construct VPack-GP (Stratagene) and the envelope construct wtEnv-I-puro were transfected using 1.5 ml unsupplemented DMEM and 45 μl FuGENE®6 (Roche) according the manufacturers' instructions. Two days post transfection, viral vector particle containing supernatants were harvested into a 50 ml-Falcon tube and subjected to a centrifugation step to obtain cell-free vector particle preparations. Using an Eppendorf centrifuge (model 5810 R), contaminating packaging cells were pelleted at 4° C. and 1,200 rpm for 3 minutes. Cell-free supernatants were used to directly transduce target cells or alternatively, stored at −80° C. for up to two weeks until required.

Transduction of target cells was performed as follows. Using 2 ml or 1.5 ml cups (Eppendorf), 2.5×105 target cells were added to each cup in a total volume of 1 ml medium containing the diluted or undiluted vector particles. These samples were centrifuged (Eppendorf, model 5417 R) at 30° C. and 3,300 rpm for 3 hours. Supernatants were discarded and the cell pellets re-suspended in their cultivation media. Two to five days post transduction, target cells were analysed for the expression of the reporter gene GFP using fluorescent activated cell sorting (FACSAria™, BD Biosciences). The generation of retroviral vector particles, transduction and FACS-analysis of gene transfer efficiency is schematically illustrated in FIG. 2a.

An example of such a transduction experiment is shown in FIG. 2b. Here frozen vector particle preparations harvested from transfected HEK cells, as described above (MigR1, VPack-GP, wtEnv-I-puro), were thawed after storage at −80° C. and while still undiluted, were used to transduce 1624-5 and CHO-S cells as described above. Two days post transduction, FACS-analysis of target cells was performed. Un-transduced target cells served as negative controls. While more than 22% of transduced murine 1624-5 pre B cells revealed expression of the reporter gene GFP, gene transfer efficiency into hamster CHO-S cells was almost undetectable (0.38%). These results show the low susceptibility of CHO cells towards transduction using conventional MLV-based vector particles using the wild type envelope (wtEnv) of ecotropic MLV.

Example 4

Transduction of Recombinant CHO-S Cells Expressing Rec1 Using wtEnv of Ecotropic MLV

To study whether the gene transfer efficiency into CHO-S cells using wild type ecotropic vector particles could be enhanced by recombinant expression of the ecotropic receptor Rec1, the above experiment (Example 3) was repeated but using CHO-S Rec1-I-puro cells in addition to parental CHO-S and 1624-5 cells. As shown in FIG. 3, 1624-5 cells were again transduced with high efficiency (23% GFP positive cells) in contrast to CHO-S cells (0.39% GFP positive cells). Notably, CHO-S Rec1-I-puro cells revealed a 3-fold elevated gene transfer efficiency (1.14% GFP positive cells) when compared to parental CHO-S cells, which demonstrates the conductive effect of Rec1-overexpression on gene transfer efficiency using wtEnv-enveloped MLV-based retroviral vector particles.

Example 5

Transduction of Recombinant CHO-S Cells Expressing Rec1 Using wtEnv of Ecotropic MLV and the Envelope of Molecular Clone PVC-211Mc (PVC-211 Env)

The gene transfer efficiency into CHO-S cells and CHO-S cells recombinantly expressing the receptor Rec1 was compared using wtEnv-enveloped MLV-based retroviral vector particles or retroviral vector particles displaying the envelope of molecular clone PVC-211 of MLV. Vector particles were generated as described in Example 3 with the exception that the transfer vector MigR1 was used and either the envelope construct pwtEnv-I-puro or pPVC-211 Env-I-puro. Cell-free vector particle-containing supernatants were harvested and stored at −80° C. as described above. Thawed, undiluted supernatants were used to transduce 1624-5, CHO-S and CHO-S Rec1-I-puro cells as outlined in Example 3.

Three days post transduction FACS-analysis revealed highly efficient transfer of the GFP reporter genes into the murine 1624-5 pre-B cells (as shown in FIG. 4). However, the use of PVC-211 Env-pseudotyped particles resulted in an approximately 3-fold higher gene transfer efficiency (60.5%) when compared to the use of wtEnv-displaying vector particles (23.2%), demonstrating that higher vector titers could be obtained with the use of MLV (PVC-211 Env) vector particles. Enhanced transduction efficiency using PVC-211 Env was also observed when CHO-S cells were used as target cells (1.45%), which exceeded the efficiency of transduction seen with MLV (wtEnv) vector particles (0.15%) by a factor of more than 9-fold.

Even greater transduction efficiency was observed when the target cells CHO-S Rec1-I-puro were transduced. Using MLV (wtEnv) vector particles, gene transfer was improved compared to that observed for CHO-S cells by a factor of 3.7 (0.56%) but was still considerably low. When MLV (PVC-211 Env) vector particles were used for transduction, 19.0% of CHO Rec1-I-puro cells were detected to express GFP. This is a 13-fold improvement compared to the gene transfer efficiency observed for CHO-S target cells and more than a 33-fold increase in transduction efficiency compared to that observed for the transduction of CHO-S Rec1-I-puro cells using MLV (wtEnv) vector particles. The results are summarised in the table below in which transduction efficiency, measured as the percentage of GFP positive cells, is shown for each cell type transduced with different MLV enveloped particles:

Retroviral vector particle
Cell type MLV (wtEnv) MLV (PVC-211Env)
1624-5 cells 23.2% 60.5%
CHO-S 0.15% 1.45%
CHO-S Rec1-I-puro 0.56% 19.0%

These findings indicate that the retroviral vector particles MLV (PVC-211 Env) yield higher titers than MLV (wtEnv) particles. In addition, MLV (PVC-211 Env) seems to more efficiently recruit the Rec1 receptor for cell entry as shown by the high transduction efficiencies observed when using CHO-S Rec1-I-puro cells. Strikingly, the comparison of gene transfer efficiencies obtained for MLV (wtEnv) vector particles in CHO-S cells (0.15%) and MLV (PVC-211 Env) vector particles in CHO-S Rec1-I-puro cells (19.0%) reveals a 126-fold increase in transduction efficiency. This is demonstrates the synergistic effect of over-expression of the ecotropic receptor Rec1 in target CHO cells and the utilization of MLV-derived vector particles pseudotyped with the envelope of the molecular clone PVC-211.

Example 6

Transduction of CHO-S Cells with MigR1-Derivatives

To assess whether different promoters for driving reporter gene expression influenced the transduction efficiencies of CHO cells, MLV (wtEnv) and MLV (PVC-211 Env) vector particles were used to transfect derivatives of MigR1 vectors.

HEK cells were seeded at a density of 5×105 cells in 2 ml medium in a 6-well plastic tissue culture dish (Greiner bio-one). Upon reattachment of the cells to the bottom of the dish 5 hours post seeding, 1 μg each of the packaging construct VPack-GP (Stratagene) the envelope constructs PVC-211 Env-I-puro or VPack-Eco (Stratagene), referred to as ‘wtEnv’, and the transfer vectors MigR1, MigR1-P, and MigR1-Ppgk respectively, were transfected using 300 μl unsupplemented DMEM and 10 μl FuGENE®6 (Roche) according the manufacturers' instructions. Two days post transfection, cell-free viral vector particle-containing supernatants were harvested and used to transduce CHO-S cells as described above.

Three days post transduction, transduced cells were analyzed using FACS and the results are as illustrated in FIG. 5. Gene transfer was barely detectable using MLV (wtEnv) vector particles whereas the use of MLV (PVC-211 Env) vector particles resulted in much higher transduction efficiencies, ranging from 1.94% (MigR1) to 3.72% (MigR1-Pvκ). The presence of the promoter for driving reporter GFP gene expression in the transfer vector, had no significant effect on transduction efficiency.

Example 7

Transduction of Human Fibrosarcoma HT1080 Cells in the Presence and Absence of Rec1 Expression

To test whether MLV (PVC-211 Env) vector particles when compared to MLV (wtEnv) vector particles would mediate higher gene transfer efficiencies in human cells, these particles were used to transduce HT1080 cells that recombinantly expressed the ecotropic receptor Rec1.

Frozen vector particles, as described in Example 3, were thawed and used to transduce a variety of different target cells: human fibrosarcoma HT1080 cells, HT1080 Rec1-I-neo cells, murine pre-B 1624-5 cells, as well as CHO-S and CHO-S Rec1-I-puro cells according to the methods described in Example 3.

Three days post transduction, FACS analysis revealed highly efficient gene transfer into 1624-5 cells, see FIG. 6. This was readily detected and independent of the envelope employed (wtEnv, 23.7%; PVC-211 Env, 47.4%). Again, transduction of CHO-S and CHO-S Rec1-I-puro cells using MLV (wtEnv) vector particles was barely detectable (0.17% for CHO-S and 0.55% for CHO-S Rec1-I-puro cells); however, as observed previously, use of MLV (PVC-211 Env) vector particles resulted in much higher transduction efficiencies (9.75% for CHO-S compared to 15.5% for CHO-S Rec1-I-puro cells).

Notably, no transduction was detected of human Rec1-negative HT1080 cells. In contrast, 16.0% of HT1080 Rec1-I-neo cells (Rec1-positive HT1080 cells) showed GFP reporter gene expression following MLV (PVC-211 Env) vector particle-mediated transduction, but only 0.21% of HT1080 Rec1-I-neo cells were GFP-positive when MLV (wtEnv) vector particles were used. These findings clearly indicate that Rec1 is the cognate receptor for PVC-211 Env and wtEnv and therefore that both envelopes mediate the same ecotropic receptor utilization or phenotype tropism. The results are summarised in the table below in which transduction efficiency, measured as the percentage of GFP positive cells, is shown for each cell type transduced with different MLV enveloped vector particles:

Retroviral vector particle
Cell type MLV (wtEnv) MLV (PVC-211Env)
1624-5 cells 23.7% 47.4%
CHO-S 0.17% 9.75%
CHO-S Rec1-I-puro 0.55% 15.5%
HT1080 undetected undetected
HT1080 Rec1-I-neo 0.21% 16.0%

These data again support the theory that PVC-211 Env recruits the receptor Rec1 for transduction more efficiently than wild type Env and demonstrates the synergistic effect of using retroviral vector particles psuedotyped with PVC-211 envelope to transduce host cells over expressing the Rec1 receptor, as was observed and described previously in Example 5.

Example 8

Transduction of CHO Cell Lines in the Presence or Absence of Recombinant Rec1 Expression

The transduction efficiencies of MLV (wtEnv) and MLV (PVC-211 Env) vector particles to transduce other CHO-based cell lines; CHO-S, CHO T-REx™ and CHO-K1, in the presence and absence of recombinant Rec1-expression was tested. As for the generation of ecotropic MLV-based vector particles (Example 3) a triple co-transfection approach employing HEK cells was used.

HEK cells were seeded at a density of 3×106 cells in 30 ml DMEM supplemented with 10% FCS and L-Glutamin (2 mM), in a 15 cm plastic tissue culture dish. Upon re-attachment of the cells to the bottom of the dish 5 hours post seeding, 7 μg of the transfer vector MigR1Ppgk, 4.0 μg of the packaging construct GP-I-bleo and 4.0 μg of the envelope construct wtEnv-I-puro or PVC-211 Env-I-puro were transfected using 1.5 ml DMEM and 45 μl FuGENE6 (Roche) according the manufacturers' instructions. Two days post transfection, cell-free viral vector-containing supernatants were harvested as described in Example 3 and were used to transduce CHO-S (Invitrogen), CHO-K1 (DSMZ) and CHO T-REx™ (Invitrogen) cells, which were either unmodified or ectopically expressing ecotropic receptor Rec1, as described in Example 2. A standard transduction protocol was used as described above and two days post transduction FACS-analysis was performed to detect gene transfer using the reporter gene GFP. As depicted in FIGS. 7a, 7b and 7c the pattern of gene transfer efficiency, as observed previously, was again observed. wtEnv mediated only very low levels of transduction in wild type CHO cells (0.49% to 1.15%) whereas MLV (PVC-211 Env) particles achieved much higher levels of transduction (11.5% to 27%) in the CHO cell lines. Recombinant expression of Rec1 by the CHO cells rendered them more susceptible to wtEnv-mediated transduction (9.95% to 14.7%). Such transduction levels however, were significantly exceeded by the use of PVC-211 Env particles (48.3% to 73.0%). In conclusion, the synergistic effect of enhancing gene transfer efficiency by the use of PVC-211 Env vector particles and Rec1-overexpression in target cells was not only observed in CHO-S cells but also in CHO-K1 and CHO T-REx™ cells. Using these two components in combination, retroviral transduction of CHO T-REx™ cells could be improved up to 145-fold (0.49% transduction with wtEnv and wild type CHO T-REx™ cells compared to 71.1% transduction with PVC-211 Env and CHO T-REx™ Rec1-I-neo cells). The results are summarised in the table below in which transduction efficiency, measured as the percentage of GFP positive cells, is shown for each CHO cell type transduced with different MLV enveloped vector particles:

Retroviral vector particle
Cell type MLV (wtEnv) MLV (PVC-211Env)
CHO-S 1.15% 27.0%
CHO-S Rec1-I-puro 12.1% 73.0%
CHO-K1 0.71% 23.3%
CHO-K1 Rec1-I-neo 14.7% 48.3%
CHO I-REx ™ 0.49% 11.5%
CHO I-REx ™ Rec1-I- 9.95% 71.1%
neo

Example 9

Concentration of MLV (wtEnv) and MLV (PVC-211 Env) Particles Using Ultra-Filtration and Transduction of CHO-S and CHO-S Rec1-I-puro Cells

To further enhance gene transfer efficiencies into CHO cells we next assessed the feasibility of concentrating MLV (wtEnv) and MLV (PVC-211 Env) vector particles prior to transduction. Ecotropic MLV-based vector particles were generated by triple co-transfection employing HEK cells (Example 3) as follows. HEK cells were seeded at a density of 5×106 cells in 36 ml DMEM supplemented with 10% FCS and L-Glutamine (2 mM), in 15 cm plastic tissue culture dishes. Five hours later and upon reattachment of the cells to the bottom of the dish, 3 μg of the transfer vector MigR1Ppgk, 3.0 μg of the packaging construct VPack-GP (Stratagene) and 3.0 μg the envelope constructs wtEnv-I-puro or PVC-211 Env-1-puro were transfected using FuGENE®6 (Roche) following the manufacturer's instructions. Cell-free supernatants were harvested as described (Example 3) and stored at −80° C. for one month. Thawed supernatants were subjected to concentration by ultra-filtration using Amicon Ultra-15 centrifugal filter devices with a cut-off rate of 30 kDa (Millipore). Supernatant volume was decreased from 30 ml to approximately 1 ml by four 15 minute centrifugation steps at 2,500 rpm and 4° C. (Centrifuge 5810R, Eppendorf). 1 ml of these concentrated and untreated supernatants was used to transduce CHO-S and CHO-S Rec1-I-puro cells using the protocol described in Example 3. FACS-analysis of the transduced cells was performed two days after transduction. As shown in FIG. 8, wtEnv- and PVC-211 Env-mediated transduction of CHO-S and CHO-S Rec1-I-puro cells was enhanced by using concentrated supernatants as opposed to unconcentrated supernatants, but only by a factor of approximately two. The only exception to these results was the transduction of CHO-S Rec1-I-puro target cells using MLV (PVC-211 Env) vector particles. In this instance, no significant elevation of gene transfer using concentrated supernatants was observed (41.4% with unconcentrated supernatants compared to 44.7% with concentrated supernatants). This is likely to be due to the saturation of susceptible target cells with vector particles. MLV-based vectors are only able to transduce cells that are going through the S-phase of the cell cycle wherein cells will be transduced during or briefly after exposure to vector particles. Therefore, it is probable that in this example the maximum susceptible frequency of cells accessible for MLV-derived vector particle-mediated gene transfer is approximately 40% to 50% and no higher efficiencies can be achieved. This notion is further supported by the observation of elevated transduction levels following the use of MLV (PVC-211 Env) vector particles with CHO-S target cells (26.6% with unconcentrated and 41.4% with concentrated supernatants). These findings clearly show that transduction efficiencies into CHO cells can be further improved using concentrated retroviral vector particles employing both envelope variants.

Example 10

Comparison of Transduction Efficiency of MLV wtEnv- and PVC-211 Env-Mediated Gene Transfer into CHO-S and CHO-S Rec1-I-Puro Cells Using Similar Multiplicities of Infection

The previous examples have demonstrated that MLV (PVC-211 Env) retroviral vector particles mediate gene transfer into CHO-derived and murine pre-B 1624-5 cell lines more efficiently than MLV (wtEnv) vector particles i.e. irrespective of the target cell line. To determine whether this effect was due to the higher vector titers obtained with transient packaging cells employing PVC-211 Env, similar multiplicities of infection (MOI; ratio of infectious particles to target cell count) of MLV (wtEnv) and MLV (PVC-211 Env) particles were utilized in the following experiment.

Experimentally, 3×106 HEK cells were seeded in 30 ml DMEM supplemented with 10% FCS and L-Glutamine (2 mM), into 15 cm tissue culture plates. 5 hours post seeding, adherent cells were co-transfected with 3.5 μg VPack-GP (Stratagene), 3.5 μg PVC-211 Env-I-puro or wtEnv-I-puro and 8 μg MigPpgk using 1.5 ml serum-free DMEM and 45 μl FuGENE6 (Roche) following the manufacturer's instructions. Two days post transfection, cell-free supernatants were harvested as described above and stored at −80° C. with one aliquot saved for vector titer titration. The following day these aliquots of supernatants were thawed diluted to 1/10 and 1/100 and subjected to the standard transduction procedure using murine pre-B 1624-5 cells. Two days post transduction 1624-5 target cells were analyzed for transfer efficiency by determining GFP-reporter gene expression using FACS. As shown in FIG. 9a, 1/10 dilutions of both vector particle-containing supernatants yielded similar transduction rates on 1624-5 cells (5.42% using wtEnv and 5.93% employing PVC-211 Env). The parental vector particle preparations were then thawed and used for the transduction of CHO-S and CHO-S Rec1-I-puro cells either undiluted or at dilutions of 1/10 and 1/100. Two days post retroviral vector-mediated gene transfer, transduced cells were analyzed for GFP-expression using FACS. As depicted in FIG. 9b, CHO-S cells transduced with undiluted MLV (wtEnv) vector particles (MOI=0.05) showed barely detectable GFP-expression (0.037%). In contrast, CHO-S cells transduced with similar MOI of MLV (PVC-211 Env) showed gene transfer efficiencies of 3.63%, which was more than 5% of the transduction rate achieved using highly susceptible 1624-5 target cells.

Using CHO-S Rec1-I-puro cells (FIG. 9c) wtEnv-mediated gene transfer reached slightly higher but still very low values (0.97% using undiluted vector preparations). In contrast, MLV (PVC-211 Env) vector particles showed an improved gene transfer efficiency of 2-fold and therefore achieved more than 10% of the transduction rate achieved when using highly permissive 1624-5 target cells.

In conclusion, these observations indicate that MLV (PVC-211 Env) vector particles are much more efficient for the transduction CHO-S cells when compared to MLV (wtEnv) vector particles. This confirms that the higher gene transfer efficiencies demonstrated in the previous examples are not solely attributable to the higher infectious vector titers yielded by the utilization of PVC-211 Env but that this envelope exerts a distinct phenotype mediating CHO-tropism.

Example 11

Comparison of Vector Titers Yielded with Components MigR1Ppgk, GP-I-Bleo and wtEnv-I-Puro and PVC-211 Env-I-puro

The efficiency of transient vector particle generation using the vector system components described below was determined as follows. 5×105 HEK cells were seeded in 2 ml of DMEM supplemented with 10% FCS and L-Glutamine (2 mM), in a six-well tissue culture dish. Five hours later and upon re-attachment of the cells to the bottom of the dish, cells in one well were transfected with 1 μg of the transfer vector MigR1Ppgk, 1 μg of the packaging construct VPack-GP (Stratagene) and 1 μg the envelope construct VPack-Eco (Stratagene). Cells in two other wells were transfected with 1 μg of the transfer vector MigR1Ppgk, 1 μg of the packaging construct GP-I-bleo and 1 μg of the envelope construct wtEnv-I-puro or PVC-211 Env-I-puro. All transfections were performed using FuGENE®6 (Roche) following the manufacturer's instructions. Cell-free supernatants were harvested as described (Example 3) and were used for the transduction of 1624-5 cells using dilutions of the vector particle-containing supernatants of 1/2, 1/10, 1/50 and 1/250 as described above (Example 10). FACS-analysis for expression of the GFP reporter gene was performed 3 days post transduction. As shown in FIG. 10, all three vector systems facilitated highly efficient gene transfer. The vector titre was calculated as follows: For example, utilization of the 1/250-diluted supernatant from transient packaging cells using PVC-211 Env-I-puro and GP-I-bleo transduced 6.7% of the 2.5×105 target cells. 6.7% (transduced cells)×250 (dilution)×2,500 (1% of initial target cell count)=4,1875×106 i.u./ml (infectious vector particle units per ml). Using this equation, wtEnv-I-puro/GP-I-bleo (1.9% of cells transduced at 1/250 dilution) yielded a vector titre of 1,1875×106 i.u./ml, while use of VPack-Eco/VPack-GP (3.3% of cells transduced at 1/250 dilution) yielded a titre of 2,0625×106 i.u./ml. These findings therefore indicate the similarity of the described vector components in achieving comparable vector titres upon triple co-transfection of HEK cells. It is useful to note that the utilization of the novel PVC-211 Env-I-puro expression construct together with the packaging construct GP-I-bleo exceeded the vector titers obtained with the commercially available VPack-system.

Example 12

Establishment of Stable HEK-Derived Packaging Cell Lines Using the Constructs GP-I-puro and PVC-211 Env-I-bsr

To test whether the disclosed vector components could establish efficient stable packaging cell lines, the following experiment was performed. 5×105 HEK cells were seeded in 2 ml of DMEM supplemented with 10% FCS and L-Glutamine (2 mM) (culture medium), in one well of a six-well tissue culture dish. Five hours later, the cells were transfected with 1 μg of the packaging construct GP-I-puro. The transfection was performed using FuGENE®6 (Roche) following the manufacturer's instructions. Two days post transfection, transfected cells were expanded in culture medium supplemented with puromycin at a concentration of 1 μg/ml. After nine days of selection, surviving cells were expanded in parallel in the presence of 5, 10, 20, 30, 40 and 50 μg/ml puromycin. After further selection for two weeks 5×105 of the surviving cells were expanded in the presence of the highest puromycin concentrations (40 and 50 μg/ml). The cells were then seeded in six-well tissue culture dishes and transfected with 1 μg of the envelope construct PVC-211 Env-I-bsr containing the blasticidin resistance gene using FuGENE6 (Roche) as described above. Two days post transfection, double-resistance selection with puromycin and blasticidin was initiated. Cells were expanded in the presence of 50 μg/ml puromycin and 30 μg/ml blasticidin or with 40 μg/ml puromycin and 20 μg/ml blasticidin. The resultant packaging cell lines obtained after two weeks of selection were termed PVC-VPC 50/30 and PVC-VPC 40/20 indicating the concentration of puromycin and blasticidin respectively, that was used for their selection.

To study the capacity of the novel packaging cells for high vector titre production, the cells were seeded at a density of 5×105 in 2 ml of culture medium in the absence of puromycin and blasticidin in a six-well tissue culture dish. In parallel, HEK cells were seeded under identical conditions. Five hours post seeding, packaging cells were transfected with 2 μg of the transfer vector MigR1 and 2 μg of the prokaryotic expression vector pUC18. The HEK cells were also transfected with 2 μg of the transfer vector MigR1 and also with 1 μg of the packaging vector VPack-GP (Stratagene) and the envelope construct VPack-Eco (Stratagene) used previously in Example 11 as a positive control. Two days post transfection cell-free vector particle-containing supernatants were harvested as described in Example 3 and were used for the transduction of 1624-5 cells as outlined in Example 11, using dilutions of 1/2, 1/10, 1/50 and 1/250. The following day, FACS-analysis of transduced cells was performed to detect gene transfer efficiency. As shown in FIG. 11 all transient and stable packaging cell lines yielded high vector titres facilitating gene transfer into murine pre-B 1624-5 target cells at comparable efficiencies. Using the equation described in Example 11, the following vector titres were calculated from transduction efficiencies obtained with the 1/50 dilution of vector particle-containing supernatants:

4.25×105 i.u./ml using triple-co-transfection of HEK cells using the VPack-system (3.4% GFP-positive cells),
2.125×105 i.u./ml using the stable packaging cell line PVC-VPC 50/30 (1.7% GFP-positive cells), and
6.25×105 i.u./ml using the stable packaging cell line PVC-VPC 40/20 (5% GFP-positive cells).

In conclusion, all three approaches resulted in comparable vector titres. Notably, PVC-VPC 40/20 yielded the highest vector titres and exceeded the gene transfer efficiency obtained using transient transfection of HEK cells with the commercially available VPack-vector system.

Example 13

Stable HEK-Derived Packaging Cell Line (PVC-VPC 40/20) Efficiently Transduces CHO-S Cells

To investigate the productivity of the stable packaging cell line PVC-VPC 40/20 (described in Example 12) for the productivity of high-titer vector particles capable of transducing CHO-S cells, the following study was performed. The cell line was seeded in a small tissue culture flask (T25) at a density of 5×105 cells. Five hours post seeding, cells were transfected with 2 μg of the transfer vector pMigR1Zeo using FuGENE®6 (Roche) according to the manufactures' instructions. MigR1Zeo is derived from MigR1 (SEQ ID No: 43) but harbours an additional Zeocin™-resistance gene immediately 5′ of the IRES which is flanked on the 3′-side by the reporter gene GFP. Two days post transfection, cell-free vector particle-containing supernatants were harvested as described above and used to transduce 1624-5 murine pre-B and hamster CHO-S cells as described in Example 3. For the transduction of 1624-5 cells a 1/10 dilution of the packaging cell supernatants was used. CHO-S cells were transduced using undiluted (1/1) supernatants. Two days post transduction, GFP-gene transfer efficiency into target cells was analysed using FACS. As depicted in FIG. 12, the stable packaging cell line yielded high vector titers. 11.8% (PVC-VPC 40/20) of transduced 1624-5 cells were readily detected to express the reporter gene GFP. In addition, 9.2% of the CHO-S cells which were transduced with vector particles produced by the novel stable packaging cell line PVC-VPC 40/20 were shown to express GFP.

Example 14

Transduction of BHK Cells

To study whether the PVC-211 Env could also enhance transduction efficiency into a target cell line other than CHO cells, the transduction of baby hamster kidney (BHK) cells was investigated. 2 ml of HEK cells were seeded at a density of 5×105 into the wells of a six-well dish and transfected 5 hours later using FuGENE®6 (Roche), according to the manufacturer's instruction, with 1 μg pGP-I-puro, 1 μg pMigR1Ppgk and the envelope constructs wtEnv-I-puro or PVC-211 Env-I-puro, as described in Example 3. Two days post transfection, cell-free supernatants were harvested and stored at −80° C. Two days later, retroviral vector-containing supernatants were thawed and subsequently used to transduce naïve BHK cells and BHK cells expressing the construct Rec1-I-puro as described above. 1 ml of undiluted supernatants were used per transduction. Three days post transduction FACS-analysis of transduced cells and un-transduced cells serving as negative controls revealed barely detectable GFP reporter gene transfer into BHK cells using wtEnv-displaying particles (0.13% GFP positive cells) as shown in FIG. 13. In contrast, particles utilizing PVC-211 Env yielded 2.03% GFP positive cells. BHK cells expressing the receptor Rec1 were more susceptible to transduction and were shown to be transduced with an efficiency of 4.72% using wtEnv and 31.0% employing the PVC-211 envelope. The results are summarised in the table below in which transduction efficiency, measured as the percentage of GFP positive cells, is shown for each BHK cell type transduced with different MLV enveloped vector particles:

Retroviral vector particle
Cell type MLV (wtEnv) MLV (PVC-211Env)
BHK 0.13%  2.03%
BHK Rec1-I-puro 4.72% 31.00%

In summary, and as previously observed with CHO-derived target cells, BHK cells were more efficiently transduced using the retroviral vector particles utilising the envelope of PVC-211 compared to utilisation of wild-type envelope (wtEnv). Upon recombinant expression of the receptor Rec1, gene transfer efficiencies were further improved, as previously observed with CHO-derived target cells.

This example clearly demonstrates that the increase in transduction efficiency observed when using retroviral vector particles enveloped with PVC-211 is not dependent on the target cell type. Furthermore, an increase in transduction efficiency observed when using target cells expressing the Rec1 receptor is not restricted to CHO cells, but is also observed with another target cell type that express the Rec1 receptor.

Example 15

Generation of CHO-S and CHO-S Rec1-I-neo-Based Cell Lines for the Production of his Tagged VEGF121 Utilizing Transduction of MLV Vector Particles Using the Envelope of PVC-211

To compare the efficiency of generating CHO-based protein producer cell lines, we constructed the retroviral transfer vector pMigR1Ppgk-VEGF121-6xHis-I-puro as described in Example 1 and illustrated schematically in FIGS. 1j and 14a.

CHO-S and CHO-S Rec1-I-neo cells were seeded in a six-well dish at a density of 2.5×105 cells per well. Five hours later, the cells were transfected with 1 μg of the plasmid DNA of pMigR1Ppgk-VEGF121-6xHis-I-puro using FuGENE6® according to the manufacturer's instructions. In parallel, CHO-S and CHO-S Rec1-I-neo cells were transduced with vector particles generated by triple co-transfection of HEK cells with the plasmids pMigR1Ppgk-VEGF121-6xHis-I-puro, GP-I-puro, and PVC-211-Env-I-puro as described in Example 2. This transduction was performed once or once daily on three consecutive days. All cell populations were expanded in six-well dishes. Five days post transfection, following the one-time transduction and two days following the last repeated transduction, the confluent cell populations were resuspended and seeded into 10 cm dishes using 10 ml cultivation medium. Untreated naïve CHO-S and CHO-S Rec1-I-neo cells serving as negative controls were seeded in parallel. Upon attachment of these cell populations five hours later, 10 μg/ml puromycin (Invitrogen) was added. Four days after initiation of the selection, naïve cells were no longer attached, indicating cell death of the entire negative control (NC) population. In contrast, transfected and transduced cell populations showed puromycin-resistant cell clones visible as colonies using light microscopy. Using a magnification of 50-fold, resistant cell colonies on all other populations were counted in ten randomly selected fields. The results are shown in the table below:

NC 1x 3x
Cell type Naïve Transfected Transduced Tranduced
CHO-S 0 12 4 12
CHO-S 0 11 41 230
Rec-1-neo

As expected, both parental cell lines CHO-S and CHO-S Rec1-I-neo revealed similar numbers of cell colonies, namely 12 and 11, respectively upon transfection. In contrast and upon single transduction, only four colonies were observed for CHO-S cells but 10-fold more (41 colonies) for CHO-S Rec1-I-neo cells. This difference was even greater after three transductions, where 12 colonies were observed for CHO-S and almost 20-fold more (230 colonies) were observed for CHO-S Rec1-I-neo cells. Therefore, and as observed previously when using transfer vectors to transduce the reporter gene gfp, CHO-S Rec1-I-neo cells were demonstrated to be more susceptible to MLV vector particle-mediated gene transfer using the envelope of molecular clone PVC-211.

The puromycin-resistant cells of all populations were seeded separately into six-well dishes in 3 ml of culture medium supplemented with 10 μg/ml puromycin per well at a density of 1×105. Naïve CHO-S and CHO-S Rec1-I-neo cells were seeded in parallel in the absence of puromycin and served as negative controls. Four days later, cell-free supernatants were harvested into 15 ml falcon tubes and stored overnight at −80° C. The next day, supernatants were thawed and sample 15 μl of NiNTA Superflow (Qiagen) were added per sample of 2.5 ml supernatant. All samples were kept at 4° C. on a test-tube-rotator to enable the binding of the NiNTA-beads to the His-tag of the VEGF121 variant protein secreted by puromycin-resistant producer cell populations. Upon pelleting using a bench-top eppifuge and two washing steps according to the manufacturer's instructions, the beads were resuspended in 70 μl of standard Western Blot loading buffer and heated for 15 min at 95° C. Subsequently, 50 μl of each sample and a molecular weight marker (BenchMark™ Prestained Protein Ladder; Invitrogen) were loaded on a 15% poly-acryl electrophoresis gel (PAGE) and subjected to electrophoresis. Resultant protein fractions were blotted onto a PVDF-membrane (Sigma) and unspecific protein binding was blocked using PBS supplemented with 2% BSA for one hour at room temperature. VEGF protein was detected by employing a polyclonal rabbit anti-serum (Santa Cruz) at a dilution of 1/1000 in PBS supplemented with 0.05% Tween 20 (PBST) and 2% BSA over night at 4° C. followed by repeated washing with PBST and subsequent exposure to an goat anti-rabbit IgG anti-serum coupled to horse-radish peroxidase (HRP; Abcam) at a dilution of 1/10000 for one hour at room temperature. Upon repeated washing, the membrane was exposed to ECL (Sigma) to detect VEGF121-6xHis using chemiluminescence and exposure to photo-film (Kodak).

As shown in FIG. 14b, no human VEGF protein was detectable in the supernatants of naïve CHO-S and CHO-S Rec1-I-neo cells serving as negative controls. In addition, only a small amount of VEGF protein was detectable in samples from CHO-S cells transfected and transduced with MigR1Ppgk-VEGF121-6xHis-I-puro, although these cells had been selected for the expression of the protein by puromycin selection since the expression of the puromycin resistance gene and the VEGF variant are genetically coupled by an IRES. This finding was also observed in supernatants originating from transfected and puromycin-resistant CHO-S Rec1-I-neo cells. In contrast, human His-tagged VEGF121 protein was readily detected in CHO-S Rec1 cells transduced only once and greater quantities of the protein were detected in CHO-S Rec1 cells transduced three-times with MLV (PVC-211-Env) vector particles. This finding indicates that multiple retroviral vector particles successfully transduced CHO-S Rec1-I-neo target cells resulting in multiple copies of transfer vectors, which inserted into the host cell genome. These multiple insertions resulted in higher VEGF121-6xHis protein yields compared to transfection of the plasmid DNA of pMigR1Ppgk-VEGF121-6xHis-I-puro or the less efficient transduction of CHO-S cells. As demonstrated, the copy number of inserted transfer vectors per CHO-S Rec1-I-cell could be further enhanced upon repeated transduction with MLV (PVC-211-Env) vector particles.

Therefore, this technique of using MLV (PVC-211-Env) retroviral vector particles for the transduction of CHO cells or CHO cells expressing the recombinant receptor Rec1 to yield highly efficient protein producer cells, can be utilised to express many other proteins of interest and is not limited to the expression of cytokines such as VEGF. For example, multimeric proteins such as homo- and hetero-multimeric receptors or immunoglobulins can be produced using the techniques as described in the Examples above and this is shown in the following Examples.

Example 16

Retroviral Expression of Anti IL-15 Antibody 146B7 with CHO-S Rec1 Neo Cells

This example describes the expression of the antibody 146B7, which recognises IL-15, in CHO-S Rec1-neo cells.

HEK cells (HEK 293T; DSMZ) were seeded in a six-well dish at a density of 3×105 cells per well in 2 ml of DMEM supplemented with 10% FCS and 2 mM L-Glutamine. Twenty-four hours later, cells were triple co-transfected with 1 μg of the packaging construct pVPack-GP (Stratagene), 1 μg of the envelope construct pPVC211-env-I-puro and 2 μg of transfer vector in 400 μl of non-supplemented DMEM using FuGENE6® (Roche) according to the manufacturer's instructions. For the generation of retroviral particles coding for the antibody heavy chain, transfer vector pMigR1-EnhP-146B7Vh-sCg-IRES-GFP as described in Example 1.8 (FIG. 15a) was used. For generation of retroviral particles coding for the antibody light chain, transfer vector pMigR1-EnhP-146B7-Vk-Ck-IRES-bcl2 as described in Example 1.8 (FIG. 15b) was used.

Two days post transfection, cell-free retroviral supernatants were harvested in a 2 ml Eppendorf tube by centrifugation for 5 min at 4° C. with 7,000 rpm in an Eppendorf 5417R centrifuge. The retroviral supernatants were either frozen at −80° C. or were used directly for the transduction of target cells. For the expression of recombinant antibody by co-transduction, 500 μl of retroviral particles coding for the antibody heavy chain and 500 μl of retroviral particles coding for the antibody light chain were added to 2.5×105 CHO-S Rec1-neo cells (see Example 2) in a 2 ml Eppendorf tube. Cells were spun in an Eppendorf 5417R centrifuge for 3 h at 30° C. with 3,300 rpm. Supernatants were discarded and cells were cultivated in SF-IMDM medium supplemented with 2% FCS containing low bovine IgG. After three days, cells were analysed for expression of EGFP to determine efficiency of transduction with retroviral particles (FIG. 16). Concentrations of recombinant human antibody secreted into the culture supernatant were determined by Luminex® assay to be 0.4 μg/ml.

Example 17

Retroviral Expression of Anti-IL-15 Antibody 146B7 Using a Bicistronic Vector in CHO-S Rec1-Neo Cells

Retroviral particles containing a bicistronic RNA coding for heavy and light chains of recombinant human antibody 146B7 were generated by triple co-transfection of HEK cells with pVPack-GP, pPVC211-env-I-puro, and transfer vector pMigRi-EnhP-146B7-Vh-sCg-IRES-Vk-Ck (Example 1.8; FIG. 17) as described in Example 16. Two days post transfection, cell-free retroviral supernatants were harvested and CHO-S Rec1-neo target cells were transduced with 1 ml of these supernatants according to Example 16.

Three days after transduction and subsequent cultivation, the levels of secreted recombinant human antibody in the culture supernatant were determined by Luminex® assay. Following two further transductions of the CHO-S Rec1-neo target cells, the levels of recombinant human IgG increased over 10 fold to approximately 12 μg/ml, as shown in the table below:

Transduction No. IgG (μg/ml)
1 1.13
2 2.00
3 11.8

Example 18

Retroviral Expression of Anti IL-1β B Cell Receptors on the Surface of CHO-S Rec1-Hygro Cells

Retroviral particles coding for heavy or light chains of recombinant human B cell receptors (BCR) were generated by co-transfection of HEK cells with pVPack-GP, pPVC211-env-I-puro, and the transfer vectors pMigR1-EnhP-SK48E26-Vh-sCg-IRES-GFP and pMigR1-EnhP-SK48E26-Vk-Ck-IRES-bcl2 respectively (see Example 1.9), as described in Example 16. Two days post transfection, cell-free retroviral supernatants were harvested and CHO-S Rec1-hygro target cells (See Examples 1.2 and 2) were co-transduced according to Example 16.

Four days after transduction and subsequent cultivation, cells were analysed for expression of GFP using a FACSCalibur™ (Beckton Dickinson) to monitor retroviral expression of BCR heavy chain (FIG. 18). In addition, unpermebealized cells were stained for expression of kappa light chain to confirm cell surface expression of BCR light chain (FIG. 18). The amount of GFP and kappa double positive cells revealed expression of BCR on the surface of 14% of CHO-S Rec1-hygro target cells.

Examples 16, 17 and 18 therefore demonstrate the successful expression of antibody protein in CHO-S Rec1 target cells and the successful expression of B cell receptor protein on CHO-S Rec1 target cells that have been transduced with a retroviral vector psuedotyped with the envelope of molecular clone PVC-211.

Example 19

Retroviral Expression of the Cytokine IL-6 in CHO-S Rec1-Neo Cells

This example describes the procedure for expressing the cytokine IL-6 in the host cells CHO-S Rec1-neo.

HEK cells (HEK 293T; DSMZ) are seeded in a six-well dish at a density of 3×105 cells per well in 2 ml of DMEM supplemented with 10% FCS and 2 mM L-Glutamine. Twenty-five hours later, cells are triple co-transfected with 1 μg of the packaging construct pVPack-GP (Stratagene), 1 μg of the envelope construct pPVC211-env-I-puro and 2 μg of transfer vector pMigR1-EnhP-IL-6-IRES-GFP (described in Example 1.10) in 400 μl of non-supplemented DMEM using FuGENE6® (Roche) according to the manufacturer's instructions.

Two days post transfection, cell-free retroviral supernatants are harvested in a 2 ml Eppendorf tube by centrifugation for 5 min at 4° C. with 7,000 rpm in an Eppendorf 5417R centrifuge. The retroviral supernatants are either frozen at −80° C. or are used directly for the transduction of target cells. For the expression of cytokine protein by transduction, 500 μl of retroviral particles coding for IL-6 are added to 2.5×105 CHO-S Rec1-neo cells (see Example 2) in a 2 ml Eppendorf tube. Cells are spun in an Eppendorf 5417R centrifuge for 3 h at 30° C. with 3,300 rpm. Supernatants are discarded and the cells are cultivated in SF-IMDM medium supplemented with 2% FCS containing low bovine IgG. After three days, cells can be analysed for expression of EGFP to determine efficiency of transduction with retroviral particles. Concentrations of IL-6 protein secreted into the culture supernatant can be determined by an appropriate assay such as a Luminex® assay.

Example 20

Retroviral Expression of the Pro-Inflammatory Cytokine TNFα in CHO-S Rec1 Host Cells

Retroviral particles coding for the pro-inflammatory cytokine TNFα are generated by triple co-transfection of HEK cells with pVPack-GP, pPVC211-env-I-puro and the transfer vector pMigR1-EnhP-TNFα-IRES-GFP (see Example 1.10), as described in Example 19. Two days post transfection, cell-free retroviral supernatants are harvested and CHO-S Rec1-neo target cells are co-transduced according to Example 19. Three days after transduction and subsequent cultivation, the levels of secreted TNFα protein in the culture supernatant can be determined by Luminex® assay.

Example 21

Retroviral Expression of the Chemokine CCL5 in CHO-S Rec1 Host Cells

Retroviral particles coding for the chemokine CCL5 are generated by triple co-transfection of HEK cells with pVPack-GP, pPVC211-env-I-puro and the transfer vector pMigR1-EnhP-CCL5-IRES-GFP (see Example 1.10), as described in Example 19. Two days post transfection, cell-free retroviral supernatants are harvested and CHO-S Rec1-neo target cells are co-transduced according to Example 19. Three days after transduction and subsequent cultivation, the levels of secreted CCL5 protein in the culture supernatant can be determined by Luminex® assay.

Examples 19, 20 and 21 detail how a number of different proteins of interest can be expressed in CHO-S Rec1 target cells that can be transduced with a retroviral vector psuedotyped with the envelope of molecular clone PVC-211.

List of Sequences

The sequences for the following nucleic acids or amino acids are shown in the appended sequence listing, in which SEQ ID NOS correspond as follows:

1: PVC-211 env molecular clone nucleic acid
2: PVC-211 env molecular clone amino acid
3: MLV envelope (wt-env) nucleic acid
4: MLV envelope (wt-env) amino acid
5: Forward primer—amplification of puroR
6: Reverse primer—amplification of puroR
7: Puromycin resistance gene nucleic acid
8: Puromycin resistance gene amino acid
9: Forward primer—amplification of hygroR
10: Reverse primer—amplification of hygroR
11: Hygromycin resistance gene nucleic acid
12: Hygromycin resistance gene amino acid
13: Forward primer—amplification of bsr
14: Reverse primer—amplification of bsr
15: Blasticidin resistance gene nucleic acid
16: Blasticidin resistance gene amino acid
17: Bleomycin resistance gene nucleic acid
18: Bleomycin resistance gene amino acid
19: Neomycin resistance gene nucleic acid
20: Neomycin resistance gene amino acid
21: Green fluorescent protein nucleic acid
22: Green fluorescent protein amino acid
23: Yellow fluorescent protein nucleic acid
24: Yellow fluorescent protein amino acid
25: Truncated NGFR nucleic acid
26: Truncated NGFR amino acid
27: Truncated CD7 nucleic acid
28: Truncated CD7 amino acid
29: Forward primer—eMLV-R
30: Reverse primer—eMLV-R
31: Rec1 receptor nucleic acid
32: Rec1 receptor amino acid
33: Stuffer sequence
34: Forward primer—Kozak Gag/Pol
35: Reverse primer—MLVgp RI
36: MLV gag/pol nucleic acid
37: MLV gag/pol amino acid
38: Forward primer—Murine Ppgk
39: Reverse primer—Murine Ppgk
40: Murine Ppgk nucleic acid
41: Vkappa promoter (Pvκ) nucleic acid
42: pIRES-puro nucleic acid
43: MigR1 vector nucleic acid
44: Forward primer—amplification of VEGF121
45: Reverse primer—amplification of VEGF121
46: VEGF121-6xHis nucleic acid
47: VEGF121-6xHis amino acid
48: murine kappa intron enhancer (κiE) nucleic acid
49: 146B7 Vh nucleic acid
50: 146B7 Vh amino acid
51: sIgH constant region (sCg) nucleic acid
52: sIgH constant region (sCg) amino acid
53: 146B7 Vk nucleic acid
54: 146B7 Vk amino acid
55: kappa constant region (Ck) nucleic acid
56: kappa constant region (Ck) amino acid
57: SK48E26 Vh nucleic acid
58: SK48E26 Vh amino acid
59: SK48E26 Vk nucleic acid
60: SK48E26 Vk amino acid
61: Forward primer murine bcl2A
62: Reverse primer murine bcl2A
63: murine bcl2A nucleic acid
64: IL-6 nucleic acid
65: TNFα nucleic acid
66: CCL5 nucleic acid

REFERENCES

  • Adam M A, Ramesh N, Miller A D, Osborne W R. (1991) J. Virol. 65(9): 4985-90.
  • Albritton L M, Tseng L, Scadden D, Cunningham J M. (1989) Cell 57(4): 659-66.
  • Albritton L M, Kim J W, Tseng L, Cunningham J M. (1993) J. Virol. 67(4): 2091-6.
  • Bergemann K, Eckermann C, Garidel P, Grammatikos S, Jacobi A. et al. (2007) In Handbook of Therapeutic Antibodies, Chapter 9. Ed Dübel S. Wiley-VCH Verlag GmbH & Co. ISBN 978-3-527-31453-9.
  • Bleck G T. (2005) Bioprocessing Journal September/October: 1-7.
  • Coffin J M, Hughes, S H, Varmus, H E. (1997) Eds Retroviruses, Cold Spring Harbor Laboratory Press.
  • Elder J H, McGee J S, Alexander S. (1986) J. Virol. 57(1): 340-2.
  • Fischer R, Stoger E, Schillberg S, Christon P, Twyman R M. (2004) Curr. Op. Plant Biol. 7: 152-8.
  • Gazdar A F, Oie H, Lalley P, Moss W W, Minna J D. (1977) Cell 11(4): 949-56.
  • Gossen M, Bujard H. (1992) Proc. Natl. Acad. Sci. USA. 89: 5547-51.
  • Graham F L, Smiley J, Russell W C, Nairn R. (1977) J. Gen. Virol. 36(1): 59-74.
  • Gray K D, Roth M J. (1993) J. Virol. 67: 3489-96.
  • Heard J M, Danos O. (1991) J. Virol. 65(8): 4026-32.
  • Hoffman P M, Cimino E F, Robbins D S, Broadwell R D, Powers J M, Ruscetti S K. (1992) Lab Invest. 67(3): 314-21.
  • Jacobsen L B, Calvin S A, Colvin, K E, Wright M. (2004) Transfection of Mammalian Cells—Methods 33: 104-12.
  • Kai K & Furuta T. (1984) J. Viral. 50: 970-3.
  • Koch W, Hunsmann G, Friedrich R. (1983) J. Virol. 45(1): 1-9.
  • Lever A, Gottlinger H, Haseltine W, Sodroski J. (1989) J. Virol. 63(9): 4085-7.
  • Masuda M, Remington M P, Hoffman P M, Ruscetti S K. (1992) J. Viral. 66(5): 2798-806.
  • Mann R, Baltimore D. (1985) J. Viral. 54(2): 401-7.
  • Masuda M, Hoffman P M, Ruscetti S K. (1993) J. Viral. 67(8): 4580-7.
  • Masuda M, Hanson C A, Alvord W G, Hoffman P M, Ruscetti S K, Masuda M. (1996a_Virology 215(2): 142-51.
  • Masuda M, Masuda M, Hanson C A, Hoffman P M, Ruscetti S K. (1996b) J. Viral. 70(12): 8534-9.
  • Mather J P. (1980) Biol. Reprod. 23(1): 243-52.
  • Mather J P, Zhuang L Z, Perez-Infante V, Phillips D M. (1982) Ann. NY Acad. Sci. 383: 44-68.
  • Miller D G, Miller A D. (1992_J. Virol. 66(1): 78-84.
  • Oie H K, Gazdar A F, Lalley P A, Russell E K, Minna J D et al. (1978) Nature 274: 60-62.
  • Ott D, Friedrich R, Rein A. (1990) J. Virol. 64(2): 757-66.
  • Pear W S, Miller J P, Xu L, Pui J C, Soffer B et al. (1998) Blood 92 (10): 3780-92.
  • Remington M P, Hoffman P M, Ruscetti S K, Masuda M. (1992) Nuc. Acids Res. 20(12): 3249.
  • Richmond J Y & McKinney R W. (1993) Biosafety in Microbiological and Biomedical Laboratories. US Department of Health and Human Services, CDC/NIH, 3rd Edition. US Government Printing Office, Washington, D.C.
  • Ruddle N H, Conta B S, Leinwand L, Kozak C, Ruddle F et al. (1978) J. Exp. Med. 148(2): 451-65.
  • Shinnick T M, Lerner R A, Sutcliffe J G. (1981) Nature 293: 543-8.
  • Siess D C, Kozak S L, Kabat D. (1996) J. Virol. 70(6): 3432-9.
  • Wilson C A, Eiden M V. (1991) J. Virol. 65(11): 5975-82.
  • Wildt S, Gerngross T U. (2005) Nat. Rev. Microbiol. 3: 119-28.
  • Yee J K, Miyanohara A, LaPorte P, Bouic K, Burns J C, Friedmann T. (1994) Proc. Natl. Acad. Sci. USA. 91(20): 9564-8.
  • Yu S F, von Rüden T, Kantoff P W, Garber C, Seiberg M et al. (1986) Proc. Natl. Acad. Sci. USA. 83(10): 3194-8.
  • Zufferey R, Donello J E, Trono D, Hope T J. (1999) J. Virol. 73(4): 2886-92.
  • WO 86/005807 A1: Kenton J H & Boss M A.
  • WO 87/004462 A1: Wilson R H & Bebbington C R.
  • WO 89/010404 A1: Bebbington C R & Yarranton G T.
  • WO 91/006657 A1: Bebbington C R & Yarranton G T.
  • WO 95/001997 A1; Young P R, Gross M S & Jonak Z L.

Claims

1. A method for transducing a host cell, said method comprising transducing the host cell with a retroviral vector particle comprising an envelope of Friend murine leukaemia virus, wherein the envelope of Friend murine leukaemia virus is encoded by molecular clone PVC-211 (SEQ ID NO: 1) or a functional fragment thereof, and wherein the host cell recombinantly expresses a Rec1 receptor or a functional fragment thereof.

2. A method for conferring or increasing susceptibility of a host cell to transduction, said method comprising transducing the host cell with a retroviral vector particle comprising an envelope of Friend murine leukaemia virus, wherein the envelope of Friend murine leukaemia virus is encoded by molecular clone PVC-211 (SEQ ID NO: 1) or a functional fragment thereof, and wherein the host cell recombinantly expresses a Rec1 receptor or a functional fragment thereof.

3. (canceled)

4. The method according to claim 1, wherein the retroviral vector particle further comprises an expressible heterologous nucleotide sequence encoding a protein of interest.

5. The method according to claim 4, further comprising the step of culturing the host cell under conditions to produce the protein of interest.

6. The method according to claim 5, wherein said culturing step produces the protein of interest at a concentration of at least 1 mg/L.

7. The method according to claim 1, wherein the host cell is a hamster cell.

8. The method according to claim 1, wherein the host cell is a Chinese hamster ovary (CHO) cell.

9. The method according to claim 4, wherein the protein of interest is selected from the group consisting of: interferons, erythropoietin, Factor VIII, clotting factors, antibodies and fragments thereof, insulin, chemokines, cytokines, growth factors, angiogenesis modulatory factors, apoptosis modulatory factors and vaccines.

10. The method according to claim 4, wherein the retroviral vector particle comprises at least two heterologous nucleotide sequences coding for at least two different proteins of interest.

11. The method according to claim 10, wherein the at least two proteins of interest are an immunoglobulin heavy chain and an immunoglobulin light chain.

12. The method according to claim 1, wherein the retroviral vector particle is produced by a retroviral packaging system comprising:

a) an envelope construct comprising a promoter operably linked to an envelope coding sequence of a Friend murine leukaemia virus, wherein the envelope of Friend murine leukaemia virus is encoded by molecular clone PVC-211 (SEQ ID NO: 1) or a functional fragment thereof;

b) a packaging construct comprising a promoter operably linked to a nucleotide sequence encoding a retroviral gag and pol; and

c) a retroviral transfer vector.

13. (canceled)

14. The method of claim 12, wherein the retroviral packaging system is expressed in a host cell under conditions effective to produce a retroviral vector particle.

15. (canceled)

16. A host cell line transduced with a retroviral vector particle comprising an envelope of Friend murine leukaemia virus encoded by the molecular clone PVC-211 (SEQ ID No: 1) or a functional fragment thereof, wherein the host cell line recombinantly expresses a Rec1 receptor.

17. (canceled)

18. The host cell line according to claim 16, wherein the host cell line produces a protein of interest encoded by the retroviral vector.

19. The host cell line according to claim 18, wherein the protein of interest is produced by the cell line at a concentration of at least 1 mg/L.

20. A system for transducing a host cell, comprising:

a) a retroviral vector particle comprising an envelope of Friend murine leukaemia virus encoded by the molecular clone PVC-211 (SEQ ID No: 1) or a functional fragment thereof; and

b) a target host cell which recombinantly expresses a Rec1 receptor (SEQ ID No: 32) or a functional fragment thereof.

21. The host cell line of claim 16, wherein the cell is a hamster cell.

22. The host cell line of claim 21, wherein the hamster cell is a Chinese hamster ovary (CHO) cell.

Resources

Images & Drawings included:

Sources:

Similar patent applications:

Recent applications in this class:

Recent applications for this Assignee: