Patent application title:

Method for increasing the efficiency of double-strand-break induced mutagenesis

Publication number:

US20140234975A1

Publication date:
Application number:

14/131,210

Filed date:

2012-07-03

✅ Patent granted

Patent number:

US 9,540,623 B2

Grant date:

2017-01-10

PCT filing:

WO; PCT/US2012/045338; 20120703

PCT publication:

WO; WO2013/009525; 20130117

Examiner:

Jennifer Dunston

Agent:

Law Office of Salvatore Arrigo and Scott Lee, LLP

Adjusted expiration:

2033-05-03

Abstract:

The present invention relates to a method for increasing double-strand-break induced mutagenesis at a genomic locus of interest in a cell, thereby giving new tools for genome engineering, including therapeutic applications and cell line engineering. More specifically, the present invention concerns the combined use of TALEN or meganucleases with TREX2, especially under the form of single-chain proteins.

Inventors:

Assignee:

Applicant:

Interested in similar patents?

Get notified when new applications in this technology area are published.

Classification:

C12N15/82 »  CPC further

Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor; Recombinant DNA-technology; Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression; Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)

C12N9/22 »  CPC main

Enzymes; Proenzymes; Compositions thereof ; Processes for preparing, activating, inhibiting, separating or purifying enzymes; Hydrolases (3) acting on ester bonds (3.1) Ribonucleases RNAses, DNAses

C12N15/8213 »  CPC further

Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor; Recombinant DNA-technology; Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression; Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs); Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation Targeted insertion of genes into the plant genome by homologous recombination

C07K2319/00 »  CPC further

Fusion polypeptide

C07K2319/80 »  CPC further

Fusion polypeptide containing a DNA binding domain, e.g. Lacl or Tet-repressor

C12N15/87 »  CPC further

Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor; Recombinant DNA-technology Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation

Description

This application claims priority to U.S. Ser. No; 61/505,793 filed Jul. 8, 2011, U.S. Ser. No. 61/551,169 filed Oct. 25, 2011, and U.S. Ser. No. 61/579,939 filed Dec. 23, 2011, the entire contents of each is incorporated herein by reference.

FIELD OF THE INVENTION

The present invention relates to a method for increasing double-strand break-induced mutagenesis at a genomic locus of interest in a cell, thereby giving new tools for genome engineering, including therapeutic applications and cell line engineering. More specifically, the present invention concerns a method for increasing double-strand break-induced mutagenesis at a genomic locus of interest, leading to a loss of genetic information. The present invention also relates to engineered endonucleases combining dimeric exonucleases, more especially TREX2 and rare-cutting endonucleases such as TALEN and Homing endonucleases, and vectors encoding such nucleases. These novel enzymes are particularly useful for inactivating genes in plants without resorting to chromosomal insertion of exogenous DNA.

BACKGROUND OF THE INVENTION

Mammalian genomes constantly suffer from various types of damage, of which double-strand breaks (DSB) are considered the most dangerous (Haber, 2000). For example, DSBs can arise when the replication fork encounters a nick or when ionizing radiation particles create clusters of reactive oxygen species along their path. These reactive oxygen species may in turn themselves cause DSBs. For cultured mammalian cells that are dividing, 5-10% appear to have at least one chromosomal break (or chromatid gap) at any one time (Lieber & Karanjawala, 2004). Hence, the need to repair DSBs arises commonly (Li et al, 2007) and is critical for cell survival (Haber, 2000). Failure or incorrect repair can result in deleterious genomic rearrangements, cell cycle arrest, or cell death.

Repair of DSBs can occur through diverse mechanisms that can depend on cellular context. Repair via homologous recombination, the most accurate process, is able to restore the original sequence at the break. Because of its strict dependence on extensive sequence homology, this mechanism is suggested to be active mainly during the S and G2 phases of the cell cycle where the sister chromatids are in close proximity (Sonoda et al, 2006). Single-strand annealing is another homology-dependent process that can repair DSB between direct repeats and thereby promotes deletions (Paques & Haber, 1999). Finally, non-homologous end joining (NHEJ) of DNA is a major pathway for the repair of DSBs because it can function throughout the cell cycle and because it does not require a homologous chromosome (Moore & Haber, 1996).

NHEJ comprises at least two different processes (Feldmann et al, 2000). The main and best characterized mechanism involves rejoining of what remains of the two DNA ends through direct re-ligation (Critchlow & Jackson, 1998) or via the so-called microhomology-mediated end joining (MMEJ) (Ma et al, 2003). Although perfect re-ligation of the broken ends is probably the most frequent event, it could be accompanied by the loss or gain of several nucleotides.

Like most DNA repair processes, there are three enzymatic activities required for repair of DSBs by the NHEJ pathway: (i) nucleases to remove damaged DNA; (ii) polymerases to aid in the repair, and; (iii) a ligase to restore the phosphodiester backbone. Depending on the nature of the DNA ends, DNA can be simply re-ligated or terminal nucleotides can be modified or removed by inherent enzymatic activities, such as phosphokinases and exonucleases. Missing nucleotides can also be added by polymerase μ or λ. In addition, an alternative or so-called back-up pathway has been described that does not depend on ligase IV and Ku components and has been involved in class switch and V(D)J recombination (Ma et al, 2003). Overall, NHEJ can be viewed as a flexible pathway wherein the goal is to restore the chromosomal integrity, even at the cost of nucleotide excisions or insertions.

DNA repair can be triggered by both physical and chemical means. Several chemicals are known to cause DNA lesions and are used routinely. Radiomimetic agents, for example, work through free-radical attack on the sugar moieties of DNA (Povirk, 1996). A second group of drugs inducing DNA damage includes inhibitors of topoisomerase I (TopoI) and II (TopoII) (Burden & N., 1998; Teicher, 2008). Other classes of chemicals bind covalently to the DNA and form bulky adducts that are repaired by the nucleotide excision repair (NER) system (Nouspikel, 2009). Chemicals inducing DNA damage have a diverse range of applications, however, although certain agents are more commonly applied in studying a particular repair pathway (e.g. cross-linking agents are favored for NER studies), most drugs simultaneously provoke a variety of lesions (Nagy & Soutoglou, 2009). Furthermore, using these classical strategies the overall yield of induced mutations is quite low, and the DNA damage leading to mutagenesis cannot be targeted to precise genomic DNA sequence.

The most widely used site-directed mutagenesis strategy is gene targeting (GT) via homologous recombination (HR). Efficient GT procedures in yeast and mouse have been available for more than 20 years (Capecchi, 1989; Rothstein, 1991). Successful GT has also been achieved in Arabidopsis and rice plants (Endo et al, 2006; Endo et al, 2007; Hanin et al, 2001; Terada et al, 2002). Typically, GT events occur in a fairly small population of treated mammalian cells and are extremely low in higher plant cells, in the range of 0.01-0.1% of the total number of random integration events (Terada et al, 2007). The low GT frequencies reported in various organisms are thought to result from competition between HR and NHEJ for repair of DSBs. There are extensive data indicating that DSB repair by NHEJ is error-prone due to end-joining processes that generate insertions and/or deletions (Britt, 1999). Thus, these NHEJ-based strategies might be more effective than HR-based strategies for targeted mutagenesis into cells.

Expression of I-SceI, a rare cutting endonuclease, has been shown to introduce mutations at I-SceI cleavage sites in mammalian cells (Liang et al, 1998), Arabidopsis and tobacco (Endo et al, 2006; Endo et al, 2007; Hanin et al, 2001; Kirik et al, 2000; Terada et al, 2007). However, the use of endonucleases is limited to rarely occurring natural recognition sites or to artificially introduced target sites. To overcome this problem, meganucleases with engineered specificity towards a chosen sequence have been developed (Arnould et al, 2006a; Arnould et al, 2007; Grizot et al, 2009; Smith et al, 2006). Meganucleases show high specificity to their DNA target, these proteins being able to cleave a unique chromosomal sequence and therefore do not affect global genome integrity. Natural meganucleases are essentially represented by homing endonucleases, a widespread class of proteins found in eukaryotes, bacteria and archae (Chevalier & Stoddard, 2001). Homing endonucleases can be classified in five different families, the largest and best characterized one being the LAGLIDAG homing endonuclease family, named after a conserved sequence motif (Stoddard, 2005). LAGLIDADG homing endonucleases can be dimeric (possessing a single LAGLIDADG motif per polypeptide), or monomeric (possessing two LAGLIDADG motifs per polypeptide).

Early studies of the I-SceI and HO homing endonucleases illustrated how the cleavage activities of these proteins could be used to initiate HR events in living cells and demonstrated the recombinogenic properties of chromosomal DSBs (Dujon et al, 1986; Haber, 1995). Since then, I-SceI-induced HR has been successfully used for genome engineering purposes in bacteria (Posfai et al, 1999b), mammalian cells (Cohen-Tannoudji et al, 1998; Donoho et al, 1998; Grizot et al, 2009; Sargent et al, 1997), mice (Gouble et al, 2006) and plants (Puchta et al, 1996; Siebert & Puchta, 2002). Meganucleases have emerged as the scaffolds of choice for deriving genome engineering tools cutting a desired target sequence (Paques & Duchateau, 2007b). Combinatorial assembly processes allowing for the engineering of meganucleases with modified specificities have been described (Arnould et al, 2006a; Arnould et al, 2007; Grizot et al, 2009; Smith et al, 2006). Briefly, these processes rely on the identification of locally engineered variants with a substrate specificity that differs from that of the wild-type meganuclease by only a few nucleotides.

Zinc-finger nucleases (ZFNs) represent another type of specific nuclease. ZFNs are chimeric proteins composed of a synthetic zinc-finger-based DNA binding domain fused to a DNA cleavage domain. By modification of the zinc-finger DNA binding domain, ZFNs can be specifically designed to cleave virtually any long stretch of dsDNA sequence (Cathomen & Joung, 2008; Kim et al, 1996). A NHEJ-based targeted mutagenesis strategy was recently developed for several organisms by using synthetic ZFNs to generate DSBs at specific genomic sites (Beumer et al, 2008; Doyon et al, 2008a; Holt et al, 2010; Lloyd et al, 2005; Meng et al, 2008; Perez et al, 2008; Santiago et al, 2008). Subsequent repair of the DSBs by NHEJ frequently produces deletions and/or insertions at the joining site. For example, in zebrafish embryos the injection of mRNA coding for engineered ZFNs led to animals carrying the desired heritable mutations (Doyon et al, 2008b). In plant, similar NHEJ-based targeted mutagenesis has also been successfully applied (Lloyd et al, 2005). Although these powerful tools are available, there is still a need to further improve double-strand break-induced mutagenesis.

Recent studies suggest that co-expressing TREX2 exonuclease with I-SceI meganuclease modify gene repair activity in mouse ES cells, thereby causing partial degradation of chromosomal DNA by I-SceI (Bennardo et al, 2009). However, it was found in these studies that limiting the persistence of a chromosome break with TREX 2, diminishes the mutagenic potential of the meganuclease.

In this context, the inventors have developed an original approach to increase the efficiency of targeted DSB-induced mutagenesis based on the use of single-chain proteins combining TREX2 exonuclease with different rare-cutting endonucleases, such LAGLIDADG homing endonucleases and TALENs.

This approach has proven particular efficiency for gene mutagenesis, especially in plant transformation.

BRIEF SUMMARY OF THE INVENTION

The present invention relates to single-chain molecules of dimeric exonuclease, typically TREX2, preferably coupled with a dimeric endonuclease, such as a TALEN or a LAGLIDAG homing endonuclease. These molecules enhance the frequency of NHEJ-based targeted mutagenesis into chromosomal genes without insertion of exogeneous DNA.

The present invention also relates to specific nucleic acids or vectors encoding these single-chain molecules, as well as compositions and kits comprising those.

The above polypeptides and polynucleotides according to the invention are useful for targeted mutagenesis into cells, especially in plant cells.

The above objects highlight certain aspects of the invention. Additional objects, aspects and embodiments of the invention are found in the following detailed description of the invention.

BRIEF DESCRIPTION OF THE DRAWINGS

In addition to the preceding features, the invention further comprises other features that will emerge from the description and appended drawings that follow. A more complete appreciation of the invention and many of the attendant advantages thereof will be readily obtained as the same becomes better understood by reference to the following figures in conjunction with the detailed description below.

FIG. 1: Effect of different single-chain TREX2 molecules on the targeted mutagenesis frequency induced by the engineered SC_GS meganuclease.

Cells were co-transfected with 1 μg of expression vector for the SC_GS meganuclease and increasing amounts of plasmids coding for TREX2 protein taken as a control (pCLS7673, SEQ ID NO: 14), and the four following TREX2 single-chain molecules: scTrex1 (pCLS8981, SEQ ID NO: 9), scTrex2 (pCLS8982, SEQ ID NO: 10), scTrex3 (pCLS8983, SEQ ID NO: 11) and scTrex4 (pCLS8986, SEQ ID NO: 12). The percentage of GFP-positive cells induced in a NHEJ model was measured by flow cytometry three days post transfection.

FIG. 2: Cells were co-transfected with 3 μg of plasmid encoding the SC_GS meganuclease (either alone or in fusion) as follows: SC_GS (pCLS2690, SEQ ID NO: 13), SC_GS (pCLS2690, SEQ ID NO: 13)+2 μg TREX (pCLS7673, SEQ ID NO: 14), SC_GS (pCLS2690, SEQ ID NO: 13)+2 μg scTrex2 (pCLS8982, SEQ ID NO: 10) and scTrex2-10-SC_GS (pCLS9572, SEQ ID NO: 39). The percentage of GFP-positive cells was measured four days post transfection by flow cytometry analysis using Guava instrumentation (Millipore).

FIG. 3: Percentage of targeted mutagenesis events (insertions and deletions) generated by SC_GS (SEQ ID NO: 60), SC_GS (SEQ ID NO: 60)+TREX (SEQ ID NO: 26), SC_GS (SEQ ID NO: 60)+scTrex2 (SEQ ID NO: 6) or scTrex2-10-SC_GS (SEQ ID NO: 56) and detected in the vicinity of the GS_CHO1 site using deep sequencing analysis (454 Life Sciences).

FIG. 4: Percentage of events corresponding to a deletion of 2 (Del2), 3 (Del3) or 4 (Del4) nucleotides at the end of double-strand break (corresponding to the loss of the 3′ overhang), generated by SC_GS (SEQ ID NO: 60), SC_GS (SEQ ID NO: 60)+TREX (SEQ ID NO: 26), SC_GS (SEQ ID NO: 60)+scTrex2 (SEQ ID NO: 6) or scTrex2-10-SC_GS (SEQ ID NO: 56); Other indicates any other mutagenic NHEJ events (e.g. insertions or extended deletions).

FIG. 5: Dose response measured using the GFP model at the GS CHO1 target. Cells were transfected with increasing amounts (1, 3, 6 or 10 μg) of SC_GS (SEQ ID NO: 60), Trex-10-SC_GS (SEQ ID NO: 53), scTrex2-10-SC_GS (SEQ ID NO: 56) or SC_GS-10-scTrex2 (SEQ ID NO: 57) as indicated. The percentage of GFP-positive cells was measured four days post transfection.

FIG. 6: Percentage of targeted mutagenesis events (insertions and deletions) generated by SC_RAG (SEQ ID NO: 47), SC_RAG (SEQ ID NO: 47)+TREX (SEQ ID NO: 26), SC_RAG (SEQ ID NO: 47)+scTrex2 (SEQ ID NO: 6) or scTrex2-10-SC_RAG (SEQ ID NO: 59) and detected in the vicinity of the RAG site using deep sequencing analysis (454 Life Sciences).

FIG. 7: Percentage of targeted mutagenesis events (insertions and deletions) generated by SC_CAPNS1 (SEQ ID NO: 45), SC_CAPNS1 (SEQ ID NO: 45)+TREX (SEQ ID NO: 26), SC_CAPNS1 (SEQ ID NO: 45)+scTrex2 (SEQ ID NO: 6) or scTrex2-10-SC_CAPNS1 (SEQ ID NO: 58) and detected in the vicinity of the CAPNS1 site using deep sequencing analysis (454 Life Sciences).

FIG. 8: Percentage of events corresponding to a deletion of 2 (Del2), 3 (Del3) or 4 (Del4) nucleotides at the end of double-strand break (corresponding to the loss of the 3′ overhang), generated by SC_RAG (SEQ ID NO: 47), SC_RAG (SEQ ID NO: 47)+TREX (SEQ ID NO: 26), SC_RAG (SEQ ID NO: 47)+scTrex2 (SEQ ID NO: 6) or scTrex2-10-SC_RAG (SEQ ID NO: 59); Other indicates any other mutagenic NHEJ events (e.g. insertions or extended deletions).

FIG. 9: Percentage of events corresponding to a deletion of 2 (Del2), 3 (Del3) or 4 (Del4) nucleotides at the end of double-strand break (corresponding to the loss of the 3′ overhang), generated by SC_CAPNS1 (SEQ ID NO: 45), SC_CAPNS1 (SEQ ID NO: 45)+TREX (SEQ ID NO: 26), SC_CAPNS1 (SEQ ID NO: 45)+scTrex2 (SEQ ID NO: 6) or scTrex2-10-SC_CAPNS1 (SEQ ID NO: 58); Other indicates any other mutagenic NHEJ events (e.g. insertions or extended deletions).

FIG. 10: Mutagenesis frequency induced by TALEN in presence of scTrex2. The TALENs DMDT, HBBT and CAPT targeting the DMD, HBBT and CAPT_target DNA sequences, respectively, were tested for their ability to induce mutagenesis in presence or absence of the DNA processing enzyme scTrex2. The percentage of mutagenesis frequency induced by TALEN in presence (+) or absence (−) of scTrex2 was determined 3 days post-transfection by deep sequencing analysis of amplicons surrounding a specific target. *represents the significant difference (p<10−16) between the two conditions (with or without scTrex2).

FIG. 11: Mutagenesis frequency obtained in example 4 with co-delivery of TREX2 and I-sceI in protoplasts derived from a tobacco line with an intergrated I-sceI recognition site. YFP: yellow fluorescent protein (transformation control).

DETAILED DESCRIPTION OF THE INVENTION

Unless specifically defined herein, all technical and scientific terms used have the same meaning as commonly understood by a skilled artisan in the fields of gene therapy, biochemistry, genetics, and molecular biology.

All methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, with suitable methods and materials being described herein. All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, the present specification, including definitions, will prevail. Further, the materials, methods, and examples are illustrative only and are not intended to be limiting, unless otherwise specified.

The practice of the present invention will employ, unless otherwise indicated, conventional techniques of cell biology, cell culture, molecular biology, transgenic biology, microbiology, recombinant DNA, and immunology, which are within the skill of the art. Such techniques are explained fully in the literature. See, for example, Current Protocols in Molecular Biology (Frederick M. AUSUBEL, 2000, Wiley and son Inc, Library of Congress, USA); Molecular Cloning: A Laboratory Manual, Third Edition, (Sambrook et al, 2001, Cold Spring Harbor, N.Y.: Cold Spring Harbor Laboratory Press); Oligonucleotide Synthesis (M. J. Gait ed., 1984); Mullis et al. U.S. Pat. No. 4,683,195; Nucleic Acid Hybridization (B. D. Harries & S. J. Higgins eds. 1984); Transcription And Translation (B. D. Hames & S. J. Higgins eds. 1984); Culture Of Animal Cells (R. I. Freshney, Alan R. Liss, Inc., 1987); Immobilized Cells And Enzymes (IRL Press, 1986); B. Perbal, A Practical Guide To Molecular Cloning (1984); the series, Methods In ENZYMOLOGY (J. Abelson and M. Simon, eds.-in-chief, Academic Press, Inc., New York), specifically, Vols. 154 and 155 (Wu et al. eds.) and Vol. 185, “Gene Expression Technology” (D. Goeddel, ed.); Gene Transfer Vectors For Mammalian Cells (J. H. Miller and M. P. Calos eds., 1987, Cold Spring Harbor Laboratory); Immunochemical Methods In Cell And Molecular Biology (Mayer and Walker, eds., Academic Press, London, 1987); Handbook Of Experimental Immunology, Volumes I-IV (D. M. Weir and C. C. Blackwell, eds., 1986); and Manipulating the Mouse Embryo, (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1986).

According to a first aspect of the invention is a single-chain molecule of a dimeric exonuclease (scExo) to be co-transfected with a gene encoding a rare-cutting endonuclease. Such single-chain exonuclease, when expressed in a cell comprising a nucleic acid sequence encoding a rare-cutting endonuclease and including in ite genome a site recognized by said rare-cutting endonuclease, has been found to stimulate the frequency of induced NHEJ-based targeted mutagenesis at this site. Without being bound by theory, the exonuclease is believed to prevent scarless re-ligation of the site of interest recognized by the rare-cutting endonuclease thereby channeling more DSBs into an error-prone DSB repair pathway, but it could also act by other mechanisms (Dumitrache et al. 2011). Such scExo has generally a higher stimulatory effect than when the exonuclease is expressed under a dimeric form as reported in the prior art. Therefore, the co-expression of said scExo with said rare-cutting endonuclease represents a significant advantage when compared with models where a dimeric exonuclease is used, as described by Bennardo et al. (Bennardo et al, 2009).

In a preferred embodiment, said scExo is a polypeptide comprising:

    • (i) a first polypeptide sharing at least 80% similarity with the human TREX2 exonuclease protomer (SEQ ID NO: 26), a functional mutant, a variant or derivative thereof;
    • (ii) a second polypeptide sharing at least 80% similarity with the human TREX2 exonuclease protomer (SEQ ID NO: 26), a functional mutant, a variant or derivative thereof;
    • (iii) a peptidic linker connecting said first and second polypeptides

In a preferred embodiment, said scExo comprises a sequence selected from the group consisting of SEQ ID NO: 5-8.

In a preferred embodiment, said scExo is a single-chained version of the dimeric TREX2 exonuclease comprising:

    • (i) a first polypeptide sharing at least 80% similarity with the human TREX2 exonuclease protomer (SEQ ID NO: 26), a functional mutant, a variant or derivative thereof;
    • (ii) a peptidic linker;
    • (iii) a second polypeptide sharing at least 80% similarity with the human TREX2 exonuclease protomer (SEQ ID NO: 26), a functional mutant, a variant or derivative thereof;

According to a further embodiment of the invention said single-chain exonuclease as described above is fused with a rare-cutting endonuclease, in particular a meganuclease or a TALEN.

When said single-chain exonuclease is fused to a meganuclease, it can give rise to a polypeptide comprising:

    • (i) a first polypeptide sharing at least 80% similarity with the human TREX2 exonuclease protomer (SEQ ID NO: 26), a functional mutant, a variant or derivative thereof;
    • (ii) a second polypeptide sharing at least 80% similarity with the human TREX2 exonuclease protomer (SEQ ID NO: 26), a functional mutant, a variant or derivative thereof;
    • (iii) a peptidic linker connecting said first and second polypeptides
    • (iv) a third polypeptide sharing at least 80% similarity with a wild type LAGLIDADG meganuclease.

Said single chain exonuclease-meganuclease can include additional peptidic linkers to link the different polypeptides, especially between the exonuclease monomers.

Said wild type LAGLIDADG meganuclease can be selected, for instance, from the group consisting of I-SceI, I-ChuI, I-CreI, I-CsmI, PI-SceI, PI-TliI, PI-MtuI, I-CeuI, I-SceII, I-SceIII, HO, PI-CivI, PI-CtrI, PI-AaeI, PI-BsuI, PI-DhaI, PI-DraI, PI-MavI, PI-MchI, PI-MfuI, PI-MflI, PI-MgaI, PI-MgoI, PI-MinI, PI-MkaI, PI-MleI, PI-MmaI, PI-MshI, PI-MsmI, PI-MthI, PI-MtuI, PI-MxeI, PI-NpuI, PI-PfuI, PI-RmaI, PI-SpbI, PI-SspI, PI-FacI, PI-MjaI, PI-PhoI, PI-TagI, PI-ThyI, PI-TkoI, PI-TspI, I-MsoI; or can be a functional mutant or variant thereof, whether homodimeric, heterodimeric or monomeric. In a preferred embodiment, said LAGLIDADG meganuclease is a I-CreI derivative.

In a preferred embodiment, said LAGLIDADG meganuclease shares at least 80% similarity with the natural I-CreI LAGLIDADG meganuclease.

In a preferred embodiment, said LAGLIDADG meganuclease shares at least 80% similarity with residues 1-152 of the natural I-CreI LAGLIDADG meganuclease. Also the above third polypeptide may consists of two monomers sharing at least 80% similarity with residues 1-152 of the natural I-CreI LAGLIDADG meganuclease linked together, with or without a linker peptide.

In a preferred embodiment, said single-chain TREX2 exonuclease fused with a LAGLIDADG meganuclease comprises a sequence selected from the group consisting of SEQ ID NO: 56-59, a functional mutant, a variant or a derivative thereof.

In a second aspect the present invention relates to a method for increasing double-strand break-induced mutagenesis at a genomic locus of interest, leading to a loss of genetic information at said genomic locus of interest by NHEJ.

In a preferred embodiment, said method for increasing double-strand-break induced mutagenesis at a genomic locus of interest in a cell comprises the steps of:

    • (i) Identifying at said genomic locus of interest at least one DNA target sequence cleavable by one natural or engineered LAGLIDADG meganuclease;
    • (ii) Introducing said LAGLIDADG meganuclease into the cell together with a single-chained version of the dimeric TREX2 exonuclease;
      thereby obtaining a cell in which double-strand-break induced mutagenesis at said genomic locus of interest is increased.

In another preferred embodiment, said method for increasing double-strand-break induced mutagenesis at a genomic locus of interest in a cell comprises the steps of:

    • (i) Identifying at said genomic locus of interest at least one DNA target sequence cleavable by one natural or engineered LAGLIDADG meganuclease
    • (ii) Introducing said natural or engineered meganuclease fused with a single-chained version of the dimeric TREX2 exonuclease wherein said polypeptide recognizes said target DNA
      thereby obtaining a cell in which double-strand break-induced mutagenesis at said genomic locus of interest is increased.

In a third aspect, the present invention relates to a single-chain version of a dimeric exonuclease, which enhances the frequency of NHEJ based targeted mutagenesis induced by a rare-cutting endonuclease whose action on DNA liberates 3′-OH overhangs.

When said single-chain exonuclease is fused to a TALEN, it can give rise to a polypeptide comprising:

    • (i) a first polypeptide sharing at least 80% similarity with the human TREX2 exonuclease protomer (SEQ ID NO: 26), a functional mutant, a variant or derivative thereof;
    • (ii) a peptidic linker;
    • (iii) a second polypeptide sharing at least 80% similarity with the human TREX2 exonuclease protomer (SEQ ID NO: 26), a functional mutant, a variant or derivative thereof;
    • (iv) a peptidic linker;
    • (v) a third polypeptide sharing at least 80% similarity with a TALEN.

In a preferred embodiment, said single-chain TREX2 exonuclease is fused to the N-terminus of said rare-cutting endonuclease. In another preferred embodiment, said single-chain TREX2 exonuclease is fused to the C-terminus of said said rare-cutting endonuclease, especially when it is a LAGLIDADG meganuclease.

In another embodiment, said method for increasing double-strand-break induced mutagenesis at a genomic locus of interest in a cell comprises the steps of:

    • (i) identifying at said genomic locus of interest at least one DNA target sequence cleavable by one natural or engineered rare-cutting endonuclease;
    • (ii) introducing said natural or engineered rare-cutting endonuclease into the cell together with a single-chained version of the dimeric TREX2 exonuclease;
      thereby obtaining a cell in which double-strand-break induced mutagenesis at said genomic locus of interest is increased.

In a preferred embodiment, said method for increasing double-strand-break induced mutagenesis at a genomic locus of interest in a cell comprises the steps of:

    • (i) identifying at said genomic locus of interest at least one DNA target sequence cleavable by one TAL nuclease (TALEN);
    • (ii) introducing said TALEN into the cell together with a single-chained version of the dimeric TREX2 exonuclease;
      thereby obtaining a cell in which double-strand-break induced mutagenesis at said genomic locus of interest is increased.

As shown hereafter, the invention more particularly relates to the use of the single chain polypeptides and polynucleotides described above for performing targeted mutagenesis in plants, especially in tobacco. According to a preferred embodiment of this method, a plant expressible plasmid encoding a single chain of TREX2, such as that described previously, is co-transfected with at least one nucleic acid encoding a rare-cutting endonuclease into a protoplast. Preferably, TREX2 and the rare cutting endonucleases sequences are co-delivered on the same nucleic acid, and more preferably by expression of a single chain molecule. The single chain of Trex2 and the endonuclease are then co-expressed in the protoplast, such that NHEJ based targeted mutagenesis is induced as the result of the collaborative effect of TREX and the rare-cutting endonuclease.

Such a method has the advantage to create stable deletions into the gene sequence at the cleavage site of the rare cutting endonuclease, without necessarily involving selection markers or insertion of exogeneous DNA into the plant genome. The method is particularly useful for plants of the genus Arabidospis, Nicotiana, Solanum, lactuca, Brassica, Oryza, Asparagus, Pisum, Medicago, Zea, Hordeum, Secale, Triticum, Capsicum, Cucumis, Cucurbita, Citrullis, Citrus, Sorghum; More preferably, the plant is of the species Arabidospis thaliana, Nicotiana tabaccum, Solanum lycopersicum, Solanum tuberosum, Solanum melongena, Solanum esculentum, Lactuca saliva, Brassica napus, Brassica oleracea, Brassica rapa, Oryza glaberrima, Oryza sativa, Asparagus officinalis, Pisum sativum, Medicago sativa, zea mays, Hordeum vulgare, Secale cereal, Triticum aestivum, Triticum durum, Capsicum sativus, Cucurbita pepo, Citrullus lanatus, Cucumis melo, Citrus aurantifolia, Citrus maxima, Citrus medic and Citrus reticulata.

The present invention also relates to polynucleotides encoding the endonuclease proteins of the invention, specific vectors (polynucleotidic or not) encoding and/or vectorizing them, compositions and/or kits comprising them, all of them being used or part of a whole to implement methods of the present invention for increasing double-strand break-induced mutagenesis at a genomic locus of interest in a cell.

DEFINITIONS

    • Amino acid residues in a polypeptide sequence are designated herein according to the one-letter code, in which, for example, Q means a Gln or Glutamine residue, R means an Arg or Arginine residue and D means an Asp or Aspartic acid residue.
    • Amino acid substitution means the replacement of one amino acid residue with another, for instance the replacement of an Arginine residue with a Glutamine residue in a peptide sequence is an amino acid substitution.
    • Altered/enhanced/increased/improved activity, refers to an increase in the detected level of rare-cutting endonuclease activity against a target DNA sequence when said endonuclease is expressed together with a single-chain TREX2 exonuclease, or in fusion with a TREX2 exonuclease (see below), in comparison to the activity against the target DNA sequence of said rare-cutting endonuclease expressed alone.
    • Nucleotides are designated as follows: a one-letter code is used for designating the base of a nucleoside: a is adenine, t is thymine, c is cytosine, and g is guanine. For the degenerated nucleotides, r represents g or a (purine nucleotides), k represents g or t, s represents g or c, w represents a or t, m represents a or c, y represents t or c (pyrimidine nucleotides), d represents g, a or t, v represents g, a or c, b represents g, t or c, h represents a, t or c, and n represents g, a, t or c.
    • By “meganuclease” is intended an endonuclease having a double-stranded DNA target sequence of 12 to 45 bp. Said meganuclease is either a dimeric enzyme, wherein each meganuclease domain is on a monomer, or a monomeric enzyme comprising the two domains on a single polypeptide.
    • By “meganuclease domain” is intended the region that interacts with one half of the DNA target of a meganuclease and is able to associate with another domain of a meganuclease that interacts with the other half of the DNA target to form a functional meganuclease able to cleave said DNA target.
    • By “variant” it is intended a recombinant protein obtained by replacement of at least one residue in the amino acid sequence of the parent protein with a different amino acid.
    • By “LAGLIDADG meganuclease”, is intended a homing endonuclease from the LAGLIDADG family, as defined in Stoddard et al (Stoddard, 2005), or an engineered variant comprising a polypeptide sharing at least 80%, 85%, 90%, 95%, 97.5%, 99% or more identity or similarity with said natural homing endonuclease. Such engineered LAGLIDADG meganucleases can be derived from monomeric or dimeric meganucleases. When derived from dimeric meganucleases, such engineered LAGLIDADG meganucleases can be single-chain or dimeric endonucleases, as described in Grizot et al. (Grizot et al, 2009).
    • By “peptide linker”, “peptidic linker” or “peptide spacer” it is intended to mean a peptide sequence that allows the connection of different monomers in a fusion protein and the adoption of the correct conformation for said fusion protein activity and which does not alter the activity of either of the monomers. Peptide linkers can be of various sizes from 1, 2, 3, 4, 5, 10, 15, 20, 30, 40 to 50 amino acids as a non limiting indicative range or any intermediate value within this range.
    • By “related to”, particularly in the expression “one cell type related to the chosen cell type or organism”, is intended a cell type or an organism sharing characteristics with said chosen cell type or said chosen organism; this cell type or organism related to the chosen cell type or organism, can be derived from said chosen cell type or organism or not.
    • By “subdomain” it is intended the region of a LAGLIDADG homing endonuclease core domain that interacts with a distinct part of a DNA target half-site.
    • By “targeting DNA construct/minimal repair matrix/repair matrix” it is intended to mean a DNA construct comprising a first and second portions that are homologous to regions 5′ and 3′ of the DNA target in situ. The DNA construct also comprises a third portion positioned between the first and second portion which comprise some homology with the corresponding DNA sequence in situ or alternatively comprise no homology with the regions 5′ and 3′ of the DNA target in situ. Following cleavage of the DNA target, a homologous recombination event is stimulated between the genome containing the targeted gene comprised in the locus of interest and the repair matrix, wherein the genomic sequence containing the DNA target is replaced by the third portion of the repair matrix and a variable part of the first and second portions of the repair matrix.
    • By “functional variant”, as related to meganucleases, is intended a variant that is able to cleave a DNA target sequence, preferably said target is a new target that is not cleaved by the parent meganuclease. For example, such variants have amino acid variations at positions contacting the DNA target sequence or interacting directly or indirectly with said DNA target. As related to a generic protein scaffold having a particular function, for example an exonuclease, a “functional variant” is intended as a variant that is able to retain its primary activity (e.g. exonuclease) to a measureable extent but having changes (amino acid substitutions and/or truncations) elsewhere in the polypeptide.
    • By “selection” or “selecting” it is intended to mean the isolation of one or more meganuclease variants based upon an observed specified phenotype, for instance altered cleavage activity. This selection can be of the variant in a peptide form upon which the observation is made or alternatively the selection can be of a nucleotide coding for selected meganuclease variant.
    • By “screening” it is intended to mean the sequential or simultaneous selection of one or more meganuclease variant (s) that exhibits a specified phenotype such as altered cleavage activity.
    • By “derived from” it is intended to mean a protein variant that is created from a parent protein and hence the peptide sequence of the protein variant is related to (primary sequence level) but derived from (mutations) the peptide sequence of the parent protein.
    • By “I-CreI” is intended the natural wild-type I-CreI meganuclease having the sequence of pdb accession code 1g9y, corresponding to sequence SEQ ID NO: 35 in the sequence listing.
    • By “I-CreI variant with novel specificity” is intended a variant having a pattern of cleaved targets different from that of the parent meganuclease. The terms “novel specificity”, “modified specificity”, “novel cleavage specificity”, “novel substrate specificity” which are equivalent and used indifferently, refer to the specificity of the variant towards the nucleotides of the DNA target sequence. In the present patent application the I-CreI variants described can comprise an additional alanine after the first methionine of the wild-type I-CreI sequence as shown in SEQ ID NO: 36. These variants also comprise two additional alanine residues and an aspartic acid residue after the final proline of the wild-type I-CreI sequence. These additional residues do not affect the properties of the enzyme and to avoid confusion these additional residues do not affect the numeration of the residues in I-CreI or a variant referred in the present patent application, as these references exclusively refer to residues of the wild type I-CreI enzyme (SEQ ID NO: 35) as present in the variant, so for instance residue 2 of I-CreI is in fact residue 3 of a variant which comprises an additional alanine after the first methionine.
    • By “I-CreI site” is intended a 22 to 24 base pair double-stranded DNA sequence that is cleaved by I-CreI. I-CreI sites include the wild-type non-palindromic I-CreI homing site and the derived palindromic sequences such as the sequence 5′-t−12c−11a−10a−9a−8a−7c−6g−5t−4−c−3g−2t−1a+1c+2g+3a+4c+5g+6t+7t+8t+9t+10g+11a+12 (SEQ ID NO: 37), also called C1221.
    • By “domain” or “core domain” is intended the “LAGLIDADG homing endonuclease core domain”, which is the characteristic αββα62 βα fold of the homing endonucleases of the LAGLIDADG family, corresponding to a sequence of about one hundred amino acid residues. Said domain comprises four beta-strands (β1β2β3β4) folded in an anti-parallel beta-sheet that interacts with one half of the DNA target. This domain is able to associate with another LAGLIDADG homing endonuclease core domain that interacts with the other half of the DNA target to form a functional endonuclease able to cleave said DNA target. For example, in the case of the homodimeric homing endonuclease I-CreI (163 amino acids), the LAGLIDADG homing endonuclease core domain corresponds to the residues 6 to 94.
    • By “subdomain” is intended the region of a LAGLIDADG homing endonuclease core domain that interacts with a distinct part of a homing endonuclease DNA target half-site.
    • By “DNA target”, “DNA target sequence”, “target sequence”, “target-site”, “target”, “site”, “site of interest”, “recognition site”, “polynucleotide recognition site”, “recognition sequence”, “homing recognition site”, “homing site”, “cleavage site” is intended a 20 to 24 bp double-stranded palindromic, partially palindromic (pseudo-palindromic) or non-palindromic polynucleotide sequence that is recognized and cleaved by a LAGLIDADG homing endonuclease such as I-CreI, or a variant, or a single-chain chimeric meganuclease derived from I-CreI. Said DNA target sequence is qualified of “cleavable” by an endonuclease, when recognized within a genomic sequence and known to correspond to the DNA target sequence of a given endonuclease or a variant of such endonuclease. These terms refer to a distinct DNA location, preferably a genomic location, at which a double-strand break (cleavage) is to be induced by the meganuclease. The DNA target is defined by the 5′ to 3′ sequence of one strand of the double-stranded polynucleotide, as indicate above for C1221. Cleavage of the DNA target occurs at nucleotides at positions +2 and −2, respectively for the sense and the antisense strand. Unless otherwise indicated, the position at which cleavage of the DNA target by an I-CreI meganuclease variant occurs, corresponds to the cleavage site on the sense strand of the DNA target. For a rare-cutting endonuclease such as a TALEN, or a rare-cutting endonuclease derived from a TALEN, in a functional layout of a FokI-based TALEN, a “DNA target”, “DNA target sequence”, “target DNA sequence”, “nucleic acid target sequence”, “target sequence”, or “processing site” requires two DNA recognition regions flanking an unspecific central region, i.e. the spacer.
    • By spacer is meant the nucleic acid area that separates the two nucleic acid sequences recognized and bound by each monomer constituting a rare-cutting endonuclease such as a TALEN according to the invention. By spacer length is meant the nucleic acid distance that separates the two nucleic acid sequences recognized and bound by each monomer constituting the rare-cutting endonuclease according to the invention.
    • By “DNA target half-site”, “half cleavage site” or half-site” is intended the portion of the DNA target which is bound by each LAGLIDADG homing endonuclease core domain.
    • By “chimeric DNA target” or “hybrid DNA target” is intended the fusion of different halves of two parent meganuclease target sequences. In addition at least one half of said target may comprise the combination of nucleotides which are bound by at least two separate subdomains (combined DNA target).
    • The term “endonuclease” refers to any wild-type or variant enzyme capable of catalyzing the hydrolysis (cleavage) of bonds between nucleic acids within a DNA or RNA molecule, preferably a DNA molecule. Endonucleases do not cleave the DNA or RNA molecule irrespective of its sequence, but recognize and cleave the DNA or RNA molecule at specific polynucleotide sequences, further referred to as “target sequences” or “target sites”. Endonucleases can be classified as rare-cutting endonucleases when having typically a polynucleotide recognition site greater than 12 base pairs (bp) in length, more preferably of 14-55 bp. Rare-cutting endonucleases significantly increase HR by inducing DNA double-strand breaks (DSBs) at a defined locus (Choulika et al, 1995; Pingoud & Silva, 2007; Rouet et al, 1994a; Rouet et al, 1994b). Rare-cutting endonucleases can for example be a homing endonuclease (Paques & Duchateau, 2007b), a chimeric Zinc-Finger nuclease (ZFN) resulting from the fusion of engineered zinc-finger domains with the catalytic domain of a restriction enzyme such as FokI (Porteus & Carroll, 2005) or a chemical endonuclease (Arimondo et al, 2006; Eisenschmidt et al, 2005). In chemical endonucleases, a chemical or peptidic cleaver is conjugated either to a polymer of nucleic acids or to another DNA recognizing a specific target sequence, thereby targeting the cleavage activity to a specific sequence. Chemical endonucleases also encompass synthetic nucleases like conjugates of orthophenanthroline, a DNA cleaving molecule, and triplex-forming oligonucleotides (TFOs), known to bind specific DNA sequences (Kalish & Glazer, 2005). Such chemical endonucleases are comprised in the term “endonuclease” according to the present invention.

Rare-cutting endonucleases can also be for example TALENs, a new class of chimeric nucleases using a FokI catalytic domain and a DNA binding domain derived from Transcription Activator Like Effector (TALE), a family of proteins used in the infection process by plant pathogens of the Xanthomonas genus (Boch et al, 2009; Christian et al, 2010; Li et al, 2010; Moscou & Bogdanove, 2009). The functional layout of a FokI-based TALE-nuclease (TALEN) is essentially that of a ZFN, with the Zinc-finger DNA binding domain being replaced by the TALE domain. As such, DNA cleavage by a TALEN requires two DNA recognition regions flanking an unspecific central region. Rare-cutting endonucleases encompassed in the present invention can also be derived from TALENs.

Rare-cutting endonuclease can be a homing endonuclease, also known under the name of meganuclease. Such homing endonucleases are well-known to the art (Stoddard, 2005). Homing endonucleases recognize a DNA target sequence and generate a single- or double-strand break. Homing endonucleases are highly specific, recognizing DNA target sites ranging from 12 to 45 base pairs (bp) in length, usually ranging from 14 to 40 bp in length. The homing endonuclease according to the invention may for example correspond to a LAGLIDADG endonuclease, to a HNH endonuclease, or to a GIY-YIG endonuclease.

In the wild, meganucleases are essentially represented by homing endonucleases. Homing Endonucleases (HEs) are a widespread family of natural meganucleases including hundreds of proteins families (Chevalier & Stoddard, 2001). These proteins are encoded by mobile genetic elements that propagate by a process called “homing”: the endonuclease cleaves a cognate allele from which the mobile element is absent, thereby stimulating a homologous recombination event that duplicates the mobile DNA into the recipient locus. Given their exceptional cleavage properties in terms of efficacy and specificity, they could represent ideal scaffolds to derive novel, highly specific endonucleases.

HEs belong to five major families. The LAGLIDADG family, named after a conserved sequence motif involved in the catalytic center, is the most widespread and the best characterized group. Several structures are now available. Whereas most proteins from this family are monomeric and display two LAGLIDADG motifs, a few have only one motif, and thus dimerize to cleave palindromic or pseudo-palindromic target sequences.

Although the LAGLIDADG motif is the only conserved region among members of the family, these proteins share a very similar architecture. The catalytic core is flanked by two DNA-binding domains with a perfect two-fold symmetry for homodimers such as I-CreI (Chevalier et al, 2001), I-MsoI (Chevalier et al, 2003) and I-CeuI (Spiegel et al, 2006) and with a pseudo symmetry for monomers such as I-SceI (Moure et al, 2003), I-DmoI (Silva et al, 1999) or I-AniI (Bolduc et al, 2003). Both monomers and both domains (for monomeric proteins) contribute to the catalytic core, organized around divalent cations. Just above the catalytic core, the two LAGLIDADG peptides also play an essential role in the dimerization interface. DNA binding depends on two typical saddle-shaped αββαββα folds, positioned in the DNA major groove. Other domains can be found, for example in inteins such as PI-PfuI (Ichiyanagi et al, 2000) and PI-SceI (Moure et al, 2002), whose protein splicing domain is also involved in DNA binding.

The making of functional chimeric meganucleases, by fusing the N-terminal I-DmoI domain with an I-CreI monomer (Chevalier et al, 2002; Epinat et al, 2003); International PCT Application WO 03/078619 (Cellectis) and WO 2004/031346 (Fred Hutchinson Cancer Research Center, Stoddard et al)) have demonstrated the plasticity of LAGLIDADG proteins.

Different groups have also used a semi-rational approach to locally alter the specificity of the I-CreI (Seligman et al, 1997; Sussman et al, 2004); International PCT Applications WO 2006/097784, WO 2006/097853, WO 2007/060495 and WO 2007/049156 (Cellectis); (Arnould et al, 2006a; Rosen et al, 2006; Smith et al, 2006), I-SceI (Doyon et al, 2006), PI-SceI (Gimble et al, 2003) and I-MsoI (Ashworth et al, 2006).

In addition, hundreds of I-CreI derivatives with locally altered specificity were engineered by combining the semi-rational approach and High Throughput Screening.

    • Residues Q44, R68 and R70 or Q44, R68, D75 and 177 of I-CreI were mutagenized and a collection of variants with altered specificity towards positions ±3 to 5 of the DNA target (5NNN DNA target) were identified by screening (International PCT Applications WO 2006/097784 and WO 2006/097853 (Cellectis); (Arnould et al, 2006a; Smith et al, 2006).
    • Residues K28, N30 and Q38 or N30, Y33 and Q38 or K28, Y33, Q38 and S40 of I-CreI were mutagenized and a collection of variants with altered specificity towards positions ±8 to 10 of the DNA target (10NNN DNA target) were identified by screening (Arnould et al, 2006a; Smith et al, 2006); International PCT Applications WO 2007/060495 and WO 2007/049156 (Cellectis)).

Two different variants were combined and assembled in a functional heterodimeric endonuclease able to cleave a chimeric target resulting from the fusion of two different halves of each variant DNA target sequence ((Arnould et al, 2006a; Smith et al, 2006); International PCT Applications WO 2006/097854 and WO 2007/034262).

Furthermore, residues 28 to 40 and 44 to 77 of I-CreI were shown to form two partially separable functional clusters, able to bind distinct parts of a homing endonuclease target half-site (Smith et al, 2006); International PCT Applications WO 2007/049095 and WO 2007/057781 (Cellectis)).

The combination of mutations from the two clusters of I-CreI within the same monomer allowed the design of novel chimeric molecules (homodimers) able to cleave a palindromic combined DNA target sequence comprising the nucleotides at positions ±3 to 5 and ±8 to 10 which are bound by each cluster ((Smith et al, 2006); International PCT Applications WO 2007/049095 and WO 2007/057781 (Cellectis)).

The method for producing meganuclease variants and the assays based on cleavage-induced recombination in mammal or yeast cells, which are used for screening variants with altered specificity are described in the International PCT Application WO 2004/067736; (Arnould et al, 2006a; Chames et al, 2005; Epinat et al, 2003). These assays result in a functional LacZ reporter gene which can be monitored by standard methods.

The combination of the two former steps allows a larger combinatorial approach, involving four different clusters. The different clusters can be modified separately and combined to obtain an entirely redesigned meganuclease variant (heterodimer or single-chain molecule) with chosen specificity. In a first step, couples of novel meganucleases are combined in new molecules (“half-meganucleases”) cleaving palindromic targets derived from the target one wants to cleave. Then, the combination of such “half-meganucleases” can result in a heterodimeric species cleaving the target of interest. The assembly of four sets of mutations into heterodimeric endonucleases cleaving a model target sequence or a sequence from different genes has been described in the following Cellectis International patent applications: XPC gene (WO2007/093918), RAG gene (WO2008/010093), HPRT gene (WO2008/059382), beta-2 microglobulin gene (WO2008/102274), Rosa26 gene (WO2008/152523), Human hemoglobin beta gene (WO2009/13622) and Human interleukin-2 receptor gamma chain gene (WO2009019614).

These variants can be used to cleave genuine chromosomal sequences and have paved the way for novel perspectives in several fields, including gene therapy.

A homing endonuclease can be a LAGLIDADG endonuclease such as I-SceI, I-CreI, I-CeuI, I-MsoI, and I-DmoI.

Said LAGLIDADG endonuclease can be I-SceI, a member of the family that contains two LAGLIDADG motifs and functions as a monomer, its molecular mass being approximately twice the mass of other family members like I-CreI which contains only one LAGLIDADG motif and functions as homodimers.

Endonucleases mentioned in the present application encompass both wild-type (naturally-occurring) and variant endonucleases. Endonucleases according to the invention can be a “variant” endonuclease, i.e. an endonuclease that does not naturally exist in nature and that is obtained by genetic engineering or by random mutagenesis, i.e. an engineered endonuclease. This variant endonuclease can for example be obtained by substitution of at least one residue in the amino acid sequence of a wild-type, naturally-occurring, endonuclease with a different amino acid. Said substitution(s) can for example be introduced by site-directed mutagenesis and/or by random mutagenesis. In the frame of the present invention, such variant endonucleases remain functional, i.e. they retain the capacity of recognizing and specifically cleaving a target sequence to initiate gene targeting process.

The variant endonuclease according to the invention cleaves a target sequence that is different from the target sequence of the corresponding wild-type endonuclease. Methods for obtaining such variant endonucleases with novel specificities are well-known in the art.

Endonucleases variants may be homodimers (meganuclease comprising two identical monomers) or heterodimers (meganuclease comprising two non-identical monomers).

Endonuclease variants may also be single-chain meganucleases. Such single-chain meganucleases may be derivatives of natural monomeric LAGLIDADG homing endonucleases or derivatives of dimeric LAGLIDADG homing endonucleases.

In this last case, the single-chain meganuclease comprises

    • (i) two LAGLIDADG homing endonuclease domains (containing at least a single LAGLIDADG motif each) linked by a peptidic linker, or
    • (ii) two polypeptides, each one sharing at least 80%, 90%, 95%, 99% or more similarity with a LAGLIDADG homing endonuclease domain, and linked by a peptidic linker.

The single-chain meganuclease is able to cleave a chimeric DNA target sequence comprising one different half of each parent meganuclease target sequence.

Endonucleases with novel specificities can be used in the method according to the present invention for gene targeting and thereby integrating a transgene of interest into a genome at a predetermined location.

    • By “delivery vector” or “delivery vectors” is intended any vector that can be used in the present invention to put into cell contact or delivered inside cells or subcellular compartments agents/chemicals and molecules (proteins or nucleic acids) needed in the present invention. It includes, but is not limited to liposomal delivery vectors, viral delivery vectors, drug delivery vectors, chemical carriers, polymeric carriers, lipoplexes, polyplexes, dendrimers, microbubbles (ultrasound contrast agents), nanoparticles, emulsions or other appropriate transfer vectors. These delivery vectors allow delivery of molecules, chemicals, macromolecules (genes, proteins), or other vectors such as plasmids, peptides developed by Diatos. In these cases, delivery vectors are molecule carriers. By “delivery vector” or “delivery vectors” is also intended delivery methods to perform transfection
    • The terms “vector” or “vectors” refer to a nucleic acid molecule capable of transporting another nucleic acid to which it has been linked. A “vector” in the present invention includes, but is not limited to, a viral vector, a plasmid, a RNA vector or a linear or circular DNA or RNA molecule which may consists of a chromosomal, non chromosomal, semi-synthetic or synthetic nucleic acids. Preferred vectors are those capable of autonomous replication (episomal vector) and/or expression of nucleic acids to which they are linked (expression vectors). Large numbers of suitable vectors are known to those of skill in the art and commercially available.

Viral vectors include retrovirus, adenovirus, parvovirus (e.g. adeno-associated viruses), coronavirus, negative strand RNA viruses such as orthomyxovirus (e.g., influenza virus), rhabdovirus (e.g., rabies and vesicular stomatitis virus), paramyxovirus (e.g. measles and Sendai), positive strand RNA viruses such as picornavirus and alphavirus, and double-stranded DNA viruses including adenovirus, herpesvirus (e.g., Herpes Simplex virus types 1 and 2, Epstein-Barr virus, cytomegalovirus), and poxvirus (e.g., vaccinia, fowlpox and canarypox). Other viruses for example include Norwalk virus, togavirus, flavivirus, reoviruses, papovavirus, hepadnavirus, and hepatitis virus. Examples of retroviruses include: avian leukosis-sarcoma, mammalian C-type, B-type viruses, D type viruses, HTLV-BLV group, lentivirus, spumavirus (Coffin, J. M., Retroviridae: The viruses and their replication, In Fundamental Virology, Third Edition, B. N. Fields, et al., Eds., Lippincott-Raven Publishers, Philadelphia, 1996).

By “lentiviral vector” is meant HIV-Based lentiviral vectors that are very promising for gene delivery because of their relatively large packaging capacity, reduced immunogenicity and their ability to stably transduce with high efficiency a large range of different cell types. Lentiviral vectors are usually generated following transient transfection of three (packaging, envelope and transfer) or more plasmids into producer cells. Like HIV, lentiviral vectors enter the target cell through the interaction of viral surface glycoproteins with receptors on the cell surface. On entry, the viral RNA undergoes reverse transcription, which is mediated by the viral reverse transcriptase complex. The product of reverse transcription is linear double-strand viral DNA, which is the substrate for viral integration in the DNA of infected cells.

    • By “integrative lentiviral vectors (or LV)”, is meant such vectors, as non limiting example, that are able to integrate into the genome of a target cell.
    • By “non integrative lentiviral vectors (or NILV)” is meant efficient gene delivery vectors that do not integrate into the genome of a target cell through the action of the virus integrase.

One type of preferred vector is an episome, i.e., a nucleic acid capable of extra-chromosomal replication. Preferred vectors are those capable of autonomous replication and/or expression of nucleic acids to which they are linked. Vectors capable of directing the expression of genes to which they are operatively linked are referred to herein as “expression vectors”. A vector according to the present invention comprises, but is not limited to, a YAC (yeast artificial chromosome), a BAC (bacterial artificial), a baculovirus vector, a phage, a phagemid, a cosmid, a viral vector, a plasmid, a RNA vector or a linear or circular DNA or RNA molecule which may consist of chromosomal, non chromosomal, semi-synthetic or synthetic DNA. In general, expression vectors of utility in recombinant DNA techniques are often in the form of “plasmids” which refer generally to circular double stranded DNA loops which, in their vector form are not bound to the chromosome. Large numbers of suitable vectors are known to those of skill in the art. Vectors can comprise selectable markers, for example: neomycin phosphotransferase, histidinol dehydrogenase, dihydrofolate reductase, hygromycin phosphotransferase, herpes simplex virus thymidine kinase, adenosine deaminase, glutamine synthetase, and hypoxanthine-guanine phosphoribosyl transferase for eukaryotic cell culture; TRP1 for S. cerevisiae; tetracyclin, rifampicin or ampicillin resistance in E. coli. Preferably said vectors are expression vectors, wherein a sequence encoding a polypeptide of interest is placed under control of appropriate transcriptional and translational control elements to permit production or synthesis of said polypeptide. Therefore, said polynucleotide is comprised in an expression cassette. More particularly, the vector comprises a replication origin, a promoter operatively linked to said encoding polynucleotide, a ribosome binding site, a RNA-splicing site (when genomic DNA is used), a polyadenylation site and a transcription termination site. It also can comprise enhancer or silencer elements. Selection of the promoter will depend upon the cell in which the polypeptide is expressed. Suitable promoters include tissue specific and/or inducible promoters. Examples of inducible promoters are: eukaryotic metallothionine promoter which is induced by increased levels of heavy metals, prokaryotic lacZ promoter which is induced in response to isopropyl-□-D-thiogalacto-pyranoside (IPTG) and eukaryotic heat shock promoter which is induced by increased temperature. Examples of tissue specific promoters are skeletal muscle creatine kinase, prostate-specific antigen (PSA), α-antitrypsin protease, human surfactant (SP) A and B proteins, β-casein and acidic whey protein genes.

    • Inducible promoters may be induced by pathogens or stress, more preferably by stress like cold, heat, UV light, or high ionic concentrations (reviewed in Potenza C et al. 2004, In vitro Cell Dev Biol 40:1-22). Inducible promoter may be induced by chemicals (reviewed in (Moore et al, 2006); (Padidam, 2003); (Wang et al, 2003); (Zuo & Chua, 2000).

Delivery vectors and vectors can be associated or combined with any cellular permeabilization techniques such as sonoporation or electroporation or derivatives of these techniques.

    • By cell or cells is intended any prokaryotic or eukaryotic living cells, cell lines derived from these organisms for in vitro cultures, primary cells from animal or plant origin.
    • By “primary cell” or “primary cells” are intended cells taken directly from living tissue (i.e. biopsy material) and established for growth in vitro, that have undergone very few population doublings and are therefore more representative of the main functional components and characteristics of tissues from which they are derived from, in comparison to continuous tumorigenic or artificially immortalized cell lines. These cells thus represent a more valuable model to the in vivo state they refer to.
    • In the frame of the present invention, “eukaryotic cells” refer to a fungal, plant or animal cell or a cell line derived from the organisms listed below and established for in vitro culture. More preferably, the fungus is of the genus Aspergillus, Penicillium, Acremonium, Trichoderma, Chrysoporium, Mortierella, Kluyveromyces or Pichia; More preferably, the fungus is of the species Aspergillus niger, Aspergillus nidulans, Aspergillus oryzae, Aspergillus terreus, Penicillium chrysogenum, Penicillium citrinum, Acremonium Chrysogenum, Trichoderma reesei, Mortierella alpine, Chrysosporium lucknowense, Kluyveromyces lactis, Pichia pastoris or Pichia ciferrii.

More preferably the plant is of the genus Arabidospis, Nicotiana, Solanum, lactuca, Brassica, Oryza, Asparagus, Pisum, Medicago, Zea, Hordeum, Secale, Triticum, Capsicum, Cucumis, Cucurbita, Citrullis, Citrus, Sorghum; More preferably, the plant is of the species Arabidospis thaliana, Nicotiana tabaccum, Solanum lycopersicum, Solanum tuberosum, Solanum melongena, Solanum esculentum, Lactuca saliva, Brassica napus, Brassica oleracea, Brassica rapa, Oryza glaberrima, Oryza sativa, Asparagus officinalis, Pisum sativum, Medicago sativa, zea mays, Hordeum vulgare, Secale cereal, Triticum aestivum, Triticum durum, Capsicum sativus, Cucurbita pepo, Citrullus lanatus, Cucumis melo, Citrus aurantifolia, Citrus maxima, Citrus medica, Citrus reticulata.

More preferably the animal cell is of the genus Homo, Rattus, Mus, Sus, Bos, Danio, Canis, Felis, Equus, Salmo, Oncorhynchus, Gallus, Meleagris, Drosophila, Caenorhabditis; more preferably, the animal cell is of the species Homo sapiens, Rattus norvegicus, Mus musculus, Sus scrofa, Bos taurus, Danio rerio, Canis lupus, Felis catus, Equus caballus, Salmo salar, Oncorhynchus mykiss, Gallus gallus, Meleagris gallopavo, Drosophila melanogaster, Caenorhabditis elegans.

    • by “homologous” is intended a sequence with enough identity to each other to lead to homologous recombination between sequences, more particularly having at least 95% identity, preferably at least 97% identity and more preferably at least 99% identity.
    • “Identity” refers to sequence identity between two nucleic acid molecules or polypeptides. Identity can be determined by comparing a position in each sequence which may be aligned for purposes of comparison. When a position in the compared sequence is occupied by the same residue, then the molecules are identical at that position. A degree of similarity or identity between nucleic acid or amino acid sequences is a function of the number of identical or matching nucleotides at positions shared by the nucleic acid sequences. Various alignment algorithms and/or programs may be used to calculate the identity between two sequences, including FASTA, or BLAST which are available as a part of the GCG sequence analysis package (University of Wisconsin, Madison, Wis.), and can be used with, e.g., default setting. When it is mentioned in the present disclosure that a polynucleotide or polypeptide shares at least 80% identity, it means that these generally share at least 90%, preferably at least 95%, more preferably at least 97%, even more preferably 99% identity with the reference indicated sequence.
    • by “mutation” is intended the substitution, deletion, insertion of one, two, three, four five, six, seven, eight, nine, ten, fifteen, twenty, thirty or more nucleotides or amino acids in a polynucleotide (cDNA, gene) or a polypeptide sequence, respectively. Said mutation can affect the coding sequence of a gene or its regulatory sequence. It may also affect the structure of the genomic sequence or the structure/stability of the encoded mRNA.
    • In the frame of the present invention, the expression “double-strand break induced mutagenesis” (DSB-induced mutagenesis) refers to a mutagenesis event consecutive to an NHEJ event following an endonuclease-induced DSB, leading to insertion/deletion at the cleavage site of an endonuclease.
    • By “gene” is meant the basic unit of heredity, consisting of a segment of DNA arranged in a linear manner along a chromosome, which codes for a specific protein or segment of protein. A gene typically includes a promoter, a 5′ untranslated region, one or more coding sequences (exons), optionally introns, a 3′ untranslated region. The gene may further comprise a terminator, enhancers and/or silencers.
    • As used herein, the term “transgene” refers to a DNA sequence introduced into a cell of interest, tissue or individual. When inserted, said transgene could be used for generating RNA and/or a polypeptide. Most preferably, the transgene encodes a therapeutic polypeptide useful for the treatment of an individual.
    • The term “gene of interest” or “GOI” refers to any nucleotide sequence encoding a known or putative gene product.
    • As used herein, the term “locus” is the specific physical location of a DNA sequence (e.g., of a gene) on a chromosome. The term “locus” usually refers to the specific physical location of an endonuclease's target sequence on a chromosome. Such a locus, which comprises a target sequence that is recognized and cleaved by an endonuclease according to the invention, is referred to as “locus according to the invention”. Also, the expression “genomic locus of interest” is used to qualify a nucleic acid sequence in a genome that can be a putative target for a double-strand break according to the invention. By “endogenous genomic locus of interest” is intended a native nucleic acid sequence in a genome, i.e. a sequence or allelic variations of this sequence that is naturally present at this genomic locus. It is understood that the considered genomic locus of interest of the present invention can be between two overlapping genes the considered endonuclease's target sequences are located in two different genes.
    • By the expression “loss of genetic information” is understood the elimination or addition of at least one given DNA fragment (at least one nucleotide) or sequence, bordering the recognition sites of the endonucleases of the present invention and leading to a change of the original sequence around said endonuclease-cut sites, within the genomic locus of interest. This loss of genetic information can be, as a non-limiting example, the elimination of an intervening sequence between two endonuclease-cut sites; it can also be, in another non-limiting example, the result of an exonuclease DNA-ends processing activity after a unique endonuclease DNA double-strand break. In this last case, loss of genetic information within the genomic locus of interest is generated “around said DNA target sequence”, i.e. around the endonuclease-cut site (DSB), taken as reference. It can also be, in other non-limiting examples, the result of DNA-ends processing activities by other enzymes, after a unique endonuclease DNA double-strand break, such as polymerase activity (TdT . . . ), dephosphatase activity . . . .
    • By “scarless re-ligation” is intended the perfect re-ligation event, without loss of genetic information (no insertion/deletion events) of the DNA broken ends through NHEJ process after the creation of a double-strand break event.
    • By “fusion protein” is intended the result of a well-known process in the art consisting in the joining of two or more genes that originally encode separate proteins, the translation of said “fusion gene” resulting in a single polypeptide with functional properties derived from each of the original proteins.

The above written description of the invention provides a manner and process of making and using it such that any person skilled in this art is enabled to make and use the same, this enablement being provided in particular for the subject matter of the appended claims, which make up a part of the original description.

As used above, the phrases “selected from the group consisting of,” “chosen from,” and the like include mixtures of the specified materials.

Where a numerical limit or range is stated herein, the endpoints are included. Also, all values and subranges within a numerical limit or range are specifically included as if explicitly written out.

The above description is presented to enable a person skilled in the art to make and use the invention, and is provided in the context of a particular application and its requirements. Various modifications to the preferred embodiments will be readily apparent to those skilled in the art, and the generic principles defined herein may be applied to other embodiments and applications without departing from the spirit and scope of the invention. Thus, this invention is not intended to be limited to the embodiments shown, but is to be accorded the widest scope consistent with the principles and features disclosed herein.

Having generally described this invention, a further understanding can be obtained by reference to certain specific examples, which are provided herein for purposes of illustration only, and are not intended to be limiting unless otherwise specified.

EXAMPLES

Example 1

Effect of Single-Chain TREX2 (scTrex) Molecules on the Meganuclease-Induced Mutagenesis

Human TREX2 protein (SEQ ID NO: 26) is known to function as a homodimer (Perrino, de Silva et al., 2008). We hypothetized that the creation of a TREX2 single-chain molecule can enhance the exonucleolytic activity. Four single-chain TREX2 molecules were designed and tested in co-expression experiments with an engineered meganuclease to evaluate their effect on meganuclease-induced mutagenesis. A set of four linkers (Link1 to Link4) consisting of 8, 11, 12 and 14 amino acids (SEQ ID NO: 1 to 4) were designed to create a bridge between the C-terminal alanine of one TREX2 molecule and the serine located at the N-terminus of the second TREX2 molecule of the homodimer. This creates a single-chain protein with a molecular weight of 53 kDa. Residues were chosen to create a flexible linker to tether the homodimer, without being restrictive. The four single-chain TREX2 (scTrex) molecular constructions were named scTrex1 to scTrex4 (SEQ ID NO: 5 to 8).

Co-Transfection of Single-Chain TREX2 (scTrex) with Meganucleases

Stimulation of mutagenesis induced by scTrex has been compared to stimulation of mutagenesis induced by wild-type TREX2 when co-transfected with a single-chain meganuclease (SC-MN). Plasmids encoding scTrex1 to scTrex4 (SEQ ID NO: 9 to 12), respectively, and the plasmid encoding SC_GS meganuclease (pCLS2690, SEQ ID NO: 13) were co-transfected into the cellular model described below and established to monitor SC_GS-induced mutagenesis.

Material and Methods

a) Cellular Model to Monitor Meganuclease-Induced Mutagenesis

The plasmid pCLS6810 (SEQ ID NO: 25) was designed to quantify the NHEJ repair frequency induced by the SC_GS meganuclease (pCLS2690, SEQ ID NO: 13). The SC_GS meganuclease is a single-chain protein where two I-CreI variants have been fused. It recognizes a 22 bp DNA sequence (5′-TGCCCCAGGGTGAGAAAGTCCA-3′: GS_CHO.1 target, SEQ ID NO: 32) located in the first exon of Cricetulus griseus glutamine synthetase gene. The sequence used to measure SC_GS-induced mutagenesis is made of an ATG start codon followed by (i) 2 codons for alanine; (ii) an HA-tag sequence; (iii) the SC_GS recognition site; (iv) a stretch of glycine-serine di-residues; (v) an additional 2 codons for alanine as in (i), and finally; (vi) a GFP reporter gene lacking its ATG start codon. The GFP reporter gene is inactive due to a frame-shift introduced by the GS recognition site. The creation of a DNA double-strand break (DSB) by the SC_GS meganuclease followed by error-prone NHEJ events can lead to restoration of the GFP gene expression in frame with the ATG start codon. The final construct was introduced at the RAG1 locus in 293H cell line using the hsRAG1 Integration Matrix CMV Neo from cGPS® Custom Human Full Kit DD (Cellectis Bioresearch) following the provider's instructions. Using this kit, a stable cell line containing a single copy of the transgene at the RAG1 locus was obtained. Thus, after transfection of this cell line by SC_GS meganuclease expressing plasmid with or without a plasmid encoding scTrex1-4 (SEQ ID NO: 5 to 8) or encoding TREX2 taken as a control (pCLS7673, SEQ ID NO: 14), the percentage of GFP-positive cells is directly correlated to the mutagenic NHEJ repair frequency induced by the transfected molecular entity/ies.

b) Transfection in a Cellular Model Monitoring Meganuclease-Induced Mutagenesis

Cells (˜106), seeded one day prior to transfection, were co-transfected with 1 μg of SC_GS encoding vector (pCLS2690, SEQ ID NO: 13) and either 0, 2.8, 5.6 or 10 μg of plasmid encoding scTrex1-4 (SEQ ID NO: 9 to 12) or control plasmid encoding TREX2 (pCLS7673 SEQ ID NO: 14) using 25 μl of lipofectamine (Invitrogen) according to the manufacturer's instructions. Total DNA transfected was adjusted to 11 μg with a pUC vector (pCLS0002, SEQ ID NO: 31). Four days post transfection, cells were harvested for flow cytometry analysis using a Guava system (Millipore). Genomic DNA was extracted from transfected cell populations and locus specific PCRs were performed using the following primers: 5′-CCATCTCATCCCTGCGTGTCTCCGACTCAG (forward adaptor sequence)-10N-(sequences needed for PCR product identification)-GCTCTCTGGCTAACTAGAGAACCC (transgenic locus specific forward sequence)-3′ (SEQ ID NO: 33) and 5′-CCTATCCCCTGTGTGCCTTGGCAGTCTCAG-(reverse adaptor sequence)-TCGATCAGCACGGGCACGATGCC (transgenic locus specific reverse sequence) (SEQ ID NO: 34). PCR products were sequenced by a 454 sequencing system (454 Life Sciences). Approximately 10,000 sequences were obtained per PCR product and then analyzed for the presence of site-specific insertion or deletion events.

c) Making of Single Chain TREX2 (scTrex) Molecules

Making single-chain molecules, where two identical proteins are fused, is a difficult task as any gene amplification would result in the amplification of only one monomer. To bypass this difficulty, we developed an original strategy. Briefly, the TREX2 protein cloned into the mammalian expression vector (pCLS7673, SEQ ID NO: 14) was taken as a template and the unique PstI restriction site covering amino acids 101 (leucine) and 102 (glutamine) of the TREX2 protein was considered. For each single-chain construct, two independent PCRs were carried out using the either primers TrexPstFor/TrexLinkiRev (where “i” varies from 1 to 4) or primers TrexLinkiFor (where “i” varies from 1 to 4) and TrexPstRev. The two PCR fragments were then purified after migration on an agarose gel and an assembly PCR was performed using primers TrexPstFor/TrexPstRev. This PCR uses the linker sequence as the initial annealing region. The resulting PCR fragment was then digested by PstI and ligated into pCLS7673 (SEQ ID NO: 14) also digested by PstI. The following table indicates the oligonucleotide sequences.

TABLE 1
Oligonucleotides used to create single chain TREX molecules
SEQ ID Final Linker
Name Sequence NO: Sequence
TrexPstFor acgctgcaggccttcctgagccgcc 15
TrexPstRev ggcctgcagcgtccgcaccacggcgccat 16
TrexLink1For ccttctgagtctgaaggttccgaggcaccccgggccgag 17 SRPSESEG
TrexLink1Rev agactcagaaggacgagacgcctccaggctggggtcatc 18 (SEQ ID NO: 1)
TrexLink2For cagaccggtctggatgttccttactccgaggcaccccgggc 19 TPPQTGLDVPY
cgag (SEQ ID NO: 2)
TrexLink2Rev aacatccagaccggtctgtggaggagtcgcctccaggctg 20
gggtcatc
TrexLink3For tctgtttctaattctgagcatattgcttccgaggcaccccggg 21 GDSSVSNSEHIA
ccgag (SEQ ID NO: 3)
TrexLink3Rev ctcagaattagaaacagaggaatcacccgcctccaggctg 22
gggtcatc
TrexLink4For gctattggaggttctaaacctcgtgttgcttccgaggcaccc 23 IRPRAIGGSKPR
cgggccgag VA
TrexLink4Rev tttagaacctccaatagcacgaggacgaatcgcctccaggc 24 (SEQ ID NO: 4)
ggggtcatc

Results

The ability of the newly obtained scTrex molecules to increase meganuclease-induced mutagenesis was evaluated using the cellular model described above. The four single chain molecules (scTrex1 to scTrex4) wherein two TREX2 promoters have been fused using, respectively, the aforementioned linkers [SRPSESEG (SEQ ID NO: 1), TPPQTGLDVPY (SEQ ID NO: 2), GDSSVSNSEHIA (SEQ ID NO: 3) and IRPRAIGGSKPRVA (SEQ ID NO: 4)] and cloned into a mammalian expression vector [pCLS8981 (SEQ ID NO: 9), pCLS8982 (SEQ ID NO: 10), pCLS8984 (SEQ ID NO: 11) and pCLS8986 (SEQ ID NO: 12)] were used in combination with the vector encoding for SC_GS meganuclease to co-transfect a cellular model measuring mutagenic NHEJ repair induced by SC_GS. 1 μg of the vector encoding for SC_GS meganuclease was transfected into the cells alone or with increasing amounts of pCLS7673 (TREX2 encoding vector, SEQ ID NO: 14) or pCLS8981 [(SEQ ID NO: 9), pCLS8982 (SEQ ID NO: 10), pCLS8984 (SEQ ID NO: 11) and pCLS8986 (SEQ ID NO: 12) encoding scTrex1 to scTrex4 (SEQ ID NO: 5 to 8)], respectively. The SC_GS meganuclease induces a mutagenesis frequency circa 0.7%. This frequency increased up to 5% when TREX2 protein is present (FIG. 1). In contrast, up to 11% mutagenic events could be achieved when single-chain TREX2 molecules were present.

Example 2

Fusion of Single-Chain TREX2 Molecules to the N- or C-Terminus of an Engineered Meganuclease

Fusion of the TREX2 protein to an engineered meganuclease presents great advantages. First, it alleviates vectorization issues as it is much easier to transfect only one molecular species into the cells. Second, the fusion protein has the advantage to concentrate the TREX2 exonucleolytic activity at the double-strand break created by the meganuclease, minimizing potential adverse effects. Therefore, each of the four scTrex molecules (scTrex1 to scTrex4) are independently fused to the N- or C-terminus of the SC_GS meganuclease to evaluate the ability of these new chimeric rare-cutting endonucleases to increase targeted mutagenesis using the cell line previously described.

Material and Methods

a) Creating Fusion Proteins of SC_GS Meganuclease and Single-Chain TREX2 Molecules.

The strategy developed to build such fusion molecules is almost identical to the one described in the previous example 1A to make the single-chain TREX2 molecules. The two fusion proteins SC_GS-10-TREX (pCLS8052, SEQ ID NO: 27) and TREX-10-SC_GS (pCLS8054, SEQ ID NO: 28) are taken as a template. Instead of considering the PstI restriction site that is no longer unique in these plasmids, the Tth111I restriction site (GACACTGTC), which covers amino acids 142 to 144 (DTV) of the TREX2 protein, is considered. Taking pCLS7673 (SEQ ID NO: 14) as a template, two independent PCRs are carried out using the either primers TrexTthFor (5′-cccgggacactgtctgcctggacacgc-3′, SEQ ID NO: 29) and TrexLinkiRev (where “i” varies from 1 to 4) or primers and TrexLinkiFor (wherein i varies from 1 to 4) and TrexTthRev (5′-aggcagacagtgtcccggggcaggcgg-3′, SEQ ID NO: 30). The two PCR fragments are then purified after migration on an agarose gel and an assembly PCR is performed using primers TrexTthFor/TrexTthRev. This PCR uses the linker sequence as the initial annealing region. The resulting PCR fragments are then digested by Tth111I and ligated into in either pCLS8052 (SEQ ID NO: 27) or pCLS8054 (SEQ ID NO: 28), also digested by Tth111I. Eight molecules (scTrex1-10-SC_GS, scTrex2-10-SC_GS, scTrex3-10-SC_GS, scTrex4-10-SC_GS and SC_GS-10-scTrex1, SC_GS-10-scTrex2, SC_GS-10-scTrex3, SC_GS-10-scTrex4) are obtained directly and cloned into the mammalian expression vector.

Taking pCLS7673 (SEQ ID NO: 14) as a template, two independent PCRs were carried out using either primers TrexTthFor (5′-cccgggacactgtctgcctggacacgc-3′, SEQ ID NO: 29) and TrexLink2Rev (SEQ ID NO: 20), or primers TrexLink2For (SEQ ID NO: 19; see Table 1) and TrexTthRev (5′-aggcagacagtgtcccggggcaggcgg-3′, SEQ ID NO: 30). The two PCR fragments were then purified after migration on an agarose gel and an assembly PCR was performed using primers TrexTthFor/TrexTthRev. This PCR used the linker sequence as the initial annealing region. The resulting PCR fragments were then digested by Tth111I and ligated into SC_GS-10_Trex (pCLS8052 of SEQ ID NO: 27, encoding protein of SEQ ID NO: 52), Trex-10-SC_GS (pCLS8054 of SEQ ID NO: 28, encoding protein of SEQ ID NO: 53), Trex-SC_CAPNS1 (pCLS8518 of SEQ ID NO: 42, encoding protein of SEQ ID NO: 54), or Trex-SC_RAG (pCLS8980 of SEQ ID NO: 38, encoding protein of SEQ ID NO: 55). Four molecules: scTrex2-10-SC_GS (pCLS9572 of SEQ ID NO: 39, encoding protein of SEQ ID NO: 56), SC_GS-10-scTrex2 (pCLS9570 of SEQ ID NO: 40, encoding protein of SEQ ID NO: 57), scTrex2_SC_CAPNS1 (pCLS9571 of SEQ ID NO: 43, encoding protein of SEQ ID NO: 58), and scTrex2_SC_RAG (pCLS9573 of SEQ ID NO: 41, encoding protein of SEQ ID NO: 59) were then obtained directly in the mammalian expression vector.

b) Mutagenesis Induced by SC_GS Fused to scTREX2

Using the cellular model as described in example 1a, one million cells were seeded one day prior to transfection. These cells were co-transfected with 3 μg of plasmid encoding SC_GS (pCLS2690 of SEQ ID NO: 13, encoding the protein of SEQ ID NO: 60), or scTrex2-10-SC_GS (pCLS9572, SEQ ID NO: 39), with 0 or 2 μg of plasmid encoding TREX or scTREX2 (respectively, pCSL7673, SEQ ID NO: 14; pCLS8982, SEQ ID NO: 10) in 5 μg of total DNA by complementation with a pUC vector (pCLS0002 SEQ ID NO: 31) using 25 μl of lipofectamine (Invitrogen) according to the manufacturer's instructions. Four days following transfection, cells were harvested and the percentage of GFP-positive cells was measured by flow cytometry analysis using Guava instrumentation (Millipore). As mentioned in example 1a), the percentage of GFP-positive cells is directly correlated to the mutagenic NHEJ repair frequency induced by the transfected molecular entities.

The results show that in the absence of TREX, the mutagenic frequency is approximately 0.3%, increasing to 1.1% on addition of TREX2, and to 3.8% with scTREX2. In comparison to the addition of TREX alone, scTREX2 results in a 3-fold increase in mutagenic frequency if used in a co-transfection, or a 6-fold increase (7.1%) when fused to the GS meganuclease (FIG. 2).

Using the same samples as above, genomic DNA was extracted from cell populations and locus specific PCRs were performed using the following primers: 5′-CCATCTCATCCCTGCGTGTCTCCGACTCAG (forward adaptor sequence)-10N-(sequences needed for PCR product identification)-GCTCTCTGGCTAACTAGAGAACCC (transgenic GS locus specific forward sequence)-3′ (SEQ ID NO: 33) and 5′-CCTATCCCCTGTGTGCCTTGGCAGTCTCAG-(reverse adaptor sequence)-TCGATCAGCACGGGCACGATGCC (transgenic GS locus specific reverse sequence) (SEQ ID NO: 34). PCR products were sequenced by a 454 sequencing system (454 Life Sciences). Approximately 10,000 sequences were obtained per PCR product and then analyzed for the presence of site-specific insertion or deletion events.

Full analysis of the targeted mutagenesis (TM) revealed that using the GS meganuclease in the absence of TREX results in a mutagenic frequency of approximately 2.5%. This increases to 4% on addition of TREX, 13% with scTREX2 and 22% when the N-terminal fusion of scTREX2 to the GS meganuclease is used (FIG. 3).

Analysis of the nature of the mutagenic events in the presence of TREX2 revealed a modification in the pattern of mutagenesis (FIG. 4). In the absence of TREX2, approximately 24% of the mutagenic events correspond to the complete or partial loss of the 3′ overhang generated by SC_GS meganuclease (e.g. deletions of 2, 3 or 4 bases; respectively Del2, Del3 and Del4). In contrast, addition of scTREX2 either co-transfected or fused to the GS meganuclease increased the frequency of these deletion events to 70% (FIG. 4).

Dose Response

Cells (106) of the cellular model described in example 1a, seeded one day prior transfection, were transfected with increasing amounts of plasmid (1 μg, 3 μg, 6 μg, 10 μg) encoding SC_GS (pCLS2690, SEQ ID NO: 13), Trex-10-SC_GS (pCLS8054, SEQ ID NO: 28), scTrex2-10-SC_GS (pCLS9572, SEQ ID NO: 39), or SC_GS-10-scTrex2 (pCLS9570, SEQ ID NO: 40) wherein a single-chain TREX2 molecule has been linked N- or C-terminally to the SC_GS meganuclease. The transfection was performed with 10 μg of total DNA (complemented with a pUC vector (pCLS0002 of SEQ ID NO: 31) as needed) using 25 μl of lipofectamine (Invitrogen) according to the manufacturer's instructions. GS locus specific PCR was carried out as above using the same primers, and the PCR products were sequenced and analysed in the same manner.

In accordance with results of example 1c, the SC-GS meganuclease alone induced a mutagenic frequency circa 0.6-1% and circa 2-7% when fused to Trex (FIG. 5). Higher levels of mutagenic events were achieved when fusions between scTREX2 and SC-GS were used. Up to 16% mutagenic events could be achieved when scTREX2 has been linked N-terminally to SC_GS and up to 15% when linked C-terminally to SC_GS (FIG. 5). Fusion of scTREX2 to the SC_GS meganuclease also resulted in a higher frequency of mutagenesis using a lower dose.

Transfection on 293H Cells to Monitor Meganuclease-Induced Mutagenesis at Endogenous Loci

One million cells were seeded one day prior to transfection. Cells were co-transfected with 3 μg of plasmid expressing SC_Meganuclease (respectively, SC_CAPNS1 in pCLS6163 of SEQ ID NO: 44, the expression vector encoding SC_CAPNS1 of SEQ ID NO: 45 and SC_RAG in pCLS2222 of SEQ ID NO: 46, the expression vector encoding SC_RAG of SEQ ID NO: 47), or scTREX2_SC_Meganuclease (respectively, scTrex2-SC_CAPNS1 in pCLS9571 of SEQ ID NO: 43, encoding the protein of SEQ ID NO: 58 and scTrex2-SC_RAG in pCLS9573 of SEQ ID NO: 41, encoding the protein of SEQ ID NO: 59) and with 0 or 2 μg of plasmid encoding TREX or scTREX2 (respectively, pCSL7673 of SEQ ID NO: 14, encoding the protein of SEQ ID NO: 26 and pCLS8982 of SEQ ID NO: 10, encoding the protein of SEQ ID NO: 6) in 5 μg of total DNA by complementation with a pUC vector (pCLS0002, SEQ ID NO: 31) using 25 l of lipofectamine (Invitrogen) according to the manufacturer's instructions. Locus specific PCRs were performed using the following primers: 5′-CCATCTCATCCCTGCGTGTCTCCGACTCAG-(forward adaptor sequence)-10N-(sequences needed for PCR product identification)-locus specific forward sequence for CAPNS1: -CGAGTCAGGGCGGGATTAAG-3′ (SEQ ID NO: 48), or for RAG1: -GGCAAAGATGAATCAAAGATTCTGTCC-3′ (SEQ ID NO: 49), and the reverse primer 5′-CCTATCCCCTGTGTGCCTTGGCAGTCTCAG-(reverse adaptor sequence)-endogenous locus specific reverse sequence for CAPNS1: -CGAGACTTCACGGTTTCGCC-3′ (SEQ ID NO: 50), or RAG1: -GATCTCACCCGGAACAGCTTAAATTTC-3′ (SEQ ID NO: 51). PCR products were sequenced by a 454 sequencing system (454 Life Sciences). Approximately 10,000 sequences were obtained per PCR product and then analyzed for the presence of site-specific insertion or deletion events.

At the RAG1 locus, co-transfection of scTREX2 resulted in a targeted mutagenesis frequency of 5.4%, increasing to 8.4% using the scTREX2 fusion, in contrast to 1.4% in the absence of TREX (Table 2, and FIG. 6). At the CAPNS1 locus, the meganuclease alone gave rise to a frequency of targeted mutagenesis (TM) of 15%, increasing to 25% when co-transfected with scTREX2, and 36% when C-terminally fused to scTREX2 (Table 2, and FIG. 7).

TABLE 2
Percentage of targeted mutagenesis at endogenous locus RAG1 or
CAPNS1; stimulation factors relative to the meganuclease alone are
shown in parenthesis.
Mega-
Mega- Mega- Mega- nuclease −
nuclease nuclease + nuclease + scTREX2
alone TREX scTREX2 (fusion)
RAG1  1.4 (1.0)  4.69 (3.4) 5.41 (3.9) 8.42 (6.0)
CAPNS1 15.2 (1.0) 18.25 (1.2) 25.4 (1.7) 35.8 (2.4)

The nature of the mutagenic events was also analysed, revealing that the frequency of small deletions corresponding to the complete or partial removal of the 3′ overhang (Del2, Del3 or Del4) is increased on addition of scTREX2. The percentage of small deletions was increased from 11% using the RAG1 meganuclease alone, to 49% on co-transfection with scTREX2 and 68% using the scTrex2_SC_RAG fusion protein (FIG. 8). The percentage of small deletions using the CAPNS1 meganuclease alone was 2%, increasing to 50% using scTREX2 in a co-transfection experiment, and 82% when the scTrex_SC_CAPNS1 fusion was used (FIG. 9).

Example 3

Impact of scTrex2 on Mutagenesis Induced by TALEN

Three heterodimeric TALENs called DMDT, HBBT and CAPT were designed to target the human genes DMD, HBB and CAPNS1 respectively. DMDT is encoded by plasmids pCLS9027 (SEQ ID NO: 61) and pCLS9028 (SEQ ID NO: 62), HBBT is an heterodimeric protein encoded by pCLS9235 (SEQ ID NO: 63) and pCLS9241 (SEQ ID NO: 64) and CAPT is encoded by pCLS9025 (SEQ ID NO: 65) and pCLS9026 (SEQ ID NO: 66). Proteins respectively encoded by these plasmids are given in SEQ ID NO: 85-90. DMDT is designed to cleave the target DNA sequences DMD_target: TGTATTCCTTTATGGATcagttaacattataaATGATAACTTTAGCTCA (SEQ ID NO: 67), HBBT is designed to cleave the target DNA sequence HBB_target: TCTGACACAACTGTGTTcactagcaacctcaaACAGACACCATGGTGCA (SEQ ID NO: 68), and CAPT is designed to cleave the target DNA sequence CAPT_target: TCCGGGAACCCAGAGCTcacagccacgatcttAGACCCGAGCCCACAGA (SEQ ID NO: 69).

Co-transfection of the DMDT, HBBT and CAPT expressing plasmids were performed in presence of plasmid pCLS8982 (SEQ ID NO: 10) coding for a single-chain variant of TREX2 (scTrex2) and in the presence of plasmids pCLS8940 (SEQ ID NO: 70) or pCLS8943 (SEQ ID NO: 71) or pCLS9893 (SEQ ID NO: 72) encoding repair matrices respectively. Targeted mutagenesis was measured by molecular analysis of a specific locus using PCR amplification followed by Deep sequencing.

Cells Transfection

The human 293H cells (ATCC) were plated at a density of 1.2×106 cells per 10 cm dish in complete medium (DMEM supplemented with 2 mM L-glutamine, penicillin (100 IU/ml), streptomycin (100 μg/ml), amphotericin B (Fongizone: 0.25 μg/ml, Invitrogen-Life Science) and 10% FBS). The next day, cells were co-transfected with 15 μg of total DNA containing 2.5 μg of each monomer of TALENS, 5 μg of scTREX2 or empty vector, and 5 mg of pCLS8940 (SEQ ID NO: 70) or pCLS8943 (SEQ ID NO: 71), or pCLS9893 (SEQ ID NO: 72) as mentioned above, with Lipofectamine 2000 transfection reagent (Invitrogen) according to the manufacturer's protocol. As negative control, cells were transfected with 10 μg of empty vector and 5 μg of scTREX2. Three days after transfection, genomic DNA was extracted and the region surrounding the target site was amplified by specific PCR. The first PCR was performed using the primers F1 and R1 and was followed by a nested PCR using the primers F2 and R2 flanked by specific adaptator needed for HTS sequencing on the 454 sequencing system (454 Life Sciences).

DMDT_F1:
(SEQ ID NO: 73)
5′-AGGCCTCCATTCCTTTGAAGGAATTGG-3′
DMDT_R1:
(SEQ ID NO: 74)
5′-TTAAACACTGCTATTCAGTAGGACACACACC-3′
DMDT_F2:
(SEQ ID NO: 75)
5′-CCATCTCATCCCTGCGTGTCTCCGACTCAG-Tag-
CCTGATATTTCTCCTATTAATATTG -3′
DMDT_R2:
(SEQ ID NO: 76)
5′- CCTATCCCCTGTGTGCCTTGGCAGTCTCAG-
GGAGTGTGGTACTTCATCATGTCAGA -3′
HBBT_F1:
(SEQ ID NO: 77)
5′-GAAGAGTAAATTTTAGTAAAGGAGG-3′
HBBT_R1:
(SEQ ID NO: 78)
5′-GCCTAGCTTGGACTCAGAATAATC-3′
HBBT_F2:
(SEQ ID NO: 79):
5′-CCATCTCATCCCTGCGTGTCTCCGACTCAG-Tag-
CCACACCCTAGGGTTGGCCAATCTACTCCC -3′
HBBT_R2:
(SEQ ID NO: 80)
5′- CCTATCCCCTGTGTGCCTTGGCAGTCTCAG-
CCCACCCTTAGGCTGCTGGTGGTCTAC -3′
CAPT_F1:
(SEQ ID NO: 81)
5′- CTTCTCCACCCTCTGTCTCATGATC-3′
CAPT_R1:
(SEQ ID NO: 82)
5′- CCTTGGCAGGTCATGGGCGCGGAGC-3′
CAPT_F2:
(SEQ ID NO: 83)
5′-CCATCTCATCCCTGCGTGTCTCCGACTCAG-tag-
CTTCTCCACCCTCTGTCTCATGATC -3′
CAPT_R2:
(SEQ ID NO: 84)
5′- CCTATCCCCTGTGTGCCTTGGCAGTCTCAG-
CCTTGGCAGGTCATGGGCGCGGAGC -3′.

5000 to 10000 sequences per sample were analyzed.

Results

The frequency of mutagenesis induced by TALE nucleases alone or in the presence of the scTREX2 molecule was determined by molecular analysis after specific amplification of each locus followed by deep sequencing analysis of the amplicons. Results are presented in FIG. 10. In absence of scTREX2, 9.98%, 13.06% and 9.75% of PCR fragments carries mutations in samples corresponding to cells transfected with plasmids expressing respectively DMDT, HBBT and CAPT. In contrast, in sample corresponding to cells co-transfected with these TALENs and scTREX2 expressing plasmids (FIG. 10) these frequencies increase significantly (p<10−16) for all the TALENs tested to 16.76%, 27.07% and 22.50% respectively.

Thus, co-transfection of TALEN nuclease with the DNA processing enzyme scTREX2 stimulates the mutagenesis frequency.

Example 4

Trex2 Increases the Mutagenic Potential of Meganucleases in Plant Cells

Experiments were performed to test whether co-expression of a meganuclease with Trex2 increases frequencies of targeted mutagenesis in plant cells. I-SceI and Trex2 were each cloned downstream of a promoter that provides high levels of constitutive expression in plant cells. Plasmids encoding I-SceI and Trex2 (pCLS8982, SEQ ID NO: 10) were then introduced into tobacco protoplasts by PEG-mediated transformation. The protoplasts were derived from a tobacco line with an integrated I-SceI recognition site.

Four batches of protoplasts, each with 1×106 cells, were transformed with different combinations of plasmids. One batch was transformed with 15 μg each of plasmids encoding I-SceI and YFP; a second batch was transformed with 15 μg each of plasmids encoding I-SceI and Trex2; a third batch was transformed with 15 μg each of plasmids encoding Trex2 and YFP, and the fourth batch was transformed with 15 μg of a plasmid encoding YFP. Twenty-four hours after transformation, genomic DNA was prepared from the protoplasts. An approximately 350 bp encompassing the I-SceI recognition site was then amplified by PCR. The PCR product was subjected to 454 pyro-sequencing. Sequencing reads with insertion/deletion (indel) mutations at the cleavage site were considered as having been derived from imprecise repair of a cleaved target site by non-homologous end-joining.

The sequencing results provided clear evidence that Trex2, in combination with a meganuclease, greatly increases frequencies of targeted mutagenesis in plants (FIG. 11). Indels were recovered from cells expressing both I-SceI and Trex2 at a frequency 16-fold greater than with I-SceI alone. In addition to increasing the mutation frequency, the expression of Trex2 also changed the mutation spectrum. For example, the occurrence of insertions in cells expressing Trex2 (7 out of 1238; 0.57%) was significantly lower than in cells expressing I-SceI alone (9 out 46; 19.5%). Furthermore, the size of the deletions created by co-expression of I-SceI and Trex2 was smaller than what was observed with I-SceI alone. In the former case, 96.6% of the deletions were less than 10 bp, whereas in the latter, the number of deletions less than 10 bp was 81.1%.

We conclude that co-expression of Trex2 with a meganuclease in plant cells greatly stimulates the frequency of mutagenesis and promotes the formation of small deletions at the cleavage site.

LIST OF CITED REFERENCES

  • Arimondo, P. B., C. J. Thomas, et al. (2006). “Exploring the cellular activity of camptothecin-triple-helix-forming oligonucleotide conjugates.” Mol Cell Biol 26(1): 324-33.
  • Arnould, S., P. Chames, et al. (2006). “Engineering of large numbers of highly specific homing endonucleases that induce recombination on novel DNA targets.” J Mol Biol 355(3): 443-58.
  • Arnould, S., C. Perez, et al. (2007). “Engineered I-CreI derivatives cleaving sequences from the human XPC gene can induce highly efficient gene correction in mammalian cells.” J Mol Biol 371(1): 49-65.
  • Ashworth, J., J. J. Havranek, et al. (2006). “Computational redesign of endonuclease DNA binding and cleavage specificity.” Nature 441(7093): 656-9.
  • Beumer, K. J., J. K. Trautman, et al. (2008). “Efficient gene targeting in Drosophila by direct embryo injection with zinc-finger nucleases.” Proc Natl Acad Sci USA 105(50): 19821-6.
  • Boch, J., H. Scholze, et al. (2009). “Breaking the code of DNA binding specificity of TAL-type III effectors.” Science 326(5959): 1509-12.
  • Bolduc, J. M., P. C. Spiegel, et al. (2003). “Structural and biochemical analyses of DNA and RNA binding by a bifunctional homing endonuclease and group I intron splicing factor.” Genes Dev 17(23): 2875-88.
  • Britt, A. B. (1999). “Molecular genetics of DNA repair in higher plants.” Trends Plant Sci 4(1): 20-25.
  • Burden and O. N. (1998). “Mechanism of action of eukaryotic topoisomerase II and drugs targeted to the enzyme.” Biochim Biophys Acta. 1400(1-3): 139-154.
  • Capecchi, M. R. (1989). “The new mouse genetics: altering the genome by gene targeting.”Trends Genet. 5(3): 70-6.
  • Cathomen, T. and J. K. Joung (2008). “Zinc-finger nucleases: the next generation emerges.” Mol Ther 16(7): 1200-7.
  • Chames, P., J. C. Epinat, et al. (2005). “In vivo selection of engineered homing endonucleases using double-strand break induced homologous recombination.”Nucleic Acids Res 33(20): e178.
  • Chevalier, B., M. Turmel, et al. (2003). “Flexible DNA target site recognition by divergent homing endonuclease isoschizomers I-CreI and I-MsoI.” J Mol Biol 329(2): 253-69.
  • Chevalier, B. S., T. Kortemme, et al. (2002). “Design, activity, and structure of a highly specific artificial endonuclease.” Mol Cell 10(4): 895-905.
  • Chevalier, B. S., R. J. Monnat, Jr., et al. (2001). “The homing endonuclease I-CreI uses three metals, one of which is shared between the two active sites.” Nat Struct Biol 8(4): 312-6.
  • Chevalier, B. S, and B. L. Stoddard (2001). “Homing endonucleases: structural and functional insight into the catalysts of intron/intein mobility.” Nucleic Acids Res 29(18): 3757-74.
  • Choulika, A., A. Perrin, et al. (1995). “Induction of homologous recombination in mammalian chromosomes by using the I-SceI system of Saccharomyces cerevisiae.” Mol Cell Biol 15(4): 1968-73.
  • Christian, M., T. Cermak, et al. (2010). “Targeting DNA double-strand breaks with TAL effector nucleases.” Genetics 186(2): 757-61.
  • Cohen-Tannoudji, M., S. Robine, et al. (1998). “I-SceI-induced gene replacement at a natural locus in embryonic stem cells.” Mol Cell Biol 18(3): 1444-8.
  • Critchlow, S. E. and S. P. Jackson (1998). “DNA end-joining: from yeast to man.” Trends Biochem Sci 23(10): 394-8.
  • Donoho, G., M. Jasin, et al. (1998). “Analysis of gene targeting and intrachromosomal homologous recombination stimulated by genomic double-strand breaks in mouse embryonic stem cells.” Mol Cell Biol 18(7): 4070-8.
  • Doyon, J. B., V. Pattanayak, et al. (2006). “Directed evolution and substrate specificity profile of homing endonuclease I-SceI.” J Am Chem Soc 128(7): 2477-84.
  • Doyon, Y., J. M. McCammon, et al. (2008). “Heritable targeted gene disruption in zebrafish using designed zinc-finger nucleases.” Nat Biotechnol 26(6): 702-8.
  • Dujon, B., L. Colleaux, et al. (1986). “Mitochondrial introns as mobile genetic elements: the role of intron-encoded proteins.” Basic Life Sci 40: 5-27.
  • Eisenschmidt, K., T. Lanio, et al. (2005). “Developing a programmed restriction endonuclease for highly specific DNA cleavage.” Nucleic Acids Res 33(22): 7039-47.
  • Endo, M., K. Osakabe, et al. (2006). “Molecular characterization of true and ectopic gene targeting events at the acetolactate synthase gene in Arabidopsis.” Plant Cell Physiol 47(3): 372-9.
  • Endo, M., K. Osakabe, et al. (2007). “Molecular breeding of a novel herbicide-tolerant rice by gene targeting.” Plant J 52(1): 157-66.
  • Epinat, J. C., S. Arnould, et al. (2003). “A novel engineered meganuclease induces homologous recombination in yeast and mammalian cells.” Nucleic Acids Res 31(11): 2952-62.
  • Feldmann, E., V. Schmiemann, et al. (2000). “DNA double-strand break repair in cell-free extracts from Ku80-deficient cells: implications for Ku serving as an alignment factor in non-homologous DNA end joining.” Nucleic Acids Res 28(13): 2585-96.
  • Gimble, F. S., C. M. Moure, et al. (2003). “Assessing the plasticity of DNA target site recognition of the PI-SceI homing endonuclease using a bacterial two-hybrid selection system.” J Mol Biol 334(5): 993-1008.
  • Gouble, A., J. Smith, et al. (2006). “Efficient in toto targeted recombination in mouse liver by meganuclease-induced double-strand break.” J Gene Med 8(5): 616-22.
  • Grizot, S., J. Smith, et al. (2009). “Efficient targeting of a SCID gene by an engineered single-chain homing endonuclease.” Nucleic Acids Res 37(16): 5405-19.
  • Haber, J. (2000). “Partners and pathways repairing a double-strand break.” Trends Genet. 16(6): 259-264.
  • Haber, J. E. (1995). “In vivo biochemistry: physical monitoring of recombination induced by site-specific endonucleases.” Bioessays 17(7): 609-20.
  • Hanin, M., S. Volrath, et al. (2001). “Gene targeting in Arabidopsis.” Plant J 28(6): 671-7.
  • Ichiyanagi, K., Y. Ishino, et al. (2000). “Crystal structure of an archaeal intein-encoded homing endonuclease PI-PfuI.” J Mol Biol 300(4): 889-901.
  • Kalish, J. M. and P. M. Glazer (2005). “Targeted genome modification via triple helix formation.” Ann NY Acad Sci 1058: 151-61.
  • Kim, Y. G., J. Cha, et al. (1996). “Hybrid restriction enzymes: zinc finger fusions to Fok I cleavage domain.” Proc Natl Acad Sci USA 93(3): 1156-60.
  • Kirik, A., S. Salomon, et al. (2000). “Species-specific double-strand break repair and genome evolution in plants.” Embo J 19(20): 5562-6.
  • Li, H., H. Vogel, et al. (2007). “Deletion of Ku70, Ku80, or both causes early aging without substantially increased cancer.” Mol Cell Biol 27(23): 8205-14.
  • Li, T., S. Huang, et al. (2010). “TAL nucleases (TALNs): hybrid proteins composed of TAL effectors and FokI DNA-cleavage domain.” Nucleic Acids Res 39(1): 359-72.
  • Lieber, M. R. and Z. E. Karanjawala (2004). “Ageing, repetitive genomes and DNA damage.” Nat Rev Mol Cell Biol. 5(1): 69-75.
  • Lloyd, A., C. L. Plaisier, et al. (2005). “Targeted mutagenesis using zinc-finger nucleases in Arabidopsis.” Proc Natl Acad Sci USA 102(6): 2232-7.
  • Ma, J., E. Kim, et al. (2003). “Yeast Mre11 and Rad1 proteins define a Ku-independent mechanism to repair double-strand breaks lacking overlapping end sequences.” Mol Cell Biol. 23(23): 8820-8828.
  • Meng, X., M. B. Noyes, et al. (2008). “Targeted gene inactivation in zebrafish using engineered zinc-finger nucleases.” Nat Biotechnol 26(6): 695-701.
  • Moore, I., M. Samalova, et al. (2006). “Transactivated and chemically inducible gene expression in plants.” Plant J 45(4): 651-83.
  • Moore, J. K. and J. E. Haber (1996). “Cell cycle and genetic requirements of two pathways of nonhomologous end-joining repair of double-strand breaks in Saccharomyces cerevisiae.” Mol Cell Biol 16(5): 2164-73.
  • Moscou, M. J. and A. J. Bogdanove (2009). “A simple cipher governs DNA recognition by TAL effectors.” Science 326(5959): 1501.
  • Moure, C. M., F. S. Gimble, et al. (2002). “Crystal structure of the intein homing endonuclease PI-SceI bound to its recognition sequence.” Nat Struct Biol 9(10): 764-70.
  • Moure, C. M., F. S. Gimble, et al. (2003). “The crystal structure of the gene targeting homing endonuclease I-SceI reveals the origins of its target site specificity.” J Mol Biol 334(4): 685-95.
  • Nagy, Z. and E. Soutoglou (2009). “DNA repair: easy to visualize, difficult to elucidate.”Trends Cell Biol 19(11): 617-29.
  • Nouspikel, T. (2009). “DNA repair in mammalian cells: Nucleotide excision repair: variations on versatility.” Cell Mol Life Sci 66(6): 994-1009.
  • Padidam, M. (2003). “Chemically regulated gene expression in plants.” Curr Opin Plant Biol 6(2): 169-77.
  • Paques, F. and P. Duchateau (2007). “Meganucleases and DNA double-strand break-induced recombination: perspectives for gene therapy.” Curr Gene Ther 7(1): 49-66.
  • Paques, F. and J. E. Haber (1999). “Multiple pathways of recombination induced by double-strand breaks in Saccharomyces cerevisiae.” Microbiol Mol Biol Rev 63(2): 349-404.
  • Pingoud, A. and G. H. Silva (2007). “Precision genome surgery.” Nat Biotechnol 25(7): 743-4.
  • Porteus, M. H. and D. Carroll (2005). “Gene targeting using zinc finger nucleases.” Nat Biotechnol 23(8): 967-73.
  • Posfai, G., V. Kolisnychenko, et al. (1999). “Markerless gene replacement in Escherichia coli stimulated by a double-strand break in the chromosome.” Nucleic Acids Res 27(22): 4409-15.
  • Povirk, L. F. (1996). “DNA damage and mutagenesis by radiomimetic DNA-cleaving agents: bleomycin, neocarzinostatin and other enediynes.” Mutat Res 355(1-2): 71-89.
  • Puchta, H., B. Dujon, et al. (1996). “Two different but related mechanisms are used in plants for the repair of genomic double-strand breaks by homologous recombination.” Proc Natl Acad Sci USA 93(10): 5055-60.
  • Rosen, L. E., H. A. Morrison, et al. (2006). “Homing endonuclease I-CreI derivatives with novel DNA target specificities.” Nucleic Acids Res.
  • Rothstein, R. (1991). “Targeting, disruption, replacement, and allele rescue: integrative DNA transformation in yeast.” Methods Enzymol 194: 281-301.
  • Rouet, P., F. Smih, et al. (1994). “Expression of a site-specific endonuclease stimulates homologous recombination in mammalian cells.” Proc Natl Acad Sci USA 91(13): 6064-8.
  • Rouet, P., F. Smih, et al. (1994). “Introduction of double-strand breaks into the genome of mouse cells by expression of a rare-cutting endonuclease.” Mol Cell Biol 14(12): 8096-106.
  • Sargent, R. G., M. A. Brenneman, et al. (1997). “Repair of site-specific double-strand breaks in a mammalian chromosome by homologous and illegitimate recombination.” Mol Cell Biol 17(1): 267-77.
  • Seligman, L. M., K. M. Stephens, et al. (1997). “Genetic analysis of the Chlamydomonas reinhardtii I-CreI mobile intron homing system in Escherichia coli.” Genetics 147(4): 1653-64.
  • Siebert, R. and H. Puchta (2002). “Efficient Repair of Genomic Double-Strand Breaks by Homologous Recombination between Directly Repeated Sequences in the Plant Genome.” Plant Cell 14(5): 1121-31.
  • Silva, G. H., J. Z. Dalgaard, et al. (1999). “Crystal structure of the thermostable archaeal intron-encoded endonuclease I-DmoI.” J Mol Biol 286(4): 1123-36.
  • Simon, P., F. Cannata, et al. (2008). “Sequence-specific DNA cleavage mediated by bipyridine polyamide conjugates.” Nucleic Acids Res 36(11): 3531-8.
  • Smith, J., S. Grizot, et al. (2006). “A combinatorial approach to create artificial homing endonucleases cleaving chosen sequences.” Nucleic Acids Res 34(22): e149.
  • Sonoda, E., H. Hochegger, et al. (2006). “Differential usage of non-homologous end-joining and homologous recombination in double strand break repair.” DNA Repair (Amst) 5(9-10): 1021-9.
  • Spiegel, P. C., B. Chevalier, et al. (2006). “The structure of I-CeuI homing endonuclease: Evolving asymmetric DNA recognition from a symmetric protein scaffold.”Structure 14(5): 869-80.
  • Stoddard, B. L. (2005). “Homing endonuclease structure and function.” Q Rev Biophys 38(1): 49-95.
  • Sussman, D., M. Chadsey, et al. (2004). “Isolation and characterization of new homing endonuclease specificities at individual target site positions.” J Mol Biol 342(1): 31-41.
  • Teicher, B. A. (2008). “Next generation topoisomerase I inhibitors: Rationale and biomarker strategies.” Biochem Pharmacol 75(6): 1262-71.
  • Terada, R., Y. Johzuka-Hisatomi, et al. (2007). “Gene targeting by homologous recombination as a biotechnological tool for rice functional genomics.” Plant Physiol 144(2): 846-56.
  • Terada, R., H. Urawa, et al. (2002). “Efficient gene targeting by homologous recombination in rice.” Nat Biotechnol 20(10): 1030-4.
  • Wang, R., X. Zhou, et al. (2003). “Chemically regulated expression systems and their applications in transgenic plants.” Transgenic Res 12(5): 529-40.
  • Zuo, J. and N. H. Chua (2000). “Chemical-inducible systems for regulated expression of plant genes.” Curr Opin Biotechnol 11(2): 146-51.
  • Mazur, D. J. and F. W. Perrino (2001). “Structure and expression of the TREX1 and TREX2 3′-->5′ exonuclease genes.” J Biol Chem 276(18): 14718-27.
  • Perrino, F. W., de Silva U, Harvey S, Pryor E. E. Jr., Cole D. W. and Hollis T (2008). “Cooperative DNA binding and communication across the dimer interface in the TREX2 3′-->5′-exonuclease.” J Biol Chem 283 (31): 21441-52.
  • Dumitrache, L. C. et al. Trex2 Enables Spontaneous Sister Chromatid Exchanges without Facilitating DNA Double Strand Break Repair. (2011, May 31). Genetics.
  • Bennardo, N., Gunn, A., Cheng, A., Hasty, P. & Stark, J. M. (2009). Limiting the persistence of a chromosome break diminishes its mutagenic potential. PLoS Genet. 5, e1000683 (2009).

Claims

1-13. (canceled)

14. A polynucleotide encoding a polypeptide that comprises:

(i) a first polypeptide that is a human TREX2 protomer (SEQ ID NO: 26) or functional mutant thereof that shares at least 80% identity with the human TREX2 exonuclease protomer;

(ii) a second polypeptide that is a human TREX2 protomer (SEQ ID NO: 26) or functional mutant thereof that shares at least 80% identity with the human TREX2 exonuclease protomer; and

(iii) a peptidic linker connecting said first and second polypeptides.

15. A polynucleotide encoding a polypeptide that comprises:

(i) a first polypeptide that is a human TREX2 protomer (SEQ ID NO: 26) or functional mutant thereof that shares at least 80% identity with the human TREX2 exonuclease protomer;

(ii) a second polypeptide that is a human TREX2 protomer (SEQ ID NO: 26) or functional mutant thereof that shares at least 80% identity with the human TREX2 exonuclease protomer;

(iii) a peptidic linker connecting said first and second polypeptides; and

(iv) a third polypeptide sharing at least 80% identity with a rare cutting endonuclease.

16. A polynucleotide according to claim 15, wherein said rare-cutting endonuclease is a TAL nuclease (TALEN).

17. A polynucleotide according to claim 15, wherein said rare-cutting endonuclease is selected from the group consisting of I-SceI, I-ChuI, I-CreI, I-CsmI, PI-SceI, PI-TliI, PI-MtuI, I-CeuI, I-SceII, I-SceIII, HO, PI-CivI, PI-CtrI, PI-AaeI, PI-BsuI, PI-DhaI, PI-DraI, PI-MavI, PI-MchI, PI-MfuI, PI-MflI, PI-MgaI, PI-MgoI, PI-MinI, PI-MkaI, PI-MleI, PI-MmaI, PI-MshI, PI-MsmI, PI-MthI, PI-MtuI, PI-MxeI, PI-NpuI, PI-PfuI, PI-RmaI, PI-SpbI, PI-SspI, PI-FacI, PI-MjaI, PI-PhoI, PI-TagI, PI-ThyI, PI-TkoI, PI-TspI, and I-MsoI.

18. A polynucleotide according to claim 15, wherein said polypeptide comprises:

(i) a first polypeptide that is a human TREX2 protomer (SEQ ID NO: 26) or functional mutant thereof that shares at least 80% identity with the human TREX2 exonuclease protomer;

(ii) a second polypeptide that is a human TREX2 protomer (SEQ ID NO: 26) or functional mutant thereof that shares at least 80% identity with the human TREX2 exonuclease protomer;

(iii) a peptidic linker connecting said first and second polypeptides

(iv) a third polypeptide sharing at least 80% identity with residues 1-152 of the natural I-CreI LAGLIDADG meganuclease (SEQ ID NO: 35).

19. The polynucleotide of claim 18, which further comprises another polypeptide sharing at least 80% identity with residues 1-152 of the natural I-CreI LAGLIDADG meganuclease (SEQ ID NO: 35).

20. A method for increasing double-strand-break induced mutagenesis at a genomic locus of interest in a cell comprising the steps of:

(i) identifying at said genomic locus of interest at least one DNA target sequence cleavable by one natural or engineered rare-cutting endonuclease;

(ii) introducing a polynucleotide encoding said rare-cutting endonuclease into the cell together with a polynucleotide according to claim 14;

thereby obtaining by expression of said polynucleotides in said cell double strand-break-induced mutagenesis at said genomic locus of interest.

21. A method according to claim 20, wherein said cell is a plant cell.

22. A method for increasing double-strand-break induced mutagenesis at a genomic locus of interest in a cell comprising the steps of:

(i) identifying at said genomic locus of interest at least one DNA target sequence cleavable by one natural or engineered rare-cutting endonuclease;

(ii) introducing a polynucleotide according to claim 15, encoding a polypeptide cleaving said target DNA;

thereby obtaining by expression of said polynucleotide in said cell double-strand-break induced mutagenesis at said genomic locus of interest.

23. A method according to claim 22, wherein said cell is a plant cell.

24. A method for increasing double-strand-break induced mutagenesis at a genomic locus of interest in a cell comprises the steps of:

(i) identifying at said genomic locus of interest at least one DNA target sequence cleavable by one TAL nuclease (TALEN);

(ii) introducing said TALEN into the cell together with a polypeptide encoded by a polynucleotide according to claim 14;

thereby obtaining a cell in which double-strand-break induced mutagenesis at said genomic locus of interest is increased.

25. A vector comprising a recombinant polynucleotide of claim 14.

26. A composition comprising a recombinant polynucleotide according to claim 14.

27. A kit comprising a recombinant polynucleotide according to claim 14 and instructions for use in increasing double-strand break-induced mutagenesis in a cell.

28. A polypeptide encoded by the polynucleotide of claim 14.

29. A polypeptide encoded by the polynucleotide of claim 15.

Resources

Images & Drawings included:

Sources:

Recent applications in this class:

Recent applications for this Assignee: