US20140349886A1
2014-11-27
14/283,823
2014-05-21
The present invention provides kits and primers for colony multiplex PCR for the detection of class A, B, C, and D β-lactamase genes. The rapid detection of bla genes by using the kits and primers according to the present invention allows appropriate prescribing of antibiotics, which can reduce patient mortality and minimize antibiotic resistance. The present invention provides kits and primers for a rapid and accurate molecular method to overcome (a) to detect all clinically-important bla genes and (b) to explain phenotypic tests' results well by using 54 primer pairs, which are designed through novel and elaborate optimization processes. With perfect specificity and sensitivity in 172 control strains and 403 clinical strains, the present invention provides prompt and clinical application to the identification of all bla genes in bacterial pathogens.
Get notified when new applications in this technology area are published.
C12Q1/689 » CPC main
Measuring or testing processes involving enzymes, nucleic acids or microorganisms ; Compositions therefor; Processes of preparing such compositions involving nucleic acids; Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
C12Q2600/16 » CPC further
Oligonucleotides characterized by their use Primer sets for multiplex assays
C12Q2600/112 » CPC further
Oligonucleotides characterized by their use Disease subtyping, staging or classification
C12Q1/68 IPC
Measuring or testing processes involving enzymes, nucleic acids or microorganisms ; Compositions therefor; Processes of preparing such compositions involving nucleic acids
This application claims the benefit of U.S. Provisional Patent Application No. 61/825,768, filed May 21, 2013, the disclosures of which are incorporated herein in their entirety by reference.
1. Technical Field
The present invention relates to a primer pairs for detection of β-lactamase genes. The present invention is also directed to kits for the detection of β-lactamase gene.
2. Description of the Related Art
The emergence and spread of multiple antibiotic resistances among pathogenic bacteria is a global health crisis1. β-Lactam antibiotics are one of the most successful drugs for the treatment of bacterial infections and represent approximately 65% of the total world market for antibiotics2. Therefore, resistance to β-lactam antibiotics by the acquisition of genes that encode β-lactamases is one of the most serious problems in Gram-negative pathogenic bacteria, such as the members of the Enterobacteriaceae, Pseudomonas spp., and Acinetobacter baumannii3,4. Since the first report observing a β-lactamase was published in 19405, a year before the introduction of first commercial antibiotic, penicillin, more than 1,200 distinct β-lactamase (bla) genes have been identified in clinical strains, showing the remarkable diversity of bla genes due to their continuous mutation4. They can be separated into the four major classes, A-D, based on their amino acid sequence and functional groups. Class A, C, and D enzymes utilize serine for β-lactam hydrolysis, while class B metalloenzymes require divalent zinc ions for substrate hydrolysis4. Of these enzymes, β-lactamases attracting the largest amount of clinical concern are extended-spectrum β-lactamases (ESBLs) which hydrolyze most penicillins and 3rd- or 4th-generation cephalosporins with an oxyimino side chain, and carbapenemases which can hydrolyze almost all β-lactam classes including carbapenems6-8. ESBL gene-harboring and carbapenemase gene-harboring Gram-negative pathogens have been responsible for increasing mortality and for serious hospital outbreaks that presented major therapeutic and infection control challenges3,7.
For earlier detection of outbreaks and minimizing the spread of resistant bacteria, the availability of rapid diagnostic methods to detect resistance genes is also significantly important. Determination of susceptibility or resistance using classical culture-based phenotypic tests is the general method used in clinical microbiological laboratories, but this procedure is time consuming and can easily not detect ESBL and carbapenemase production by Enterobacteriaceae owing to variable levels of enzyme expression and the poor specificity of some antibiotic combinations9,10. In contrast, implementation of molecular-based diagnostic methods easily overcome these limitations and can increase the speed and accuracy of detecting resistance genes, which is important for both infection control and therapeutic options in hospital and community settings9. However, previous developed methods for bla gene detection are restricted to the identification of several bla genes and the molecular diagnostic method for detecting all clinically-important bla genes is not available11-17. Because these methods can detect only partial types of bla genes, they cannot replace for the susceptibility test.
For solve such problem, the present inventors designed ready-to-use 54 PCR primer pairs with optimal features that are readily usable for rapid and accurate detection of all clinically-important bla genes with perfect specificity and sensitivity. This large-scale bla detection method (designated as LARGE-SCALEblaFinder) can rapidly and accurately determine the bla gene typing of clinical strains at low cost and thus can help minimize antibiotic resistance. Notably, the LARGE-SCALEblaFinder detects 24 additional unreported bla genes in the strains that were previously studied, suggesting that this method have the ability to detect all bla genes existing in a clinical strain.
According to a first aspect, the present invention provides a primer pair for identifying β-lactamase nucleic acid. The said primer pair could be selected from the primer pair group consisting of a pair of Seq. No. 1 and 2, a pair of Seq. 3 and 4, a pair of Seq. No. 5 and 6, a pair of Seq. No. 7 and 8, a pair of Seq. No. 9 and 10, a pair of Seq. No. 11 and 12, a pair of Seq. No. 13 and 14, a pair of Seq. No. 15 and 16, a pair of Seq. No. 17 and 18, a pair of Seq. No. 19 and 20, a pair of Seq. No. 21 and 22, a pair of Seq. No. 23 and 24, a pair of Seq. No. 25 and 26, a pair of Seq. No. 27 and 28, a pair of Seq. No. 29 and 30, a pair of Seq. No. 31 and 32, a pair of Seq. No. 33 and 34, a pair of Seq. No. 35 and 36, a pair of Seq. No. 37 and 38, a pair of Seq. No. 39 and 40, a pair of Seq. No. 41 and 42, a pair of Seq. No. 43 and 44, a pair of Seq. No. 45 and 46, a pair of Seq. No. 47 and 48, a pair of Seq. No. 49 and 50, a pair of Seq. No. 51 and 52, a pair of Seq. No. 53 and 54, No. 55 and 56, a pair of Seq. 57 and 58, a pair of Seq. No. 59 and 60, a pair of Seq. No. 61 and 62, a pair of Seq. No. 63 and 64, a pair of Seq. No. 65 and 66, a pair of Seq. No. 67 and 68, a pair of Seq. No. 69 and 70, a pair of Seq. No. 71 and 72, a pair of Seq. No. 73 and 74, a pair of Seq. No. 75 and 76, a pair of Seq. No. 77 and 78, a pair of Seq. No. 79 and 80, a pair of Seq. No. 81 and 82, a pair of Seq. No. 83 and 84, a pair of Seq. No. 85 and 86, a pair of Seq. No. 87 and 88, a pair of Seq. No. 89 and 90, a pair of Seq. No. 91 and 92, a pair of Seq. No. 93 and 94, a pair of Seq. No. 95 and 96, a pair of Seq. No. 97 and 98, a pair of Seq. No. 99 and 100, a pair of Seq. No. 101 and 102, a pair of Seq. No. 103 and 104, a pair of Seq. No. 105 and 106, and a pair of Seq. No. 107 and 108; and each of full-length complement primer pairs thereof. Specifically, the primer pairs could have at least two (2) primer pairs selected from the group. More specifically, the primer pairs could have at least five (5) primer pairs selected from the group. More further specifically, the primer pairs could have at least eight (8) primer pairs selected from the group. Most specifically, the primer pairs could be the group having all of the primer pairs (total 54 primer pairs).
The terms “complement” and “complementary,” as used herein, refer to a nucleic acid that is capable of hybridizing to a specified nucleic acid molecule under stringent hybridization conditions. Thus, a specified DNA molecule is typically “complementary” to a nucleic acid if hybridization occurs between the specified DNA molecule and the nucleic acid. If the specified DNA molecule hybridizes to the full length of the nucleic acid molecule, then the specified DNA molecule is typically a “full-length complement.” “Complementary,” further refers to the capacity of purine and pyrimidine nucleotides to associate through hydrogen bonding in double stranded nucleic acid molecules. The following base pairs are complementary: guanine and cytosine; adenine and thymine; and adenine and uracil
Hereinafter we use the classification of β-lactamase according to Ambler's molecular classification. The most widely used classification of β-lactamases is the Ambler classification35 that divides β-lactamases into four classes (A, B, C, and D) based upon their amino acid sequences. Ambler originally specified two classes: class A, the active-site serine β-lactamases; and class B, the metallo-β-lactamases that require a bivalent metal ion, usually Zn2+, for activity. Later a new class of serine β-lactamases was found that bore little sequence similarity to the then-known class A enzymes. Designated class C, its members are also known as the ‘AmpC’ β-lactamases. Another class of serine β-lactamases, familiarly known as the OXA β-lactamases, was found to bear little resemblance to either class A or class C and was designated class D. The three classes of serine β-lactamases are sufficiently different that alignment programs such as BLAST find no detectable sequence similarity, yet there is sufficient structural similarity among the three classes of serine β-lactamases that it is clear that they are homologous, i.e. descended from a common ancestor.
According to second aspect, the present invention provides one or more of primer pair for identifying Class A β-lactamase nucleic acid. The said primer pair could be one or more of primer pair selected from the primer pair group consisting of a pair of Seq. No. 1 and 2, a pair of Seq. 3 and 4, a pair of Seq. No. 5 and 6, a pair of Seq. No. 7 and 8, a pair of Seq. No. 9 and 10, a pair of Seq. No. 11 and 12, a pair of Seq. No. 13 and 14, a pair of Seq. No. 15 and 16, a pair of Seq. No. 17 and 18, a pair of Seq. No. 19 and 20, a pair of Seq. No. 21 and 22, a pair of Seq. No. 23 and 24, and a pair of Seq. No. 25 and 26; and each of full-length complement primer pairs thereof for identifying Class A β-lactamase nucleic acid. Specifically, the present invention provides primer pairs consisting of a pair of Seq. No. 1 and 2, a pair of Seq. 3 and 4, a pair of Seq. No. 5 and 6, a pair of Seq. No. 7 and 8, a pair of Seq. No. 9 and 10, a pair of Seq. No. 11 and 12, a pair of Seq. No. 13 and 14, a pair of Seq. No. 15 and 16, a pair of Seq. No. 17 and 18, a pair of Seq. No. 19 and 20, a pair of Seq. No. 21 and 22, a pair of Seq. No. 23 and 24, and a pair of Seq. No. 25 and 26 for identifying Class A β-lactamase nucleic acid.
According to third aspect, the present invention provides one or more of primer pair selected from the primer pair group consisting of a pair of Seq. No. 27 and 28, a pair of Seq. No. 29 and 30, a pair of Seq. No. 31 and 32, a pair of Seq. No. 33 and 34, a pair of Seq. No. 35 and 36, a pair of Seq. No. 37 and 38, a pair of Seq. No. 39 and 40, a pair of Seq. No. 41 and 42, a pair of Seq. No. 43 and 44, a pair of Seq. No. 45 and 46, a pair of Seq. No. 47 and 48, a pair of Seq. No. 49 and 50, a pair of Seq. No. 51 and 52, a pair of Seq. No. 53 and 54, No. 55 and 56, and a pair of Seq. 57 and 58; and each of full-length complement primer pairs thereof for identifying Class B β-lactamase nucleic acid. Specifically, the present invention provides primer pairs consisting of a pair of Seq. No. 27 and 28, a pair of Seq. No. 29 and 30, a pair of Seq. No. 31 and 32, a pair of Seq. No. 33 and 34, a pair of Seq. No. 35 and 36, a pair of Seq. No. 37 and 38, a pair of Seq. No. 39 and 40, a pair of Seq. No. 41 and 42, a pair of Seq. No. 43 and 44, a pair of Seq. No. 45 and 46, a pair of Seq. No. 47 and 48, a pair of Seq. No. 49 and 50, a pair of Seq. No. 51 and 52, a pair of Seq. No. 53 and 54, No. 55 and 56, and a pair of Seq. 57 and 58 for identifying Class B β-lactamase nucleic acid.
According to forth aspect, the present invention provides one or more of primer pair selected from the primer pair group consisting of a pair of Seq. No. 59 and 60, a pair of Seq. No. 61 and 62, a pair of Seq. No. 63 and 64, a pair of Seq. No. 65 and 66, a pair of Seq. No. 67 and 68, a pair of Seq. No. 69 and 70, a pair of Seq. No. 71 and 72, a pair of Seq. No. 73 and 74, a pair of Seq. No. 75 and 76, and a pair of Seq. No. 77 and 78; and each of full-length complement primer pairs thereof for identifying Class C β-lactamase nucleic acid. Specifically, the present invention provides primer pairs consisting of a pair of Seq. No. 59 and 60, a pair of Seq. No. 61 and 62, a pair of Seq. No. 63 and 64, a pair of Seq. No. 65 and 66, a pair of Seq. No. 67 and 68, a pair of Seq. No. 69 and 70, a pair of Seq. No. 71 and 72, a pair of Seq. No. 73 and 74, a pair of Seq. No. 75 and 76, and a pair of Seq. No. 77 and 78 for identifying Class C β-lactamase nucleic acid.
According to fifth aspect, the present invention provides one or more of primer pair selected from the primer pair group consisting of a pair of Seq. No. 79 and 80, a pair of Seq. No. 81 and 82, a pair of Seq. No. 83 and 84, a pair of Seq. No. 85 and 86, a pair of Seq. No. 87 and 88, a pair of Seq. No. 89 and 90, a pair of Seq. No. 91 and 92, a pair of Seq. No. 93 and 94, a pair of Seq. No. 95 and 96, a pair of Seq. No. 97 and 98, a pair of Seq. No. 99 and 100, a pair of Seq. No. 101 and 102, a pair of Seq. No. 103 and 104, a pair of Seq. No. 105 and 106, and a pair of Seq. No. 107 and 108; and each of full-length complement primer pairs thereof for identifying Class D β-lactamase nucleic acid. Specifically, the present invention provides primer pairs consisting of a pair of Seq. No. 79 and 80, a pair of Seq. No. 81 and 82, a pair of Seq. No. 83 and 84, a pair of Seq. No. 85 and 86, a pair of Seq. No. 87 and 88, a pair of Seq. No. 89 and 90, a pair of Seq. No. 91 and 92, a pair of Seq. No. 93 and 94, a pair of Seq. No. 95 and 96, a pair of Seq. No. 97 and 98, a pair of Seq. No. 99 and 100, a pair of Seq. No. 101 and 102, a pair of Seq. No. 103 and 104, a pair of Seq. No. 105 and 106, and a pair of Seq. No. 107 and 108 for identifying Class D β-lactamase nucleic acid.
According to sixth aspect, the present invention provides a detection kit for identifying β-lactamase nucleic acid, wherein the kit comprises: According to a first aspect, the present invention provides a primer pair for identifying β-lactamase nucleic acid. The said primer pair could be selected from the primer pair group consisting of a pair of Seq. No. 1 and 2, a pair of Seq. 3 and 4, a pair of Seq. No. 5 and 6, a pair of Seq. No. 7 and 8, a pair of Seq. No. 9 and 10, a pair of Seq. No. 11 and 12, a pair of Seq. No. 13 and 14, a pair of Seq. No. 15 and 16, a pair of Seq. No. 17 and 18, a pair of Seq. No. 19 and 20, a pair of Seq. No. 21 and 22, a pair of Seq. No. 23 and 24, a pair of Seq. No. 25 and 26, a pair of Seq. No. 27 and 28, a pair of Seq. No. 29 and 30, a pair of Seq. No. 31 and 32, a pair of Seq. No. 33 and 34, a pair of Seq. No. 35 and 36, a pair of Seq. No. 37 and 38, a pair of Seq. No. 39 and 40, a pair of Seq. No. 41 and 42, a pair of Seq. No. 43 and 44, a pair of Seq. No. 45 and 46, a pair of Seq. No. 47 and 48, a pair of Seq. No. 49 and 50, a pair of Seq. No. 51 and 52, a pair of Seq. No. 53 and 54, No. 55 and 56, a pair of Seq. 57 and 58, a pair of Seq. No. 59 and 60, a pair of Seq. No. 61 and 62, a pair of Seq. No. 63 and 64, a pair of Seq. No. 65 and 66, a pair of Seq. No. 67 and 68, a pair of Seq. No. 69 and 70, a pair of Seq. No. 71 and 72, a pair of Seq. No. 73 and 74, a pair of Seq. No. 75 and 76, a pair of Seq. No. 77 and 78, a pair of Seq. No. 79 and 80, a pair of Seq. No. 81 and 82, a pair of Seq. No. 83 and 84, a pair of Seq. No. 85 and 86, a pair of Seq. No. 87 and 88, a pair of Seq. No. 89 and 90, a pair of Seq. No. 91 and 92, a pair of Seq. No. 93 and 94, a pair of Seq. No. 95 and 96, a pair of Seq. No. 97 and 98, a pair of Seq. No. 99 and 100, a pair of Seq. No. 101 and 102, a pair of Seq. No. 103 and 104, a pair of Seq. No. 105 and 106, and a pair of Seq. No. 107 and 108; and each of full-length complement primer pairs thereof. Specifically, the primer pairs could have at least two (2) primer pairs selected from the group. More specifically, the primer pairs could have at least five (5) primer pairs selected from the group. Further more specifically, the primer pairs could have at least eight (8) primer pairs selected from the group. Most specifically, the primer pairs could be the group having all of the primer pairs (total 54 primer pairs).
The terms “complement” and “complementary,” as used herein, refer to a nucleic acid that is capable of hybridizing to a specified nucleic acid molecule under stringent hybridization conditions. Thus, a specified DNA molecule is typically “complementary” to a nucleic acid if hybridization occurs between the specified DNA molecule and the nucleic acid. If the specified DNA molecule hybridizes to the full length of the nucleic acid molecule, then the specified DNA molecule is typically a “full-length complement.” “Complementary,” further refers to the capacity of purine and pyrimidine nucleotides to associate through hydrogen bonding in double stranded nucleic acid molecules. The following base pairs are complementary: guanine and cytosine; adenine and thymine; and adenine and uracil.
Hereinafter we use the classification of β-lactamase according to Ambler's molecular classification. The most widely used classification of β-lactamases is the Ambler classification35 that divides β-lactamases into four classes (A, B, C, and D) based upon their amino acid sequences. Ambler originally specified two classes: class A, the active-site serine β-lactamases; and class B, the metallo-β-lactamases that require a bivalent metal ion, usually Zn2+, for activity. Later a new class of serine β-lactamases was found that bore little sequence similarity to the then-known class A enzymes. Designated class C, its members are also known as the ‘AmpC’ β-lactamases. Another class of serine β-lactamases, familiarly known as the OXA β-lactamases, was found to bear little resemblance to either class A or class C and was designated class D. The three classes of serine β-lactamases are sufficiently different that alignment programs such as BLAST find no detectable sequence similarity, yet there is sufficient structural similarity among the three classes of serine β-lactamases that it is clear that they are homologous, i.e. descended from a common ancestor.
According to second aspect, the present invention provides one or more of primer pair for identifying Class A β-lactamase nucleic acid. The said primer pair could be one or more of primer pair selected from the primer pair group consisting of a pair of Seq. No. 1 and 2, a pair of Seq. 3 and 4, a pair of Seq. No. 5 and 6, a pair of Seq. No. 7 and 8, a pair of Seq. No. 9 and 10, a pair of Seq. No. 11 and 12, a pair of Seq. No. 13 and 14, a pair of Seq. No. 15 and 16, a pair of Seq. No. 17 and 18, a pair of Seq. No. 19 and 20, a pair of Seq. No. 21 and 22, a pair of Seq. No. 23 and 24, and a pair of Seq. No. 25 and 26; and each of full-length complement primer pairs thereof for identifying Class A β-lactamase nucleic acid. Specifically, the present invention provides primer pairs consisting of a pair of Seq. No. 1 and 2, a pair of Seq. 3 and 4, a pair of Seq. No. 5 and 6, a pair of Seq. No. 7 and 8, a pair of Seq. No. 9 and 10, a pair of Seq. No. 11 and 12, a pair of Seq. No. 13 and 14, a pair of Seq. No. 15 and 16, a pair of Seq. No. 17 and 18, a pair of Seq. No. 19 and 20, a pair of Seq. No. 21 and 22, a pair of Seq. No. 23 and 24, and a pair of Seq. No. 25 and 26 for identifying Class A β-lactamase nucleic acid.
According to third aspect, the present invention provides one or more of primer pair selected from the primer pair group consisting of a pair of Seq. No. 27 and 28, a pair of Seq. No. 29 and 30, a pair of Seq. No. 31 and 32, a pair of Seq. No. 33 and 34, a pair of Seq. No. 35 and 36, a pair of Seq. No. 37 and 38, a pair of Seq. No. 39 and 40, a pair of Seq. No. 41 and 42, a pair of Seq. No. 43 and 44, a pair of Seq. No. 45 and 46, a pair of Seq. No. 47 and 48, a pair of Seq. No. 49 and 50, a pair of Seq. No. 51 and 52, a pair of Seq. No. 53 and 54, No. 55 and 56, and a pair of Seq. 57 and 58; and each of full-length complement primer pairs thereof for identifying Class B β-lactamase nucleic acid. Specifically, the present invention provides primer pairs consisting of a pair of Seq. No. 27 and 28, a pair of Seq. No. 29 and 30, a pair of Seq. No. 31 and 32, a pair of Seq. No. 33 and 34, a pair of Seq. No. 35 and 36, a pair of Seq. No. 37 and 38, a pair of Seq. No. 39 and 40, a pair of Seq. No. 41 and 42, a pair of Seq. No. 43 and 44, a pair of Seq. No. 45 and 46, a pair of Seq. No. 47 and 48, a pair of Seq. No. 49 and 50, a pair of Seq. No. 51 and 52, a pair of Seq. No. 53 and 54, No. 55 and 56, and a pair of Seq. 57 and 58 for identifying Class B β-lactamase nucleic acid.
According to forth aspect, the present invention provides one or more of primer pair selected from the primer pair group consisting of a pair of Seq. No. 59 and 60, a pair of Seq. No. 61 and 62, a pair of Seq. No. 63 and 64, a pair of Seq. No. 65 and 66, a pair of Seq. No. 67 and 68, a pair of Seq. No. 69 and 70, a pair of Seq. No. 71 and 72, a pair of Seq. No. 73 and 74, a pair of Seq. No. 75 and 76, and a pair of Seq. No. 77 and 78; and each of full-length complement primer pairs thereof for identifying Class C β-lactamase nucleic acid. Specifically, the present invention provides primer pairs consisting of a pair of Seq. No. 59 and 60, a pair of Seq. No. 61 and 62, a pair of Seq. No. 63 and 64, a pair of Seq. No. 65 and 66, a pair of Seq. No. 67 and 68, a pair of Seq. No. 69 and 70, a pair of Seq. No. 71 and 72, a pair of Seq. No. 73 and 74, a pair of Seq. No. 75 and 76, and a pair of Seq. No. 77 and 78 for identifying Class C β-lactamase nucleic acid.
According to fifth aspect, the present invention provides one or more of primer pair selected from the primer pair group consisting of a pair of Seq. No. 79 and 80, a pair of Seq. No. 81 and 82, a pair of Seq. No. 83 and 84, a pair of Seq. No. 85 and 86, a pair of Seq. No. 87 and 88, a pair of Seq. No. 89 and 90, a pair of Seq. No. 91 and 92, a pair of Seq. No. 93 and 94, a pair of Seq. No. 95 and 96, a pair of Seq. No. 97 and 98, a pair of Seq. No. 99 and 100, a pair of Seq. No. 101 and 102, a pair of Seq. No. 103 and 104, a pair of Seq. No. 105 and 106, and a pair of Seq. No. 107 and 108; and each of full-length complement primer pairs thereof for identifying Class D β-lactamase nucleic acid. Specifically, the present invention provides primer pairs consisting of a pair of Seq. No. 79 and 80, a pair of Seq. No. 81 and 82, a pair of Seq. No. 83 and 84, a pair of Seq. No. 85 and 86, a pair of Seq. No. 87 and 88, a pair of Seq. No. 89 and 90, a pair of Seq. No. 91 and 92, a pair of Seq. No. 93 and 94, a pair of Seq. No. 95 and 96, a pair of Seq. No. 97 and 98, a pair of Seq. No. 99 and 100, a pair of Seq. No. 101 and 102, a pair of Seq. No. 103 and 104, a pair of Seq. No. 105 and 106, and a pair of Seq. No. 107 and 108 for identifying Class Dβ-lactamase nucleic acid.
According to sixth aspect, the present invention provides a detection kit for identifying β-lactamase nucleic acid, wherein the kit comprises:
a) at least a primer pair capable of hybridizing to β-lactamase nucleic acid;
b) at least one positive control and at least one negative control; and
c) a protocol for identification of β-lactamase nucleic acid;
wherein a primer pair is selected from the group consisting of a pair of Seq. No. 1 and 2, a pair of Seq. 3 and 4, a pair of Seq. No. 5 and 6, a pair of Seq. No. 7 and 8, a pair of Seq. No. 9 and 10, a pair of Seq. No. 11 and 12, a pair of Seq. No. 13 and 14, a pair of Seq. No. 15 and 16, a pair of Seq. No. 17 and 18, a pair of Seq. No. 19 and 20, a pair of Seq. No. 21 and 22, a pair of Seq. No. 23 and 24, a pair of Seq. No. 25 and 26, a pair of Seq. No. 27 and 28, a pair of Seq. No. 29 and 30, a pair of Seq. No. 31 and 32, a pair of Seq. No. 33 and 34, a pair of Seq. No. 35 and 36, a pair of Seq. No. 37 and 38, a pair of Seq. No. 39 and 40, a pair of Seq. No. 41 and 42, a pair of Seq. No. 43 and 44, a pair of Seq. No. 45 and 46, a pair of Seq. No. 47 and 48, a pair of Seq. No. 49 and 50, a pair of Seq. No. 51 and 52, a pair of Seq. No. 53 and 54, No. 55 and 56, a pair of Seq. 57 and 58, a pair of Seq. No. 59 and 60, a pair of Seq. No. 61 and 62, a pair of Seq. No. 63 and 64, a pair of Seq. No. 65 and 66, a pair of Seq. No. 67 and 68, a pair of Seq. No. 69 and 70, a pair of Seq. No. 71 and 72, a pair of Seq. No. 73 and 74, a pair of Seq. No. 75 and 76, a pair of Seq. No. 77 and 78, a pair of Seq. No. 79 and 80, a pair of Seq. No. 81 and 82, a pair of Seq. No. 83 and 84, a pair of Seq. No. 85 and 86, a pair of Seq. No. 87 and 88, a pair of Seq. No. 89 and 90, a pair of Seq. No. 91 and 92, a pair of Seq. No. 93 and 94, a pair of Seq. No. 95 and 96, a pair of Seq. No. 97 and 98, a pair of Seq. No. 99 and 100, a pair of Seq. No. 101 and 102, a pair of Seq. No. 103 and 104, a pair of Seq. No. 105 and 106, and a pair of Seq. No. 107 and 108; and each of full-length complement primer pairs thereof.
Specifically, the kit is for identifying class A β-lactamase nucleic acid comprising one or more of primer pair selected from the group consisting of a pair of Seq. No. 1 and 2, a pair of Seq. 3 and 4, a pair of Seq. No. 5 and 6, a pair of Seq. No. 7 and 8, a pair of Seq. No. 9 and 10, a pair of Seq. No. 11 and 12, a pair of Seq. No. 13 and 14, and a pair of Seq. No. 15 and 16, a pair of Seq. No. 17 and 18, a pair of Seq. No. 19 and 20, a pair of Seq. No. 21 and 22, a pair of Seq. No. 23 and 24, and a pair of Seq. No. 25 and 26; and each of full-length complement primer pairs thereof.
Specifically, the kit is for identifying class A (A1)β-lactamase nucleic acid comprising one or more of primer pair selected from the group consisting of a pair of Seq. No. 1 and 2, a pair of Seq. 3 and 4, a pair of Seq. No. 5 and 6, a pair of Seq. No. 7 and 8, a pair of Seq. No. 9 and 10, a pair of Seq. No. 11 and 12, a pair of Seq. No. 13 and 14, and a pair of Seq. No. 15 and 16.
Specifically, the kit is for identifying class A (A2)β-lactamase nucleic acid comprising one or more of primer pair selected from the group consisting of a pair of Seq. No. 17 and 18, a pair of Seq. No. 19 and 20, a pair of Seq. No. 21 and 22, a pair of Seq. No. 23 and 24, and a pair of Seq. No. 25 and 26; and each of full-length complement primer pairs thereof.
Specifically, the kit is for identifying class B β-lactamase nucleic acid comprising one or more of primer pair selected from the group consisting of a pair of Seq. No. 27 and 28, a pair of Seq. No. 29 and 30, a pair of Seq. No. 31 and 32, a pair of Seq. No. 33 and 34, a pair of Seq. No. 35 and 36, a pair of Seq. No. 37 and 38, a pair of Seq. No. 39 and 40, a pair of Seq. No. 41 and 42, a pair of Seq. No. 43 and 44, a pair of Seq. No. 45 and 46, a pair of Seq. No. 47 and 48, a pair of Seq. No. 49 and 50, a pair of Seq. No. 51 and 52, a pair of Seq. No. 53 and 54, No. 55 and 56, and a pair of Seq. 57 and 58; and each of full-length complement primer pairs thereof.
Specifically, the kit is for identifying class B (B1)β-lactamase nucleic acid comprising one or more of primer pair selected from the group consisting of a pair of Seq. No. 27 and 28, a pair of Seq. No. 29 and 30, a pair of Seq. No. 31 and 32, a pair of Seq. No. 33 and 34, a pair of Seq. No. 35 and 36, a pair of Seq. No. 37 and 38, a pair of Seq. No. 39 and 40, and a pair of Seq. No. 41 and 42; and each of full-length complement primer pairs thereof.
Specifically, the kit is for identifying class B (B2)β-lactamase nucleic acid comprising one or more of primer pair selected from the group consisting of a pair of Seq. No. 43 and 44, a pair of Seq. No. 45 and 46, a pair of Seq. No. 47 and 48, a pair of Seq. No. 49 and 50, a pair of Seq. No. 51 and 52, a pair of Seq. No. 53 and 54, No. 55 and 56, and a pair of Seq. 57 and 58; and each of full-length complement primer pairs thereof.
Specifically, the kit is for identifying class C β-lactamase nucleic acid comprising one or more of primer pair selected from the group consisting of a pair of Seq. No. 59 and 60, a pair of Seq. No. 61 and 62, a pair of Seq. No. 63 and 64, a pair of Seq. No. 65 and 66, a pair of Seq. No. 67 and 68, a pair of Seq. No. 69 and 70, a pair of Seq. No. 71 and 72, a pair of Seq. No. 73 and 74, a pair of Seq. No. 75 and 76, a pair of Seq. No. 77 and 78; and each of full-length complement primer pairs thereof.
Specifically, the kit is for identifying class C (C1)β-lactamase nucleic acid comprising one or more of primer pair selected from the group consisting of a pair of Seq. No. 59 and 60, a pair of Seq. No. 61 and 62, a pair of Seq. No. 63 and 64, a pair of Seq. No. 65 and 66, and a pair of Seq. No. 67 and 68; and each of full-length complement primer pairs thereof.
Specifically, the kit is for identifying class C (C2)β-lactamase nucleic acid comprising one or more of primer pair selected from the group consisting of a pair of Seq. No. 69 and 70, a pair of Seq. No. 71 and 72, a pair of Seq. No. 73 and 74, a pair of Seq. No. 75 and 76, a pair of Seq. No. 77 and 78; and each of full-length complement primer pairs thereof.
Specifically, the kit is for identifying class D β-lactamase nucleic acid comprising one or more of primer pair selected from the group consisting of a pair of Seq. No. 79 and 80, a pair of Seq. No. 81 and 82, a pair of Seq. No. 83 and 84, a pair of Seq. No. 85 and 86, a pair of Seq. No. 87 and 88, a pair of Seq. No. 89 and 90, a pair of Seq. No. 91 and 92, a pair of Seq. No. 93 and 94, a pair of Seq. No. 95 and 96, a pair of Seq. No. 97 and 98, a pair of Seq. No. 99 and 100, a pair of Seq. No. 101 and 102, a pair of Seq. No. 103 and 104, a pair of Seq. No. 105 and 106, and a pair of Seq. No. 107 and 108; and each of full-length complement primer pairs thereof.
Specifically, the kit is for identifying class D (D1) β-lactamase nucleic acid comprising one or more of primer pair selected from the group consisting of a pair of Seq. No. 79 and 80, a pair of Seq. No. 81 and 82, a pair of Seq. No. 83 and 84, a pair of Seq. No. 85 and 86, a pair of Seq. No. 87 and 88, a pair of Seq. No. 89 and 90, a pair of Seq. No. 91 and 92, and a pair of Seq. No. 93 and 94; and each of full-length complement primer pairs thereof.
Specifically, the kit is for identifying class D (D2) β-lactamase nucleic acid comprising one or more of primer pair selected from the group consisting of a pair of Seq. No. 95 and 96, a pair of Seq. No. 97 and 98, a pair of Seq. No. 99 and 100, a pair of Seq. No. 101 and 102, a pair of Seq. No. 103 and 104, a pair of Seq. No. 105 and 106, and a pair of Seq. No. 107 and 108; and each of full-length complement primer pairs thereof.
According to seventh aspect, the present invention provides a method of identifying β-lactamase type from a sample, comprising:
(a) contacting in solution said sample with one of more of primer pairs selected from the primer pair group comprising of a pair of Seq. No. 1 and 2, a pair of Seq. 3 and 4, a pair of Seq. No. 5 and 6, a pair of Seq. No. 7 and 8, a pair of Seq. No. 9 and 10, a pair of Seq. No. 11 and 12, a pair of Seq. No. 13 and 14, a pair of Seq. No. 15 and 16, a pair of Seq. No. 17 and 18, a pair of Seq. No. 19 and 20, a pair of Seq. No. 21 and 22, a pair of Seq. No. 23 and 24, a pair of Seq. No. 25 and 26, a pair of Seq. No. 27 and 28, a pair of Seq. No. 29 and 30, a pair of Seq. No. 31 and 32, a pair of Seq. No. 33 and 34, a pair of Seq. No. 35 and 36, a pair of Seq. No. 37 and 38, a pair of Seq. No. 39 and 40, a pair of Seq. No. 41 and 42, a pair of Seq. No. 43 and 44, a pair of Seq. No. 45 and 46, a pair of Seq. No. 47 and 48, a pair of Seq. No. 49 and 50, a pair of Seq. No. 51 and 52, a pair of Seq. No. 53 and 54, No. 55 and 56, a pair of Seq. 57 and 58, a pair of Seq. No. 59 and 60, a pair of Seq. No. 61 and 62, a pair of Seq. No. 63 and 64, a pair of Seq. No. 65 and 66, a pair of Seq. No. 67 and 68, a pair of Seq. No. 69 and 70, a pair of Seq. No. 71 and 72, a pair of Seq. No. 73 and 74, a pair of Seq. No. 75 and 76, a pair of Seq. No. 77 and 78, a pair of Seq. No. 79 and 80, a pair of Seq. No. 81 and 82, a pair of Seq. No. 83 and 84, a pair of Seq. No. 85 and 86, a pair of Seq. No. 87 and 88, a pair of Seq. No. 89 and 90, a pair of Seq. No. 91 and 92, a pair of Seq. No. 93 and 94, a pair of Seq. No. 95 and 96, a pair of Seq. No. 97 and 98, a pair of Seq. No. 99 and 100, a pair of Seq. No. 101 and 102, a pair of Seq. No. 103 and 104, a pair of Seq. No. 105 and 106, and a pair of Seq. No. 107 and 108; and each of full-length complement primer pairs thereof;
(b) simultaneously amplifying by polymerase chain reaction (PCR) in one reaction chamber using said primer pair to produce amplified nucleic acid products; and
(c) detecting said nucleic acid products by gel electrophoresis.
Specifically, the present invention could be a method of identifying Class C β-lactamase type from a sample, comprising:
(a) contacting in solution said sample with one or more of primer pairs for Class A1 β-lactamase selected from the group comprising a pair of Seq. No. 1 and 2, a pair of Seq. 3 and 4, a pair of Seq. No. 5 and 6, a pair of Seq. No. 7 and 8, a pair of Seq. No. 9 and 10, a pair of Seq. No. 11 and 12, a pair of Seq. No. 13 and 14, a pair of Seq. No. 15 and 16; one or more of primer pairs for Class A2 β-lactamase selected from the group comprising a pair of No. 17 and 18, a pair of Seq. No. 19 and 20, a pair of Seq. No. 21 and 22, a pair of Seq. No. 23 and 24, a pair of Seq. No. 25 and 26; one or more of primer pairs for Class B1 β-lactamase selected from the group comprising a pair of No. 27 and 28, a pair of Seq. No. 29 and 30, a pair of Seq. No. 31 and 32, a pair of Seq. No. 33 and 34, a pair of Seq. No. 35 and 36, a pair of Seq. No. 37 and 38, a pair of Seq. No. 39 and 40, a pair of Seq. No. 41 and 42; one or more of primer pairs for Class B2 β-lactamase selected from the group comprising a pair of No. 43 and 44, a pair of Seq. No. 45 and 46, a pair of Seq. No. 47 and 48, a pair of Seq. No. 49 and 50, a pair of Seq. No. 51 and 52, a pair of Seq. No. 53 and 54, No. 55 and 56, a pair of Seq. 57 and 58; one or more of primer pairs for Class C1 β-lactamase selected from the group comprising a pair of Seq. No. 59 and 60, a pair of Seq. No. 61 and 62, a pair of Seq. No. 63 and 64, a pair of Seq. No. 65 and 66, a pair of Seq. No. 67 and 68; one or more of primer pairs for Class C2 β-lactamase selected from the group comprising a pair of Seq. No. 69 and 70, a pair of Seq. No. 71 and 72, a pair of Seq. No. 73 and 74, a pair of Seq. No. 75 and 76, a pair of Seq. No. 77 and 78; one or more of primer pairs for Class D1 β-lactamase selected from the group comprising a pair of No. 79 and 80, a pair of Seq. No. 81 and 82, a pair of Seq. No. 83 and 84, a pair of Seq. No. 85 and 86, a pair of Seq. No. 87 and 88, a pair of Seq. No. 89 and 90, a pair of Seq. No. 91 and 92, a pair of Seq. No. 93 and 94; and one or more of primer pairs for Class D2 β-lactamase selected from the group comprising a pair of Seq. No. 95 and 96, a pair of Seq. No. 97 and 98, a pair of Seq. No. 99 and 100, a pair of Seq. No. 101 and 102, a pair of Seq. No. 103 and 104, a pair of Seq. No. 105 and 106, and a pair of Seq. No. 107 and 108;
(b) simultaneously amplifying by polymerase chain reaction (PCR) in a different reaction chamber for each class of β-lactamase using each class of primer pair to produce amplified nucleic acid products; and
(c) detecting said nucleic acid products of each chamber by gel electrophoresis.
More specifically, the present invention could comprise further step for sequencing of PCR product.
According to an embodiment of the present invention, primer pairs consist of a pair of Seq. No. 1 and 2, a pair of Seq. 3 and 4, a pair of Seq. No. 5 and 6, a pair of Seq. No. 7 and 8, a pair of Seq. No. 9 and 10, a pair of Seq. No. 11 and 12, a pair of Seq. No. 13 and 14, a pair of Seq. No. 15 and 16, a pair of Seq. No. 17 and 18, a pair of Seq. No. 19 and 20, a pair of Seq. No. 21 and 22, a pair of Seq. No. 23 and 24, and a pair of Seq. No. 25 and 26 for identifying Class A β-lactamase nucleic acid.
According to an embodiment of the present invention, a primer pair is selected from the primer pair group consisting of a pair of Seq. No. 27 and 28, a pair of Seq. No. 29 and 30, a pair of Seq. No. 31 and 32, a pair of Seq. No. 33 and 34, a pair of Seq. No. 35 and 36, a pair of Seq. No. 37 and 38, a pair of Seq. No. 39 and 40, a pair of Seq. No. 41 and 42, a pair of Seq. No. 43 and 44, a pair of Seq. No. 45 and 46, a pair of Seq. No. 47 and 48, a pair of Seq. No. 49 and 50, a pair of Seq. No. 51 and 52, a pair of Seq. No. 53 and 54, No. 55 and 56, and a pair of Seq. 57 and 58; and each of full-length complement primer pairs thereof for identifying Class B β-lactamase nucleic acid.
According to an embodiment of the present invention, primer pairs consist of a pair of Seq. No. 27 and 28, a pair of Seq. No. 29 and 30, a pair of Seq. No. 31 and 32, a pair of Seq. No. 33 and 34, a pair of Seq. No. 35 and 36, a pair of Seq. No. 37 and 38, a pair of Seq. No. 39 and 40, a pair of Seq. No. 41 and 42, a pair of Seq. No. 43 and 44, a pair of Seq. No. 45 and 46, a pair of Seq. No. 47 and 48, a pair of Seq. No. 49 and 50, a pair of Seq. No. 51 and 52, a pair of Seq. No. 53 and 54, No. 55 and 56, and a pair of Seq. 57 and 58 for identifying Class B β-lactamase nucleic acid.
According to an embodiment of the present invention, a primer pair is selected from the primer pair group consisting of a pair of Seq. No. 59 and 60, a pair of Seq. No. 61 and 62, a pair of Seq. No. 63 and 64, a pair of Seq. No. 65 and 66, a pair of Seq. No. 67 and 68, a pair of Seq. No. 69 and 70, a pair of Seq. No. 71 and 72, a pair of Seq. No. 73 and 74, a pair of Seq. No. 75 and 76, and a pair of Seq. No. 77 and 78; and each of full-length complement primer pairs thereof for identifying Class C β-lactamase nucleic acid.
According to an embodiment of the present invention, primer pairs consist of a pair of Seq. No. 59 and 60, a pair of Seq. No. 61 and 62, a pair of Seq. No. 63 and 64, a pair of Seq. No. 65 and 66, a pair of Seq. No. 67 and 68, a pair of Seq. No. 69 and 70, a pair of Seq. No. 71 and 72, a pair of Seq. No. 73 and 74, a pair of Seq. No. 75 and 76, and a pair of Seq. No. 77 and 78 for identifying Class C β-lactamase nucleic acid.
According to an embodiment of the present invention, a primer pair is selected from the primer pair group consisting of a pair of Seq. No. 79 and 80, a pair of Seq. No. 81 and 82, a pair of Seq. No. 83 and 84, a pair of Seq. No. 85 and 86, a pair of Seq. No. 87 and 88, a pair of Seq. No. 89 and 90, a pair of Seq. No. 91 and 92, a pair of Seq. No. 93 and 94, a pair of Seq. No. 95 and 96, a pair of Seq. No. 97 and 98, a pair of Seq. No. 99 and 100, a pair of Seq. No. 101 and 102, a pair of Seq. No. 103 and 104, a pair of Seq. No. 105 and 106, and a pair of Seq. No. 107 and 108; and each of full-length complement primer pairs thereof for identifying Class D β-lactamase nucleic acid.
According to an embodiment of the present invention, primer pairs consist of a pair of Seq. No. 79 and 80, a pair of Seq. No. 81 and 82, a pair of Seq. No. 83 and 84, a pair of Seq. No. 85 and 86, a pair of Seq. No. 87 and 88, a pair of Seq. No. 89 and 90, a pair of Seq. No. 91 and 92, a pair of Seq. No. 93 and 94, a pair of Seq. No. 95 and 96, a pair of Seq. No. 97 and 98, a pair of Seq. No. 99 and 100, a pair of Seq. No. 101 and 102, a pair of Seq. No. 103 and 104, a pair of Seq. No. 105 and 106, and a pair of Seq. No. 107 and 108 for identifying Class D β-lactamase nucleic acid.
According to an embodiment of the present invention, a detection kit is for identifying β-lactamase nucleic acid, wherein the kit comprises: a) at least a primer pair capable of hybridizing to β-lactamase nucleic acid; b) at least one positive control and at least one negative control; and c) a protocol for identification of β-lactamase nucleic acid; wherein a primer pair is selected from the group consisting of a pair of Seq. No. 1 and 2, a pair of Seq. 3 and 4, a pair of Seq. No. 5 and 6, a pair of Seq. No. 7 and 8, a pair of Seq. No. 9 and 10, a pair of Seq. No. 11 and 12, a pair of Seq. No. 13 and 14, a pair of Seq. No. 15 and 16, a pair of Seq. No. 17 and 18, a pair of Seq. No. 19 and 20, a pair of Seq. No. 21 and 22, a pair of Seq. No. 23 and 24, a pair of Seq. No. 25 and 26, a pair of Seq. No. 27 and 28, a pair of Seq. No. 29 and 30, a pair of Seq. No. 31 and 32, a pair of Seq. No. 33 and 34, a pair of Seq. No. 35 and 36, a pair of Seq. No. 37 and 38, a pair of Seq. No. 39 and 40, a pair of Seq. No. 41 and 42, a pair of Seq. No. 43 and 44, a pair of Seq. No. 45 and 46, a pair of Seq. No. 47 and 48, a pair of Seq. No. 49 and 50, a pair of Seq. No. 51 and 52, a pair of Seq. No. 53 and 54, No. 55 and 56, a pair of Seq. 57 and 58, a pair of Seq. No. 59 and 60, a pair of Seq. No. 61 and 62, a pair of Seq. No. 63 and 64, a pair of Seq. No. 65 and 66, a pair of Seq. No. 67 and 68, a pair of Seq. No. 69 and 70, a pair of Seq. No. 71 and 72, a pair of Seq. No. 73 and 74, a pair of Seq. No. 75 and 76, a pair of Seq. No. 77 and 78, a pair of Seq. No. 79 and 80, a pair of Seq. No. 81 and 82, a pair of Seq. No. 83 and 84, a pair of Seq. No. 85 and 86, a pair of Seq. No. 87 and 88, a pair of Seq. No. 89 and 90, a pair of Seq. No. 91 and 92, a pair of Seq. No. 93 and 94, a pair of Seq. No. 95 and 96, a pair of Seq. No. 97 and 98, a pair of Seq. No. 99 and 100, a pair of Seq. No. 101 and 102, a pair of Seq. No. 103 and 104, a pair of Seq. No. 105 and 106, and a pair of Seq. No. 107 and 108; and each of full-length complement primer pairs thereof.
According to an embodiment of the present invention, a detection kit for identifying class A β-lactamase nucleic acid, wherein the kit comprises: a) at least a primer pair capable of hybridizing to class A β-lactamase nucleic acid; b) at least one positive control and at least one negative control; and c) a protocol for identification of class D β-lactamase nucleic acid; wherein a primer pair is selected from the group consisting of a pair of Seq. No. 1 and 2, a pair of Seq. 3 and 4, a pair of Seq. No. 5 and 6, a pair of Seq. No. 7 and 8, a pair of Seq. No. 9 and 10, a pair of Seq. No. 11 and 12, a pair of Seq. No. 13 and 14, a pair of Seq. No. 15 and 16, a pair of Seq. No. 17 and 18, a pair of Seq. No. 19 and 20, a pair of Seq. No. 21 and 22, a pair of Seq. No. 23 and 24, and a pair of Seq. No. 25 and 26; and each of full-length complement primer pairs thereof.
According to an embodiment of the present invention, a detection kit for identifying class A (A1) β-lactamase nucleic acid, wherein the kit comprises: a) at least a primer pair capable of hybridizing to class A (A1) β-lactamase nucleic acid; b) at least one positive control and at least one negative control; and c) a protocol for identification of class A β-lactamase nucleic acid; wherein a primer pair is selected from the group consisting of a pair of Seq. No. 1 and 2, a pair of Seq. 3 and 4, a pair of Seq. No. 5 and 6, a pair of Seq. No. 7 and 8, a pair of Seq. No. 9 and 10, a pair of Seq. No. 11 and 12, a pair of Seq. No. 13 and 14, and a pair of Seq. No. 15 and 16; and each of full-length complement primer pairs thereof.
According to an embodiment of the present invention, a detection kit is for identifying class A (A1)β-lactamase nucleic acid, wherein the kit comprises: a) primer pairs capable of hybridizing to class A (A1) β-lactamase nucleic acid; b) at least one positive control and at least one negative control; and c) a protocol for identification of class A (A1)β-lactamase nucleic acid; wherein the said primer pairs consists of a pair of Seq. No. 1 and 2, a pair of Seq. 3 and 4, a pair of Seq. No. 5 and 6, a pair of Seq. No. 7 and 8, a pair of Seq. No. 9 and 10, a pair of Seq. No. 11 and 12, a pair of Seq. No. 13 and 14, and a pair of Seq. No. 15 and 16.
According to an embodiment of the present invention, a detection kit is for identifying class A (A2)β-lactamase nucleic acid, wherein the kit comprises: a) at least a primer pair capable of hybridizing to class A (A2)β-lactamase nucleic acid; b) at least one positive control and at least one negative control; and c) a protocol for identification of class A (A2)β-lactamase nucleic acid; wherein a primer pair is selected from the group consisting of a pair of Seq. No. 17 and 18, a pair of Seq. No. 19 and 20, a pair of Seq. No. 21 and 22, a pair of Seq. No. 23 and 24, and a pair of Seq. No. 25 and 26; and each of full-length complement primer pairs thereof.
According to an embodiment of the present invention, a detection kit for identifying class A (A2) β-lactamase nucleic acid, wherein the kit comprises: a) primer pairs capable of hybridizing to class A (A2) β-lactamase nucleic acid; b) at least one positive control and at least one negative control; and c) a protocol for identification of class A (A2)β-lactamase nucleic acid; wherein the said primer pairs consists of a pair of Seq. No. 17 and 18, a pair of Seq. No. 19 and 20, a pair of Seq. No. 21 and 22, a pair of Seq. No. 23 and 24, and a pair of Seq. No. 25 and 26.
According to an embodiment of the present invention, a detection kit is for identifying class B β-lactamase nucleic acid, wherein the kit comprises: a) at least a primer pair capable of hybridizing to class B β-lactamase nucleic acid; b) at least one positive control and at least one negative control; and c) a protocol for identification of class B β-lactamase nucleic acid; wherein a primer pair is selected from the group consisting of a pair of Seq. No. 27 and 28, a pair of Seq. No. 29 and 30, a pair of Seq. No. 31 and 32, a pair of Seq. No. 33 and 34, a pair of Seq. No. 35 and 36, a pair of Seq. No. 37 and 38, a pair of Seq. No. 39 and 40, a pair of Seq. No. 41 and 42, a pair of Seq. No. 43 and 44, a pair of Seq. No. 45 and 46, a pair of Seq. No. 47 and 48, a pair of Seq. No. 49 and 50, a pair of Seq. No. 51 and 52, a pair of Seq. No. 53 and 54, No. 55 and 56, and a pair of Seq. 57 and 58; and each of full-length complement primer pairs thereof.
According to an embodiment of the present invention, a detection kit is for identifying class B (B1)β-lactamase nucleic acid, wherein the kit comprises: a) at least a primer pair capable of hybridizing to class B (B1)β-lactamase nucleic acid; b) at least one positive control and at least one negative control; and c) a protocol for identification of class B (B1)β-lactamase nucleic acid; wherein a primer pair is selected from the group consisting of a pair of a pair of Seq. No. 27 and 28, a pair of Seq. No. 29 and 30, a pair of Seq. No. 31 and 32, a pair of Seq. No. 33 and 34, a pair of Seq. No. 35 and 36, a pair of Seq. No. 37 and 38, a pair of Seq. No. 39 and 40, and a pair of Seq. No. 41 and 42; and each of full-length complement primer pairs thereof.
According to an embodiment of the present invention, a detection kit is for identifying class B (B1)β-lactamase nucleic acid, wherein the kit comprises: a) primer pairs capable of hybridizing to class B (B1)β-lactamase nucleic acid; b) at least one positive control and at least one negative control; and c) a protocol for identification of class B β-lactamase nucleic acid; wherein the said primer pairs consists of a pair of Seq. No. 27 and 28, a pair of Seq. No. 29 and 30, a pair of Seq. No. 31 and 32, a pair of Seq. No. 33 and 34, a pair of Seq. No. 35 and 36, a pair of Seq. No. 37 and 38, a pair of Seq. No. 39 and 40, and a pair of Seq. No. 41 and 42.
According to an embodiment of the present invention, a detection kit for identifying class B (B2)β-lactamase nucleic acid, wherein the kit comprises: a) at least a primer pair capable of hybridizing to class B (B2)β-lactamase nucleic acid; b) at least one positive control and at least one negative control; and c) a protocol for identification of class B (B2)β-lactamase nucleic acid; wherein a primer pair is selected from the group consisting of a pair of Seq. No. 43 and 44, a pair of Seq. No. 45 and 46, a pair of Seq. No. 47 and 48, a pair of Seq. No. 49 and 50, a pair of Seq. No. 51 and 52, a pair of Seq. No. 53 and 54, No. 55 and 56, and a pair of Seq. 57 and 58; and each of full-length complement primer pairs thereof.
According to an embodiment of the present invention, a detection kit for identifying class B (B2)β-lactamase nucleic acid, wherein the kit comprises: a) primer pairs capable of hybridizing to class B (B2)β-lactamase nucleic acid; b) at least one positive control and at least one negative control; and c) a protocol for identification of class B (B2)β-lactamase nucleic acid; wherein the said primer pairs consists of a pair of Seq. No. 43 and 44, a pair of Seq. No. 45 and 46, a pair of Seq. No. 47 and 48, a pair of Seq. No. 49 and 50, a pair of Seq. No. 51 and 52, a pair of Seq. No. 53 and 54, No. 55 and 56, and a pair of Seq. 57 and 58.
According to an embodiment of the present invention, a detection kit is for identifying class Cβ-lactamase nucleic acid, wherein the kit comprises: a) at least a primer pair capable of hybridizing to class Cβ-lactamase nucleic acid; b) at least one positive control and at least one negative control; and c) a protocol for identification of class C β-lactamase nucleic acid; wherein a primer pair is selected from the group a pair of Seq. No. 59 and 60, a pair of Seq. No. 61 and 62, a pair of Seq. No. 63 and 64, a pair of Seq. No. 65 and 66, a pair of Seq. No. 67 and 68, a pair of Seq. No. 69 and 70, a pair of Seq. No. 71 and 72, a pair of Seq. No. 73 and 74, a pair of Seq. No. 75 and 76, a pair of Seq. No. 77 and 78; and each of full-length complement primer pairs thereof.
According to an embodiment of the present invention, a detection kit for identifying class C (C1)β-lactamase nucleic acid, wherein the kit comprises: a) at least a primer pair capable of hybridizing to class C (C1)β-lactamase nucleic acid; b) at least one positive control and at least one negative control; and c) a protocol for identification of class C (C1) β-lactamase nucleic acid; wherein a primer pair is selected from the group a pair of a pair of Seq. No. 59 and 60, a pair of Seq. No. 61 and 62, a pair of Seq. No. 63 and 64, a pair of Seq. No. 65 and 66, and a pair of Seq. No. 67 and 68; and each of full-length complement primer pairs thereof.
According to an embodiment of the present invention, a detection kit is for identifying class C (C1)β-lactamase nucleic acid, wherein the kit comprises: a) primer pairs capable of hybridizing to class C (C1)β-lactamase nucleic acid; b) at least one positive control and at least one negative control; and c) a protocol for identification of class C (C1) β-lactamase nucleic acid; wherein the said primer pairs consists of a pair of a pair of Seq. No. 59 and 60, a pair of Seq. No. 61 and 62, a pair of Seq. No. 63 and 64, a pair of Seq. No. 65 and 66, and a pair of Seq. No. 67 and 68.
According to an embodiment of the present invention, a detection kit for identifying class C (C2)β-lactamase nucleic acid, wherein the kit comprises: a) at least a primer pair capable of hybridizing to class C (C2)β-lactamase nucleic acid; b) at least one positive control and at least one negative control; and c) a protocol for identification of class C (C2) β-lactamase nucleic acid; wherein a primer pair is selected from the group a pair of Seq. No. 69 and 70, a pair of Seq. No. 71 and 72, a pair of Seq. No. 73 and 74, a pair of Seq. No. 75 and 76, and a pair of Seq. No. 77 and 78; and each of full-length complement primer pairs thereof.
According to an embodiment of the present invention, a detection kit is for identifying class C (C2)β-lactamase nucleic acid, wherein the kit comprises: a) primer pairs capable of hybridizing to class C (C2)β-lactamase nucleic acid; b) at least one positive control and at least one negative control; and c) a protocol for identification of class C (C2) β-lactamase nucleic acid; wherein the said primer pairs consists of a pair of Seq. No. 69 and 70, a pair of Seq. No. 71 and 72, a pair of Seq. No. 73 and 74, a pair of Seq. No. 75 and 76, a pair of Seq. No. 77 and 78.
According to an embodiment of the present invention, a detection kit for identifying class D β-lactamase nucleic acid, wherein the kit comprises: a) at least a primer pair capable of hybridizing to class A β-lactamase nucleic acid; b) at least one positive control and at least one negative control; and c) a protocol for identification of class D β-lactamase nucleic acid; wherein a primer pair is selected from the group consisting of a pair of Seq. No. 79 and 80, a pair of Seq. No. 81 and 82, a pair of Seq. No. 83 and 84, a pair of Seq. No. 85 and 86, a pair of Seq. No. 87 and 88, a pair of Seq. No. 89 and 90, a pair of Seq. No. 91 and 92, a pair of Seq. No. 93 and 94, a pair of Seq. No. 95 and 96, a pair of Seq. No. 97 and 98, a pair of Seq. No. 99 and 100, a pair of Seq. No. 101 and 102, a pair of Seq. No. 103 and 104, a pair of Seq. No. 105 and 106, and a pair of Seq. No. 107 and 108; and each of full-length complement primer pairs thereof.
According to an embodiment of the present invention, a detection kit for identifying class D (D1) β-lactamase nucleic acid, wherein the kit comprises: a) at least a primer pair capable of hybridizing to class D (D1) β-lactamase nucleic acid; b) at least one positive control and at least one negative control; and c) a protocol for identification of class D (D1) β-lactamase nucleic acid; wherein a primer pair is selected from the group consisting of a pair of Seq. No. 79 and 80, a pair of Seq. No. 81 and 82, a pair of Seq. No. 83 and 84, a pair of Seq. No. 85 and 86, a pair of Seq. No. 87 and 88, a pair of Seq. No. 89 and 90, a pair of Seq. No. 91 and 92, and a pair of Seq. No. 93 and 94; and each of full-length complement primer pairs thereof.
According to an embodiment of the present invention, a detection kit is for identifying class D (D1)β-lactamase nucleic acid, wherein the kit comprises: a) primer pairs capable of hybridizing to class D (D1) β-lactamase nucleic acid; b) at least one positive control and at least one negative control; and c) a protocol for identification of class D (D1) β-lactamase nucleic acid; wherein the said primer pairs consists of Seq. No. 79 and 80, a pair of Seq. No. 81 and 82, a pair of Seq. No. 83 and 84, a pair of Seq. No. 85 and 86, a pair of Seq. No. 87 and 88, a pair of Seq. No. 89 and 90, a pair of Seq. No. 91 and 92, and a pair of Seq. No. 93 and 94.
According to an embodiment of the present invention, a detection kit is for identifying class D (D2)β-lactamase nucleic acid, wherein the kit comprises: a) at least a primer pair capable of hybridizing to class D (D2)β-lactamase nucleic acid; b) at least one positive control and at least one negative control; and c) a protocol for identification of class D (D2)β-lactamase nucleic acid; wherein a primer pair is selected from the group consisting of a pair of Seq. No. 95 and 96, a pair of Seq. No. 97 and 98, a pair of Seq. No. 99 and 100, a pair of Seq. No. 101 and 102, a pair of Seq. No. 103 and 104, a pair of Seq. No. 105 and 106, and a pair of Seq. No. 107 and 108; and each of full-length complement primer pairs thereof.
According to an embodiment of the present invention, a detection kit is for identifying class D (D2)β-lactamase nucleic acid, wherein the kit comprises: a) primer pairs capable of hybridizing to class D (D2) β-lactamase nucleic acid; b) at least one positive control and at least one negative control; and c) a protocol for identification of class D (D2)β-lactamase nucleic acid; wherein the said primer pairs consists of a pair of Seq. No. 95 and 96, a pair of Seq. No. 97 and 98, a pair of Seq. No. 99 and 100, a pair of Seq. No. 101 and 102, a pair of Seq. No. 103 and 104, a pair of Seq. No. 105 and 106, and a pair of Seq. No. 107 and 108.
According to an embodiment of the present invention, a method of identifying β-lactamase type from a sample, includes: (a) contacting in solution said sample with one of more of primer pairs selected from the primer pair group comprising of a pair of Seq. No. 1 and 2, a pair of Seq. 3 and 4, a pair of Seq. No. 5 and 6, a pair of Seq. No. 7 and 8, a pair of Seq. No. 9 and 10, a pair of Seq. No. 11 and 12, a pair of Seq. No. 13 and 14, a pair of Seq. No. 15 and 16, a pair of Seq. No. 17 and 18, a pair of Seq. No. 19 and 20, a pair of Seq. No. 21 and 22, a pair of Seq. No. 23 and 24, a pair of Seq. No. 25 and 26, a pair of Seq. No. 27 and 28, a pair of Seq. No. 29 and 30, a pair of Seq. No. 31 and 32, a pair of Seq. No. 33 and 34, a pair of Seq. No. 35 and 36, a pair of Seq. No. 37 and 38, a pair of Seq. No. 39 and 40, a pair of Seq. No. 41 and 42, a pair of Seq. No. 43 and 44, a pair of Seq. No. 45 and 46, a pair of Seq. No. 47 and 48, a pair of Seq. No. 49 and 50, a pair of Seq. No. 51 and 52, a pair of Seq. No. 53 and 54, No. 55 and 56, a pair of Seq. 57 and 58, a pair of Seq. No. 59 and 60, a pair of Seq. No. 61 and 62, a pair of Seq. No. 63 and 64, a pair of Seq. No. 65 and 66, a pair of Seq. No. 67 and 68, a pair of Seq. No. 69 and 70, a pair of Seq. No. 71 and 72, a pair of Seq. No. 73 and 74, a pair of Seq. No. 75 and 76, a pair of Seq. No. 77 and 78, a pair of Seq. No. 79 and 80, a pair of Seq. No. 81 and 82, a pair of Seq. No. 83 and 84, a pair of Seq. No. 85 and 86, a pair of Seq. No. 87 and 88, a pair of Seq. No. 89 and 90, a pair of Seq. No. 91 and 92, a pair of Seq. No. 93 and 94, a pair of Seq. No. 95 and 96, a pair of Seq. No. 97 and 98, a pair of Seq. No. 99 and 100, a pair of Seq. No. 101 and 102, a pair of Seq. No. 103 and 104, a pair of Seq. No. 105 and 106, and a pair of Seq. No. 107 and 108; and each of full-length complement primer pairs thereof; (b) simultaneously amplifying by polymerase chain reaction (PCR) in one reaction chamber using said primer pair to produce amplified nucleic acid products; and (c) detecting said nucleic acid products by gel electrophoresis.
According to an embodiment of the present invention, a method of identifying Class A β-lactamase type from a sample, includes: (a) contacting in solution said sample with a primer pair selected from the primer pair group comprising of a pair of No. 1 and 2, a pair of Seq. 3 and 4, a pair of Seq. No. 5 and 6, a pair of Seq. No. 7 and 8, a pair of Seq. No. 9 and 10, a pair of Seq. No. 11 and 12, a pair of Seq. No. 13 and 14, a pair of Seq. No. 15 and 16, a pair of Seq. No. 17 and 18, a pair of Seq. No. 19 and 20, a pair of Seq. No. 21 and 22, a pair of Seq. No. 23 and 24, and a pair of Seq. No. 25 and 26; and each of full-length complement primer pairs thereof; (b) simultaneously amplifying by polymerase chain reaction (PCR) in one reaction chamber using said primer pair to produce amplified nucleic acid products; and (c) detecting said nucleic acid products by gel electrophoresis.
According to an embodiment of the present invention, a method of identifying Class B β-lactamase type from a sample, includes: (a) contacting in solution said sample with a primer pair selected from the primer pair group comprising of a pair of No. 27 and 28, a pair of Seq. No. 29 and 30, a pair of Seq. No. 31 and 32, a pair of Seq. No. 33 and 34, a pair of Seq. No. 35 and 36, a pair of Seq. No. 37 and 38, a pair of Seq. No. 39 and 40, a pair of Seq. No. 41 and 42, a pair of Seq. No. 43 and 44, a pair of Seq. No. 45 and 46, a pair of Seq. No. 47 and 48, a pair of Seq. No. 49 and 50, a pair of Seq. No. 51 and 52, a pair of Seq. No. 53 and 54, No. 55 and 56, and a pair of Seq. 57 and 58; and each of full-length complement primer pairs thereof; (b) simultaneously amplifying by polymerase chain reaction (PCR) in one reaction chamber using said primer pair to produce amplified nucleic acid products; and (c) detecting said nucleic acid products by gel electrophoresis.
According to an embodiment of the present invention, a method of identifying Class C β-lactamase type from a sample, includes: (a) contacting in solution said sample with a primer pair selected from the primer pair group comprising of a pair of Seq. No. 59 and 60, a pair of Seq. No. 61 and 62, a pair of Seq. No. 63 and 64, a pair of Seq. No. 65 and 66, a pair of Seq. No. 67 and 68, a pair of Seq. No. 69 and 70, a pair of Seq. No. 71 and 72, a pair of Seq. No. 73 and 74, a pair of Seq. No. 75 and 76, and a pair of Seq. No. 77 and 78; and each of full-length complement primer pairs thereof; (b) simultaneously amplifying by polymerase chain reaction (PCR) in one reaction chamber using said primer pair to produce amplified nucleic acid products; and (c) detecting said nucleic acid products by gel electrophoresis.
According to an embodiment of the present invention, a method of identifying Class C β-lactamase type from a sample, includes: (a) contacting in solution said sample with a primer pair selected from the primer pair group comprising of a pair of Seq. No. 79 and 80, a pair of Seq. No. 81 and 82, a pair of Seq. No. 83 and 84, a pair of Seq. No. 85 and 86, a pair of Seq. No. 87 and 88, a pair of Seq. No. 89 and 90, a pair of Seq. No. 91 and 92, a pair of Seq. No. 93 and 94, a pair of Seq. No. 95 and 96, a pair of Seq. No. 97 and 98, a pair of Seq. No. 99 and 100, a pair of Seq. No. 101 and 102, a pair of Seq. No. 103 and 104, a pair of Seq. No. 105 and 106, and a pair of Seq. No. 107 and 108; and each of full-length complement primer pairs thereof; (b) simultaneously amplifying by polymerase chain reaction (PCR) in one reaction chamber using said primer pair to produce amplified nucleic acid products; and (c) detecting said nucleic acid products by gel electrophoresis.
According to an embodiment of the present invention, a method of identifying Class C β-lactamase type from a sample, includes: (a) contacting in solution said sample with one or more of primer pairs for Class A1 β-lactamase selected from the group comprising a pair of Seq. No. 1 and 2, a pair of Seq. 3 and 4, a pair of Seq. No. 5 and 6, a pair of Seq. No. 7 and 8, a pair of Seq. No. 9 and 10, a pair of Seq. No. 11 and 12, a pair of Seq. No. 13 and 14, a pair of Seq. No. 15 and 16; one or more of primer pairs for Class A2 β-lactamase selected from the group comprising a pair of No. 17 and 18, a pair of Seq. No. 19 and 20, a pair of Seq. No. 21 and 22, a pair of Seq. No. 23 and 24, a pair of Seq. No. 25 and 26; one or more of primer pairs for Class B1 β-lactamase selected from the group comprising a pair of No. 27 and 28, a pair of Seq. No. 29 and 30, a pair of Seq. No. 31 and 32, a pair of Seq. No. 33 and 34, a pair of Seq. No. 35 and 36, a pair of Seq. No. 37 and 38, a pair of Seq. No. 39 and 40, a pair of Seq. No. 41 and 42; one or more of primer pairs for Class B2 β-lactamase selected from the group comprising a pair of No. 43 and 44, a pair of Seq. No. 45 and 46, a pair of Seq. No. 47 and 48, a pair of Seq. No. 49 and 50, a pair of Seq. No. 51 and 52, a pair of Seq. No. 53 and 54, No. 55 and 56, a pair of Seq. 57 and 58; one or more of primer pairs for Class C113-lactamase selected from the group comprising a pair of Seq. No. 59 and 60, a pair of Seq. No. 61 and 62, a pair of Seq. No. 63 and 64, a pair of Seq. No. 65 and 66, a pair of Seq. No. 67 and 68; one or more of primer pairs for Class C2 β-lactamase selected from the group comprising a pair of Seq. No. 69 and 70, a pair of Seq. No. 71 and 72, a pair of Seq. No. 73 and 74, a pair of Seq. No. 75 and 76, a pair of Seq. No. 77 and 78; one or more of primer pairs for Class D1 β-lactamase selected from the group comprising a pair of No. 79 and 80, a pair of Seq. No. 81 and 82, a pair of Seq. No. 83 and 84, a pair of Seq. No. 85 and 86, a pair of Seq. No. 87 and 88, a pair of Seq. No. 89 and 90, a pair of Seq. No. 91 and 92, a pair of Seq. No. 93 and 94; and one or more of primer pairs for Class D2 β-lactamase selected from the group comprising a pair of Seq. No. 95 and 96, a pair of Seq. No. 97 and 98, a pair of Seq. No. 99 and 100, a pair of Seq. No. 101 and 102, a pair of Seq. No. 103 and 104, a pair of Seq. No. 105 and 106, and a pair of Seq. No. 107 and 108; (b) simultaneously amplifying by polymerase chain reaction (PCR) in a different reaction chamber for each class of β-lactamase using each class of primer pair to produce amplified nucleic acid products; and (c) detecting said nucleic acid products of each chamber by gel electrophoresis.
According to an embodiment of the present invention, the method further includes sequencing of PCR product.
The present invention provides a rapid and accurate molecular method to overcome the failure (a) to detect all clinically-important bla genes and (b) to explain phenotypic tests' results well by using 54 primer pairs, which are designed through novel and elaborate optimization processes. With perfect specificity and sensitivity in 172 control strains and 403 clinical strains, the present method (LARGE-SCALEblaFinder) could detect all clinically-important bla genes. Therefore, this large-scale bla detection ability of LARGE-SCALEblaFinder enables prompt and clinical application to the identification of all bla genes in bacterial pathogens.
FIG. 1 shows the large-scale bla detection method (LARGE-SCALEblaFinder) using a single colony. A single colony from an overnight culture was suspended in the solution containing 0.1% Triton X-100, immediately followed by heating of the cell suspension at 100° C. for 10 min. After removing cellular debris by a centrifugation step at 18,000×g for 1 min, the supernatant (1 μl, template) was subjected to a multiplex PCR with eight multiplex PCR tubes (A1, A2, B1, B2, C1, C2, D1, and D2). 34 μl reaction mixture of each multiplex PCR tube contained 1× DiaStar™ Multiplex PCR Smart mix and 0.2 μM bla type-specific primers (e.g., 16 primers in case of the multiplex PCR tube A1, Table 1). All amplifications in eight multiplex PCR tubes were performed with the identical and following thermal cycling condition: initial denaturation at 95° C. for 5 min; 30 cycles of 95° C. for 30 sec, 64° C. for 40 sec, and 72° C. 50 sec; and a final elongation step at 72° C. for 7 min. All multiplex PCR products (5 μl) were separated in a 2% agarose gel. Each bla gene type was determined by comparing each band size on agarose gels with the corresponding size shown in FIGS. 2a to 2h (or the corresponding amplicon size of Table 1). In case of false positive and/or negative band(s), optimization processes of 54 primer pairs were performed through our novel and unique method.
FIGS. 2a to 2h show the validation of primer pairs by simplex and multiplex PCR assays. To confirm whether primer pairs can correctly amplify their respective loci, primer pairs were evaluated in simplex and multiplex PCR assays. The supernatant obtained from a single colony (FIG. 1) with each bla gene type was used as a template. The supernatants were obtained from 54 representative and positive control strains harboring 54 bla gene types, respectively. Each (expected) size of 54 type-specific bla PCR products (A1-1˜D2-7) was shown in the Table 1. Results from optimized multiplex PCR assays in 100 (including above 54) positive control strains were shown in FIGS. 3a-1 to 3h-3. Multiplex (lane 1) and simplex (lanes other than 1) PCR products were separated in a 2% agarose gel. Direct sequencing of all PCR products in 54 simplex and eight multiplex PCRs confirmed the exact detection of 54 bla gene types. Lane M is a molecular size marker. (a) Templates of multiplex and simplex PCRs for the detection of A1-specific bla genes are as follows: lane 1, eight templates used in lanes 2-9; lane 2, GES-5 from K. pneumoniae CHAK36; lane 3, TEM-30 from E. coli CF0022; lane 4, IMI-1 from E. coli pCCLLimiA; lane 5, KPC-3 from K. pneumoniae CL5761; lane 6, SHV-2a from E. coli ECLA-4; lane 7, VEB-2 from E. coli TOPVEB02; lane 8, PER-2 from E. coli TOPPER02; lane 9, SME-1 from E. coli TOPSME01. (b) Templates of multiplex and simplex PCRs for the detection of A2-specific bla genes are as follows: lane 1, five templates used in lanes 2-6; lane 2, CTX-M-27 from E. coli TOPC027; lane 3, CTX-M-114 from P. rettgeri PS022; lane 4, CTX-M-25 from E. coli TOPC025; lane 5, CTX-M-43 from E. coli TOPC043; lane 6, CTX-M-8 from E. coli TOPC008. (c) Templates of multiplex and simplex PCRs for the detection of B1-specific bla genes are as follows: lane 1, eight templates used in lanes 2-9; lane 2, THIN-B from E. coli TOPTHINB; lane 3, CAU-1 from E. coli TOPCAU01; lane 4, SIM-1 from E. coli TOPSIM01; lane 5, CphA from E. coli TOPCPHA; lane 6, IND-6 from E. coli TOPIND06; lane 7, IMP-1 from E. coli JAEE1; lane 8, NDM-1 from E. coli TOPNDM01; lane 9, VIM-2 from C. freundii 11-7F4560. (d) Templates of multiplex and simplex PCRs for the detection of B2-specific bla genes are as follows: lane 1, eight templates used in lanes 2-9; lane 2, AIM-1 from E. coli TOPAIM01; lane 3, KHM-1 from E. coli TOPKHM01; lane 4, FEZ-1 from E. coli TOPFEZ01; lane 5, GOB-1 from E. coli TOPGOB01; lane 6, BlaB-1 from E. coli TOPBLAB01; lane 7, SPM-1 from E. coli TOPSPM01; lane 8, EBR-1 from E. coli TOPEBR01; lane 9, JOHN-1 from E. coli TOPJOHN01. (e) Templates of multiplex and simplex PCRs for the detection of C1-specific bla genes are as follows: lane 1, five templates used in lanes 2-6; lane 2, ACC-4 from E. coli TOPACC04; lane 3, DHA-1 from E. coli E07-39524; lane 4, MIR-1 from E. coli C600; lane 5, PDC-3 from E. coli TOPPDC03; lane 6, ADC-2 from E. coli TOPADC002. (f) Templates of multiplex and simplex PCRs for the detection of C2-specific bla genes are as follows: lane 1, five templates used in lanes 2-6; lane 2, CMY-3 from E. coli JM109; lane 3, Ear1 from E. coli TOPEAR01; lane 4, 520R from E. coli 520R; lane 5, CMY-10 from E. aerogenes K9911729; lane 6, BER from E. coli BER. (g) Templates of multiplex and simplex PCRs for the detection of D1-specific bla genes are as follows: lane 1, eight templates used in lanes 2-9; lane 2, OXA-23 from A. baumannii K0420859; lane 3, OXA-2 from P. aeruginosa 08PAE4; lane 4, OXA-10 from P. aeruginosa WK20; lane 5, OXA-69 from E. coli TOPDXA069; lane 6, OXA-31 from E. coli TOPDXA031; lane 7, OXA-40 from E. coli TOPDXA040; lane 8, OXA-63 from E. coli TOPDXA063; lane 9, OXA-42 from E. coli TOPDXA042. (h) Templates of multiplex and simplex PCRs for the detection of D2-specific bla genes are as follows: lane 1, seven templates used in lanes 2-8; lane 2, OXA-235 from E. coli TOPDXA235; lane 3, OXA-228 from E. coli TOPDXA228; lane 4, OXA-58 from E. coli TOPDXA058; lane 5, OXA-48 from E. coli TOPDXA048; lane 6, OXA-214 from E. coli TOPDXA214; lane 7, OXA-211 from E. coli TOPDXA211; lane 8, OXA-20 from E. coli TOPDXA020.
FIGS. 3a-1 to 3h-3 show results from multiplex polymerase chain reaction (PCR) assays in positive or negative control strains. Well-characterized 100 bacterial strains with known (reported) bla genes were used as positive controls and 72 bacterial strains without any targeted bla gene were used as negative controls (FIGS. 3a-1 to 3h-3). In case of FIGS. 3a-1 to 3a-5 for the detection of A1-specific bla genes (8 bla types in Table 1), the first 9 strains (1-9) showed no band (targeted bla type) in multiplex PCR tube A1 (lane A1) although with some band(s) in other PCR tubes (lanes A2-D2). In all experiments (FIGS. 3a-1 to 3h-3), the first 9 strains were used as negative controls. All multiplex PCRs were performed according to the large-scaleblaFinder using a single colony as described in the Online Methods. All multiplex PCR products (10 μl) were separated in a 2% agarose gel. To exactly find false positive band(s) if false positive result(s) might happened, 10 μl (not 5 μl) of PCR products were used. However, any false positive or negative result in all multiplex PCRs was not detected, suggesting the complete specificity and sensitivity of the large-scaleblaFinder (FIGS. 3a-1 to 3h-3).
FIGS. 3a-1 to 3a-5 show results from multiplex PCR assays for the detection of A1-specific bla genesin positive (17) or negative (9) control strains. (1) E. coli TOPC015 harboring CTX-M-15 (lane A2) and BER (EC2, KL, AmpC-10) type (lane C2). (2) E. coli TOPC055 harboring CTX-M-55 (lane A2) and BER (EC2, KL, AmpC-10) type (lane C2). (3) E. coli JAEE1 harboring IMP-1 (lane B1) and BER (EC2, KL, AmpC-10) type (lane C2). (4) E. coli C600 harboring MIR-1 (lane C1) and BER (EC2, KL, AmpC-10) type (lane C2). (5) E. cloacae 10-12 703 harboring ACT-2 (lane C1). (6) E. coli TOPCMY010 harboring CMY-10 (lane C2) and BER (EC2, KL, AmpC-10) type (lane C2). (7) E. coli BER harboring BER (lane C2). (8) P. aeruginosa 08PAE8 harboring OXA-2 (lane D1) and MIR (ACT, CHE, GC1, AmpC-3) type (lane C1). (9) E. coli TOPO210 harboring OXA-210 (lane D1) and BER (EC2, KL, AmpC-10) type (lane C2). (10) E. coli CF804 harboring TEM-8 (lane A1) and BER (EC2, KL, AmpC-10) type (lane C2). (11) E. coli CF244 harboring TEM-15 (lane A1) and BER (EC2, KL, AmpC-10) type (lane C2). (12) E. coli CF0022 harboring TEM-30 (lane A1) and BER (EC2, KL, AmpC-10) type (lane C2). (13) E. coli CF0012 harboring TEM-31 (lane A1) and BER (EC2, KL, AmpC-10) type (lane C2). (14) E. coli 57461 harboring TEM-34 (lane A1) and BER (EC2, KL, AmpC-10) type (lane C2). (15) E. coli CF0042 harboring TEM-35 (lane A1) and BER (EC2, KL, AmpC-10) type (lane C2). (16) K. pneumoniae L-867 harboring TEM-49 (lane A1) and SHV type (lane A1). (17) E. coli L267 harboring TEM-47 (lane A1) and BER (EC2, KL, AmpC-10) type (lane C2). (18) E. coli ECLA-4 harboring SHV-2a (lane A1) [In addition, TEM type (lane A1) and BER (EC2, KL, AmpC-10) type (lane C2) were newly detected by bla detection method]. (19) E. coli HB101 harboring SHV-11 (lane A1) and BER (EC2, KL, AmpC-10) type (lane C2). (20) E. coli ECZP-1 harboring SHV-12 (lane A1) [In addition, TEM type (lane A1) and BER (EC2, KL, AmpC-10) type (lane C2) were newly detected by bla detection method]. (21) K. pneumoniae CL5761 harboring KPC-3 (lane A1) [In addition, TEM type (lane A1) and SHV type (lane A1) were newly detected by bla detection method]. (22) E. coli TOPSME01 harboring SME-1 (lane A1), TEM type (lane A1), and BER (EC2, KL, AmpC-10) type (lane C2). (23) K. pneumoniae CHAK36 harboring GES-5 (lane A1), SHV-12 (lane A1), and OXA-17 (lane D1) [In addition, TEM type (lane A1) was newly detected by bla detection method]. (24) E. coli pCCLLimiA harboring IMI-1 (lane A1) and BER (EC2, KL, AmpC-10) type (lane C2). (25) E. coli TOPVEB02 harboring VEB-2 (lane A1), TEM type (lane A1), and BER (EC2, KL, AmpC-10) type (lane C2). (26) E. coli TOPPER02 harboring PER-2 (lane A1), TEM type (lane A1), and BER (EC2, KL, AmpC-10) type (lane C2). Lane M1, 100 bp DNA size marker (Biosesang, Korea); Lane M2, 100 bp plus DNA size marker (Bioneer, Korea); lane A1, A1 multiplex tube; lane A2, A2 multiplex tube; lane B1, B1 multiplex tube; lane B2, B2 multiplex tube; lane C1, C1 multiplex tube; lane C2, C2 multiplex tube; lane D1, D1 multiplex tube; lane D2, D2 multiplex tube.
FIGS. 3b-1 to 3b-4 show results from multiplex PCR assays for the detection of A2-specific bla genesin positive (11) or negative (9) control strains. (1) E. coli CF804 harboring TEM-8 (lane A1) and BER (EC2, KL, AmpC-10) type (lane C2). (2) E. coli CF244 harboring TEM-15 (lane A1) and BER (EC2, KL, AmpC-10) type (lane C2). (3) C. freundii 11-7F4560 harboring VIM-2 (lane B1), TEM type (lane A1), CMY-2 (CFE, LAT, BIL, AmpC-6) type (lane C2), CMY-1 (MOX, FOX, AmpC-9) type (lane C2), OXA-1 type (lane D1), and OXA-23 type (lane D1). (4) E. coli TOPIND06 harboring IND-6 (lane B1), TEM type (lane A1), and BER (EC2, KL, AmpC-10) type (lane C2). (5) E. coli TOPACC04 harboring ACC-4 (lane C1), TEM type (lane A1), and BER (EC2, KL, AmpC-10) type (lane C2). (6) E. coli TOPPDC03 harboring PDC-3 (lane C1), TEM type (lane A1), and BER (EC2, KL, AmpC-10) type (lane C2). (7) P. aeruginosa 08PAE4 harboring OXA-2 (lane D1), TEM type (lane A1), MIR (ACT, CHE, GC1, AmpC-3) type (lane C1), and CMY-1 (MOX, FOX, AmpC-9) type (lane C2). (8) E. coli TOPDXA040 harboring OXA-40 (lane D1), TEM type (lane A1), and BER (EC2, KL, AmpC-10) type (lane C2). (9) E. coli TOPDXA020 harboring OXA-20 (lane D2), TEM type (lane A1), and BER (EC2, KL, AmpC-10) type (lane C2). (10) E. coli A15R(+) harboring CTX-M-3 (lane A2) [In addition, TEM type (lane A1) and BER (EC2, KL, AmpC-10) type (lane C2) were newly detected by bla detection method]. (11) E. coli TOPC008 harboring CTX-M-8 (lane A2), TEM type (lane A1), and BER (EC2, KL, AmpC-10) type (lane C2). (12) E. coli K0519020 harboring CTX-M-15 (lane A2) [In addition, TEM type (lane A1), BER (EC2, KL, AmpC-10) type (lane C2), and OXA-1 type (lane D1) were newly detected by bla detection method]. (13) E. coli TOPC015 harboring CTX-M-15 (lane A2) and BER (EC2, KL, AmpC-10) type (lane C2). (14) E. coli TOPC025 harboring CTX-M-25 (lane A2), TEM type (lane A1), and BER (EC2, KL, AmpC-10) type (lane C2). (15) E. coli TOPC027 harboring CTX-M-27 (lane A2), TEM type (lane A1), and BER (EC2, KL, AmpC-10) type (lane C2). (16) E. coli TOPC043 harboring CTX-M-43 (lane A2), TEM type (lane A1), and BER (EC2, KL, AmpC-10) type (lane C2). (17) E. coli T034 harboring CTX-M-55 (lane A2), TEM type (lane A1), and BER (EC2, KL, AmpC-10) type (lane C2). (18) E. coli TOPC055 harboring CTX-M-55 (lane A2) and BER (EC2, KL, AmpC-10) type (lane C2). (19) P. rettgeri PS022 harboring CTX-M-114 (lane A2). (20) E. coli TOPC114 harboring CTX-M-114 (lane A2) and BER (EC2, KL, AmpC-10) type (lane C2).
FIGS. 3c-1 to 3c-4 show results from multiplex PCR assays for the detection of B1-specific bla genesin positive (10) or negative (9) control strains. (1) E. coli CF0022 harboring TEM-30 (lane A1) and BER (EC2, KL, AmpC-10) type (lane C2). (2) E. coli L267 harboring TEM-47 (lane A1) and BER (EC2, KL, AmpC-10) type (lane C2). (3) E. coli CF0012 harboring TEM-31 (lane A1) and BER (EC2, KL, AmpC-10) type (lane C2). (4) E. coli TOPAIM01 harboring AIM-1 (lane B2), TEM type (lane A1), and BER (EC2, KL, AmpC-10) type (lane C2). (5) E. coli E07-39524 harboring DHA-1 (lane C1), TEM type (lane A1), CTX-M-1 type (lane A2), CTX-M-9 type (lane A2), BER (EC2, KL, AmpC-10) type (lane C2), and OXA-1 type (lane D1). (6) E. aerogenes K9911729 harboring CMY-10 (lane C2), TEM type (lane A1), SHV type, (lane A1), and MIR (ACT, CHE, GC1, AmpC-3) type (lane C1). (7) E. coli K986110 harboring CMY-11 (lane C2) [In addition, TEM type (lane A1), OXA-1 type (lane D1), and BER (EC2, KL, AmpC-10) type (lane C2) were newly detected by bla detection method]. (8) E. coli TOPO002 harboring OXA-2 (lane D1) and BER (EC2, KL, AmpC-10) type (lane C2). (9) E. coli TOPDXA048 harboring OXA-48 (lane D2), TEM type (lane A1), and BER (EC2, KL, AmpC-10) type (lane C2). (10) E. coli JAEE1 harboring IMP-1 (lane B1) and BER (EC2, KL, AmpC-10) type (lane C2). (11) C. freundii 11-7F4560 harboring VIM-2 (lane B1), TEM type (lane A1), CMY-2 (CFE, LAT, BIL, AmpC-6) type (lane C2), CMY-1 (MOX, FOX, AmpC-9) type (lane C2), OXA-1 type (lane D1), and OXA-23 type (lane D1). (12) E. coli TOPIND06 harboring IND-6 (lane B1), TEM type (lane A1), and BER (EC2, KL, AmpC-10) type (lane C2). (13) E. coli TOPNDM01 harboring NDM-1 (lane B1), TEM type (lane A1), and BER (EC2, KL, AmpC-10) type (lane C2). (14) E. coli TOPCPHA harboring CphA (lane B1), TEM type (lane A1), and BER (EC2, KL, AmpC-10) type (lane C2). (15) E. coli TOPIMIS harboring ImiS (lane B1), TEM type (lane A1), and BER (EC2, KL, AmpC-10) type (lane C2). (16) E. coli TOPCAU01 harboring CAU-1 (lane B1), TEM type (lane A1), and BER (EC2, KL, AmpC-10) type (lane C2). (17) E. coli TOPMBL1B harboring Mbl1b (lane B1), TEM type (lane A1), and BER (EC2, KL, AmpC-10) type (lane C2). (18) E. coli TOPSIM01harboring SIM-1 (lane B1), TEM type (lane A1), and BER (EC2, KL, AmpC-10) type (lane C2). (19) E. coli TOPTHINB harboring THIN-B (lane B1), TEM type (lane A1), and BER (EC2, KL, AmpC-10) type (lane C2).
FIGS. 3d-1 to 3d-3 show results from multiplex PCR assays for the detection of B2-specific bla genesin positive (8) or negative (9) control strains. (1) E. coli 57461 harboring TEM-34 (lane A1) and BER (EC2, KL, AmpC-10) type (lane C2). (2) E. coli CF0042 harboring TEM-35 (lane A1) and BER (EC2, KL, AmpC-10) type (lane C2). (3) E. coli A15R(+) harboring CTX-M-3 (lane A2) [In addition, TEM type (lane A1) and BER (EC2, KL, AmpC-10) type (lane C2) were newly detected by bla detection method]. (4) E. coli TOPNDM01 harboring NDM-1 (lane B1), TEM type (lane A1), and BER (EC2, KL, AmpC-10) type (lane C2). (5) E. coli TOPGC1 harboring GC1 (lane C1), TEM type (lane A1), and BER (EC2, KL, AmpC-10) type (lane C2). (6) E. coli 520R harboring 520R (lane C2) and BER (EC2, KL, AmpC-10) type (lane C2). (7) E. coli MG1655 harboring BER (EC2, KL, AmpC-10) type (lane C2). (8) E. coli TOPO010 harboring OXA-10 (lane D1) and BER (EC2, KL, AmpC-10) type (lane C2). (9) E. coli TOPDXA0058 harboring OXA-58 (lane D2), TEM type (lane A1), and BER (EC2, KL, AmpC-10) type (lane C2). (10) E. coli TOPAIM01 harboring AIM-1 (lane B2), TEM type (lane A1), and BER (EC2, KL, AmpC-10) type (lane C2). (11) E. coli TOPKHM01 harboring KHM-1 (lane B2), TEM type (lane A1), and BER (EC2, KL, AmpC-10) type (lane C2). (12) E. coli TOPFEZ01 harboring FEZ-1 (lane B2), TEM type (lane A1), and BER (EC2, KL, AmpC-10) type (lane C2). (13) E. coli TOPGOB01 harboring GOB-1 (lane B2), TEM type (lane A1), and BER (EC2, KL, AmpC-10) type (lane C2). (14) E. coli TOPBLAB01 harboring BlaB-1 (lane B2), TEM type (lane A1), and BER (EC2, KL, AmpC-10) type (lane C2). (15) E. coli TOPSPM01 harboring SPM-1 (lane B2), TEM type (lane A1), and BER (EC2, KL, AmpC-10) type (lane C2). (16) E. coli TOPEBR01 harboring EBR-1 (lane B2), TEM type (lane A1), and BER (EC2, KL, AmpC-10) type (lane C2). (17) E. coli TOPJOHN01 harboring JOHN-1 (lane B2), TEM type (lane A1), and BER (EC2, KL, AmpC-10) type (lane C2).
FIGS. 3e-1 to 3e-3 show results from multiplex PCR assays for the detection of C1-specific bla genesin positive (9) or negative (9) control strains. (1) E. coli ECLA-4 harboring SHV-2a (lane A1) [In addition, TEM type (lane A1) and BER (EC2, KL, AmpC-10) type (lane C2) were newly detected by bla detection method]. (2) E. coli HB101 harboring SHV-11 (lane A1) and BER (EC2, KL, AmpC-10) type (lane C2). (3) E. coli TOPCPHA harboring CphA (lane B1), TEM type (lane A1), and BER (EC2, KL, AmpC-10) type (lane C2). (4) E. coli TOPIMIS harboring ImiS (lane B1), TEM type (lane A1), and BER (EC2, KL, AmpC-10) type (lane C2). (5) E. coli TOPFEZ01 harboring FEZ-1 (lane B2), TEM type (lane A1), and BER (EC2, KL, AmpC-10) type (lane C2). (6) E. coli TOPCMY011 harboring CMY-11 (lane C2) and BER (EC2, KL, AmpC-10) type (lane C2). (7) E. coli ATCC25922 harboring BER (EC2, KL, AmpC-10) type (lane C2). (8) E. coli TOPDXA031 harboring OXA-31 (lane D1), TEM type (lane A1), and BER (EC2, KL, AmpC-10) type (lane C2). (9) E. coli TOPDXA0097 harboring OXA-97 (lane D2), TEM type (lane A1), and BER (EC2, KL, AmpC-10) type (lane C2). (10) E. coli TOPACC04 harboring ACC-4 (lane C1), TEM type (lane A1), and BER (EC2, KL, AmpC-10) type (lane C2). (11) E. coli E07-39524 harboring DHA-1 (lane C1), TEM type (lane A1), CTX-M-1 type (lane A2), CTX-M-9 type (lane A2), BER (EC2, KL, AmpC-10) type (lane C2), and OXA 1 type (lane D1). (12) E. coli TOPPDC03 harboring PDC-3 (lane C1), TEM type (lane A1), and BER (EC2, KL, AmpC-10) type (lane C2). (13) E. coli C600 harboring MIR-1 (lane C1) and BER (EC2, KL, AmpC-10) type (lane C2). (14) E. cloacae 10-12 703 harboring ACT-2 (lane C1). (15) E. coli TOPGC1 harboring GC1 (lane C1), TEM type (lane A1), and BER (EC2, KL, AmpC-10) type (lane C2). (16) E. cloacae CHE harboring CHE (lane C1). (17) E. coli TOPADC002 harboring ADC-2 (lane C1), TEM type (lane A1), and BER (EC2, KL, AmpC-10) type (lane C2). (18) E. coli TOPADC033 harboring ADC-33 (lane C1), TEM type (lane A1), and BER (EC2, KL, AmpC-10) type (lane C2).
FIGS. 3f-1 to 3f-5 show results from multiplex PCR assays for the detection of C2-specific bla genesin positive (20) or negative (9) control strains. (1) K. pneumoniae CL5761 harboring KPC-3 (lane A1) [In addition, TEM type (lane A1) and SHV type (lane A1) were newly detected by bla detection method]. (2) K. pneumoniae CHAK36 harboring GES-5 (lane A1), SHV-12 (lane A1), OXA-17 (lane D1), [In addition, TEM type (lane A1) was newly detected by bla detection method]. (3) P. rettgeri PS022 harboring CTX-M-114 (lane A2). (4) E. cloacae CHE harboring CHE (lane C1). (5) P. aeruginosa 08PAE32 harboring OXA-10 (lane D1), VIM type (lane B1), MIR (ACT, CHE, GC1, AmpC-3) type (lane C1), and OXA-23 type (lane D1). (6) A. baumannii AB4-1 harboring OXA-21 (lane D1), TEM type (lane A1), ADC (AmpC-5) type (lane C1), and OXA-10 type (lane D1). (7) A. baumannii K0420859 harboring OXA-23 (lane D1) [In addition, ADC (AmpC-5) type (lane C1) and OXA-10 type (lane D1) were newly detected by bla detection method]. (8) P. aeruginosa WK20 harboring OXA-10 (lane D1) and MIR (ACT, CHE, GC1, AmpC-3) type (lane C1). (9) P. aeruginosa WK28 harboring OXA-240 (lane D1) and AmpCCARBA-2 type (lane C1). (10) E. coli JM109 harboring CMY-3 (lane C2) and BER (EC2, KL, AmpC-10) type (lane C2). (11) E. aerogenes K9911729 harboring CMY-10 (lane C2), TEM type (lane A1), SHV type, (lane A1), and MIR (ACT, CHE, GC1, AmpC-3) type (lane C1). (12) E. coli TOPCMY010 harboring CMY-10 (lane C2) and BER (EC2, KL, AmpC-10) type (lane C2). (13) E. coli K986110 harboring CMY-11 (lane C2) [In addition, TEM type (lane A1), OXA-1 type (lane D1), and BER (EC2, KL, AmpC-10) type (lane C2) were newly detected by bla detection method]. (14) E. coli TOPCMY011 harboring CMY-11 (lane C2) and BER (EC2, KL, AmpC-10) type (lane C2). (15) E. coli K0739377 harboring CMY-43 (lane C2), TEM type (lane A1), and BER (EC2, KL, AmpC-10) type (lane C2). (16) E. coli TOPCMY043 harboring CMY-43 (lane C2) and BER (EC2, KL, AmpC-10) type (lane C2). (17) E. coli CSH-2 harboring MOX-1 (lane C2), TEM type (lane A1), SHV type (lane A1), and MIR (ACT, CHE, GC1, AmpC-3) type (lane C1). (18) E. coli J53-2R(+) harboring FOX-3 (lane C2) [In addition, TEM type (lane A1) and BER (EC2, KL, AmpC-10) type (lane C2) were newly detected by bla detection method]. (19) E. coli BER harboring BER (lane C2). (20) E. coli 520R harboring 520R (lane C2) and BER (EC2, KL, AmpC-10) type (lane C2). (21) E. coli TOPEAR01 harboring Ear1 (lane C2) and BER (EC2, KL, AmpC-10) type (lane C2). (22) E. coli MG1655 harboring BER (EC2, KL, AmpC-10) type (lane C2). (23) E. coli ATCC25922 harboring BER (EC2, KL, AmpC-10) type (lane C2). (24) E. coli TOP10 harboring BER (EC2, KL, AmpC-10) type (lane C2). (25) E. coli DH5a harboring BER (EC2, KL, AmpC-10) type (lane C2). (26) E. coli BL21(DE3) harboring BER (EC2, KL, AmpC-10) type (lane C2). (27) E. coli HB4 harboring BER (EC2, KL, AmpC-10) type (lane C2). (28) E. coli JF701 harboring BER (EC2, KL, AmpC-10) type (lane C2). (29) E. coli JF703 harboring BER (EC2, KL, AmpC-10) type (lane C2).
FIGS. 3g-1 to 3g-5 show results from multiplex PCR assays for the detection of D1-specific bla genesin positive (17) or negative (9) control strains. (1) E. coli ECZP-1 harboring SHV-12 (lane A1) [In addition, TEM type (lane A1) and BER (EC2, KL, AmpC-10) type (lane C2) were newly detected by bla detection method]. (2) E. coli pCCLLimiA harboring IMI-1 (lane A1) and BER (EC2, KL, AmpC-10) type (lane C2). (3) E. coli TOPC008 harboring CTX-M-8 (lane A2), TEM type (lane A1), and BER (EC2, KL, AmpC-10) type (lane C2). (4) E. coli TOPCAU01 harboring CAU-1 (lane B1), TEM type (lane A1), and BER (EC2, KL, AmpC-10) type (lane C2). (5) E. coli TOPGOB01 harboring GOB-1 (lane B2), TEM type (lane A1), and BER (EC2, KL, AmpC-10) type (lane C2). (6) E. coli TOPADC002 harboring ADC-2 (lane C1), TEM type (lane A1), and BER (EC2, KL, AmpC-10) type (lane C2). (7) E. coli TOPCMY043 harboring CMY-43 (lane C2) and BER (EC2, KL, AmpC-10) type (lane C2). (8) E. coli DH5a harboring BER (EC2, KL, AmpC-10) type (lane C2). (9) E. coli TOPDXA211 harboring OXA-211 (lane D2), TEM type (lane A1), and BER (EC2, KL, AmpC-10) type (lane C2). (10) P. aeruginosa 08PAE4 harboring OXA-2 (lane D1), TEM type (lane A1), MIR (ACT, CHE, GC1, AmpC-3) type (lane C1), and CMY-1 (MOX, FOX, AmpC-9) type (lane C2). (11) P. aeruginosa 08PAE8 harboring OXA-2 (lane D1) and MIR (ACT, CHE, GC1, AmpC-3) type (lane C1). (12) E. coli TOPO002 harboring OXA-2 (lane D1) and BER (EC2, KL, AmpC-10) type (lane C2). (13) P. aeruginosa 08PAE32 harboring OXA-10 (lane D1), VIM type (lane B1), MIR (ACT, CHE, GC1, AmpC-3) type (lane C1), and OXA-23 type (lane D1). (14) P. aeruginosa WK20 harboring OXA-10 (lane D1) and MIR (ACT, CHE, GC1, AmpC-3) type (lane C1). (15) E. coli TOP010 harboring OXA-10 (lane D1) and BER (EC2, KL, AmpC-10) type (lane C2). (16) A. baumannii AB4-1 harboring OXA-21 (lane D1), TEM type (lane A1), ADC (AmpC-5) type (lane C1), and OXA-10 type (lane D1). (17) A. baumannii K0420859 harboring OXA-23 (lane D1) [In addition, ADC (AmpC-5) type (lane C1) and OXA-10 type (lane D1) were newly detected by bla detection method]. (18) E. coli TOPDXA031 harboring OXA-31 (lane D1), TEM type (lane A1), and BER (EC2, KL, AmpC-10) type (lane C2). (19) E. coli TOPDXA040 harboring OXA-40 (lane D1), TEM type (lane A1), and BER (EC2, KL, AmpC-10) type (lane C2). (20) E. coli TOPDXA042 harboring OXA-42 (lane D1), TEM type (lane A1), and BER (EC2, KL, AmpC-10) type (lane C2). (21) E. coli TOPDXA063 harboring OXA-63 (lane D1), TEM type (lane A1), and BER (EC2, KL, AmpC-10) type (lane C2). (22) E. coli TOPDXA069 harboring OXA-69 (lane D1), TEM type (lane A1), and BER (EC2, KL, AmpC-10) type (lane C2). (23) P. aeruginosa PAE0831 harboring OXA-210 (lane D1) and AmpCCARBA-2 type (lane C1). (24) E. coli TOPO210 harboring OXA-210 (lane D1) and BER (EC2, KL, AmpC-10) type (lane C2). (25) P. aeruginosa WK28 harboring OXA-240 (lane D1) and AmpCCARBA-2 type (lane C1). (26) E. coli TOPO240 harboring OXA-240 (lane D1) and BER (EC2, KL, AmpC-10) type (lane C2).
FIGS. 3h-1 to 3h-3 show results from multiplex PCR assays for the detection of A1-specific bla genesin positive (8) or negative (9) control strains. (1) E. coli TOPVEB02 harboring VEB-2 (lane A1), TEM type (lane A1), and BER (EC2, KL, AmpC-10) type (lane C2). (2) E. coli TOPC025 harboring CTX-M-25 (lane A2), TEM type (lane A1), and BER (EC2, KL, AmpC-10) type (lane C2). (3) E. coli TOPMBL1B harboring Mbl1b (lane B1), TEM type (lane A1), and BER (EC2, KL, AmpC-10) type (lane C2). (4) E. coli TOPSPM01 harboring SPM-1 (lane B2), TEM type (lane A1), and BER (EC2, KL, AmpC-10) type (lane C2). (5) E. coli TOPADC033 harboring ADC-33 (lane C1), TEM type (lane A1), and BER (EC2, KL, AmpC-10) type (lane C2). (6) E. coli CSH-2 harboring MOX-1 (lane C2), TEM type (lane A1), SHV type (lane A1), and MIR (ACT, CHE, GC1, AmpC-3) type (lane C1). (7) E. coli JF701 harboring BER (EC2, KL, AmpC-10) type (lane C2). (8) E. coli TOPDXA042 harboring OXA-42 (lane D1), TEM type (lane A1), and BER (EC2, KL, AmpC-10) type (lane C2). (9) E. coli TOPDXA063 harboring OXA-63 (lane D1), TEM type (lane A1), and BER (EC2, KL, AmpC-10) type (lane C2). (10) E. coli TOPDXA020 harboring OXA-20 (lane D2), TEM type (lane A1), and BER (EC2, KL, AmpC-10) type (lane C2). (11) E. coli TOPDXA048 harboring OXA-48 (lane D2), TEM type (lane A1), and BER (EC2, KL, AmpC-10) type (lane C2). (12) E. coli TOPDXA058 harboring OXA-58 (lane D2), TEM type (lane A1), and BER (EC2, KL, AmpC-10) type (lane C2). (13) E. coli TOPDXA097 harboring OXA-97 (lane D2), TEM type (lane A1), and BER (EC2, KL, AmpC-10) type (lane C2). (14) E. coli TOPDXA211 harboring OXA-211 (lane D2), TEM type (lane A1), and BER (EC2, KL, AmpC-10) type (lane C2). (15) E. coli TOPDXA214 harboring OXA-214 (lane D2), TEM type (lane A1), and BER (EC2, KL, AmpC-10) type (lane C2). (16) E. coli TOPDXA228harboring OXA-228 (lane D2), TEM type (lane A1), and BER (EC2, KL, AmpC-10) type (lane C2). (17) E. coli TOPDXA235 harboring OXA-235 (lane D2), TEM type (lane A1), and BER (EC2, KL, AmpC-10) type (lane C2).
FIGS. 4a to 4e show optimization of primer pairs in multiplex PCR assays. Several false positive bands among 100 positive control strains were detected in some multiplex PCR tubes, including A1, A2, C1, C2, and D1 multiplex tubes. Here, representative optimization of primer pairs in A1, A2, and D1 multiplex tubes was shown. To identify which primer is responsible for the false positive band(s), multiplex PCR assays using primer mixtures without one primer were performed. All multiplex PCR products (10 μl) were separated in a 2% agarose gel. To exactly find false positive band(s) if false positive result(s) might happened, 10 μl (not 5 μl) of PCR products were used. (a) In case of K. pneumoniae CHAK36, the weak intensity (non-optimized result) of GES type (top band) in A1 multiplex tube (lane A1) was improved by a small increase in length of GES type primer pair (optimized result). Five conserved bases (5′-CATTC-3′) were added in the 5′ end of GES type-F primer, while a single conserved base (5′-A-3′) was inserted in the 5′ end of GES type-R primer. (b) Optimization process in case of P. aeruginosa WK28. Experimental procedures to identify the primer(s) responsible for false positive bands were described in the Online Methods. A false positive band (arrow) was shown in lanes 2-8 and 10 but the false positive band (dashed red box) was removed in lane 1 (without only CTX-M-1 type-F primer) and lane 9 (without only CTX-M-25 type-F primer. DNA sequence analysis showed that the false positive amplicon was the PCR product of a chromosomal gene coding for β-hexosaminidase in the control strain. The forward primer of CTX-M-1 type (5′-AGTTCACGCTGATGGCGAC-3′) and the forward primer of CTX-M-25 type (5′-AAAAGCGTAAGGCGGGCGA-3′) responsible for the false positive band were changed to new primers (CTX-M-1-F: 5′-CAGTTCACGCTGATGGCGAC-3′; CTX-M-25-F: 5′-TAATGACGACAGCCTGTGTTTC-3′). Lane 1: A2 multiplex tube without CTX-M-1 type-F; lane 2: A2 multiplex tube without CTX-M-1 type-R; lane 3: A2 multiplex tube without CTX-M-2 type-F; lane 4: A2 multiplex tube without CTX-M-2 type-R; lane 5: A2 multiplex tube without CTX-M-8 type-F; lane 6: A2 multiplex tube without CTX-M-8 type-R; lane 7: A2 multiplex tube without CTX-M-9 type-F; lane 8: A2 multiplex tube without CTX-M-9 type-R; lane 9: A2 multiplex tube without CTX-M-25 type-F; lane 10: A2 multiplex tube without CTX-M-25 type-R. (c) In case of P. aeruginosa WK28, a false positive band (non-optimized result with tow unchanged primers) in an A2 multiplex PCR tube (lane A2) was removed by redesigning two primers responsible for the false positive band (optimized result with two newly-changed primers). (d) Optimization process in case of E. coli CF0022. Experimental procedures to identify the primer(s) responsible for false positive bands were described in the Online Methods. One (or two) false positive band(s) (arrow) were shown in lanes 4-16 but two false positive bands (dashed red box) were removed in lanes 1 (without only OXA-1 type-F primer), lane 2 (without only OXA-1 type-R primer), and lane 3 (without only OXA-2 type-F primer). Therefore, these three primers were responsible for two false positive bands. DNA sequence analysis showed that the false positive amplicons were PCR products of chromosomal genes (two genes coding for periplasmic murein peptide-binding protein MppA and the catalytic subunit of acetolactate synthase) in the control strain. Lane 1: D1 multiplex tube without OXA-1 type-F; lane 2: D1 multiplex tube without OXA-1 type-R; lane 3: D1 multiplex tube without OXA-2 type-F; lane 4: D1 multiplex tube without OXA-2 type-R; lane 5: D1 multiplex tube without OXA-10 type-F; lane 6: D1 multiplex tube without OXA-10 type-R; lane 7: D1 multiplex tube without OXA-23 type-F; lane 8: D1 multiplex tube without OXA-23 type-R; lane 9: D1 multiplex tube without OXA-24 type-F; lane 10: D1 multiplex tube without OXA-24 type-R; lane 11: D1 multiplex tube without OXA-42 type-F; lane 12: D1 multiplex tube without OXA-42 type-R; lane 13: D1 multiplex tube without OXA-51 type-F; lane 14: D1 multiplex tube without OXA-51 type-R; lane 15: D1 multiplex tube without OXA-63 type-F; lane 16: D1 multiplex tube without OXA-63 type-R. (e) In case of E. coli CF0022, two false positive bands (non-optimized result) in a D1 multiplex PCR tube was removed by redesigning primers responsible for the false positive bands. Although three primers (OXA-1 type-F: 5′-CAATCATACACCAAAGACGTGGA-3′; OXA-1 type-R: 5′-GCTTCCTGTAAGTGCGGACAC-3′; OXA-2-F: 5′-AGTTGTGGCAGACGAACGC-3′) were responsible for two false positive bands (non-optimized result), two false positive bands could be removed by the only one changed primer (OXA-1-R; 5′-AGCTTCCTGTAAGTGCGGACACA-3′) (optimized result).
Hereinafter, the present invention will be described in further detail with reference to examples. It is to be understood, however, that these examples are for illustrative purposes only and are not to be construed to limit the scope of the present invention.
Our strategy for the bla gene typing is the primer design using gene type-specific regions. We divided previously-reported bla genes into 54 types, which are comprised of 13 in class A, 16 in class B, 10 in class C, and 15 in class D (Table 1).
| TABLE 1 | ||||||
| Multiplex | Type | β-Lactamase (s) | Amplicon size | Sequence | ||
| Class | PCR tube | name | Gene type | targeted | (bp) | Number |
| A | A1 | A1-1 | GES type | GES-1* to GES-22 | 748 | Seq. No. 1 |
| Seq. No. 2 | ||||||
| A1-2 | TEM type | TEM-1* to TEM-209 | 626 | Seq. No. 3 | ||
| Seq. No. 4 | ||||||
| A1-3 | NMC | NMC-A*; IMI-1 to | 513 | Seq. No. 5 | ||
| (IMI) | IMI-3 | Seq. No. 6 | ||||
| type | ||||||
| A1-4 | KPC type | KPC-1* to KPC-10 | 438 | Seq. No. 7 | ||
| Seq. No. 8 | ||||||
| A1-5 | SHV type | SHV-1* to SHV-173 | 341 | Seq. No. 9 | ||
| Seq. No. 10 | ||||||
| A1-6 | VEB type | VEB-1* to VEB-8 | 257 | Seq. No. 11 | ||
| Seq. No. 12 | ||||||
| A1-7 | PER type | PER-1* to PER-7 | 152 | Seq. No. 13 | ||
| Seq. No. 14 | ||||||
| A1-8 | SME type | SME-1* to SME-3 | 110 | Seq. No. 15 | ||
| Seq. No. 16 | ||||||
| A2 | A2-1 | CTX-M-9 | CTX-M-9*, 13, 14, | 689 | Seq. No. 17 | |
| type | 16 to 19, 21, 24, 27, | Seq. No. 18 | ||||
| 38, 45 to 51, 65, 67, | ||||||
| 81, 83 to 87, 90, 98, | ||||||
| 99, 102, 104 to 106, | ||||||
| 110, 111, 113, 121, | ||||||
| 122, 126, 129, 130, | ||||||
| 134 | ||||||
| A2-2 | CTX-M-1 | CTX-M-1*, 3, 10, 11, | 462 | Seq. No. 19 | ||
| type | 12, 15, 22, 23, 28, 29, | Seq. No. 20 | ||||
| 30, 32, 33, 34, 36, 37, | ||||||
| 42, 52 to 55, 57, 58, | ||||||
| 60, 61 62, 64, 66, 68, | ||||||
| 69, 71, 72, 79 to 80, | ||||||
| 82, 101, 107, 108, | ||||||
| 109, 114, 116, 117, | ||||||
| 133, 136, 139, 142 | ||||||
| A2-3 | CTX-M- | CTX-M-25*, 26, 39, | 348 | Seq. No. 21 | ||
| 25 type | 41, 78, 89, 91, 94 | Seq. No. 22 | ||||
| A2-4 | CTX-M-2 | CTX-M-2*, 4 to 7, | 261 | Seq. No. 23 | ||
| type | 20, 31, 35, 43, 44, 56, | Seq. No. 24 | ||||
| 59, 76, 77, 92, 95, 97, | ||||||
| 124, 131 | ||||||
| A2-5 | CTX-M-8 | CTX-M-8*, 40, 63 | 150 | Seq. No. 25 | ||
| type | Seq. No. 26 | |||||
| B | B1 | B1-1 | THIN-B | THIN-B* | 896 | Seq. No. 27 |
| Seq. No. 28 | ||||||
| B1-2 | CAU-1 | CAU-1*; Mb11b | 720 | Seq. No. 29 | ||
| (Mbl1b) | Seq. No. 30 | |||||
| B1-3 | SIM-1 | SIM-1* | 631 | Seq. No. 31 | ||
| Seq. No. 32 | ||||||
| B1-4 | CphA | CphA2*, 4 to 8; ImiS | 567 (570d) | Seq. No. 33 | ||
| (ImiS) | Seq. No. 34 | |||||
| type | ||||||
| B1-5 | IND type | IND-1, 3, 5, 6*, 7, 8, | 463 | Seq. No. 35 | ||
| 10, 14 | Seq. No. 36 | |||||
| B1-6 | IMP type | IMP-1* to 16, 18 to | 344 | Seq. No. 37 | ||
| 22, 24 to 35, 37, 38, | Seq. No. 38 | |||||
| 40 to 44 | ||||||
| B1-7 | NDM | NDM-1* to NDM-10 | 254 | Seq. No. 39 | ||
| type | Seq. No. 40 | |||||
| B1-8 | VIM type | VIM-1* to VIM-38 | 148 | Seq. No. 41 | ||
| Seq. No. 42 | ||||||
| B2 | B2-1 | AIM-1 | AIM-1* | 836 | Seq. No. 43 | |
| Seq. No. 44 | ||||||
| B2-2 | KHM-1 | KHM-1* | 711 | Seq. No. 45 | ||
| Seq. No. 46 | ||||||
| B2-3 | FEZ-1 | FEZ-1* | 637 | Seq. No. 47 | ||
| Seq. No. 48 | ||||||
| B2-4 | GOB type | GOB-1* to 15, 18 | 506 | Seq. No. 49 | ||
| Seq. No. 50 | ||||||
| B2-5 | BlaB type | BlaB-1* to 3, 5 to 13 | 441 | Seq. No. 51 | ||
| Seq. No. 52 | ||||||
| B2-6 | SPM-1 | SPM-1* | 355 | Seq. No. 53 | ||
| Seq. No. 54 | ||||||
| B2-7 | EBR-1 | EBR-1* | 262 | Seq. No. 55 | ||
| Seq. No. 56 | ||||||
| B2-8 | JOHN-1 | JOHN-1* | 186 | Seq. No. 57 | ||
| Seq. No. 58 | ||||||
| C | C1 | C1-1 | ACC | ACC-1* to 5; 6 other | 984 | Seq. No. 59 |
| (AmpC- | AmpCs | Seq. No. 60 | ||||
| 1) type | ||||||
| C1-2 | DHA | DHA-1* to 3, 5 to 7; | 881 | Seq. No. 61 | ||
| (AmpC- | 18 other AmpCs | Seq. No. 62 | ||||
| 2) type | ||||||
| C1-3 | MIR | MIR-1* to 6; ACT-1 | 669 | Seq. No. 63 | ||
| (ACT, | to 8, 10, 14 to 16, 20, | Seq. No. 64 | ||||
| CHE, | 21, 23; CHE; GC-1; | |||||
| GC1, | 26 other AmpCs | |||||
| AmpC-3) | ||||||
| type | ||||||
| C1-4 | PDC | PDC-1* to 3; 37 | 562 | Seq. No. 65 | ||
| (AmpC- | other AmpCs | Seq. No. 66 | ||||
| 4) type | ||||||
| C1-5 | ADC | ADC-1* to 7, 10, 11 | 176 | Seq. No. 67 | ||
| (AmpC- | to 23, 25, 26, 29, 30, | Seq. No. 68 | ||||
| 5) type | 38, 39, 41 to 44, 50 to | |||||
| 54, 56, 57, 64, 67; 23 | ||||||
| other AmpCs | ||||||
| C2 | C2-1 | CMY-2 | CMY-2* to 7, 12 to | 888 | Seq. No. 69 | |
| (CFE, | 18, 20 to 103, 110; | Seq. No. 70 | ||||
| LAT, | CFE, LAT; BIL; 29 | |||||
| BIL, | other AmpCs | |||||
| AmpC-6) | ||||||
| type | ||||||
| C2-2 | Ear | Ear0* to 2; 13 other | 657 | Seq. No. 71 | ||
| (AmpC- | AmpCs | Seq. No. 72 | ||||
| 7) type | ||||||
| C2-3 | 520R | 520R*; SRT-1; HD; | 477 | Seq. No. 73 | ||
| (SRT-1, | SMSA; 7 other | Seq. No. 74 | ||||
| HD, | AmpCs | |||||
| SMSA, | ||||||
| AmpC-8) | ||||||
| type | ||||||
| C2-4 | CMY-1 | CMY-1*, 8 to 11, 19; | 306 | Seq. No. 75 | ||
| (MOX, | MOX-1 to 7; FOX-1 | Seq. No. 76 | ||||
| FOX, | to 10; 16 other | |||||
| AmpC-9) | AmpCs | |||||
| type | ||||||
| C2-5 | BER | BER*; EC2; KL; 85 | 241 | Seq. No. 77 | ||
| (EC2, | other AmpCs | Seq. No. 78 | ||||
| KL, | ||||||
| AmpC- | ||||||
| 10) type | ||||||
| D | D1 | D1-1 | OXA-23 | OXA-23*, 27, 49, 73, | 718 | Seq. No. 79 |
| type | 133, 134, 146, 165 to | Seq. No. 80 | ||||
| 171, 225, 239 | ||||||
| D1-2 | OXA-2 | OXA-2*, 3, 15, 21, | 639 | Seq. No. 81 | ||
| type | 32, 34, 36, 141, 161, | Seq. No. 82 | ||||
| 210 | ||||||
| D1-3 | OXA-10 | OXA-7, 10*, 11, 13, | 549 | Seq. No. 83 | ||
| type | 14, 16, 17, 19, 28, 35, | Seq. No. 84 | ||||
| 56, 74, 101, 142, 145, | ||||||
| 147, 183, 240, 251, | ||||||
| 256 | ||||||
| D1-4 | OXA-51 | OXA-51*, 64 to 71, | 490 | Seq. No. 85 | ||
| type | 75 to 80, 82 to 84, 86 | Seq. No. 86 | ||||
| to 95, 98, 99, 106 to | ||||||
| 113, 115 to 117, 128, | ||||||
| 130 to 132, 138, 148 | ||||||
| to 150, 172 to 180, | ||||||
| 194 to 197, 200 to | ||||||
| 203, 206, 208, 216 to | ||||||
| 217, 241, 248, 250 | ||||||
| D1-5 | OXA-1 | OXA-1*, 4, 30, 31, | 437 | Seq. No. 87 | ||
| type | 47, 224 | Seq. No. 88 | ||||
| D1-6 | OXA-24 | OXA-24* to 26, 33, | 356 | Seq. No. 89 | ||
| type | 40, 72, 139, 143, 160, | Seq. No. 90 | ||||
| 182, 207, 231 | ||||||
| D1-7 | OXA-63 | OXA-63*, 136, 137, | 267 | Seq. No. 91 | ||
| type | 192 | Seq. No. 92 | ||||
| D1-8 | OXA-42 | OXA-42*, 43, 57, 59 | 142 | Seq. No. 93 | ||
| type | Seq. No. 94 | |||||
| D2 | D2-1 | OXA-235 | OXA-235*, 237, 278 | 721 | Seq. No. 95 | |
| type | Seq. No. 96 | |||||
| D2-2 | OXA-228 | OXA-228* to 230, | 641 | Seq. No. 97 | ||
| type | 257 | Seq. No. 98 | ||||
| D2-3 | OXA-58 | OXA-58*, 96, 97, | 560 | Seq. No. 99 | ||
| type | 164 | Seq. No. 100 | ||||
| D2-4 | OXA-48 | OXA-48*, 162, 163, | 473 | Seq. No. 101 | ||
| type | 181, 204, 232, 244, | Seq. No. 102 | ||||
| 245, 247 | ||||||
| D2-5 | OXA-214 | OXA-214*, 215 | 321 | Seq. No. 103 | ||
| type | Seq. No. 104 | |||||
| D2-6 | OXA-211 | OXA-211*, 212 | 251 | Seq. No. 105 | ||
| type | Seq. No. 106 | |||||
| D2-7 | OXA-20 | OXA-20*, 37 | 160 | Seq. No. 107 | ||
| type | Seq. No. 108 | |||||
| TABLE 2 | ||
| Sequence | Length | |
| Number | Sequence (5′-3′) | (bases) |
| Seq. No. 1 | CATTCACGCACTATTACTGGCA | 22 |
| Seq. No. 2 | AGCGTAATCTCTCTCCTGGG | 20 |
| Seq. No. 3 | CGTGTCGCCCTTATTCCCT | 19 |
| Seq. No. 4 | GCAACTTTATCCGCCTCCAT | 20 |
| Seq. No. 5 | GAACGATTTCCATTATGTAGTTC | 23 |
| Seq. No. 6 | ATCGCCAACTACCCAATCGCTTG | 23 |
| Seq. No. 7 | GACACACCCATCCGTTACG | 19 |
| Seq. No. 8 | GGTTCCGGTTTTGTCTCCG | 19 |
| Seq. No. 9 | ATCTGGTGGACTACTCGCC | 19 |
| Seq. No. 10 | ATCGTCCACCATCCACTGC | 19 |
| Seq. No. 11 | CCCGATGCAAAGCGTTATG | 19 |
| Seq. No. 12 | GAACAGAATCAGTTCCTCCG | 20 |
| Seq. No. 13 | TGGATGGTCGAAACCACCACAG | 22 |
| Seq. No. 14 | CGTCCATCAGGCAACAGAATGA | 22 |
| Seq. No. 15 | GGGGAATGTTCTCAATGCTAA | 21 |
| Seq. No. 16 | CTACAACCCAATCAGCAGGA | 20 |
| Seq. No. 17 | GAGAGTGCAACGGATGATGTT | 21 |
| Seq. No. 18 | CAGTCCACGACGTCGGTAAG | 20 |
| Seq. No. 19 | CAGTTCACGCTGATGGCGAC | 20 |
| Seq. No. 20 | TTCGTCTCCCAGCTGTCGGG | 20 |
| Seq. No. 21 | TAATGACGACAGCCTGTGTTTC | 22 |
| Seq. No. 22 | CGCTCAACTCCCCGAATGTCAT | 22 |
| Seq. No. 23 | CCTGCTATTTAGCAGCGCAA | 20 |
| Seq. No. 24 | AGGTCGCTCTTCTTGATT | 18 |
| Seq. No. 25 | AGACATCGCGTTAAGCGGA | 19 |
| Seq. No. 26 | CAGCGCCACTCCCAACCG | 18 |
| Seq. No. 27 | ACACTATTGGCGAAGTTGATG | 21 |
| Seq. No. 28 | TCCTTCGCCAGCCGTTTCG | 19 |
| Seq. No. 29 | TGGTCGGCAACATCTATTACGT | 22 |
| Seq. No. 30 | TGTTGAAGGCGGCTTCGGA | 19 |
| Seq. No. 31 | TGCGGAAGAAGCCCAGCCA | 19 |
| Seq. No. 32 | TGTGAGTTTCAATAGTGATGCG | 22 |
| Seq. No. 33 | CGTGGTGCTGATGGCGAG | 18 |
| Seq. No. 34 | AGGTTGCCCAGCTTCTCCT | 19 |
| Seq. No. 35 | CAATACCAAAGCCTGATGGATC | 22 |
| Seq. No. 36 | CGCCGCCTTTCCATTCATC | 19 |
| Seq. No. 37 | AAACACGGTTTGGTGGTTCTTGT | 23 |
| Seq. No. 38 | CAAACCACTACGTTATCTGGAG | 22 |
| Seq. No. 39 | ATCTCGACATGCCGGGTTTCGG | 22 |
| Seq. No. 40 | AAGCTGGTTCGACAACGCAT | 20 |
| Seq. No. 41 | GTGTTTGGTCGCATATCGCAAC | 22 |
| Seq. No. 42 | TTCTCAATCTCCGCGAGAAGT | 21 |
| Seq. No. 43 | TCGCCCTCTCATCCACAGC | 19 |
| Seq. No. 44 | TTCCTCGGCCAGGCGCTT | 18 |
| Seq. No. 45 | TAGCTCTTGTTATATCGTTTGGT | 23 |
| Seq. No. 46 | TAGCTGCAAGCGCTTCAACT | 20 |
| Seq. No. 47 | GTCACACCGAGAGGGAACA | 19 |
| Seq. No. 48 | TACAGCCTGTGGGATCAACA | 20 |
| Seq. No. 49 | TATATTACGTAGGAACCTATGATTT | 28 |
| GGC | ||
| Seq. No. 50 | AACTTCAGAAAATTTCTTATCAA | 29 |
| CAATAA | ||
| Seq. No. 51 | GCCGGAGGTCTTGAATATTT | 26 |
| TGGTAA | ||
| Seq. No. 52 | TTAATTTGAAGCCTTTTGTTTTTG | 27 |
| TTG | ||
| Seq. No. 53 | GAAGCCGAAGAAAGTAGTAGCCA | 23 |
| Seq. No. 54 | GCCGCCAAACAGCAGTTTCTTC | 22 |
| Seq. No. 55 | GCAAATGGAATGTATTTGGTAACG | 27 |
| AAT | ||
| Seq. No. 56 | CAATCTCAAATTTAGAAGTCGCTT | 27 |
| TTC | ||
| Seq. No. 57 | AGATTTCTGCCAATGCTATGTA | 22 |
| Seq. No. 58 | TCTTGTAAAAATCAAATCCTCCT | 23 |
| Seq. No. 59 | GTTATCCGTGATTACCTGTCT | 21 |
| Seq. No. 60 | ATCCACACATTTTCCTGTGGCGG | 23 |
| Seq. No. 61 | GCAACACTGATTTCCGCTCTGCT | 23 |
| Seq. No. 62 | TCTTTCTGCTGCGGCCAGTCATA | 23 |
| Seq. No. 63 | TGCGCTTTTATCAAAACTGG | 26 |
| CAGCCG | ||
| Seq. No. 64 | GGTATGCCGCCTCAACGCGTG | 21 |
| Seq. No. 65 | GATCGCCTGAAGGCACTGGT | 20 |
| Seq. No. 66 | GCACGTCGAGGTGGGTCTGT | 20 |
| Seq. No. 67 | CCGCGACAGCAGGTGGATATGC | 22 |
| Seq. No. 68 | GTCTGTTTGTACTTCATCTGGAAA | 24 |
| Seq. No. 69 | GCAGGAGCAGGCTATTCCGG | 20 |
| Seq. No. 70 | GTTTTATGCACCCATGAGGCTTTC | 24 |
| Seq. No. 71 | CGAACTGGTCAATCAGACCATC | 22 |
| Seq. No. 72 | TCAATGCTCGACTTCACGCCGTA | 23 |
| Seq. No. 73 | CTATGCGCAGCAGCAGGGCAA | 21 |
| Seq. No. 74 | AGATAGCGAATCAGATCGCGAGC | 23 |
| Seq. No. 75 | TCAGCGAGCAGACCCTGTTCG | 21 |
| Seq. No. 76 | CTATGCTGGGGTTGGAGTACTGG | 23 |
| Seq. No. 77 | TACCGCCTCTTGCTCCACATTTGC | 24 |
| Seq. No. 78 | GCCACCAAGCACGCCCGTAAATG | 23 |
| Seq. No. 79 | CTGGTTGTACGGTTCAGCAT | 20 |
| Seq. No. 80 | GGCATTTCTGACCGCATTTCCAT | 23 |
| Seq. No. 81 | AGTTGTGGCAGACGAACGC | 19 |
| Seq. No. 82 | AGGATTGCCCGCACGATTG | 19 |
| Seq. No. 83 | CTCTGCCGAAGCCGTCAAT | 19 |
| Seq. No. 84 | GACTCAGTTCCCACACCAG | 19 |
| Seq. No. 85 | AGTATGTACCTGCTTCGACC | 20 |
| Seq. No. 86 | GGCTGAACAACCCATCCAG | 19 |
| Seq. No. 87 | CAATCATACACCAAAGACGTGGA | 23 |
| Seq. No. 88 | AGTTTCCTGTAAGTGCGGACACA | 23 |
| Seq. No. 89 | GACTTTAGGTGAGGCAATGGC | 21 |
| Seq. No. 90 | GCTCCACCCAACCAGTCAAC | 20 |
| Seq. No. 91 | CTAATAGCAATGCTGAAGGAACA | 23 |
| Seq. No. 92 | CTTTATATGCCGGTACTTGCGA | 22 |
| Seq. No. 93 | TGCGAAGACGATCTGCACGG | 20 |
| Seq. No. 94 | CAGGAAGCCTGCGTCGTAGC | 20 |
| Seq. No. 95 | CTTGAGCCTGACAGCCTGTA | 20 |
| Seq. No. 96 | CATATTACTTTGCATCTGCATATT | 24 |
| Seq. No. 97 | CAACGCCCAGTCATATCAGA | 20 |
| Seq. No. 98 | GTCACCTTGCCATTGGGTTG | 20 |
| Seq. No. 99 | GATCAGAATGTTCAAGCGCT | 20 |
| Seq. No. 100 | ACAGCCATTCCCCAGCCACT | 20 |
| Seq. No. 101 | GGGCGTAGTTGTGCTCTG | 18 |
| Seq. No. 102 | CTTCGGTCAGCATGGCTTGT | 20 |
| Seq. No. 103 | CATACGGTAATGATCTGAATCG | 22 |
| Seq. No. 104 | AAGGTCCAATGAGCCAGAAGT | 21 |
| Seq. No. 105 | TGCAAGCATCTGCCGTTCCC | 20 |
| Seq. No. 106 | TTCAATCAGCAGCATGTCTTGT | 22 |
| Seq. No. 107 | GCTATTCGCCTGCGTCCA | 18 |
| Seq. No. 108 | GAATTGCGCATTGCCGATCG | 20 |
The sequences of all genes belonging to each gene type were aligned using Clustal W, and gene type-specific conserved regions were identified. Using these regions, primer pairs specific for each gene type were designed in silico and they were compared with all members of the different primer pairs in order to evade cross-hybridization. To easily define gene types of amplicons, primer pairs within each multiplex PCR tube (A1, A2, B1, B2, C1, C2, D1, and D2) were designed to make different PCR product sizes (expected amplicon sizes of Table 1). Therefore, a multiplex PCR was designed with eight reaction tubes including each primer mixture set (e.g., eight primer pairs in case of the multiplex PCR tube A1, Table 1) and to detect and distinguish 1,228 bla genes previously reported, which include 453 class A genes, 140 class B genes, 464 class C genes, and 171 class D genes. The number of total detectable bla gene accession numbers was 7,059 but total number of different and detectable bla genes was 1,228 due to the assignment of different accession numbers to a bla gene. This method (LARGE-SCALEblaFinder), to our knowledge, is the first large-scale method showing that a multiplex PCR can detect and distinguish all clinically-important bla genes.
Design of 54 Primer Pairs for the Large-Scale β-Lactamase (Bla) Detection Method (LARGE-SCALEblaFinder: One Colony Multiplex PCR Assay Per Clinical Strain).
Reference gene sequences (total number of bla gene accession numbers was 7,059 but total number of different bla genes was 1,228) for each of 54 bla gene types were obtained from GenBank (http://www.ncbi.nlm.nih.gov/GenBank). Based on multiple alignments of the sequences of all genes belonging to each gene type using Clustal W (http://www.genome.jp/tools/clustalw/), primer pairs were specifically designed within conserved sites to amplify all alleles of each bla gene type. The melting temperatures of designed primer pairs were calculated using Primer331 and OligoCalc, an online oligonucleotide properties calculator32. To avoid amplification of false positive (or negative) PCR products and to check the specificity of designed primers pairs, a software tool called Primer-BLAST33 was used (http://www.ncbi.nlm.nih.gov/tools/primer-blast/). Sequences of 54 primer pairs and sizes of the expected products are detailed in Table 1 and Table 2. To confirm the specificity of the PCR assay, 54 primer pairs were evaluated in 54 simplex PCR assays to ensure that they correctly amplified the expected bla genes.
Templates for the LARGE-SCALEblaFinder Using a Single Colony.
After many trials and errors, the LARGE-SCALEblaFinder for multiplex PCRs using a single colony was established as follows: (a) a single colony grown on agar plate overnight was emulsified in 20 μl of 0.1% Triton X-100 using the 10 μl pipette tip, and heated at 100° C. for 10 min; (b) after removing cell debris by a centrifugation step of the cell suspension at 18,000×g for 1 min, the supernatant (1 μl) was used as a template DNA for the multiplex PCR.
To avoid time consuming steps such as genomic DNA extraction, we introduced the simple LARGE-SCALEblaFinder using a single colony (FIG. 1). A single colony from an overnight culture was picked using 10 μl pipette tip and was suspended in the special solution containing 0.1% Triton X-100. The heated colony suspension followed by a centrifugation step was used as a template for the multiplex PCR. A single colony always yielded enough genomic DNA for the LARGE-SCALEblaFinder when the heated colony supernatants from control and clinical (test) strains (Escherichia coli, Enterobacter cloacae, Citrobacter freundii, Providencia rettgeri, Klebsiella pneumoniae, Pseudomonas aeruginosa, Acinetobacter baumannii, Enterobacter aerogenes, and Serratia marcescens) were used as templates. Through precise optimization processes of colony multiplex PCRs, a DNA Taq polymerase, an annealing temperature, and concentrations of components, were selected for the most effective LARGE-SCALEblaFinder as described in the Online Method. In case of false positive and/or negative band(s), optimization processes of 54 primer pairs were performed through our novel and unique method
In order to verify the ability of this method, PCR assays were performed on previously-reported bacterial strains, which have been reported to have bla gene(s) on chromosome or plasmid (FIGS. 2a to 2h). First, all primer pairs were validated as simplex PCRs before being employed in a multiplex PCR. Expectedly, only one amplification product of each bla gene with the expected size was detected in 54 simplex PCRs for detecting 54 bla gene types (FIGS. 2a to 2h). Besides the size of PCR product, direct sequencing of 54 PCR products confirmed the exact detection of 54 bla genes (FIGS. 2a to 2h). Notably, although there was not any optimization process, the multiplex PCR experiments with several templates (five-eight; e.g., five in C1 and eight in A1, Table 1) obtained from 54 positive control strains showed that 54 bla type-specific PCR products were exactly detected in eight multiplex PCR assays (eight lane 1s of FIGS. 2a to 2h), suggesting the good quality of 54 designed primer pairs. Similarly, the exact detection of bla genes was confirmed through direct sequencing of PCR products (FIGS. 2a to 2h). However, each multiplex PCR assay cannot discriminate whether one clinical strain harbors only one bla gene or more than two. If one of eight strains harbors two bla gene types (e.g., A1-1 and A1-5 of FIGS. 2a to 2h) and another strain harbors only one bla gene type (e.g., A1-5) in case of a multiplex PCR tube A1 containing eight primer pairs and eight templates obtained from eight positive control strains, one band (A1-5) is overlapped in an agarose gel of this multiplex PCR assay. To solve this problem, it was need that the multiplex PCR assay per a control strain had to be performed with eight multiplex PCR tubes (A1-D2) and only one template obtained from a control strain.
However, unlike the simplex PCR assays, the multiplex PCR assay triggered two problems, the weak intensity of an amplification product of GES type genes and some false positive bands by chromosomal cross-hybridization. Novel optimization processes were needed to solve these problems. The exact in silicoprimer design to detect all clinically-important bla genes cannot generate false negative bands. However, false positive bands cannot be prevented without our novel and unique optimization processes described below. Although the weak intensity of an amplification product was easily solved through increasing the length of GES type-specific primer pairs (FIG. 4a), much efforts were required to eliminate amplification of the false positive band by chromosomal cross-hybridization. To identify which primer is responsible for false positive bands shown in the multiplex PCR assays, many multiplex PCR assays using primer mixtures without one primer were performed (Online Method). As a result, we could find that false positive PCR products were generated by chromosomal cross-hybridization between the forward (or reverse) primer of one bla gene type and the reverse (or forward) primer of another type (FIGS. 4b to 4e). Suspicious primers were redesigned and the redesigned primers were effective for the optimized multiplex PCRs with complete specificity (FIGS. 4c and 4e). Theses novel optimization processes can remove all false positive bands identified in multiplex PCR assays using 100 control strains (Table 3: and FIGS. 3a-1 to 3h-3).
| TABLE 3 | ||
| Detection of β-lactamase (bla) genea |
| Control strains | Positive results | Negative results | Total | |
| Positive strains | 100 | 0 | 100 | |
| Negative strains | 0 | 72 | 72 | |
| Total | 172 | |||
| aSensitivity = 100%, specificity = 100%, positive predictive value = 100%, negative predicted value = 100%. |
On the contrary to positive controls, in the case of 72 negative control strains without any targeted bla genes (FIGS. 3a-1 to 3h-3), any PCR product was not detected in all strains tested, except (a) ampC genes already existing in the genome of an E. coli strain K-12 and its derivatives18; and (b) additional bla genes newly detected by the LARGE-SCALEblaFinder because previously-reported primers could detect only limited types of bla genes (FIGS. 3a-1 to 3h-3). Therefore, these results suggest that this LARGE-SCALEblaFinder can detect all clinically-important bla genes with the complete specificity and sensitivity (Table 3).
Notably, multiplex PCR experiments in 12 strains could detect 24 additional unreported bla genes in the strains that were previously studied (Table 4).
| TABLE 4 | |||
| Additional bla | Position | ||
| bla gene(s) | gene type(s) | at FIGS. | |
| reported by | detected by LARGE- | 3a-1 to | |
| Strain | previousinvestigators | SCALEblaFinder | 3h-3 |
| Escherichia coli | SHV-2a | TEM type, BER | a-18 |
| ECLA-423 | (EC2, KL, | ||
| AmpC-10) type | |||
| Escherichia coli | SHV-12 | TEM type, BER | a-20 |
| ECZP-123 | (EC2, KL, | ||
| AmpC-10) type | |||
| Klebsiella pneumoniae | KPC-3 | TEM type, SHV | a-21 |
| CL576124 | type | ||
| Klebsiella pneumoniae | GES-5, SHV-12, | TEM type | a-23 |
| CHAK3625 | OXA-17 | ||
| Escherichia coli | CTX-M-3 | TEM type, BER | b-10 |
| A15R(+)26 | (EC2, KL, | ||
| AmpC-10) type | |||
| Escherichia coli | CTX-M-15 | TEM type, | b-12 |
| K051902027 | OXA-1 | ||
| type, BER (EC2, | |||
| KL, AmpC-10) | |||
| type | |||
| Escherichia coli | CMY-11 | TEM type, | f-13 |
| K98611028 | OXA-1 type, | ||
| BER (EC2, KL, | |||
| AmpC-10) type | |||
| Escherichia coli | FOX-3 | TEM type | f-18 |
| J53-2R(+)29 | |||
| Acinetobacter | OXA-23 | OXA-10 type, | g-17 |
| baumannii | ADC (AmpC-5) | ||
| K042085930 | type | ||
For example, although the report in 2004 showed that an Escherichia coli strain K986110 had a CMY-1 type (CMY-11) bla gene, the LARGE-SCALEblaFinder detected three additional bla gene types such as OXA-1 type, TEM type, and BER (EC2, KL, AmpC-10) type. The sequence of each additional bla gene was identified by direct sequencing of PCR products. Similarly, previous report showed that a Klebsiella pneumoniae strain CL5761 isolated at the Tisch Hospital, New York, was resistant to carbapenems and harbored a KPC type bla gene of class A. But, through the LARGE-SCALEblaFinder, additional two bla genes (TEM and SHV types) were found in this KPC-3 producing strain (Table 4). These results demonstrated that previous methods detecting only limited types of bla genes can miss unexpected bla genes existing in pathogenic bacteria. In summary, because molecular methods that are able to detect only partial bla gene types cannot detect bla genes beyond the bounds of previous methods, they have the possibility to give researchers an insufficient result, like the case of an Escherichia coli strain K986110. In contrast, our method can detect all clinically-important bla genes including unexpected bla genes undetected by previous methods. Therefore, these results suggest that our method has the ability to give researchers the exact information about bla gene(s) existing in pathogenic bacteria
Optimization Processes of Multiplex PCR Conditions.
To select optimal Taq DNA polymerase, a variety of Taq DNA polymerases were used as follows: Expand High Fidelity PCR system (Roche Diagnostics: DNA-free and high-purity enzyme without pre-mixture), 2× Prime STAR Premix (TaKaRa: DNA-free and high-purity enzyme), 2× EmeraldAmp GT PCR Master mix (TaKaRa), and 2× DiaStar™ Multiplex PCR Smart mix (SolGent: DNA-free). Multiplex PCRs using the heated colony supernatant as a template DNA were performed at various conditions recommended by each manufacture. As a result, only 2× DiaStar™ Multiplex PCR Smart mix was effective for multiplex PCRs, so it was selected as Taq DNA polymerase for multiplex PCRs. According to our previous report34, commercial Taq DNA polymerase could be contaminated with the TEM type bla gene. Therefore, Taq DNA polymerase should be treated DNase I or DNA-free34. Otherwise, false positive PCR product could be detected due to the contamination of the TEM type bla gene. For optimization of the annealing temperature, the gradient PCR machine (PCR Thermal Cycler Dice™ TP600, TaKaRa) was used. Multiplex PCR assays were performed at a variety of annealing temperatures (60° C.˜65° C.). Consequently, the optimal annealing temperature (64° C.) was selected. Because Dallenne et al.12 used various concentrations of primers (0.2 mM˜0.5 mM), a variety of primer concentrations (0.1 mM˜0.5 mM) were tested. There was no PCR product at a concentration of 0.1 mM and false positive bands were detected at primer concentrations in the range between 0.3 mM and 0.5 mM. As only an expected DNA product was detected at the primer concentration of 0.2 mM, 0.2 mM was selected as the optimal concentration of primer for multiplex PCRs. In summary, the optimal multiplex PCR condition was selected as follows. A single colony from an overnight culture was picked using 10 μl pipette tip and was suspended in a total volume of 20 μl of 0.1% Triton X-100, immediately followed by heating of the cell suspension at 100° C. for 10 min. After removing cellular debris by a centrifugation step at 18,000×g for 30 sec, the supernatant (1 μl) was added to each multiplex PCR tube (34 μl per PCR mixture of each tube [A1, A2, B1, B2, C1, C2, D1, or D2]) containing 1× DiaStar™ Multiplex PCR Smart mix and 0.2 mM bla type-specific primers (A1: 16 primers; A2: 10; B1: 16; B2: 16; C1: 10; C2: 10; D1: 16; D2: 14, Table 5).
| TABLE 5 | ||||||||
| Multiplex | Multiplex | Multiplex | Multiplex | Multiplex | Multiplex | Multiplex | Multiplex | |
| tube | tube | tube | tube | tube | tube | tube | tube | |
| Component | A1 | A2 | B1 | B2 | C1 | C2 | D1 | D2 |
| Multiplex | 18 μL | 18 μL | 18 μL | 18 μL | 18 μL | 18 μL | 18 μL | 18 μL |
| PCR | ||||||||
| master | ||||||||
| mixturea | ||||||||
| Primer | 12 μL | 7.5 μL | 12 μL | 12 μL | 7.5 μL | 7.5 μL | 12 μL | 10.5 μL |
| mixtureb | ||||||||
| RNase- | 4 μL | 8.5 μL | 4 μL | 4 μL | 8.5 μL | 8.5 μL | 4 μL | 5.5 μL |
| free | ||||||||
| water | ||||||||
| Template | 1 μL | 1 μL | 1 μL | 1 μL | 1 μL | 1 μL | 1 μL | 1 μL |
| DNA | ||||||||
| (supernatant | ||||||||
| of | ||||||||
| FIG. 1)c |
| Total | 35 μL |
| volume | |
| per tube | |
| a1 × DiaStar™ Multiplex PCR Smart mix (0.3 mM dNTP, 2.5 mM MgCl2, and 100 U/mL DiaStar ™ Fh-Taq; SolGent, Korea) | |
| b0.2 μM bla type-specific primer mixture (16 primers in A1; 10 primers in A2; 16 primers in B1; 16 primers in B2; 10 primers in C1; 10 primers in C2; 16 primers in D1; |
Eight multiplex PCR tubes were needed to test a single strain and the total volume of each multiplex PCR mixture was 35 μl (Table 5). Amplification was performed with the following thermal cycling conditions: initial denaturation at 95° C. for 5 min; 30 cycles of 95° C. for 30 sec, 64° C. for 40 sec, and 72° C. 50 sec; and a final elongation step at 72° C. for 7 min. Amplicons were analyzed by electrophoresis on a 2% agarose gel at 100 V for 1 h and ethidium bromide staining A 100 bp DNA ladder (Biosesang) was used as a size maker.
Novel Optimization Processes of 54 Primer Pairs.
Even though each primer pair was designed to be bound to only target bla genes and all primer pairs was validated by simplex and multiplex PCR assays (FIG. 1), several false positive bands among 100 control strains were detected in some multiplex PCR tubes, including A1, A2, C1, C2, and D1 multiplex tubes. DNA sequence analysis showed that false positive amplicons were PCR products of chromosomal genes from control strains, but not specific bla genes. Consequently, we could find that false positive PCR products were generated by chromosomal cross-hybridization between the forward (or reverse) primer of one bla gene type and the forward (or reverse) primer of another type (FIGS. 4c and 4e). To identify which primer is responsible for the false positive band(s), multiplex PCR assays using primer mixtures without one primer were performed. In case of the false positive band (FIG. 4c) detected in multiplex tube A2 containing 10 different primers, 10 multiplex PCR assays with nine primers were needed and each assay mixture did not have one different primer. In a multiplex PCR assay of tube A2 using a OXA-240-producing strain, the multiplex PCR assay without the forward primer of CTX-M-1 type (5′-AGTTCACGCTGATGGCGAC-3′) and another multiplex PCR assay without the forward primer of CTX-M-25 type (5′-AAAAGCGTAAGGCGGGCGA-3′) showed no false positive band (FIG. 4b). Therefore, these two primers were responsible for the false positive band. Two redesigned primers (CTX-M-1-F; 5′-CAGTTCACGCTGATGGCGAC-3′ and CTX-M-25-F; 5′-TAATGACGACAGCCTGTGTTTC-3′) were effective for multiplex PCRs with complete specificity and fortunately, they didn't generate any false positive band in a multiplex tube A2 (FIG. 4c). Unlike the case of multiplex PCR tube A2, in a multiplex PCR assay of tube D1 using a TEM-30-producing strain as template, two false positive bands were detected. Through the novel optimization process same to that of multiplex PCR tube A2 (FIG. 4d), three primers, the primer pair of OXA-1 type (5′-CAATCATACACCAAAGACGTGGA-3′ and 5′-GCTTCCTGTAAGTGCGGACAC-3′) and the forward primer of OXA-2 type (5′-AGTTGTGGCAGACGAACGC-3′), were responsible for two false positive bands. In this case, by only one redesigned primer (OXA-1-R; 5′-AGCTTCCTGTAAGTGCGGACACA-3′), two false positive bands could be removed in multiplex PCR assays (FIG. 4e). In the case of GES type in multiplex PCR tube A1, the weak intensity of an amplification product was observed (FIG. 4a). To increase the amount of the GES type amplicon, the length of GES type primer pairs increased. Subsequently, more thick bands were obtained.
Positive or Negative Control Strains
For validation of 54 designed primer pairs and optimization of the multiplex PCR assays, well-characterized 100 bacterial strains with known (reported) bla genes were used as positive controls and 72 bacterial strains without any targeted bla gene were used as negative controls. Any PCR product was not detected in all negative strains tested, except (i) ampC genes already existing in the genome of an E. coli strain K-12 and its derivatives (E. coli TOP 10, E. coli MG1655, E. coli ATCC25922, E. coli DH5a, E. coli BL21[DE3], E. coli HB4, E. coli JF701, E. coli JF703, and so on) that have the ampCbla gene in the genome18; and (ii) additional bla genes newly detected by our LARGE-SCALEblaFinder because previously-reported primers could detect only limited types of bla genes (FIGS. 3a-1 to 3h-3).
To confirm the applicability of the LARGE-SCALEblaFinder, multiplex PCR assays were performed on 403 clinical strains, as determined by phenotypic analysis and not characterized by molecular methods. As a result, all strains had at least single bla gene, suggesting the surprising accuracy of this method. Single bla gene was detected in 78 strains, and 325 strains had more than two bla genes. And direct sequencing of all PCR products confirmed that this LARGE-SCALEblaFinder could determine the exact bla gene typing of clinical strains without any false positive or false negative result (Table 6).
| TABLE 6 | ||||
| Number of | ||||
| Number of | positive | |||
| positive | strains | |||
| Number | strains | confirmed | ||
| of | detected | through direct | Detection | |
| strains | by this | sequencing of | percentage | |
| Strains | tested | method | PCR products | (%) |
| Escherichia coli | 199 | 199 | 199 | 100 |
| Klebsiella | 144 | 144 | 144 | 100 |
| pneumoniae | ||||
| Acinetobacter | 38 | 38 | 38 | 100 |
| baumannii | ||||
| Serratia | 22 | 22 | 22 | 100 |
| marcescens | ||||
Therefore, our method can be sufficiently applied as the clinical diagnostic technique for identification and gene typing of β-lactamases in bacterial pathogens.
Clinical Strains Used for Assay (LARGE-SCALEblaFinder) Validation.
The LARGE-SCALEblaFinder was further assessed using 403 clinical strains, which were selected by phenotypic analysis such as MIC (minimum inhibitory concentration), but not characterized by any molecular method. MICs and their interpretation (resistance) were determined by the following method: Susceptibility was determined on Mueller-Hinton agar plates (Difco Laboratories) containing serially twofold-diluted β-lactams. Plates were inoculated with a Steers replicator (Craft Machine) and ca 104 CFU per spot were incubated at 37° C. for 18 h. The results were interpreted by using the Clinical and Laboratory Standards Institute (CLSI) criteria. All strains exhibited resistance to one or more β-lactam(s).
Sequencing Analysis of Multiplex PCR Products.
In order to confirm the exact bla gene type, all PCR products amplified in multiplex PCR assays were identified by direct sequencing of PCR products. Amplified PCR products were purified using a PCR purification kit (Qiagen) and bidirectional sequencing was performed using ABI Prism Big Dye Terminator Cycle Sequencing kit (Applied Biosystems) according to standard procedures. 54 designed primer pairs were used those for bidirectional sequencings.
Solution of the Big Problem in Studying β-Lactam Resistance
Until now, several molecular methods of the bla gene typing were developed to detect the existence of bla gene(s) in clinical strains (Table 7).
| TABLE 7 | ||||||
| Number | ||||||
| Number | of | Specificity | ||||
| of | clinically- | in | ||||
| Number of | control | isolated | Specificity | clinically- | ||
| Source or | Method | detectable | strains | strains | in control | isolated |
| reference | type | bla genes | tested | tested | strains | strains |
| Perez-Perez et | Multiplex | 30 | 29 | 22 | NDa | ND |
| al.11 | PCR | |||||
| Dallenne et al.12 | Multiplex | 539 | 42 | 31 | ND | ND |
| and | ||||||
| simplex | ||||||
| PCRs | ||||||
| Poirel et al.14 | Multiplex | 105 | 13 | 27 | 100% | 100% |
| PCR | ||||||
| Monteiro et | Multiplex | 80 | 30 | 28 | 100% | 100% |
| al.15 | real-time | |||||
| PCR | ||||||
| Ellem et al.13 | Multiplex | 123 | 41 | 617 | 100% | 97.6% |
| real-time | ||||||
| PCR | ||||||
| Grimm et al.21 | Microarray | 102 | 1 | 12 | ND | ND |
| with | ||||||
| simplex | ||||||
| PCR | ||||||
| Leinberger et | Microarray | 156 | 14 | 60 | 100% | 100% |
| al.19 | with | |||||
| dual-plex | ||||||
| and | ||||||
| multiplex | ||||||
| PCRs | ||||||
| Barisic et al.20 | Padlock | 33 | 33 | 70 | ND | 98.6% |
| probes | ||||||
| This invention | Multiplex | 1,228 | 172 | 403 | 100% | 100% |
| (LARGE-SCALEblaFinder) | PCR | |||||
| aNot determined. |
These methods could detect only the limited bla genes (less than 539 bla genes, Table 7), such as ESBL genes11-15. Because these methods cannot detect all clinically-important bla genes, they cannot perfectly explain results of the culture-based phenotypic tests11-15,19-21. This is a big problem in studying β-lactam resistance, which can increase β-lactam resistance due to inappropriate β-lactam use. However, our LARGE-SCALEblaFinder, designed to solve this problem, could detect all clinically-important 1,228 bla genes with 100% specificity and 100% sensitivity, and through experimental tests in 403 clinical strains, the availability of this method in the clinical environment was also proved (Table 7). Although perfect specificity and sensitivity were shown in three previous methods, these methods had the low number of control and test (clinical) strains (Table 7). Furthermore, unlike previous methods12,19,21, our method need one optimized Multiplex PCR per clinical strain and thus it can be a rapid and low-cost molecular method. Therefore, the present invention can be used as a clinical tool for confirming results of the classical culture-based phenotypic method.
The global health crisis by the upsurge of multiple antibiotic resistances strongly triggers the development of the fast and accurate molecular method for detecting antibiotic resistant genes. Although several methods detecting bla genes were reported, these methods could detect only small bla genes. The present inventors provide new LARGE-SCALEblaFinder that is able to detect all clinically-important bla genes and also identify the exact gene type of detected bla genes, which was confirmed by DNA sequence analysis. This optimized multiplex PCR method is a fast, low-cost, and accurate technique for the screening of bla genes encountered in the clinical environment. This method would be suitable for clinical microbiological laboratories without sophisticated instruments, providing accurate detection of β-lactam resistant pathogens and offering rapid and reliable guidelines for appropriate antibiotic prescribing on the basis of case-by-case scientific data.
The big problem in investigating β-lactam resistance is the fact that using primer pairs only for several interesting bla gene types, most researchers detect bla genes in clinical strains. This tendency has an important limitation that these methods cannot detect the unexpected bla genes which exist within the target strain but do not belong to the primer-specific bla gene types. Because the detection of all existing bla genes is significantly important for the accurate prescribing of antibiotics, this problem can increase the possibility of inadequate treatments for bacterial infections. Susceptibility tests using classical culture-based phenotypic tests are the routine method that is able to determine the susceptibilities to most β-lactam antibiotics. However, this procedure can provide inaccurate information about which bla gene types exist in the bacterial strain, especially in strains with ESBL and carbapenemase genes. A recent study demonstrated that ESBL and carbapenemase detection based on the susceptibility tests causes the failure of therapy to levels similar to cases of success22. Additionally, although ESBL and carbapenemase detection for epidemiological purpose is continuously advocated, some laboratories do not seek theses enzymes for treatment purposes22. Therefore, the inaccuracy and experimental difficulty of the phenotypic test can be complemented by the molecular gene typing method. Because our method is accurately able to detect all clinically-important bla genes through only one optimized multiplex PCR assay (with eight PCR tubes) per clinical strain, this technique can solve this big problem in detecting β-lactam resistance.
To remove false positive and false negative results in multiplex PCR assays, we carried out the novel and elaborate optimization processes of 54 primer pairs, such as the removal of chromosomal cross-hybridization between primers belonging to different types (FIGS. 4b and 4c). Based on these optimization processes, new bla genes that will be reported in the future can be included in this detection method. Therefore, the present invention becomes probably a molecular diagnostic tool to be easily upgradeable.
The present invention can be successfully applied to all clinical strains exhibiting resistance to any β-lactam antibiotic. In the study of 403 clinical strains, there was distinct concordance between the phenotypic resistance to β-lactams and the bla gene type(s) detected by method of the present invention, suggesting the highly sensitive and specific feature of our molecular method. This ability to identify antibiotic-resistant pathogens rapidly will be one of major strategies for the success of Antimicrobial Stewardship Programs (ASPs), the institutional programs to optimize antimicrobial therapy, reduce treatment-related cost, improve clinical outcomes and safety, and reduce or stabilize antibiotic resistance.
In conclusion, the present inventors develop the molecular diagnostic method that can detect all clinically-important bla genes in various pathogenic strains using only one unique multiplex PCR condition. The present invention enables rapid and accurate detection of all clinically-important bla genes, such as ESBL and carbapenemase genes. So, the present invention can be promptly used as effective molecular diagnostic technique for identification of bla genes in bacterial pathogens and will provide an important aid for appropriate antibiotic prescribing and minimizing the spread of resistant bacteria.
1. A primer pair selected from the primer pair group consisting of a pair of Seq. No. 1 and 2, a pair of Seq. 3 and 4, a pair of Seq. No. 5 and 6, a pair of Seq. No. 7 and 8, a pair of Seq. No. 9 and 10, a pair of Seq. No. 11 and 12, a pair of Seq. No. 13 and 14, a pair of Seq. No. 15 and 16, a pair of Seq. No. 17 and 18, a pair of Seq. No. 19 and 20, a pair of Seq. No. 21 and 22, a pair of Seq. No. 23 and 24, a pair of Seq. No. 25 and 26, a pair of Seq. No. 27 and 28, a pair of Seq. No. 29 and 30, a pair of Seq. No. 31 and 32, a pair of Seq. No. 33 and 34, a pair of Seq. No. 35 and 36, a pair of Seq. No. 37 and 38, a pair of Seq. No. 39 and 40, a pair of Seq. No. 41 and 42, a pair of Seq. No. 43 and 44, a pair of Seq. No. 45 and 46, a pair of Seq. No. 47 and 48, a pair of Seq. No. 49 and 50, a pair of Seq. No. 51 and 52, a pair of Seq. No. 53 and 54, No. 55 and 56, a pair of Seq. 57 and 58, a pair of Seq. No. 59 and 60, a pair of Seq. No. 61 and 62, a pair of Seq. No. 63 and 64, a pair of Seq. No. 65 and 66, a pair of Seq. No. 67 and 68, a pair of Seq. No. 69 and 70, a pair of Seq. No. 71 and 72, a pair of Seq. No. 73 and 74, a pair of Seq. No. 75 and 76, a pair of Seq. No. 77 and 78, a pair of Seq. No. 79 and 80, a pair of Seq. No. 81 and 82, a pair of Seq. No. 83 and 84, a pair of Seq. No. 85 and 86, a pair of Seq. No. 87 and 88, a pair of Seq. No. 89 and 90, a pair of Seq. No. 91 and 92, a pair of Seq. No. 93 and 94, a pair of Seq. No. 95 and 96, a pair of Seq. No. 97 and 98, a pair of Seq. No. 99 and 100, a pair of Seq. No. 101 and 102, a pair of Seq. No. 103 and 104, a pair of Seq. No. 105 and 106, and a pair of Seq. No. 107 and 108; and each of full-length complement primer pairs thereof for identifying β-lactamase nucleic acid.
2. Primer pairs having at least 2 primer pairs selected from the group consisting of a pair of Seq. No. 1 and 2, a pair of Seq. 3 and 4, a pair of Seq. No. 5 and 6, a pair of Seq. No. 7 and 8, a pair of Seq. No. 9 and 10, a pair of Seq. No. 11 and 12, a pair of Seq. No. 13 and 14, a pair of Seq. No. 15 and 16, a pair of Seq. No. 17 and 18, a pair of Seq. No. 19 and 20, a pair of Seq. No. 21 and 22, a pair of Seq. No. 23 and 24, a pair of Seq. No. 25 and 26, a pair of Seq. No. 27 and 28, a pair of Seq. No. 29 and 30, a pair of Seq. No. 31 and 32, a pair of Seq. No. 33 and 34, a pair of Seq. No. 35 and 36, a pair of Seq. No. 37 and 38, a pair of Seq. No. 39 and 40, a pair of Seq. No. 41 and 42, a pair of Seq. No. 43 and 44, a pair of Seq. No. 45 and 46, a pair of Seq. No. 47 and 48, a pair of Seq. No. 49 and 50, a pair of Seq. No. 51 and 52, a pair of Seq. No. 53 and 54, No. 55 and 56, a pair of Seq. 57 and 58, a pair of Seq. No. 59 and 60, a pair of Seq. No. 61 and 62, a pair of Seq. No. 63 and 64, a pair of Seq. No. 65 and 66, a pair of Seq. No. 67 and 68, a pair of Seq. No. 69 and 70, a pair of Seq. No. 71 and 72, a pair of Seq. No. 73 and 74, a pair of Seq. No. 75 and 76, a pair of Seq. No. 77 and 78, a pair of Seq. No. 79 and 80, a pair of Seq. No. 81 and 82, a pair of Seq. No. 83 and 84, a pair of Seq. No. 85 and 86, a pair of Seq. No. 87 and 88, a pair of Seq. No. 89 and 90, a pair of Seq. No. 91 and 92, a pair of Seq. No. 93 and 94, a pair of Seq. No. 95 and 96, a pair of Seq. No. 97 and 98, a pair of Seq. No. 99 and 100, a pair of Seq. No. 101 and 102, a pair of Seq. No. 103 and 104, a pair of Seq. No. 105 and 106, and a pair of Seq. No. 107 and 108; and each of full-length complement primer pairs thereof for identifying β-lactamase nucleic acid.
3. Primer pairs according to claim 2, having at least 5 primer pairs selected from the group consisting of a pair of Seq. No. 1 and 2, a pair of Seq. 3 and 4, a pair of Seq. No. 5 and 6, a pair of Seq. No. 7 and 8, a pair of Seq. No. 9 and 10, a pair of Seq. No. 11 and 12, a pair of Seq. No. 13 and 14, a pair of Seq. No. 15 and 16, a pair of Seq. No. 17 and 18, a pair of Seq. No. 19 and 20, a pair of Seq. No. 21 and 22, a pair of Seq. No. 23 and 24, a pair of Seq. No. 25 and 26, a pair of Seq. No. 27 and 28, a pair of Seq. No. 29 and 30, a pair of Seq. No. 31 and 32, a pair of Seq. No. 33 and 34, a pair of Seq. No. 35 and 36, a pair of Seq. No. 37 and 38, a pair of Seq. No. 39 and 40, a pair of Seq. No. 41 and 42, a pair of Seq. No. 43 and 44, a pair of Seq. No. 45 and 46, a pair of Seq. No. 47 and 48, a pair of Seq. No. 49 and 50, a pair of Seq. No. 51 and 52, a pair of Seq. No. 53 and 54, No. 55 and 56, a pair of Seq. 57 and 58, a pair of Seq. No. 59 and 60, a pair of Seq. No. 61 and 62, a pair of Seq. No. 63 and 64, a pair of Seq. No. 65 and 66, a pair of Seq. No. 67 and 68, a pair of Seq. No. 69 and 70, a pair of Seq. No. 71 and 72, a pair of Seq. No. 73 and 74, a pair of Seq. No. 75 and 76, a pair of Seq. No. 77 and 78, a pair of Seq. No. 79 and 80, a pair of Seq. No. 81 and 82, a pair of Seq. No. 83 and 84, a pair of Seq. No. 85 and 86, a pair of Seq. No. 87 and 88, a pair of Seq. No. 89 and 90, a pair of Seq. No. 91 and 92, a pair of Seq. No. 93 and 94, a pair of Seq. No. 95 and 96, a pair of Seq. No. 97 and 98, a pair of Seq. No. 99 and 100, a pair of Seq. No. 101 and 102, a pair of Seq. No. 103 and 104, a pair of Seq. No. 105 and 106, and a pair of Seq. No. 107 and 108; and each of full-length complement primer pairs thereof for identifying β-lactamase nucleic acid.
4. Primer pairs according to claim 3, having at least 8 primer pairs selected from the group consisting of a pair of Seq. No. 1 and 2, a pair of Seq. 3 and 4, a pair of Seq. No. 5 and 6, a pair of Seq. No. 7 and 8, a pair of Seq. No. 9 and 10, a pair of Seq. No. 11 and 12, a pair of Seq. No. 13 and 14, a pair of Seq. No. 15 and 16, a pair of Seq. No. 17 and 18, a pair of Seq. No. 19 and 20, a pair of Seq. No. 21 and 22, a pair of Seq. No. 23 and 24, a pair of Seq. No. 25 and 26, a pair of Seq. No. 27 and 28, a pair of Seq. No. 29 and 30, a pair of Seq. No. 31 and 32, a pair of Seq. No. 33 and 34, a pair of Seq. No. 35 and 36, a pair of Seq. No. 37 and 38, a pair of Seq. No. 39 and 40, a pair of Seq. No. 41 and 42, a pair of Seq. No. 43 and 44, a pair of Seq. No. 45 and 46, a pair of Seq. No. 47 and 48, a pair of Seq. No. 49 and 50, a pair of Seq. No. 51 and 52, a pair of Seq. No. 53 and 54, No. 55 and 56, a pair of Seq. 57 and 58, a pair of Seq. No. 59 and 60, a pair of Seq. No. 61 and 62, a pair of Seq. No. 63 and 64, a pair of Seq. No. 65 and 66, a pair of Seq. No. 67 and 68, a pair of Seq. No. 69 and 70, a pair of Seq. No. 71 and 72, a pair of Seq. No. 73 and 74, a pair of Seq. No. 75 and 76, a pair of Seq. No. 77 and 78, a pair of Seq. No. 79 and 80, a pair of Seq. No. 81 and 82, a pair of Seq. No. 83 and 84, a pair of Seq. No. 85 and 86, a pair of Seq. No. 87 and 88, a pair of Seq. No. 89 and 90, a pair of Seq. No. 91 and 92, a pair of Seq. No. 93 and 94, a pair of Seq. No. 95 and 96, a pair of Seq. No. 97 and 98, a pair of Seq. No. 99 and 100, a pair of Seq. No. 101 and 102, a pair of Seq. No. 103 and 104, a pair of Seq. No. 105 and 106, and a pair of Seq. No. 107 and 108; and each of full-length complement primer pairs thereof for identifying β-lactamase nucleic acid.
5. Primer pairs according to claim 4, consisting of a pair of Seq. No. 1 and 2, a pair of Seq. 3 and 4, a pair of Seq. No. 5 and 6, a pair of Seq. No. 7 and 8, a pair of Seq. No. 9 and 10, a pair of Seq. No. 11 and 12, a pair of Seq. No. 13 and 14, a pair of Seq. No. 15 and 16, a pair of Seq. No. 17 and 18, a pair of Seq. No. 19 and 20, a pair of Seq. No. 21 and 22, a pair of Seq. No. 23 and 24, a pair of Seq. No. 25 and 26, a pair of Seq. No. 27 and 28, a pair of Seq. No. 29 and 30, a pair of Seq. No. 31 and 32, a pair of Seq. No. 33 and 34, a pair of Seq. No. 35 and 36, a pair of Seq. No. 37 and 38, a pair of Seq. No. 39 and 40, a pair of Seq. No. 41 and 42, a pair of Seq. No. 43 and 44, a pair of Seq. No. 45 and 46, a pair of Seq. No. 47 and 48, a pair of Seq. No. 49 and 50, a pair of Seq. No. 51 and 52, a pair of Seq. No. 53 and 54, No. 55 and 56, a pair of Seq. 57 and 58, a pair of Seq. No. 59 and 60, a pair of Seq. No. 61 and 62, a pair of Seq. No. 63 and 64, a pair of Seq. No. 65 and 66, a pair of Seq. No. 67 and 68, a pair of Seq. No. 69 and 70, a pair of Seq. No. 71 and 72, a pair of Seq. No. 73 and 74, a pair of Seq. No. 75 and 76, a pair of Seq. No. 77 and 78, a pair of Seq. No. 79 and 80, a pair of Seq. No. 81 and 82, a pair of Seq. No. 83 and 84, a pair of Seq. No. 85 and 86, a pair of Seq. No. 87 and 88, a pair of Seq. No. 89 and 90, a pair of Seq. No. 91 and 92, a pair of Seq. No. 93 and 94, a pair of Seq. No. 95 and 96, a pair of Seq. No. 97 and 98, a pair of Seq. No. 99 and 100, a pair of Seq. No. 101 and 102, a pair of Seq. No. 103 and 104, a pair of Seq. No. 105 and 106, and a pair of Seq. No. 107 and 108; and each of full-length complement primer pairs thereof for identifying β-lactamase nucleic acid.
6. A primer pair selected from the primer pair group consisting of a pair of Seq. No. 1 and 2, a pair of Seq. 3 and 4, a pair of Seq. No. 5 and 6, a pair of Seq. No. 7 and 8, a pair of Seq. No. 9 and 10, a pair of Seq. No. 11 and 12, a pair of Seq. No. 13 and 14, a pair of Seq. No. 15 and 16, a pair of Seq. No. 17 and 18, a pair of Seq. No. 19 and 20, a pair of Seq. No. 21 and 22, a pair of Seq. No. 23 and 24, and a pair of Seq. No. 25 and 26; and each of full-length complement primer pairs thereof for identifying Class A β-lactamase nucleic acid.