Patent application title:

REPELLENT COMPOSITIONS AND GENETIC APPROACHES FOR CONTROLLING HUANGLONGBING

Publication number:

US20150353955A1

Publication date:
Application number:

14/733,439

Filed date:

2015-06-08

Abstract:

The invention provides a method for controlling Huanglongbing (HLB) disease of citrus plants through expressing genes encoding synthases for sesquiterpenes such as β-caryophyllene, and α-copaene, and combinations thereof, in citrus plants. Methods of controlling HLB comprising applying at least one purified sesquiterpene, which repels Diaphorina citri and/or Tryoza erytrae psyllid insects, so as to control the HLB disease of citrus plants, are also disclosed.

Inventors:

Interested in similar patents?

Get notified when new applications in this technology area are published.

Classification:

C12N9/1085 »  CPC further

Enzymes; Proenzymes; Compositions thereof ; Processes for preparing, activating, inhibiting, separating or purifying enzymes; Transferases (2.) transferring alkyl or aryl groups other than methyl groups (2.5)

C12Y402/03057 »  CPC further

Carbon-oxygen lyases (4.2) acting on phosphates (4.2.3) Beta-caryophyllene synthase (4.2.3.57)

C12Y205/01001 »  CPC further

transferring alkyl or aryl groups, other than methyl groups (2.5.1) Dimethylallyltranstransferase (2.5.1.1)

C12N15/82 IPC

Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor; Recombinant DNA-technology; Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression; Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)

A01N45/02 »  CPC further

Biocides, pest repellants or attractants, or plant growth regulators, containing compounds having three or more carbocyclic rings condensed among themselves, at least one ring not being a six-membered ring having three carbocyclic rings

A01N27/00 »  CPC further

Biocides, pest repellants or attractants, or plant growth regulators containing hydrocarbons

C12N9/88 »  CPC further

Enzymes; Proenzymes; Compositions thereof ; Processes for preparing, activating, inhibiting, separating or purifying enzymes Lyases (4.)

C12N9/10 IPC

Enzymes; Proenzymes; Compositions thereof ; Processes for preparing, activating, inhibiting, separating or purifying enzymes Transferases (2.)

Description

CROSS-REFERENCE TO RELATED APPLICATIONS

This application is a continuation-in-part of application Ser. No. 13/501,739 filed Apr. 12, 2012, now U.S. Pat. No. 9,078,448, which is the US national phase of PCT application PCT/BR2010/000353 filed Oct. 26, 2010, which claims the benefit of provisional application 61/255,705 Oct. 28, 2009, the entire content of each of which is expressly incorporated herein by reference thereto.

FIELD OF INVENTION

The invention relates to repellent compositions comprising sesquiterpenes to control Huanglongbing (HLB) in citrus plants. Methods for controlling HLB through genetic modification of citrus plants are also disclosed.

BACKGROUND OF THE INVENTION

Huanglongbing (HLB), also known as citrus vein phloem degeneration (CVPD), citrus greening disease, yellow shoot disease (translated from Chinese huang-lunpin), likubin in Taiwan (translated from Chinese as Immediate Withering Disease), leaf mottle yellows in the Philippines, and citrus dieback in India, is probably the worst disease of citrus caused by a vectored pathogen. The causative agent is a motile bacterium, Candidatus Liberibacter spp., which is transmitted by Asian citrus psyllids (Sternorrhyncha: Psyllidae), also known as Diaphorina citri or, in Africa, by Trioza erytreae, the African citrus psyllid.

Distribution of HLB is primarily in tropical and subtropical Asia. It has been reported in all citrus-growing regions in Asia. The disease has affected crops in China, Taiwan, India, Sri Lanka, Malaysia, Indonesia, Myanmar, the Philippines, Pakistan, Thailand, the Ryukyu Islands, Nepal, Reunion, Mauritius, and Afghanistan. Areas outside Asia such as Saudi Arabia, Brazil and Florida in the U.S. have also reported the disease.

Although existing insecticidal and repellent compositions may be useful in controlling HLB, the safety of these compositions has been questioned as many of these compositions are excessively toxic to other organisms in the ecosystem. In addition, many of these compositions are extraordinarily long-lived, and persist within the environment to which they are applied almost indefinitely. Moreover, many insect species have evolved resistance to many of the known insecticidal and repellent compositions. Thus, a need exists for a relatively non-toxic, shorter-lived, effective repellent composition, such as a biological repellent composition.

It is long known in Vietnam that guava grown in proximity to or intercropped with citrus has a protectant or repellant effect against the Asian citrus psyllid. Guavas are plants in the myrtle family (Myrtaceae) genus Psidium, which contains about 100 species of tropical shrubs and small trees. The most frequently-encountered species, and the one often simply referred to as “the guava,” is the Apple Guava (Psidium guajava).

The protective effect of planting guava and citrus is likely due to volatiles produced from the guava leaves because the protective effect is present year round. Although fifty-seven components including 27 terpenes (or sesquiterpenes) along with 14 alcohols and 4 esters have been identified in guava leaf oil using Gas Chromatography-Mass Spectrometry (GC-MS) obtained from a hydrodistillation of guava leaves, the exact mechanism underlying the protective effect of guava is not known. A recent report (Rouseff et al., “Sulfur Volatiles in Guava (Psidium guajava L.) Leaves: Possible Defense Mechanism”, J. Agric. Food Chem, 56:8905-10, 2008) suggests that sulfur volatiles such as dimethyl disulfide are responsible for the repulsive effect of guava, rather than the major volatiles such as β-caryophyllene since the latter is also present in citrus. But sulfur volatiles contained in guava leaves are emitted at very low levels and only for a period of about 30 minutes after wounding, indicating that these compounds have nothing or little to do with what is observed in citrus-guava intercroppings in Vietnam. On the other hand, β-caryophyllene is present in undamaged citrus leaves at concentrations generally below 0.2% of total volatiles, and represents usually more than 50% of total volatiles emitted by guava leaves.

Regardless of that knowledge, there still remains a need for controlling HLB in citrus plants, and the present embodiments of the invention provide a novel solution to this problem.

SUMMARY OF THE INVENTION

It has been found that sesquiterpenes such as β-caryophyllene and α-copaene produced from the guava leaves repel Diaphorina citri and/or Tryoza erytrae psyllid insects. Thus, the various embodiments of the invention satisfy a need of the industry for controlling HLB in citrus plants by providing a biological repellent composition comprising sesquiterpenes. Methods for controlling HLB through genetic modification of citrus plants to over-express genes coding sesquiterpene synthases are also provided.

Thus, the invention relates in general to a method for controlling HLB in citrus plants, which comprises expressing at least one gene encoding a polypeptide having sesquiterpene synthase activity in citrus plants to produce an additional amount of β-caryophyllene over that expressed by an unmodified citrus plant to repel Diaphorina citri and/or Tryoza erytrae psyllid insects, so as to control HLB, wherein the sesquiterpene that is over-accumulated is β-caryophyllene, α-copaene, or combinations thereof.

In this method, the at least one gene has β-caryophyllene synthase and/or α-copaene synthase activity.

In certain embodiments, the expression of the at least one gene is driven by its own promoter and terminator regions. In other preferred embodiments, the expression of the at least one gene is driven by a heterologous regulator region providing strong constitutive, tissue-specific or inducible expression. More preferably, the heterologous regulator region provides strong tissue-specific expression in the cytosol, chloroplasts or mitochondria.

In additional embodiments, the present method further comprises expressing a gene encoding a farnesyl pyrophosphase synthase to enhance the accumulation of the sesquiterpene produced by the polypeptide having sesquiterpene synthase activity.

The invention also relates to a method for controlling Huanglongbing (HLB) disease of citrus plants comprising applying an amount of at least one purified sesquiterpene, which repels Diaphorina citri and/or Tryoza erytrae psyllid insects, so as to control the HLB disease of citrus plants, wherein the at least one sesquiterpene is selected from the group consisting of β-caryophyllene and α-copaene, or combinations thereof. In this method, the at least one purified sesquiterpene is purified from an organism selected from the group consisting of plants, bacteria and yeasts.

In a preferred embodiment, the at least one purified sesquiterpene is purified from the guava plant, preferably, the leaf extracts of the guava plant.

In some preferred embodiments, the at least one sesquiterpene is applied to the citrus plants by a delivery system that contains those chemicals. Preferably, the amount to be applied to the plant is at least 1 μg/μL. The amount may be applied through slow delivery systems as those already used by entomologists to deliver pheromones. The amount of sesquiterpene that is applied to the plant in an amount that is greater than what the plant can produce normally and is effective to repel the pysllid insects.

In a preferred embodiment of the present invention, a method is described for controlling Huanglongbing (HLB) in citrus plants comprising genetically modifying the citrus plants, such that they express at least one isolated gene encoding a polypeptide having β-caryophyllene synthase (BCS) activity to produce additional β-caryophyllene, so as to repel Diaphorina citri and/or Tryoza erytrae psyllid insects in order to control HLB in the genetically modified plant. This method comprises the steps of (a) introducing into a citrus cell of a construct comprising, in addition to DNA sequences required for selection of transgenic events, an expression construct including a DNA sequence encoding a BCS linked to a promoter for expressing said DNA sequence; (b) recovering a plant which contains the expression construct and; and (c) determining that the recovered plant has increased β-caryophyllene content/emission and a repellent effect on Diaphorina citri and/or Tryoza erytrae.

In one embodiment, the DNA sequence encoding BCS may comprise an already isolated and characterized BCS, for which the enzymatic activity has been confirmed, and include protein sequences such as SEQ ID NO:21 (Arabidopsis thaliana BCS), SEQ ID NO:18 (Artemisia spp. BCS), SEQ ID NO: 19 (Mikania spp. BCS), SEQ ID NO:20 (Cucumis sativus BCS), SEQ ID NO:22 (Zea mays BCS), SEQ ID NO:23 (Oryza sativa BCS); SEQ ID NO:29 (Picea spp. BCS), SEQ ID NO:30 (Solanum lycopersicum BCS), SEQ ID NO:31 (Phyla dulcis BCS), SEQ ID NO:32 (Cucumis melo BCS), SEQ ID NO:33 (Matricaria chamomilla BCS), SEQ ID NO:34 (Lavandula spp. BCS) or SEQ ID NO:35 (Origanum vulgare BCS).

In another embodiment, the DNA sequence encoding BCS may comprise a newly isolated BCS gene, which has been identified on the basis on its conserved motifs and for which the enzymatic activity has been confirmed, such as SEQ ID NO:2.

In another embodiment, the DNA sequence encoding BCS may comprise a newly isolated BCS gene, which has been identified on the basis on its genome annotation and for which the enzymatic activity has been confirmed, such as SEQ ID NO:167 (Citrus spp. BCS).

In still other embodiments, the DNA sequence of the present invention may encode a BCS and may present at least 50% and preferably at least 70% homology to SEQ ID NO:98 (Citrus spp. BCS), SEQ ID NO:36 (Arabidopsis thaliana BCS), SEQ ID NO:42 (Artemisia spp. BCS), SEQ ID NO:44 (Mikania spp. BCS), SEQ ID NO:43 (Cucumis sativus BCS), SEQ ID NO:39 (Zea mays BCS); SEQ ID NO:40 (Oryza sativa), SEQ ID NO:41 (Picea spp. BCS), SEQ ID NO:49 (Solanum lycopersicum BCS), SEQ ID NO:47 (Phyla dulcis BCS), ACC. No. EU158098 (SEQ ID NO:166) (Cucumis melo BCS), SEQ ID NO:46 (Matricaria chamomilla BCS), SEQ ID NO:48 (Lavandula spp. BCS) or SEQ ID NO:45 (Origanum vulgare BCS).

In another embodiment, the DNA sequence of the current method disclosed herein encodes a BCS, wherein the BCS exhibits at least 50% and preferably at least 70% homology to SEQ ID NO:167 (Citrus spp. BCS), SEQ ID NO:18 (Artemisia spp.), SEQ ID NO:19 (Mikania spp.), SEQ ID NO:20 (Cucumis sativus), SEQ ID NO:21 (Arabidopsis thaliana), SEQ ID NO:22 (Zea mays), SEQ ID NO:23 (Oryza sativa), SEQ ID NO:29 (Picea spp), SEQ ID NO:30 (Solanum lycopersicum), SEQ ID NO:31 (Phyla dulcis), SEQ ID NO:32 (Cucumis melo), SEQ ID NO:33 (Matricaria chamomilla), SEQ ID NO:34 (Lavandula spp.), SEQ ID NO:35 (Oreganum vulgare).

In one embodiment, the method of the present invention incorporates the expression of at least one isolated gene encoding a BCS, which is driven by a constitutive promoter and a terminator region.

In other embodiments, the expression of at least one isolated gene is driven by a regulatory region providing strong constitutive, tissue-specific or inducible expression.

In one embodiment, the regulatory region provides strong expression in the cytosol, chloroplasts or mitochondria.

In still other embodiments, the method in this disclosure further comprises expressing a gene encoding a farnesyl pyrophosphase synthase in order to enhance the accumulation of the β-caryophyllene produced by the polypeptide having β-caryophyllene synthase activity.

In one embodiment, the method incorporates a DNA sequence encoding a farnesyl pyrophosphase synthase from citrus.

BRIEF DESCRIPTION OF THE FIGURES

FIG. 1 shows alignments of the amino acid sequences of beta-caryophyllene synthase from maize (SEQ ID NO:22, Acc. No. ABY79206), rice (SEQ ID NO:23, Acc. No. ABJ16553), spruce (SEQ ID NO:29, Acc. No. ADZ45513), Arabidopsis thaliana (SEQ ID NO:21, Acc. No. AA085539), Artemisia annua (SEQ ID NO:18, Acc. No. AAL79181), Mikania micrantha (SEQ ID NO:19, Acc. No. ACN67535), Cucumis sativus (SEQ ID NO:20, Acc. No. AAU05952), Solanum lycopersicum (SEQ ID NO:30, Acc. No. NP 001234766), Phyla dulcis (SEQ ID NO:31, Acc. No. AFR23370), Cucumis melo (SEQ ID NO:32, Acc. No. ABX83200), chamomile (SEQ ID NO:33, Acc. No. AFM43734), lavandule (SEQ ID NO:34, Acc. No. AGU13712) and oregano (SEQ ID NO:35, Acc. No. ADK73615). Highlighted in black and highlighted in grey are respectively identical and similar residues in these sequences. RXR, RRX8W, DDXXD and NSE/DTE characteristic motifs of TPS are highlighted.

FIG. 2 shows volatile terpenes emitted (upper chromatogram) and extracted (lower chromatogram) from guava leaves.

FIG. 3 shows representative gas chromatographic separation of volatiles emitted from the leaves of different citrus genotypes.

FIG. 4 shows representative gas chromatographic separation of volatiles emitted from guava leaves at different developmental stages: A, flush; B, young; C, mature; D, old.

FIG. 5 shows representative percentage and number of selections of Diaphorina citri to citrus volatiles±guava odor (A) and to guava volatiles versus clean air (B) in two arms and four arms olfactometers, respectively.

FIG. 6 shows alignments of the nucleotide (SEQ ID NO:36) and amino acid (SEQ ID NO:21) sequences of β-caryophyllene synthase from Arabidopsis thaliana. Underlined are sequences used to design primers (SEQ ID NO:37) and (SEQ ID NO:38) for amplifying a full-length cDNA encoding the functional BCS.

FIGS. 7A and 7B show alignments of the amino acid sequences of beta-caryophyllene synthase QHS1 from Artemisia annua (SEQ ID NO:18, Accession No. AAL79181), beta-caryophyllene synthase from Mikania micrantha (SEQ ID NO:19, Accession No. ACN67535), beta-caryophyllene synthase from Cucumis sativus (SEQ ID NO:20, Accession No. AAU05952), beta-caryophyllene/alpha-humulene synthase from Arabidopsis thaliana (SEQ ID NO: 21, Accession No. AA085539), beta-caryophyllene synthase from Solanum lycopersicum (SEQ ID NO:30, Acc. No. NP001234766), beta-caryophyllene synthase from Phyla dulcis (SEQ ID NO:31, Acc. No. AFR23370), beta-caryophyllene synthase from Cucumis melo (SEQ ID NO:32, Acc. No. ABX83200), beta-caryophyllene synthase from chamomile (SEQ ID NO:33, Acc. No. AFM43734), beta-caryophyllene synthase from lavandule (SEQ ID NO:34, Acc. No. AGU13712) and beta-caryophyllene synthase from oregano (SEQ ID NO:35, Acc. No. ADK73615) (A), and alignments of the amino acid sequences of (E)-beta-caryophyllene synthase from Zea mays (SEQ ID NO:22, Accession No. ABY79206), spruce (SEQ ID NO:29, Acc. No. ADZ45513) and (E)-beta-caryophyllene/beta-elemene synthase from Oryza sativa (SEQ ID NO:23, Accession No. ABJ16553) (B). Highlighted in black and highlighted in gray are respectively identical and similar residues in these sequences.

FIG. 8 shows alignments of the amino acid sequences of beta-caryophyllene synthase QHS1 from Artemisia annua (SEQ ID NO:18, Accession No. AAL79181), beta-caryophyllene synthase from Mikania micrantha (SEQ ID NO:19, Accession No. ACN67535), beta-caryophyllene synthase from Cucumis sativus (SEQ ID NO:20, Accession No. AAU05952), (E)-beta-farnesene synthase from Citrus junos (SEQ ID NO:24, Accession No. AAK54279), beta-caryophyllene synthase from Solanum lycopersicum (SEQ ID NO:30, Acc. No. NP001234766), beta-caryophyllene synthase from Phyla dulcis (SEQ ID NO:31, Acc. No. AFR23370), beta-caryophyllene synthase from Cucumis melo (SEQ ID NO: 32, Acc. No. ABX83200), beta-caryophyllene synthase from chamomile (SEQ ID NO:33, Acc. No. AFM43734), beta-caryophyllene synthase from lavandule (SEQ ID NO:34, Acc. No. AGU13712) and beta-caryophyllene synthase from oregano (SEQ ID NO:35, Acc. No. ADK73615) terpene synthase from Citrus junos (Accession No. AAG01339), putative terpene synthase from Citrus x paradisi (SEQ ID NO:26, Accession No. AAM00426), and beta-caryophyllene/alpha-humulene synthase from Arabidopsis thaliana (SEQ ID NO:21, Accession No. AA085539). Highlighted in black and highlighted in gray are respectively identical and similar residues in these sequences. Primers designed for amplifying beta-caryophyllene synthase genes are underlined.

FIG. 9 shows partial DNA sequence corresponding to citrus sesquiterpene synthase (SEQ ID NO:3) and primers designed for rapid amplification of its 5′- and 3′-ends employing RACE methodology.

FIGS. 10A and 10B show the nucleotide sequences of SEQ ID NO:1 and SEQ ID NO:3, and protein sequences of SEQ ID NO:2 and SEQ ID NO:4.

FIG. 11 illustrates the phylogeny of putative full-length TPSs from the citrus sequenced plant genomes and characterized TPSs from citrus.

FIG. 12 shows alignments of the amino acid sequences of putative SQS from citrus: SEQ ID NO:167, SEQ ID NO:168 and SEQ ID NO:169 (transcripts 1, 2 and 5 of orange1.1t04360), SEQ ID NO:170 (Cs4g12050.1), SEQ ID NO:171 (Cs4g12080.1), SEQ ID NO:172 (Cs5g12880.1), SEQ ID NO:173 (Cs5g12900.1), SEQ ID NO:174 (Cs5g12900.2), SEQ ID NO:175 (Cs4g12400.1), SEQ ID NO:176 (Cs4g12350.1), SEQ ID NO:177 (Cs4g12450.1), SEQ ID NO:178 (orange1.1t00017.1), SEQ ID NO:179 (orange1.1t00017.2), SEQ ID:180 (orange1.1t02008.1), SEQ ID NO:181 (Cs4g11980.1), SEQ ID NO:182 (Cs5g06290.1), SEQ ID NO:183 (Cs3g21590.1), SEQ ID NO:184 (Cs3g21560.1), SEQ ID NO:185 (Cs4g12110.1), SEQ ID NO:186 (Cs4g12110.2), SEQ ID NO:187 (Cs3g16210.1), SEQ ID NO:188 (Cs4g12090.1), SEQ ID NO:189 (Cs4g12120.1), SEQ ID NO:190 (Cs4g12120.2), SEQ ID NO:191 (Cs2g23470.1), SEQ ID NO:192 (Cs2g23540.1), SEQ ID NO:193 (Cs5g23510.1) and SEQ ID NO:194 (Cs5g23510.2). Highlighted in black and highlighted in grey are respectively identical and similar residues in these sequences. RXR, RRX8W, DDXXD and NSE/DTE characteristic motifs of TPS are bold-lettered.

FIG. 13 are graphs illustrating the invention wherein (A) shows representative total ion chromatogram of sesquiterpene products of SEQ ID NO:2. Assays were conducted with crude protein extracts from in vitro expression with farnesyl diphosphate as substrate. Peak 2 corresponds to an internal standard. (B) shows comparison of TIC fragmentation pattern of background-corrected peak 1 and spectra of β-caryophyllene obtained from libraries.

FIG. 14 shows representative total ion chromatogram of sesquiterpene products of empty vector cultures (A) and vector harbouring SEQ ID NO:98 (B). Assays were conducted with crude protein extracts from in vitro expression with farnesyl diphosphate (FPP) as substrate. Peak 1 corresponds to β-caryophyllene.

FIG. 15 shows alignments of the nucleotide and amino acid sequences of farnesyl pyrophosphate synthase 1 (FPPS1) from Arabidopsis thaliana (Accession No. X75789). Underlined are sequences used to design primers for amplifying a full-length cDNA encoding a functional FPP synthase gene.

FIG. 16 shows alignments of the amino acid sequences of FPP synthase from Arabidopsis thaliana (SEQ ID NO:28, Acc. No. Q09152), Malus domestica (SEQ ID NO:142, Acc. No. AAM08927), Medicago sativa (SEQ ID NO:143, Acc. No. ADC32809), Glycine hispida (SEQ ID NO:144, Acc. No. ACU21393), Lupinus albus (SEQ ID NO:145, Acc. No. AAA86687), Vitis vinifera (SEQ ID NO:146, Acc. No. AAX76910), Gossypum hirsutum (SEQ ID NO:147, Acc. No. CAA72793), Euphorbia pekinensis (SEQ ID NO:148, Acc. No. ACN63187), Hevea brasilensis (SEQ ID NO:149, Acc. No. AAM98379), Populus trichocarpa (SEQ ID NO:150, Acc. No. ABK95166), Mentha piperita (SEQ ID NO:151, Acc. No. AAK63847) and Cyclocaria paliurus (SEQ ID NO:152, Acc. No. ACY80695) and citrus predicted proteins SEQ ID NO:198 (Cs4g08260.1), SEQ ID NO:153 (Cs4g08260.2), SEQ ID NO:154 (Cs4g08260.3), SEQ ID NO:155 (Cs4g08260.4) and SEQ ID NO:156 (Cs4g08260.1). Highlighted in black and highlighted in grey are respectively identical and similar residues in these sequences. Upperlined portions correspond to highly conserved FPPS motifs.

FIG. 17 shows internode length (black bars), stem diameter (grey bars) and number of evaluated clones (white bars) of five different non-transformed Pera sweet orange lines (PNT, numbered 3, 4, 5, 6 and 8) and of transgenic lines (numbered 1 and 2) harbouring different T-DNAs (A (35S::AtCS), TA (35S::TPssu-AtCS), MA (35S::mtTP-AtCS), FA (35S::AtCS/35S::AtFPPS), FTA (35S::TPssu-AtCS/35S::TPssu-AtFPPS), FMA (35S::mtTP-AtCS/355::mtTP-AtFPPS), C (35S::CsCS), TC (35S::TPssu-CsCS), MC (35S::mtTP-CsCS), FC (35S::CsCS/35S::CsFPPS), FTC (35S::TPssu-CsCS/35S::TPssu-CsFPPS), MC (35S::mtTP-CsCS/35S::mtTP-CsFPPS).

FIG. 18 illustrates quantitative real-time PCR analyses of genes AtBCS (black bars) and AtFPPS (grey bars) heterologously overexpressed in citrus plants.

FIG. 19A and B show representative results of monoterpene (A) and sesquiterpene (B) content of citrus leaves from non-transformed plants (PNT-1 and PNT-2) and genetically modified citrus lines overexpressing AtBCS gene (GM-1, GM-2 and GM-3). Relative amount of individual terpenes is presented as a percentage area of each terpene with respect to the total terpene peak area of terpenes in each line. Data represent mean values 6±SEM and are derived from at least five leaves per plant.

FIG. 20 depicts chromatograms wherein (A) illustrates representative total ion chromatograms of the volatile profile of leaves from AtBCS overexpressing transgenic citrus representative line (black lined) and non-genetically modified citrus control plant (blue lined); (B) details the total ion chromatogram at the retention time at which β-caryophyllene appears; and (C) illustrates a comparison of TIC fragmentation pattern of background-corrected β-caryophyllene peak from transgenic sample (upper panel) and spectra of β-caryophyllene obtained from libraries (lower panel).

FIGS. 21A and 21B are graphs that illustrate the response of insects to headspace volatiles wherein 21A shows the response of D. citri to transgenic (GM) citrus headspace volatiles in a 4-arm olfactometer and 21B shows representative olfactometric response of D. citri adults to volatiles emitted by conventional sweet orange (Citrus), guava and two different genetically modified sweet orange lines (Citrus GM1 and GM2) plants overexpressing BCS.

FIG. 22 is a graph that illustrates mean (±SE) percentages of psyllids that in a no-choice test were attracted to and landed on non-transformed (black bars) or genetically modified sweet orange plants overexpressing BCS (grey bars) plants.

DETAILED DESCRIPTION OF THE INVENTION

As noted herein, the invention relates to methods for controlling HLB based on the observation that terpene volatiles produced by the guava leaves repel the HLB vectors, Diaphorina citri and/or Tryoza erytrae psyllid insects.

A terpene is an unsaturated hydrocarbon based on an isoprene unit (C5H8), which may be acyclic or cyclic. A sesquiterpene is a terpene based on a C15 structure.

The guava, like other aromatic plants or essential-oil-plants, accumulates large amounts of sesquiterpenes in their leaves. Typically, sesquiterpenes such as β-caryophyllene and α-copaene represents 50-60% of the total amount of volatiles emitted by guava leaves. In guava plants, the sesquiterpenes are often synthesized and accumulated in specialized anatomical structures, glandular trichomes or secretory cavities, localized on the leaves and stems surface. The sesquiterpenes accumulated in the plants can be extracted by different means such as steam distillation that produces the so-called essential oil containing the concentrated sesquiterpenes.

In certain embodiments of the invention, as a method to control HLB, at least one sesquiterpene extracted from guava plants, preferably β-caryophyllene is applied to the citrus plants through spray or slow delivery systems. Slow delivery systems have been already used by entomologists to deliver pheromones. In such systems, pure β-caryophyllene is disposed in a PVC resin that preserves and releases the chemical compound. This resin is applied directly to citrus trees in the orchards. It has the property of releasing the compound over a period of 3-4 months.

The price and availability of the plant natural extracts are dependent on their abundance, oil yield and geographical origin of the plants. Because of the complexity of their structure, production of individual sesquiterpene molecules by chemical synthesis is often limited by the cost of the process and may not always be chemically or financially feasible. Therefore, a biochemical route for the production of sesquiterpene molecules would be of great interest. The engineering of a biochemical route for the production of sesquiterpene molecules requires a clear understanding of the biosynthesis of sesquiterpenes and the isolation of the genes encoding enzymes involved in specific biosynthetic steps.

The biosynthesis of sesquiterpenes in plants has been extensively studied by the present inventors as well as others. The common five-carbon precursor to all terpenes is isopentenyl pyrophosphate (IPP). Most of the enzymes catalyzing the steps leading to IPP have been cloned and characterized. Two distinct pathways for IPP biosynthesis coexist in the plants. The mevalonate pathway is found in the cytosol and endoplasmic reticulum and the non-mevalonate pathway (or deoxyxylulose 5-phosphate (DXP) pathway) is found in the plastids. In the next step IPP is repetitively condensed by prenyl transferases to form the acyclic prenyl pyrophosphate terpene precursors for the sesquiterpenes, farnesyl-pyrophosphate (FPP). These precursors serve as substrate for the sesquiterpene synthases, which catalyze complex multiple step cyclizations. Thus, the first committed step of β-caryophyllene biosynthesis is the cyclization of the universal sesquiterpene precursor FPP by a sesquiterpene synthase.

Chimeric genes encoding sesquiterpene synthases have been used to genetically transform plants with the aim to attract/repel pollinators (Kessler et al., “Field experiments with transformed plants reveal the sense of floral scents”, Science 321: 1200-1202 (2008), to attract pest-killing insects (Kappers et al., “Genetic engineering of terpenoid metabolism attracts bodyguards to Arabidopsis”, Science 309: 2070-2072 (2005); Schnee et al., “The products of a single maize sesquiterpene synthase form a volatile defense signal that attracts natural enemies of maize herbivores”, PNAS 103: 1129-1134 (2006)) and nematodes (Degenhardt et al., “Restoring a maize root signal that attracts insect-killing nematodes to control a major pest”, PNAS 106:13213-218 (2009)), and directly to kill insect pests (Wu et al., “Redirection of cytosolic or plastidic isoprenoid precursors elevates terpene production in plants”, Nature Biotechnology, 24: 1441-1447 (2006)), indicating that transgenic strategies addressed in order to increase the accumulation of such sesquiterpenes, including β-caryophyllene, could be an ecologically sound alternative, that alone or in combination with a reduced use of pesticides, would prevent damages caused by pest-transmitted devastating diseases.

Overexpression of a β-caryophyllene synthase gene (BCS) leads to increased emission of β-caryophyllene in transgenic plants if an endogenous gene is used, as it has been previously documented in Arabidopsis (Huang et al., “The major volatile organic compound emitted from Arabidopsis thaliana flowers, the sesquiterpene (E)-β-caryophyllene, is a defense against a bacterial pathogen”, New Phytol.; March; 193(4):997-1008 (2012) and in rice (Cheng et al., “The rice (E)-beta-caryophyllene synthase (OsTPS3) accounts for the major inducible volatile sesquiterpenes”, Phytochemistry; June; 68(12):1632-41 (2007).

Further, transgenic overexpression of any of these BCS genes in plant species other than those plants from which the genes were derived and isolated from similarly results in an elevated emission of β-caryophyllene, as it was shown in transgenic maize lines overexpressing a BCS gene from oregano (Degenhardt et al., “Restoring a maize root signal that attracts insect-killing nematodes to control a major pests”, Proc Natl Acad Sci. 106(32): 13213-13218 (2009)).

In addition, transgenic overexpression of any of these BCS genes in non-plant organisms also outcomes in elevated production of β-caryophyllene, as demonstrated by Reinsvold and co-workers, who engineered a β-caryophyllene-producing cyanobacterium by overexpressing a BCS gene from Artemisia annua (Reinsvold et al., “The production of the sesquiterpene β-caryophyllene in a transgenic strain of the cyanobacterium Synechocystis”, J Plant Physiol; May 15; 168(8):848-52 (2011)).

The inventors, in U.S. patent application Ser. No. 13/501,739 with Publication No. US 2012/0272405 A1, wherein the entire content is expressly incorporated herein by reference, have demonstrated that β-caryophyllene in pure form confers repellence to the psyllids Diaphorina citri and Trioza erytrae. Thus, by overexpressing any β-caryophyllene synthase gene biochemically from any organism in any transgenic citrus plant, the transgenic citrus plant would be biochemically converted into a “factory,” wherein the citrus plant overproduces β-caryophyllene, and consequently, repellence to D. citri or T. erytrae is advantageously obtained.

Up to date, as reported in bibliographic references cited herein, there are 13 proteins from different plants that are capable of synthesizing β-caryophyllene as a major product. Three of such plants that produce these proteins correspond to monocotyledonous species, such as maize (Kollner et al., “A maize (E)-β-caryophyllene synthase implicated in indirect defence responses against herbivores is not expressed in most American maize varieties”, The Plant Cell 20:482-494 (2008)); rice (Cheng et al., “The rice (E)-β-caryophyllene synthase (OsTPS3) accounts for the major inducible volatile sesquiterpenes”, Phytochem 68: 1632-1641 (2007)) and spruce (Keeling et al., “Transcriptome mining, functional characterization, and phylogeny of a large terpene synthase gene family in spruce (Picea spp)”, BMC Plant Biology 11: 43-56 (2011)).

The remaining proteins are produced in dicotyledonous plants, for example, Arabidopsis thaliana (Chen et al., “Biosynthesis and emission of terpenoid volatiles from Arabidopsis flowers”, Plant Cell 15: 481-494 (2003); Tholl et al., “Two sesquiterpene synthases are responsible for the complex mixture of sesquiterpenes emitted from Arabidopsis flowers”, The Plant J. 42: 757-771 (2005)), Artemisia annua (Cai et al., “A cDNA clone for β-caryophyllene synthase from Artemisia annua”, Phytochem 61:523-529 (2002)), Mikania micrantha (Wang et al., “Cloning, expression and wounding induction of b-caryophyllene synthase gene from Mikania micrantha H.B.K. and allelopathic potential of b-caryophyllene”, Allelophaty journal 24 (1): 35-44 (2009)), Cucumis sativus (Mercke et al., “Combined transcript and metabolite analysis reveals genes involved in spider mite induced volatile formation in cucumber plants”, Plant Phys. 135: 2012-2024 (2004)), Solanum lycopersicum (Falara et al., “The tomato terpene synthase gene family”, Plant Physiol. 157 (2), 770-789 (2011)), Phyla dulcis (Attia et al., “Molecular cloning and characterization of (+)-epi-α-bisabolol synthase, catalyzing the first step in the biosynthesis of the natural sweetener, hernandulcin, in Lippia dulcis”, Archives of Biochemistry and Biophysics 527 (1): 37-44 (2012)), Cucumis melo (Portnoy et al., “The molecular and biochemical basis for varietal variation in sesquiterpene content in melon (Cucumis melo L.) rinds”, Plant molecular Biology 66: 647-661 (2008)), chamomile (Irmisch et al., “The organ-specific expression of terpene synthase genes contributes to the terpene hydrocarbon composition of chamomile essential oils”, BMC Plant Biology 12:84-96 (2012)), lavandule (Sarker et al., “Cloning of a sesquiterpene synthase from Lavandula x intermedia glandular trichomes”, Planta 238 (5):983-989 (2013)) and oregano (Crocoll et al., “Terpene synthases of oregano (Origanum vulgare L.) and their roles in the pathway and regulation of terpene biosynthesis”, Plant Molecular Biology 73 (6): 587-603 (2010)).

It is a well-accepted biological phenomenon that β-caryophyllene synthase proteins are well-conserved among dicotyledonous plants, showing an overall identity of 47.9%. Besides their identity at the amino acid level, all of these proteins share common features characteristic of plant sesquiterpene synthases. For example, they are all constituted of a length around 550 amino acids, and by in silico analysis, employing on-line informatics tools, they lack any predictable transit-peptide, thus envisaging their cytosolic localization in vivo.

In addition, they share conserved motifs reported in the literature as characteristics of sesquiterpene synthases, as demonstrates alignments of the amino acid sequences (FIG. 1) of beta-caryophyllene synthase from maize (SEQ ID NO:22, Acc. No. ABY79206), rice (SEQ ID NO:23, Acc. No. ABJ16553), spruce (SEQ ID NO:29, Acc. No. ADZ45513), Arabidopsis thaliana (SEQ ID NO:21, Acc. No. AA085539), Artemisia annua (SEQ ID NO:18, Acc. No. AAL79181), Mikania micrantha (SEQ ID NO:19, Acc. No. ACN67535), Cucumis sativus (SEQ ID NO:20, Acc. No. AAU05952), Solanum lycopersicum (SEQ ID NO: 30, Acc. No. NP001234766), Phyla dulcis (SEQ ID NO:31, Acc. No. AFR23370), Cucumis melo (SEQ ID NO:32, Acc. No. ABX83200), chamomile (SEQ ID NO:33, Acc. No. AFM43734), lavandule (SEQ ID:34, Acc. No. AGU13712) and oregano (SEQ ID NO:35, Acc. No. ADK73615).

The two highly conserved aspartate-rich motifs DDXXD and NSE/DTE, which are found in most of the sesquiterpene synthases are highlighted in FIG. 1, together with the other commonly conserved arginine rich region (RXR motif).

The DDXXD and NSE/DTE motifs have been reported to flank the entrance of the active site (Lopez-Gallego et al., “Selectivity of fungal sesquiterpene synthases: Role of the active site's H-1α loop in catalysis”, Applied and Environmental Microbiology 76 (23) 7723-7733 (2010)), and to be involved in binding a trinuclear magnesium cluster, with DDXXD binding two magnesium ions and NSE/DTE binding one magnesium ion (Christianson, D. W., “Structural biology and chemistry of the terpenoid cyclases”, Chemical Reviews, vol. 106, no. 8, pp. 3412-3442, (2006)).

Catalysis of farnesyl diphosphate (FPP) occurs when it reaches the hydrophobic active site, wherein the diphosphate moiety of FPP interacts with the magnesium ions (Degenhart et al., “Monoterpene and sesquiterpene synthases and the origin of terpene skeletal diversity in plants”, Phytochemistry 70: 1621-1637 (2009)). The motif RRX8W, which is essential for enzymatic cyclization, and may play a role in isomerization or stabilizing protein through electrostatic interactions (Martin et al., “Functional annotation, genome organization and phylogeny of the grapevine (Vitis vinifera) terpene synthase gene family based on genome assembly, FLcDNA cloning, and enzyme assays” 10(1): 226-(2010); van der Hoeven et al., “Genetic control and evolution of sesquiterpene biosynthesis in Lycopersicon esculentum and L. hirsutum”, Plant Cell 12 (11): 2283-2294 (2000)) is also partially conserved in all the β-caryophyllene synthases that have been identified up to date (FIG. 1, RX8W), while in monoterpene synthases it is highly conserved (Martin et al., “Functional annotation, genome organization and phylogeny of the grapevine (Vitis vinifera) terpene synthase gene family based on genome assembly, FLcDNA cloning, and enzyme assays” 10(1): 226-(2010); van der Hoeven et al., “Genetic control and evolution of sesquiterpene biosynthesis in Lycopersicon esculentum and L. hirsutum”, Plant Cell 12 (11): 2283-2294 (2000)).

Any one of the nucleotide sequences encoding the BCS proteins as depicted in FIG. 1, or any other newly characterized bona fide β-caryophyllene synthase, would be easily identifiable and isolable by a skilled artisan to which the invention belongs, and by employing different strategies well known and available to any expert in molecular biology. One of ordinary skill in the art would know that one approach is searching in public databases, such as that from National Center for Biotechnology Information (NCBI, http://www.ncbi.nlm.nih.gov/), the nucleotide sequence encoding the desired protein, either by blasting the amino acid sequence or by searching through their accession number. Once sequences are retrieved, nucleotide triplets coding start and stop codons can be easily identified, and forward and reverse primers designed to bind in these regions can be used in order to amplify full length cDNAs using as a target cDNA from the selected organism.

For example, for the BCS produced in Arabidopsis thaliana (SEQ ID NO:21, Acc. No. AA085539), the nucleotide sequence ACC. No. AF497491 (SEQ ID NO:36) is obtained from NCBI, for the BCS produced in Zea mays (SEQ ID NO: 22, Acc. No. ABY79206), the nucleotide sequence ACC. No. EU259633 (SEQ ID NO:39) is obtained from NCBI, for the BCS produced in rice (SEQ ID NO:23, Acc. No. ABJ16553), the nucleotide sequence ACC. No. DQ872158 (SEQ ID NO:40) is obtained from NCBI, for the BCS produced in spruce (SEQ ID NO:29, Acc. No. ADZ45513), the nucleotide sequence ACC. No. HQ426115 (SEQ ID NO:41) is obtained from NCBI, for the BCS produced in Artemisia annua (SEQ ID NO:18, Acc. No. AAL79181), the nucleotide sequence ACC. No. AF472361 (SEQ ID NO:42) is obtained from NCBI, for the BCS produced in Cucumis sativus (SEQ ID NO:20, Acc. No. AAU05952), the nucleotide sequence ACC. No. AY640155 (SEQ ID NO:43) is obtained from NCBI, for the BCS produced in Cucumis melo (SEQ ID NO:32, Acc. No. ABX83200), the nucleotide sequence ACC. No. EU158098 (SEQ ID NO:166) is obtained from NCBI, for the BCS produced in Mikania micrantha (SEQ ID NO:19, Acc. No. ACN67535), the nucleotide sequence ACC. No. FJ767894 (SEQ ID NO:44) is obtained from NCBI, for the BCS produced in oregano (SEQ ID NO:35, Acc. No. ADK73615), the nucleotide sequence ACC. No. GU385969 (SEQ ID NO:45) is obtained from NCBI, for BCS produced in chamomile (SEQ ID NO:33, Acc. No. AFM43734), the nucleotide sequence ACC. No. JQ255375 (SEQ ID NO:46) is obtained from NCBI, for BCS produced in Phyla dulcis (SEQ ID NO:31, Acc. No. AFR2370), the nucleotide sequence ACC. No. JQ731634 (SEQ ID NO:47) is obtained from NCBI, for the BCS produced in lavandula (SEQ ID NO:34, Acc. No. AGU13712), the nucleotide sequence ACC. No. KF470962 (SEQ ID NO:48) is obtained from NCBI, and for BCS produced in tomato (SEQ ID NO:30, Acc. No. NP001234766) the nucleotide sequence ACC. No. NM001247837 (SEQ ID NO:49) is obtained from NCBI.

Consequently, by translating any one of these sequences, start and stop codons can be identified and primers containing these triplets are subsequently designed easily by any skilled artisan in the field, for example those as depicted in Table 1. Once primers are designed, target genes can be amplified with no complication from the selected plant material employing routine PCR methods. The whole process of a detailed description of the isolation of an already characterized BCS gene, namely that from Arabidopsis, is given in Example 6.

Still in other embodiments, other options for obtaining the desired BCS clone would be by way of chemical synthesis of the desired DNA sequence, which is a service nowadays offered by a plethora of genomic companies (i.e. SGI-DNA https://sgidna.com/; GeneScript http://www.genscript.com/gene_synthesis.html; lifetechnologies http://www.lifetechnologies.com/es/en/home/life-science/cloning/gene-synthesis/geneart-gene_synthesis.html). Proper genes of interest are harbored in a cloning and expression vector and expressed in bacterial expression systems and are thus ready to use for a variety of applications.

TABLE 1
Primers employed for amplifying cDNA corresponding
to the BCS sequences SEQ ID NO: 36 (AtCS), SEQ ID
 NO: 39 (ZmCS), SEQ ID NO: 40 (OsCS), SEQ ID
NO: 41 (PgCS), SEQ ID NO: 42 (AaCS), SEQ ID NO: 43
(CsCS), SEQ ID NO: 44 (MmCS), SEQ ID NO: 45
(OvCS), SEQ ID NO: 46 (McCS), SEQ ID NO: 47
(PdCS), SEQ ID NO: 48 (LiCS), SEQ ID NO: 166 (CmCS)
and SEQ ID NO: 49 (S1CS). Triplets encoding start  
and stop codons are underlined.
S, Sense; AS, Antisense.
Orien-
Primer Primer sequence (5′→ 3′) tation
SEQ ID NO: 37 AtCSF ATGGGGAGTGAAGTCAAC S
SEQ ID NO: 38 AtCSR TCAAATGGGTATAGTTTCAAT AS
SEQ ID NO: 49 ZmCSF ATGGCAGCTGATGAGGCAAG S
SEQ ID NO: 50 ZmCSR TTAGTCTATTAGATGCACAT AS
SEQ ID NO: 51 OsCSF ATGGCAACCTCTGTTCCGA S
SEQ ID NO: 52 OsCSR TTAAACAGAGAGGATGTAGATGG AS
SEQ ID NO: 53 PgCSF ATGGCTCAGATTTCTGAAT S
SEQ ID NO: 54 PgCSR TTAGTCCTCAATCGGGAT AS
SEQ ID NO: 55 AaCSF ATGTCTGTTAAAGAAGAGAA S
SEQ ID NO: 56 AaCSR TTATATAGGTATAGGATGAA AS
SEQ ID NO: 57 CsCSF ATGTCTTCTCATTTTCCTG S
SEQ ID NO: 58 CsCSR TTACAAATGCAATGGATCA AS
SEQ ID NO: 59 CmCSF ATGTCTTCTCAAGTTTCAAAT S
SEQ ID NO: 60 CmCSR TTAACAAGGCAGTGGGTCA AS
SEQ ID NO: 61 MmCSF ATGGGTTGTAAGCAAGAAT S
SEQ ID NO: 62 MmCSR TTATTTAAAGTCCAACACAAT AS
SEQ ID NO: 63 OvCSF ATGGAATTTCCGGCATCGGT S
SEQ ID NO: 64 OvCSR TTATACGGGATCAACGAGTATG AS
SEQ ID NO: 65 McCSF ATGGGGAAAGAAGAGAAA S
SEQ ID NO: 66 McCSR CAAAGATTTAATATGATCCTG AS
SEQ ID NO: 67 PdCSF ATGGGTATCCATTCTTCG S
SEQ ID NO: 68 PdCSR TCATATTTTAACAGGTTGAA AS
SEQ ID NO: 69 LiCSF ATGGAGGCCAGGAGGTC S
SEQ ID NO: 70 LiCSR TTATTTAATATGGAAGG AS
SEQ ID NO: 71 S1CSF ATGGCTTCTTCTTCTGCTA S
SEQ ID NO: 72 S1CSR TCATATTTCGACAGACTCAAC AS

Other Examples in this patent application describe a method for identifying and isolating plant terpene synthase (TPS) genes, and more specifically plant β-caryophyllene synthase genes, on basis of their conserved motifs (Examples 7 and 8).

Briefly, this is done by designing degenerate primers and performing rapid amplification of cDNA ends, which are routine procedures for any person skilled in the art, and characterizing TPS activity by in vitro assays, which are routinely performed in many laboratories since many years ago as reflected in the more than 800 reviewed scientific publications from year 1973 to 2014. Different ways of performing TPS activity characterization, by performing in vitro or in vivo transcription/traduction, are described in examples 10, 11 and 12. It would lead to BCS identification from virtually any organism harbouring this gene in its genome.

Besides, the acceleration of TPS-gene discovery in remote places of the plant kingdom has been fuelled by accessibility to comprehensive genome and transcriptome sequence resources for a number of model and non-model systems (Chen et al., “The family of terpene synthases in plants: a mid-size family of genes for specialized metabolism that is highly diversified throughout the kingdom”, The Plant Journal 66 (1): 212-229 (2011)).

For example, NCBI (http://www.ncbi.nlm.nih.gov/genome/browse/), Phytozome 10.1 (http://phytozome.jgi.doe.gov/pz/portal.html), PlantGDB (http://www.plantgdb.org/prj/GenomeBr owser/) or Genoscope (http://www.genoscope.cns.fr/externe/GenomeBrowser/Vitis/) databases provide access to 156, 48, 29 and 18 sequenced and annotated plant genomes, respectively.

Other databases are more specialized providing information of genomes of concrete families, such as Solgenomics which is addressed to Solanum and Nicotiana species (http://solgenomics.net/genomes/), TAIR, centred on Arabidopsis thaliana information (https://www.arabidopsis.org/) or CAP, which is related to sweet orange (http://citrus.hzau.edu.cn/orange/). Identifying TPS genes from any annotated genome is a relatively straightforward task for one of ordinary skill in the art and can be undertaken by searching DNA databases with keywords such as but not limited to “terpene,” “monoterpene” or “sesquiterpene” for example.

Besides, as similarity among plant TPS is based more on taxonomic affinities of the plant species from which the gene was isolated, rather than on the type of product formed, an efficient way of searching BCS genes is using as a template any TPS from the organism of interest. However, if no sequence is available, as certain domains are well-defined as TPS-characteristic (FIG. 1), another useful way for identifying such kind of proteins is performing a TBLASTN search using as a query the consensus sequence of conserved motifs or the sequence of any TPS from any other organism, preferable for those more related with the organism of interest. Working Example 9 demonstrates a detailed identification and functional characterization (Example 12) of a previously uncharacterized BCS gene from citrus.

It has also been discovered that β-caryophyllene, whether it is emitted by guava leaves, or it is used as a pure compound, has a repellent effect on Diaphorina citri and Trioza erytrae (Example 3), it was envisaged, that transgenic citrus plants overproducing this sesquiterpene (Example 22) would become repellent to the psyllid vectors of HLB (Example 23 and 24). Isolating a characterized BCS (Example 6) or identifying, isolating and characterizing a new BCS (Examples 7, 8, 9 and 16) is an affordable task for any expert with basic skills in molecular biology. As such, any BCS gene with or without introns can be used to generate binary vectors (Example 17) subsequently followed by transforming citrus plants (Example 18) in order to obtain β-caryophyllene-producing transgenic citrus trees (Example 22). As used herein, the term “intron” refers to any nucleotide sequence within a gene that is removed by RNA splicing during maturation of the final RNA product. As such, the term “intron” refers to both the DNA sequence within a gene and the corresponding sequence in RNA transcripts.

In certain embodiments, the expression of the BCS gene may be driven by a regulatory region providing strong constitutive, tissue-specific or inducible expression. More preferably, the regulatory region would provide strong tissue-specific expression in the cytosol, chloroplasts or mitochondria. In additional embodiments, the present method may further comprise expressing a gene encoding a farnesyl pyrophosphate synthase to enhance the accumulation of β-caryophyllene. Genes coding for FPPS, as those coding for BCS, are also easily identifiable and isolable from any organism, including citrus as illustrated in Examples 13 and 14. Once transgenic citrus plants are regenerated, expression level of transgenes and plant volatile profiles could be evaluated by different methods, for example those described in Examples 21 and 22. Finally, the behaviour of D. citri/T. erytrae to transgenic plants can easily be assessed and measured as demonstrated in Examples 23 and 24.

As such, in light of the given the background described hereinabove relating to sesquiterpene synthases used for repelling D. citri/T. erytrae psyllids, in accordance with one embodiment of the present invention, there is disclosed a method which relates to the isolation of nucleic acids encoding any sesquiterpene synthase from any citrus plant, citrus-related plants belonging to the Rutaceae family, guava, guava-related plants from the Myrtaceae family, or any other living organism.

As used herein, a “sesquiterpene synthase” is any enzyme that catalyzes the synthesis of a sesquiterpene. One of ordinary skill in the art can easily determine whether a polypeptide encoded by a nucleic acid of the invention has sesquiterpene synthase activity by the enzyme characterization assay described in the Examples herein.

In a preferred embodiment of the present invention, without being limited, a method is described for controlling Huanglongbing (HLB) in citrus plants comprising genetically modifying the citrus plants, such that they express at least one isolated gene encoding a polypeptide having β-caryophyllene synthase (BCS) activity to produce additional β-caryophyllene, so as to repel Diaphorina citri and/or Tryoza erytrae psyllid insects in order to control HLB in the genetically modified plant.

As used herein this disclosure, the term “in an amount sufficient to repel” refers to the lowest minimal amount of the transgenically expressed BCS that is sufficient to produce additional β-caryophyllene with the biochemical capability of repeling Diaphorina citri and/or Tryoza erytrae psyllid insects, so as to control control HLB in the genetically modified plant. As, such it would be rather routine for a skilled artisan do determine what “in an amount sufficient to repel” covers, as all the skilled artisan would have to do, would be to conduct a linear 10, 100, 1000 or any other suitable X-fold serial dilution of the β-caryophyllene subsequent to purifying it from the heterologously expressed host, thereby resulting in different concentrations of the β-caryophyllene, and then applying and assaying the different concentrations of the β-caryophyllene according to Examples 3 and 10 in order to achieve the minimal amount that produces psyllid repellence.

In one embodiment, the DNA sequence encoding BCS may comprise a newly isolated BCS gene, identified on the basis on conserved motifs and for which the enzymatic activity has been confirmed.

In another embodiment, the DNA sequence encoding BCS may comprise a newly isolated BCS gene, identified on the basis on genome annotation and for which the enzymatic activity has been confirmed.

In other embodiments, the method of the current invention may comprise using nucleic acid encoding SEQ ID NO:2, SEQ ID NO:167 (Citrus spp. BCS), SEQ ID NO:21 (Arabidopsis thaliana BCS); SEQ ID NO:18 (Artemisia spp. BCS), SEQ ID NO:19 (Mikania spp. BCS); SEQ ID NO:20 (Cucumis sativus BCS), SEQ ID NO:22 (Zea mays BCS), SEQ ID NO:23 (Oryza sativa), SEQ ID NO: 29 (Picea spp. BCS), SEQ ID NO:30 (Solanum lycopersicum BCS), SEQ ID NO:31 (Phyla dulcis BCS); SEQ ID NO:32 (Cucumis melo BCS), SEQ ID NO:33 (Matricaria chamomilla BCS), SEQ ID NO:34 (Lavandula spp. BCS) or SEQ ID NO:35 (Origanum vulgare BCS).

In this disclosure, there is also contemplated utilizing a method, wherein the DNA sequence of the method in accordance with another embodiment encodes a BCS and presents at least 50, 55, 60, 65, 70, 75, 80, 85, 90 or 95 as well as 100% homology to SEQ ID NO:2, SEQ ID NO:167 (Citrus spp. BCS), SEQ ID NO:21 (Arabidopsis thaliana BCS), SEQ ID NO:18 (Artemisia spp. BCS), SEQ ID NO:19 (Mikania spp. BCS); SEQ ID NO:20 (Cucumis sativus BCS), SEQ ID NO:22 (Zea mays BCS), SEQ ID NO:23 (Oryza sativa); SEQ ID NO:29 (Picea spp. BCS), SEQ ID NO:30 (Solanum lycopersicum BCS); SEQ ID NO:31 (Phyla dulcis BCS), SEQ ID NO:32 (Cucumis melo BCS), SEQ ID NO:33 (Matricaria chamomilla BCS), SEQ ID NO:34 (Lavandula spp. BCS) or SEQ ID NO:35 (Origanum vulgare BCS).

In order to determine the percent identity of two amino acid sequences or of two nucleic acid sequences, the sequences are aligned for optimal comparison purposes (e.g., gaps can be introduced in the sequence of a first amino acid or nucleic acid sequence for optimal alignment with a second amino acid or nucleic acid sequence). The amino acid residues or nucleotides at corresponding amino acid positions or nucleotide positions are then compared. When a position in the first sequence is occupied by the same amino acid residue or nucleotide as the corresponding position in the second sequence, then the molecules are identical at that position. The percent identity between the two sequences is a function of the number of identical positions shared by the sequences (i.e., % identity=number of identical overlapping positions/total number of positions×100%). Most preferably, the two sequences are the same length.

The determination of percent identity between two sequences can also be accomplished using a mathematical algorithm. A preferred, but non-limiting example of a mathematical algorithm utilized for the comparison of two sequences is the algorithm of Karlin and Altschul, 1990, Proc. Natl. Acad. Sci. U.S.A. 87:2264-2268, modified as in Karlin and Altschul, 1993, Proc. Natl. Acad. Sci. U.S.A. 90:5873-5877. Such an algorithm is incorporated into the NBLAST and XBLAST programs of Altschul et al., 1990, J. Mol. Biol. 215:403. BLAST nucleotide searches can be performed with the NBLAST nucleotide program parameters set, e.g., for score=100, wordlength=12 to obtain nucleotide sequences homologous to a nucleic acid molecules of the present invention. BLAST protein searches can be performed with the XBLAST program parameters set, e.g., to score-50, wordlength=3 to obtain amino acid sequences homologous to a protein molecule of the present invention. In order to obtain gapped alignments for comparison purposes, “Gapped BLAST” can be utilized as described in Altschul et al., 1997, Nucleic Acids Res. 25:3389-3402. Alternatively, “PSI-BLAST” can be used to perform an iterated search which detects distant relationships between molecules (Id.). When utilizing BLAST, Gapped BLAST, and PSI-Blast programs, the default parameters of the respective programs (e.g., of XBLAST and NBLAST) can be advantageously used (e.g., http://www.ncbi.nlm.nih.gov). Another preferred, non-limiting example of a mathematical algorithm utilized for the comparison of sequences is the algorithm of Myers and Miller, 1988, CABIOS 4:11-17. Such an algorithm is incorporated in the ALIGN program (version 2.0) which is part of the GCG sequence alignment software package. When utilizing the ALIGN program for comparing amino acid sequences, a PAM120 weight residue table, a gap length penalty of 12, and a gap penalty of 4 can be used.

The percent identity between two sequences can be determined using techniques similar to those described hereinabove, with or without allowing gaps. In calculating percent identity, one having ordinary skill in the art would typically only include exact matches, which are counted.

In another embodiment, the DNA sequence of the current method disclosed herein encodes a BCS and presents at least 50, 55, 60, 65, 70, 75, 80, 85, 90, or 95 and even 100% homology to SEQ ID NO:2, SEQ ID NO:167 (Citrus spp. BCS), SEQ ID NO:18 (Artemisia spp.), SEQ ID NO:19 (Mikania spp.), SEQ ID NO:20 (Cucumis sativus), SEQ ID NO:21 (Arabidopsis thaliana), SEQ ID NO:22 (Zea mays), SEQ ID NO:23 (Oryza sativa), SEQ ID NO:28 (Arabidopsis thaliana), SEQ ID NO:29 (Picea spp), SEQ ID NO:30 (Solanum lycopersicum), SEQ ID NO:31 (Phyla dulcis), SEQ ID NO:32 (Cucumis melo), SEQ ID NO:33 (Anthemis Eecutita), SEQ ID NO:34 (Lavandula Officinalis), SEQ ID NO:35 (Oreganum vulgare).

In one embodiment, the method of the present invention incorporates the expression of at least one isolated gene encoding a BCS which is driven by a constitutive promoter and a terminator region.

In other embodiments, the expression of at least one isolated gene is driven by a regulatory region providing strong constitutive, tissue-specific or inducible expression.

In one embodiment, the regulatory region provides strong expression in the cytosol, chloroplasts or mitochondria.

In other embodiments, the method further comprises expressing a gene encoding a farnesyl pyrophosphase synthase in order to enhance the accumulation of the β-caryophyllene produced by the polypeptide having β-caryophyllene synthase activity.

In one embodiment, the method uses a DNA sequence encoding a farnesyl pyrophosphase synthase from citrus.

In yet other embodiments, the nucleic acid is chosen from (a) a nucleic acid comprising the nucleotide sequence substantially as set out in SEQ ID NO:1; or (b) a nucleic acid encoding the polypeptide substantially set out in SEQ ID NO:2, wherein the polypeptide encoded by said nucleic acid has β-caryophyllene and/or α-copaene synthase activity.

In another embodiment of the nucleic acid of the invention, the nucleic acid is chosen from (a) a nucleic acid comprising the nucleotide sequence substantially as set out in SEQ ID NO:98 or in SEQ ID NO:127; or (b) a nucleic acid encoding the polypeptide substantially set out in SEQ ID NO:167, wherein the polypeptide encoded by said nucleic acid has β-caryophyllene and/or α-copaene synthase activity.

Preferably, without limitation, a nucleic acid encoding any β-caryophyllene and/or α-copaene synthase and/or polypeptide of any sesquiterpene synthase of the invention is isolated from any citrus plant. In an embodiment, the nucleic acid is isolated from guava plants.

In a particular embodiment, the invention relates to certain isolated nucleotide sequences including those that are substantially free from contaminating natural or endogenous material. The terms “ ”nucleic acid” or “nucleic acid molecule” refer to a deoxyribonucleotide or ribonucleotide polymer in either single- or double-stranded form, and unless otherwise limited, would encompass known analogs of natural nucleotides that can function in a similar manner as naturally occurring nucleotides. A “nucleotide sequence” also refers to a polynucleotide molecule or oligonucleotide molecule in the form of a separate fragment or as a component of a larger nucleic acid. Some of the nucleic acid molecules of the invention are derived from DNA or RNA isolated at least once in substantially pure form and in a quantity or concentration enabling identification, manipulation, and recovery of its component nucleotide sequence by standard biochemical methods. Examples of such methods, including methods for PCR protocols that may be used herein, are disclosed in Sambrook et al., “Molecular Cloning: A Laboratory Manual”, 2nd ed., Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. (1989), “Current Protocols in Molecular Biology” edited by F. A. Ausubel et al., John Wiley and Sons, Inc. (1987), and Innis, M. et al., eds., “PCR Protocols: A Guide to Methods and Applications”, Academic Press (1990).

As described herein, the nucleic acid molecules of the invention include DNA in both single-stranded and double-stranded form, as well as the RNA complement thereof. DNA includes, for example, cDNA, genomic DNA, chemically synthesized DNA, DNA amplified by PCR, and any combinations thereof. Genomic DNA, including translated, non-translated and control regions, may be isolated by conventional techniques, e.g., using any one of the cDNAs of the invention, or suitable fragments thereof, as a probe, to identify a piece of genomic DNA which can then be cloned using methods commonly known in the art. In general, nucleic acid molecules within the scope of the invention include sequences that hybridize to sequences of the invention at temperatures 5° C., 10° C., 15° C., 20° C., 25° C., or 30° C. below the melting temperature of the DNA duplex of sequences of the invention, including any range of conditions subsumed within these ranges.

As used herein, the phrase “hybridizes under stringent conditions” is intended to describe conditions for hybridization and washing under which nucleotide sequences at least 70% identical to each other typically remain hybridized to each other. Such stringent conditions are known to those skilled in the art and can be found in Current Protocols in Molecular Biology, John Wiley & Sons, N.Y. (1989), 6.3.1-6.3.6, which describes aqueous and non-aqueous methods, either of which can be used. Another preferred, non-limiting example of stringent hybridization conditions are hybridization in 6× sodium chloride/sodium citrate (SSC) at about 45° C., followed by one or more washes in 2.0×SSC at 50° C. (low stringency) or 0.2×SSC, 0.1% SDS at 50-65° C. (high stringency). Another preferred example of stringent hybridization conditions are hybridization in 6× sodium chloride/sodium citrate (SSC) at about 45° C., followed by one or more washes in 0.2×SSC, 0.1% SDS at 50° C. Another example of stringent hybridization conditions are hybridization in 6× sodium chloride/sodium citrate (SSC) at about 45° C., followed by one or more washes in 0.2×SSC, 0.1% SDS at 55° C. A further example of stringent hybridization conditions are hybridization in 6× sodium chloride/sodium citrate (SSC) at about 45° C., followed by one or more washes in 0.2×SSC, 0.1% SDS at 60° C. Preferably, stringent hybridization conditions are hybridization in 6× sodium chloride/sodium citrate (SSC) at about 45° C., followed by one or more washes in 0.2×SSC, 0.1% SDS at 65° C. Particularly preferred stringency conditions (and the conditions that should be used if the practitioner is uncertain about what conditions should be applied to determine if a molecule is within a hybridization limitation of the invention) are 0.5 M Sodium Phosphate, 7% SDS at 65° C., followed by one or more washes at 0.2×SSC, 1% SDS at 65° C.

In another embodiment, the nucleic acids of the invention comprises a sequence substantially as set out in SEQ ID NO:1 or SEQ ID NO:98 or SEQ ID NO:127. In one embodiment, the nucleic acids are at least 50, 55, 60, 65, 70, 75, 80, 85, 90, or 95%, or preferably 100% identical to nucleotides SEQ ID NO:1 or SEQ ID NO:98 or SEQ ID NO:127, and each nucleic acid encodes a protein that has β-caryophyllene and/or α-copaene synthase activity, as demonstrated, for example, in the enzyme assay described in the examples, with increased stability and efficacy as compared with that of the polypeptide encoded by SEQ ID NO:1 or SEQ ID NO:98 or SEQ ID NO:127.

In one embodiment, the nucleic acid comprises the nucleotide sequence SEQ ID NO:1. In another embodiment, the nucleic acid comprises the nucleotide sequence SEQ ID NO:98 or SEQ ID NO:127.

In yet another embodiment, the nucleic acid comprises a contiguous stretch of at least 50, 100, 250, 500, or 750 contiguous nucleotides of SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:98, SEQ ID NO:127, SEQ ID NO:27, SEQ ID NO:36, SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44, SEQ ID NO:45, SEQ ID NO:46, SEQ ID NO:47, SEQ ID NO:48, SEQ ID NO:49, SEQ ID NO:166.

Such contiguous fragments of these nucleotides may also contain at least one mutation so long as the mutant sequence retains the functionality of the original sequence and the capacity to hybridize to these nucleotides under low or high stringency conditions, such as for example, moderate or high stringency conditions. Such a fragment can be derived, for example, from nucleotide (nt) 200 to nt 1700, from nt 800 to nt 1700, from nt 1000 to nt 1700, from nt 200 to nt 1000, from nt 200 to nt 800, from nt 400 to nt 1600, or from nt 400 to nt 1000 of SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:98, SEQ ID NO:127, SEQ ID NO:27, SEQ ID NO:36, SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44, SEQ ID NO:45, SEQ ID NO:46, SEQ ID NO:47, SEQ ID NO:48, SEQ ID NO:49, SEQ ID NO:75, SEQ ID NO:78, SEQ ID NO:79, SEQ ID NO:81 SEQ ID NO:82 or SEQ ID NO: 166.

As described above, polypeptides encoded by the nucleic acids of the invention are encompassed by the invention. The isolated nucleic acids of the invention may be selected from a nucleic acid encoding the polypeptide substantially set out in SEQ ID NO:167 (Citrus spp. BCS), SEQ ID NO:21 (Arabidopsis thaliana BCS), SEQ ID NO:18 (Artemisia spp. BCS), SEQ ID NO:19 (Mikania spp. BCS), SEQ ID NO:20 (Cucumis sativus BCS), SEQ ID NO:22 (Zea mays BCS), SEQ ID NO:23 (Oryza sativa BCS); SEQ ID NO:29 (Picea spp. BCS), SEQ ID NO:30 (Solanum lycopersicum BCS); SEQ ID NO:31 (Phyla dulcis BCS), SEQ ID NO:32 (Cucumis melo BCS); SEQ ID NO:33 (Matricaria chamomilla BCS), SEQ ID NO:34 (Lavandula spp. BCS), SEQ ID NO:35 (Origanum vulgare BCS), SEQ ID NO:2 or SEQ ID NO:4.

In one embodiment, the polypeptides are at least 50, 55, 60, 65, 70, 75, 80, 85, 90, or 95%, or preferably 100 homologous to SEQ ID NO:2, SEQ ID NO:4, to SEQ ID NO:18 (Artemisia spp.), SEQ ID NO:19 (Mikania spp.), SEQ ID NO:20 (Cucumis sativus), SEQ ID NO:21 (Arabidopsis thaliana), SEQ ID NO:22 (Zea mays), SEQ ID NO:23 (Oryza sativa), SEQ ID:24 (Citrus junos), SEQ ID:26 (Citrus paradisi), SEQ ID:28 (Arabidopsis thaliana), SEQ ID NO:29 (Picea spp), SEQ ID NO:30 (Solanum lycopersicum), SEQ ID NO:31 (Phyla dulcis), SEQ ID NO:32 (Cucumis melo), SEQ ID NO:33 (Anthemis Eecutita), SEQ ID NO:34 (Lavandula Officinalis), SEQ ID NO:35 (Oreganum vulgare) or SEQ ID NO:167 (Citrus sinensis).

Due to the degeneracy of the genetic code wherein more than one codon can encode the same amino acid, multiple DNA sequences can code for the same polypeptide. Such variant DNA sequences can result from genetic drift or artificial manipulation (e.g., occurring during PCR amplification or as the product of deliberate mutagenesis of a native sequence). The present invention thus encompasses any nucleic acid derived from SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:98, or SEQ ID NO:127 capable of encoding a polypeptide substantially set out in SEQ ID NO:2, SEQ ID NO:4 or SEQ ID NO:167.

Deliberate mutagenesis of a native sequence can be carried out using numerous techniques well known in the art. For example, oligonucleotide-directed site-specific mutagenesis procedures can be employed, particularly where it is desired to mutate a gene such that predetermined restriction nucleotides or codons are altered by substitution, deletion or insertion. Exemplary methods of making such alterations are disclosed by Walder et al., (“Gene” 42:133, 1986); Bauer et al. (“Gene” 37:73, 1985); Craik (“BioTechniques”, Jan. 12-19, 1985); Smith et al. (Genetic Engineering: Principles and Methods, Plenum Press, 1981); Kunkel (Proc. Natl. Acad. Sci. USA 82:488, 1985); Kunkel et al. (“Methods in Enzymol.” 154:367, 1987); and U.S. Pat. Nos. 4,518,584 and 4,737,462. In one embodiment, the invention provides for isolated polypeptides. As used herein, the term “polypeptides” refers to a genus of polypeptide or peptide fragments that encompass the amino acid sequences identified herein, as well as smaller fragments. Alternatively, a polypeptide may be defined in terms of its antigenic relatedness to any peptide encoded by the nucleic acid sequences of the invention. Thus, in one embodiment, a polypeptide within the scope of the invention is defined as an amino acid sequence comprising a linear or 3-dimensional epitope shared with any peptide encoded by the nucleic acid sequences of the invention. Alternatively, a polypeptide within the scope of the invention is recognized by an antibody that specifically recognizes any peptide encoded by the nucleic acid sequences of the invention. Antibodies are defined to be specifically binding if they bind polypeptides of the invention with a Ka of greater than or equal to about 107 M−1, such as greater than or equal to 108 M−1.

A polypeptide “variant” as referred to herein means a polypeptide substantially homologous to a native polypeptide, but which has an amino acid sequence different from that encoded by any of the nucleic acid sequences of the invention because of one or more deletions, additions, insertions or substitutions.

Variants can comprise conservatively substituted sequences, meaning that a given amino acid residue is replaced by a residue having similar physiochemical characteristics. Examples of conservative substitutions include substitution of one aliphatic residue for another, such as Ile, Val, Leu, or Ala for one another, or substitutions of one polar residue for another, such as between Lys and Arg; Glu and Asp; or Gln and Asn. See Zubay, Biochemistry, Addison-Wesley Pub. Co., (1983). The effects of such substitutions can be calculated using substitution score matrices such a PAM-120, PAM-200, and PAM-250 as discussed in Altschul, (J. Mol. Biol. 219:555-65, 1991). Other such conservative substitutions, for example, substitutions of entire regions having similar hydrophobicity characteristics, are well known. Also encompassed within the term “variant” is chemically modified natural and synthetic polypeptide molecules.

Homologues and analogs of a BCS molecule are also contemplated by the present invention. As used herein, the term “analog(ue)” or “analog(ue)s” as used herein refers to a polypeptide that possesses similar or identical function to a BCS polypeptide or a fragment of a BCS, but does not necessarily comprise a similar or identical amino acid sequence of a BCS polypeptide or a fragment of a BCS polypeptide, or possess a similar or identical structure to a BCS polypeptide or a fragment of a BCS polypeptide. A polypeptide that has a similar amino acid sequence refers to a polypeptide that satisfies at least one, or all of the following: (a) a polypeptide having an amino acid sequence that is one or more of at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% or preferably even 100% identical to the amino acid sequence of a BCS polypeptide or a fragment of a BCS polypeptide described herein; (b) a polypeptide encoded by a nucleotide sequence that hybridizes under stringent conditions to a nucleotide sequence encoding a BCS polypeptide or a fragment of a BCS polypeptide described herein or (c) a polypeptide encoded by a nucleotide sequence that is at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% or preferably even 100% identical to the nucleotide sequence of a BCS polypeptide or a fragment of a BCS polypeptide described herein. A polypeptide with similar structure to a BCS polypeptide or a fragment of a BCS polypeptide described herein refers to a polypeptide that has a similar secondary, tertiary or quaternary structure of a BCS polypeptide or a fragment of a BCS polypeptide described herein. The structure of a polypeptide can determined using methods known to those having ordinary skill in the art, including but not limited to, X-ray crystallography, nuclear magnetic resonance, and crystallographic electron microscopy or methods that are akin to the mentioned methods.

BCS activity is important to obtain psyllid repellence although other volatile compounds, for example α-coapene, may also be involved in the repellence that is provided by the transformants. Repellence can be improved when the synthase is sent to a specific cellular compartment together with a precursor gene of the pathway. Thus, BCS activity through genetic modification of the plant is an essential component of the present invention.

Naturally-occurring peptide variants are also encompassed by the invention. Examples of such variants are proteins that result from alternate mRNA splicing events or from proteolytic cleavage of the polypeptides described herein. Variations attributable to proteolysis include, for example, differences in the N- or C-termini upon expression in different types of host cells, due to proteolytic removal of one or more terminal amino acids from the polypeptides encoded by the sequences of the invention.

Variants of the sesquiterpene synthases of the invention may be used to attain desired enhanced or reduced enzymatic activity, modified regiochemistry or stereochemistry, or altered substrate utilization or product distribution. Furthermore, variants may be prepared to have at least one modified property, for example an increased affinity for the substrate, an improved specificity for the production of one or more desired compounds, a different product distribution, a different enzymatic activity, an increase of the velocity of the enzyme reaction, a higher activity or stability in a specific environment (pH, temperature, solvent, etc), or an improved expression level in a desired expression system. A variant or site direct mutant may be made by any method known in the art. As stated above, the invention provides recombinant and non-recombinant, isolated and purified polypeptides, such as from guava or citrus plants. Variants and derivatives of native polypeptides can be obtained by isolating naturally-occurring variants, or the nucleotide sequence of variants, of other or same plant lines or species, or by artificially programming mutations of nucleotide sequences coding for native guava or citrus polypeptides. Alterations of the native amino acid sequence can be accomplished by any of a number of conventional methods.

Accordingly, the different embodiments of the present invention provide a method for preparing a variant functional sesquiterpene synthase, the method comprising the steps of (a) selecting any of nucleic acids from the group consisting of SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:36, SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44, SEQ ID NO:45, SEQ ID NO:46, SEQ ID NO:47, SEQ ID NO:48, SEQ ID NO:49, SEQ ID NO:166 or SEQ ID NO:127, (b) altering the nucleic acid sequence so as to obtain a population of mutant nucleic acids, and, (c) transforming host cells with the mutant nucleic acid to express polypeptides, and, (d) screening the polypeptides for a functional polypeptide having at least one modified property. The modified property may be any desired property, for example the properties mentioned above. The alteration of the selected nucleic acid may be performed by random mutagenesis, site-specific mutagenesis or DNA shuffling, for example. The alteration may be at least one point mutation, deletion or insertion.

For example, polypeptides that have undergone mutation(s) having an initial amino acid sequence prior to the mutation(s) as characterized in SEQ ID NO:2, SEQ ID NO:4, to SEQ ID NO:18 (Artemisia spp.), SEQ ID NO:19 (Mikania spp.), SEQ ID NO:20 (Cucumis sativus), SEQ ID NO:21 (Arabidopsis thaliana), SEQ ID NO:22 (Zea mays), SEQ ID NO:23 (Oryza sativa), SEQ ID NO:29 (Picea spp), SEQ ID NO:30 (Solanum lycopersicum), SEQ ID NO:31 (Phyla dulcis), SEQ ID NO:32 (Cucumis melo), SEQ ID NO:33 (Matricaria chamomilla), SEQ ID NO:34 (Lavandula Officinalis), SEQ ID NO:35 (Oreganum vulgare) or SEQ ID NO:167 (Citrus sinensis) are also encompassed by the present invention. Polypeptides that have undergone mutation(s) having an initial amino acid sequence prior to the mutation(s) as characterized in SEQ ID NO:28 and SEQ ID NO:198 are also covered by the present invention. The steps of the method according to this embodiment of the invention, such as screening the polypeptides for a functional polypeptide, are known to the skilled person who will routinely adapt known protocols to the specific modified property that is desired.

For example, mutations can be introduced at particular loci by synthesizing oligonucleotides containing a mutant sequence, flanked by restriction sites enabling ligation to fragments of the native sequence. Following ligation, the resulting reconstructed sequence encodes an analog having the desired amino acid insertion, substitution, or deletion. Alternatively, oligonucleotide-directed site-specific mutagenesis procedures can be employed to provide an altered gene wherein predetermined codons can be altered by substitution, deletion or insertion. The present invention also encompasses nucleic acids obtained from altering a nucleic acid of the present invention, for example in order to obtain a variant polypeptide.

There are several methods known in the art for the creation of transgenic plants. These include, but are not limited to: electroporation of plant protoplasts, liposome-mediated transformation, Agrobacterium-mediated transformation, polyethylene-glycol-mediated transformation, microinjection of plant cells, and transformation using viruses. In one embodiment, direct gene transfer by particle bombardment is utilized. In another embodiment, Agrobacterium-mediated transformation is utilized.

Agrobacterium tumefaciens-mediated transformation is the most common method used to transform citrus plants. It uses a disarmed A. tumefaciens strain carrying the gene(s) of interest in its genome as a vector to transform citrus cells or tissues by cocultivation for a few days.

Genetic transformation is used naturally by Agrobacterium species as a system to insert fragments of their DNA in infected plant cells. Expression of the genes transferred by the bacteria in plant cells leads to the elicitation of crown gall tumors in plants usually at wound sites. In A. tumefaciens the transferred DNA is called T-DNA and it resides in a megaplasmid called Ti (from Tumor-Inducing) plasmid.

Disarmed Ti plasmids can be engineered by removing T-DNA genes involved in tumor formation. Then, heterologous genes with the appropriate regulatory regions can be inserted into a new chimeric T-DNA region that once incorporated in Agrobacterium cells carrying a disarmed Ti plasmid can be used to integrate and express the foreign genes in plant cells. From transformed plant cells it is possible to regenerate whole transgenic plants by using standard tissue culture systems.

Direct gene transfer by particle bombardment provides another example for transforming plant tissue. In this technique a particle, or microprojectile, coated with DNA is shot through the physical barriers of the cell. Particle bombardment can be used to introduce DNA into any target tissue that is penetrable by DNA coated particles, but for stable transformation, it is imperative that regenerable cells be used. Typically, the particles are made of gold or tungsten. The particles are coated with DNA using either CaCl2 or ethanol precipitation methods which are commonly known in the art.

DNA coated particles are shot out of a particle gun. A suitable particle gun can be purchased from Bio-Rad Laboratories (Hercules, Calif.). Particle penetration is controlled by varying parameters such as the intensity of the explosive burst, the size of the particles, or the distance particles must travel to reach the target tissue.

The DNA used for coating the particles may comprise an expression cassette suitable for driving the expression of the gene of interest that will comprise a promoter operably linked to the gene of interest.

Methods for performing direct gene transfer by particle bombardment are disclosed in U.S. Pat. No. 5,990,387 to Tomes et al. In one embodiment, transfected DNA is integrated into a chromosome of a non-human organism such that a stable recombinant systems results. Any chromosomal integration method known in the art may be used in the practice of the invention, including but not limited to, recombinase-mediated cassette exchange (RMCE), viral site specific chromosomal insertion, adenovirus, and pronuclear injection.

Other than in the operating example, or where otherwise indicated, all numbers expressing quantities of ingredients, reaction conditions, and so forth used in the specification and claims are to be understood as being modified in all instances by the term “about.” Accordingly, unless indicated to the contrary, the numerical parameters set forth in the specification and claims are approximations that may vary depending upon the desired properties sought to be obtained by the present invention. At the very least, and not as an attempt to limit the application of the doctrine of equivalents to the scope of the claims, each numerical parameter should be construed in light of the number of significant digits and ordinary rounding approaches.

Notwithstanding that the numerical ranges and parameters setting forth the broad scope of the invention are approximations, the numerical values set forth in the specific Examples are reported as precisely as possible. Any numerical value, however, inherently contains certain errors necessarily resulting from the standard deviation found in their respective testing measurements. The following Examples are intended to illustrate the invention without limiting the scope as a result. The percentages are given on a weight basis.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although any methods and materials similar or equivalent to those described herein can also be used in the practice of the present invention, exemplary methods and materials are described for illustrative purposes. All publications mentioned in this application are incorporated by reference to disclose and describe the methods and/or materials in connection with which the publications are cited.

Additionally, the publications discussed herein are provided solely for their disclosure prior to the filing date of the present application. Nothing herein should be construed as an admission that the present invention is not entitled to antedate such publication by virtue of prior invention. Further, the dates of publication provided may be different from the actual publication dates, which may need to be independently confirmed.

Further since numerous modifications and changes will readily be apparent to those having ordinary skill in the art, it is not desired to limit the invention to the exact constructions as demonstrated in this disclosure. Accordingly, all suitable modifications and equivalents may be resorted to falling within the scope of the invention.

Thus for example any sequence(s) and/or temporal order of steps of various processes or methods (or sequence of system connections or operation) that are described herein are illustrative and should not be interpreted as being restrictive. Accordingly, it should be understood that although steps of various processes or methods or connections or sequence of operations may be shown and described as being in a sequence or temporal order, but they are not necessary limited to being carried out in any particular sequence or order. For example, the steps in such processes or methods generally may be carried out in various different sequences and orders, while still falling within the scope of the present invention.

Unless defined otherwise, all technical and scientific terms used herein this disclosure have same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. As used herein and in the appended claims, the singular form “a,” “and,” “the” include plural referents unless the context clearly dictates otherwise. All technical and scientific terms used herein have the same meaning.

The terms “comprises,” “comprising,” “includes,” “including,” “having” and their conjugates mean “including but not limited to.” The term “consisting essentially of” means that the method, composition or structure may include additional ingredients, steps and/or parts, but only if the additional ingredients, steps and/or parts do not materially alter the basic and novel characteristics of the claimed method, composition or structure.

Although the present invention has been described and illustrated herein with referred to preferred embodiments, it will be apparent to those of ordinary skill in the art that other embodiments may perform similar functions and/or achieve like results. Thus it should be understood that various features and aspects of the disclosed of the disclosed embodiments can be combined with, or substituted for one another in order to form varying modes of the disclosed invention. Many different embodiments such as variations, adaptations, modifications, and equivalent arrangements are will be implicitly and explicitly disclosed by the embodiments described herein, and thus fall within the scope and spirit of the present invention.

Thus, the scope of the embodiments of the present invention should be determined by the appended claims and their legal equivalents rather than by the Examples and Figures.

EXAMPLES

The following Examples are intended to illustrate the preferred embodiments of the invention without limiting the scope as a result.

Material

Citrus plants used in the present examples were obtained from The Citrus Germplasm Bank (Instituto Valenciano de Investigaciones Agrarias (IVIA), Moncada, Valencia, Spain). Guava seeds were obtained from local growers from Vietnam and Brazil and were grown in a green house at the IVIA. Other available sources of Guava mature plants were Politechnical University and Botanical Garden from Valencia (Spain).

Example 1

Analysis of Leaf Volatile Content and Emission from Citrus and Guava Plants

Volatile content and emission was studied in leaves from different genotypes (Psidium guajava, Citrus sinensis, Citrus aurantifolia and Citrus clementina). Analyses were conducted using leaves at different developmental stages, collected at different hours of the day and in different seasons. Each sample was analyzed at least four times (two biological replicates plus two technical replicates).

To determine volatile content, collected leaf tissue was immediately frozen in liquid nitrogen and stored at −80° C. until extraction. Freeze ground material (200 mg) was weighted in screw-cap Pyrex tubes and immediately 3 mL of cold pentane was added. Samples were homogenized on ice for 30 s with a Yellowline homogenizer (model DI 25). The suspension was vortexed for 15 s and 3 mL of Milli-Q water were added, further vortexed for 30 s and centrifuged at 1800 g for 10 min at 4° C. The organic phase was recovered with a Pasteur pipette and the aqueous phase re-extracted two times more with 3 mL of pentane. An aliquot of 2 μL of the pooled organic phases was directly injected into the GC-MS for volatile analysis (see below).

As headspace analysis gives a more realistic picture of the volatile profile emitted by plants and detected by insects that respond to plant volatiles, static headspace sampling with a solid phase microextraction (SPME) device was performed. Leaf samples were enclosed in 50 mL screw-cap Pyrex tubes carrying a septum on the top and containing 1 mL of milli-Q water for avoiding leaf hydric stress. SPME fiber (100 μm poly(dimethyl) siloxane, Supelco, Bellefonte, Pa.) was exposed, at a controlled temperature of 22° C., between 1 and 4 hours. Immediately afterwards, fiber was transferred to GC injector (220° C.) and thermal desorption was prolonged to 4 mins.

Results showed that main compounds identified through volatile content were also the major volatiles emitted by leaves (for a representative example, see FIG. 2). As described in the literature, more than 80% of total volatiles contained and emitted by citrus leaves were monoterpenes, with linaool being the most abundant one in all the genotypes and sampling dates analysed (FIG. 3). In these samples, β-caryophyllene was not detected or detected at very low levels and not in all the replicates. In guava leaves, sesquiterpenes were the predominant volatiles and, in all the samples analysed, β-caryophyllene constituted at least 50% of total compounds (FIG. 4).

Example 2

GC-MS Analysis

A Thermo Trace GC Ultra coupled to a Thermo DSQ mass spectrometer with electron ionization mode (EI) at 70 eV was used. The ion source and the transfer line were at 200 and 260° C., respectively. Volatile compounds were separated on a HP-INNOWax (Agilent J&C Columns) column (30 m×0.25 mm i.d.×0.25 μm film). The column temperatures were programmed from 40° C. for 5 min, raised to 150° C. at 5° C. min−1, then raised to 250° C. at 20° C. min−1 and held 2 min at 250° C. The injector temperature was 220° C. Helium was the carrier gas at 1.5 mL min−1 in the splitless mode. Electron impact mass spectra were recorded in the 30-400 amu range with a scanning speed of 0.5 scans−1. Compounds were identified by matching of the acquired mass spectra with those stored in reference libraries (NIST, MAINLIB, REPLIBT) or from authentic standard compounds when available.

Example 3

Response of D. citri to Guava Volatiles

A series of experiments were designed in order to investigate the effect of guava leaf volatiles on D. citri behaviour. D. citri adults of mixed sex were obtained from continuously reared cultures on C. limonia seedlings maintained in Fundecitrus (Araraquara, Brazil) at 25±1° C., 70±10% relative humidity and a L14:D10 photoperiod.

A Y-tube olfactometer with one 12.5 cm long entrance arm and two 21.0 cm long test arms (0.6 cm inner diameter) was used for behavioural assays. Charcoal cleaned air (granulated 4-8 mm. Applichem GmbH, Darmstadt, Germany) was pumped (0.4 L min−1) through two glass jars of 2 L containing the volatile sources, consisting of air or guava seedlings. 40 psyllids were assayed in each experiment, and each experiment was conducted at least per triplicate. Position of psyllids was determined after 10 min and those which had passed 10.0 cm after branching were recorded as ‘responsive’. Results showed that guava volatiles repelled or immobilized psyllids or limited citrus attractivenes (FIG. 5A).

Further studies were conducted employing a four-arm olfactometer. Charcoal cleaned air was humidified by passage through a glass cylinder filled with water and separated into four flows (0.4 L min−1) each of which was directed to one of the four olfactometer fields. The air flowing into the test field of the olfactometer passed through a glass cylinder (1 L) containing the samples or clean air. 40 psyllids were assayed in each experiment, and each experiment was conducted at least per triplicate. Results from guava versus clean air clearly indicated that guava volatiles had a repellent effect (FIG. 5B).

Effect of pure β-caryophyllene (puriss>98.5%; Sigma-Aldrich, Germany) and α-copaene (puriss>90.0%; Sigma-Aldrich, Germany) on D. citri was also evaluated employing a four-arm olfactometer. In each observation, a psyllid was placed in the middle of the olfactometer permeated by air coming from each of its four stretched-out arms. In two of the arms clean air was pumped, while in the remaining arms air was pumped through glass vials containing 10 μL of pure compounds. Each observation lasted five min, and the first and final choices of every individual psyllid were recorded. At least 29 psyllids were employed for studying behavioral response to each compound. In the preliminary test with clean air, no significant differences were obtained between the arms, indicating that all of them were equivalent and did not introduce any bias during choice tests. Assays conducted with β-caryophyllene and α-copaene showed a higher level of psyllids entering the unscented arm, envisaging the repellent effect of these compounds (Table 2).

TABLE 2
Clean air χ2 p n
β-caryophyllene
First choice 42.3% 57.7% 1.23 0.4054 29(26)
Final choice 32.0% 68.0%* 6.48 0.0237 29(25)
α-copaene
First choice 42.0% 58.0% 0.76 0.4862 34(33)
Final choice 33.0% 67.0%** 7.33 0.0138 34(33)
Table 2. Representative results from olfactometric assays. Percentage of individuals that chose each compound in four-arm olfactometer trials examining responses of psyllids to treatment odor sources versus a clean air control. n: total sample size (with number of individuals that made a choice in parentheses). Data were compared using chi-square test (*p < 0.05; **p < 0.01).

These results have similarly been reproduced when lower doses of the pure compounds were used in olfactometric assays.

Example 4

Isolation of Total RNA

Leaves, flowers and fruits were collected from Citrus, Arabidopsis and Guava plants, immediately frozen in liquid nitrogen and grounded using a mortar and pestle. Total RNA was extracted using the Qiagen RNeasy Mini. As described by Keszei et al. (Phytochem. 71: 844-852. 2010) the extraction buffer was modified by adding 2% PVP (Sigma-Aldrich) and 120 mg/mL of sodium-isoascorbate (to saturation) (Sigma-Aldrich) to inhibit the oxidative conjugation of phenolics to the RNA. Typically, an average of 100 μg total RNA was obtained from 200 mg of grounded tissue. The concentration of RNA was estimated from the OD at 260 nm. The integrity of the RNA was evaluated on an agarose gel by verifying the integrity of the ribosomic RNA bands.

Example 5

Reverse Transcription (RT) and PCR Amplification

Synthesis of cDNAs was performed with 1 μg of total RNA. RT was carried out in the presence of 500 ng of oligo-dT and 200 units of SuperScript II Reverse transcriptase (Gibco BRL, Germany). Samples were incubated 5 min at 65° C., 50 min at 42° C. and 15 min at 70° C. In general, the thermal cycler conditions were: 5 min at 95° C.; 35 cycles of 30 sec at 94° C., 30 sec at 56° C. and 150 sec at 72° C.; and finally 10 min at 72° C. When KAPA HiFi HotStart (KAPA Biosystems) was employed the cycler conditions were: 5 min at 95° C.; 25 cycles of 20 sec at 98° C., 15 sec at 60° C. and 100 sec at 72° C.; and finally 10 min at 72° C. The sizes of the PCR products were evaluated on a 1% agarose gel. The bands corresponding to the expected size were excised from the gel, purified using the QIAquick™ Gel Extraction Kit (Qiagen) and cloned in the pTZ57R/T (Fermentas GMBH) or pJET1.2 (Fermentas GMBH). Inserted DNA fragments were then subject to DNA sequencing and the sequence compared against the GenBank non-redundant protein database (NCBI) using the BLASTX algorithm (Altschul, S. F., Gish, W., Miller, W., Myers, E. W., and Lipman, D. J. (1990) Basic local alignment search tool. J. Mol. Biol. 215, 403-410).

Example 6

Cloning of a β-Caryophyllene Synthase Gene from Arabidopsis

The nucleotide sequence ACC. No. AF497491 (SEQ ID NO: 36), coding for the BCS produced in Arabidopsis thaliana (SEQ ID NO:21, Acc. No. AA085539), was obtained from NCBI, and primers containing start and stop codons were designed (FIG. 6, Table 1).

As β-caryophyllene is a common volatile compound emitted from Arabidopsis thaliana flowers (Huang et al., “The major volatile organic compound emitted from Arabidopsis thaliana flowers, the sesquiterpene (E)-β-caryophyllene, is a defense against a bacterial pathogen”, New Phytol. 193 (4): 997-1008 (2012)), RNA extraction from flowers was performed using the RNeasy Mini Kit (Qiagen). cDNA synthesis, PCR amplification using the designed specific primers, cloning in an appropriate plasmid such as pJET 1.2 (Fermentas GMBH) and identity confirmation by sequencing, all routine procedures in any molecular biology lab, were performed as previously described in Examples 4 and 5.

Example 7

Isolating Partial Sequences Corresponding to Sesquiterpene Synthases Using RT-PCR

The deduced amino-acid sequences of plant β-caryophyllene synthases were aligned to identify conserved regions and design plant β-caryophyllene synthase-specific oligonucleotides (FIG. 1). Amino acid sequences from plant sesquiterpene synthases with demonstrated β-caryophyllene synthase activity were obtained from the NCBI database. Homology analysis showed more than 40% protein identity between known plant β-caryophyllene synthases. Moreover, higher homology was found if protein sequences were separated in two groups (FIGS. 7A and 7B). The first group (FIG. 7A) contained the sequences of the β-caryophyllene synthases from dicotyledonous plants, as Arabidopsis (Chen et al., “Biosynthesis and emission of terpenoid volatiles from Arabidopsis flowers”, Plant Cell 15: 481-494 (2003); Tholl et al., “Two sesquiterpene synthases are responsible for the complex mixture of sesquiterpenes emitted from Arabidopsis flowers”, The Plant J. 42: 757-771 (2005), cucumber (Mercke et al., “Combined transcript and metabolite analysis reveals genes involved in spider mite induced volatile formation in cucumber plants” Plant Phys. 135: 2012-2024), Mikania Micrantha (Wang et al., “Cloning, expression and wounding induction of β-caryophyllene synthase gene from Mikania micrantha H.B.K. and allelopathic potential of β-caryophyllene”, Alleophaty J. 24:35-44 (2009)), Artemisia annua (Cai et al., “A cDNA clone for β-caryophyllene synthase from Artemisia annua”, Phytochem 61:523-529 (2002), Solanum lycopersicum (Falara et al., “The tomato terpene synthase gene family”, Plant Physiol. 157 (2), 770-789 (2011), Phyla dulcis (Attia et al., “Molecular cloning and characterization of (+)-epi-α-bisabolol synthase, catalyzing the first step in the biosynthesis of the natural sweetener, hernandulcin, in Lippia dulcis”, Archives of Biochemistry and Biophysics 527 (1): 37-44 (2012), Cucumis melo (Portnoy et al., “The molecular and biochemical basis for varietal variation in sesquiterpene content in melon (Cucumis melo L.) rinds”, Plant molecular Biology 66: 647-661 (2008), chamomile (Irmisch et al., “The organ-specific expression of terpene synthase genes contributes to the terpene hydrocarbon composition of chamomile essential oils”, BMC Plant Biology 12:84-96 (2012), lavandule (Sarker et al., “Cloning of a sesquiterpene synthase from Lavandula x intermedia glandular trichomes”, Planta 238 (5):983-989 (2013) and oregano (Crocoll et al., “Terpene synthases of oregano (Origanum vulgare L.) and their roles in the pathway and regulation of terpene biosynthesis”, Plant Molecular Biology 73 (6): 587-603 (2010). The second group (FIG. 7B) contained sequences of β-caryophyllene synthases from monocotyledonous plants as maize (Kollner et al., “A maize (E)-β-caryophyllene synthase implicated in indirect defense responses against herbivores is not expressed in most american maize varieties”, The Plant Cell 20:482-494 (2008), spruce (Keeling et al., “Transcriptome mining, functional characterization, and phylogeny of a large terpene synthase gene family in spruce (Picea spp.)”, BMC Plant Biology 11: 43-56 (2011)) and rice (Cheng et al., “The rice (E)-β-caryophyllene synthase (OsTPS3) accounts for the major inducible volatile sesquiterpenes” Phytochem 68: 1632-1641 (2007). Beta-caryophyllene synthases from monocotyledonous presented an overall identity of 44%, while that from from dicotyledonous showed an overall identity of around 55%. In order to gain insight into citrus sesquiterpene synthases, amino acid sequences from the NCBI database were aligned with β-caryophyllene synthases from dicotyledonous plants (FIG. 8). Sequences employed for analysis were (E)-β-farnesene synthase from Citrus junos (AAK54279), putative terpene synthase from Citrus junos (AAG01339), putative terpene synthase from Citrus paradisi (AAM00426), and valencene synthase from Citrus sinensis (AAQ04608).

Based on these conserved regions among plants, degenerated primers from β-caryophyllene synthases and citrus sesquiterpene synthases were designed (underlined in FIG. 10) in order to isolate β-caryophyllene synthase from guava plants. Detailed sequence of these primers is provided in Table 3. The highest sequence homology was found in the central part of the sequences. Three regions containing sufficiently conserved amino acids were selected and degenerated oligonucleotides specific for these regions were designed (i.e. four forward (CSF1A, CSF1B, CSF2, CSF3) and three reverse primers (CSR3, CSR2, CSR1) were deduced) (Table 3). Partial sequences were amplified, cloned and sequenced following standard procedures. On the basis of these sequences, new primers were designed and amplification of 5′ and 3′ ends was performed employing the 5′/3′ RACE Kit (Roche, Mannheim, Germany) following the instructions of the manufacturer.

TABLE 3
CSF1A, CSF1B, CSF2, CSF3 and CSR1, CSR2 and CSR3
are primers designed based on conserved motifs
in order to amplify partial sequences corresponding
to sesquiterpene synthases. FPPF and FPPR, are
primers designed for amplifying FPP synthase from
Arabidopsis thaliana. S, Sense; AS, Antisense.
K: G or T; R: A or G; M: C or A;
W: T or A; Y: T or C.
Orien-
Primer Primer sequence (5′→ 3′) tation
SEQ ID NO: 11 CSF1A TKGGKGTRKCKTATCAYTTTGA S
SEQ ID NO: 12 CSF1B GGAGTRKCMTAYCATTTTGAA S
SEQ ID NO: 13 CSF2 GGSATGTTAAGTTTGTAYGARGC S
SEQ ID NO: 14 CSF3 GATGAYACWTWTGACGCKTAYGG S
SEQ ID NO: 15 CSR3 CCRTAMGCGTCAWTWGTRTCATC AS
SEQ ID NO: 16 CSR2 TCCTCATTCATATCTTTCCA AS
SEQ ID NO: 17 CSR1 CTATCTCTTGCAAAAGG AS

Example 8

Isolation of Full-Length Sequences Corresponding to Sesquiterpene Synthase Genes. 3′- and 5′-RACE

Synthesis of first-strand cDNAs from leaf tissues and PCR amplifications were performed as described above. Combinations of sense and antisense primers detailed in Table 3 were used for PCR. PCR products were ligated into pTZ57R/T (Fermentas GMBH) and sequenced. Sequence information allowed rapid amplification of cDNA ends by RACE-PCR strategy, using the 5′/3′ RACE Kit (Roche, Mannheim, Germany) according to the manufacturer instructions. For example, CSF1B and CSR1 amplified a band of 621 by with high homology to sesquiterpene synthase genes from NCBI database. On basis of this sequence, new specific primers were designed for 5′-end (B62R and B63R) and 3′-end (B61F) amplification (FIG. 9). For 5′-end amplification, first strand cDNA was synthesized using the specific primer CSR1 (Table 3). A homopolymeric A-tail was added to the 3′ end of purified cDNA and then it was PCR amplified using the gene specific primer B62R and specific oligo-dT anchor primer. A band of about 800 by was amplified, gel purified QIAquick Gel Extraction Kit (Qiagen) and further amplified by a second PCR using the nested gene specific primer B63R and the PCR anchor primer. The amplification product (700 bp) was purified from agarose gel, ligated into pTZ57R/T (Fermentas GMBH) and sequenced. For 3′-end amplification, cDNA was synthesized using oligo dT-anchor primer, and PCR amplification was performed with PCR anchor primer and the gene specific primer B61F. The amplification product (900 bp) was purified from agarose gel, ligated into pTZ57R/T (Fermentas GMBH) and sequenced. Obtained DNA sequences were in silico overlapped and primers containing start and stop were designed in order to PCR-amplify full length clones (Table 4).

Obtained sequences were first compared against the GenBank non-redundant protein database (NCBI) using the BLASTX algorithm (Altschul, S. E, Gish, W., Miller, W., Myers, E. W., and Lipman, D. J. (1990) Basic local alignment search tool. J. Mol. Biol. 215, 403-410) and then compared against the initial DNA sequence to ensure that significant DNA sequence overlap was obtained.

TABLE 4
primers employed for amplifying cDNAs 
corresponding to sequences SEQ ID NO: 5 (B25F) and
SEQ ID NO: 6 (B26R), SEQ ID NO: 7 (B27F) and
SEQ ID NO: 8 (B28R). The start and stop codons
are underlined. S, Sense; AS, Antisense.
Orien-
Primer Primer sequence (5′→ 3′) tation
SEQ ID NO: 5 B25F CACCATGTCCGCTCAAGTTC S
SEQ ID NO: 6 B26R TCAGATGGTAACAGGGTCTC AS
SEQ ID NO: 7 B27F GCATGAGGGATGTTAAGAG S
SEQ ID NO: 8 B28R CTGTTTTCTTTGAAGACTAGGC AS

Example 9

Identification and Cloning of a Citrus β-Caryophyllene Synthase Gene

Citrus proteins AAK54279 (SEQ ID NO:24) and AAM00426 (SEQ ID NO:26), annotated in NCBI database as (E)-β-farnesene synthase from Citrus junos and Citrus x paradisi putative terpene synthase, respectively, and keywords ‘terpene synthase’, ‘linalool’ and ‘limonene’ (the last two being abundant monoterpenes in citrus tissues) were selected for searching in the CAP database, and 96, 112, 55, 62 and 71 cDNA sequences were retrieved, respectively.

After removing from the results duplicate sequences, sequences which did not present good homology to TPS in the NCBI database, as for example, those from chromosome 1, and those encoding proteins of less than 490 amino acids length, the remaining 61 nucleotide sequences, corresponding to 54 different loci with good homology to TPS genes, were selected. Twelve of the loci were located in chromosome 2 (named as Cs2g), 9 in chromosome 3 (named as Cs3g), 11 in chromosome 4 (named as Cs4g), 8 in chromosome 5 (named as Cs5g), 2 in chromosome 7 (named as Cs7g), 1 in chromosome 8 (named as Cs8g) and 11 had no assigned position in the genome (named as orange 1.1t).

Obtained sequences were subjected to multi-sequence alignment analysis, which was next employed to generate a phylogenetic tree by the neighbour joining method (Saitou et al., “The neighbor-joining method: a new method for reconstructing phylogenetic trees”, Molecular biology and evolution 4(4):406-425 (1987). In this analysis, besides the sequences used in the blast as a query, some already characterized citrus terpene synthases, such as Acc. No. BAP75559 and BAP75560 coding for linalool synthases (Shimada et al., “Characterization of three linalool synthase genes from Citrus unshiu Marc. and analysis of linalool-mediated resistance against Xanthomonas citri subsp. citri and Penicilium italicum in citrus leaves and fruits”, Plant Science 229: 154-166 (2014), Acc. No. BAP75561 coding for a linalool/nerolidol synthase (Shimada et al., “Characterization of three linalool synthase genes from Citrus unshiu Marc. and analysis of linalool-mediated resistance against Xanthomonas citri subsp. citri and Penicilium italicum in citrus leaves and fruits”, Plant Science 229: 154-166 (2014), Acc. No. AAQ04608 coding for valencene synthase (Sharon-Asa et al., “Citrus fruit flavour and aroma biosynthesis: isolation, functional characterization, and developmental regulation of Cstps1, a key gene in the production of the sesquiterpene aroma compound valencene”, The Plant Journal 36: 664.674 (2003), Acc. No. AAM53945 and Acc. No. BAF73933 coding for β-pinene synthases (Shimada et al., “Molecular cloning and functional characterization of four monoterpene synthase genes from Citrus unshiu”, Marc Plant Science 166 49-58 (2004); Yamasaki et al., “In situ localization of gene transcriptions for monoterpene synthesis in irregular parenchymatic cells surrounding the secretory cavities in rough lemon (Citrus jambhiri)”, Journal of Plant Physiology 164: 1436-1448 (2007), Acc. No. BAD91045 coding for β-ocimene synthase (Shimada et al., “Isolation and characterization of (E)-beta-ocimene and 1,8 cineole synthases in Citrus unshiu Marc”, Plant Science 168 987-995 (2005), Acc. No. AAM53943 coding for γ-terpinene synthase (Shimada et al., “Molecular cloning and functional characterization of four monoterpene synthase genes from Citrus unshiu Marc”, Plant Science 166 49-58 (2004, Acc. No. BAD91046 coding for 1,8-cineole synthase (Shimada et al., “Isolation and characterization of (E)-beta-ocimene and 1,8 cineole synthases in Citrus unshiu” Marc., Plant Science 168 987-995 (2005), Acc. No. BAD27257 and Acc. No. AAM53944 coding for limonene synthases (Shimada et al., “Isolation and characterization of a new d-limonene synthase gene with a different expression pattern in Citrus unshiu” Marc., Scientia Horticulturae 105: 507-512 (2005); Shimada et al., “Molecular cloning and functional characterization of four monoterpene synthase genes from Citrus unshiu”, Marc. Plant Science 166 49-58 (2004)) and Acc. No. BAM29049 coding for a geraniol synthase (Shishido et al., “Geraniol synthase whose mRNA is induced by host-selective ACT-toxin in the ACT-toxin-insensitive rough lemon (Citrus jambhiri)”, Journal of Plant Physiology 169 1401-1407 (2012), were included. The resulting phylogenetic tree (FIG. 11) showed four different clusters. Cluster c/e/f contained two proteins with good homology to copalyl diphospohate synthases (Cs5g15530.1 and Cs5g31210) and two proteins with good homology to ent-kaurene synthases (Cs2g06470 and orange1.1t03278). Twenty six of the proteins (framed in FIG. 11) are predicted to be chloroplast localized and/or to harbour a chloroplast transit signal (TargetP and ChloroP, respectively), thus presumably being monoterpene synthases (MTS). Accordingly, most of them clade in TPS b and g groups, corresponding to cyclic and acyclic angiosperm monoterpene cyclases, respectively. TPSb clade (cyclic MTS) includes previously characterized citrus 1,8-cineole synthase, β-ocimene synthase, α-pinene synthase, limonene synthase and geraniol synthase, while previously characterized linalool synthases are in TPSg clade (acyclic MTS). The clade TPSa1 included dicotyledonous sesquiterpene synthases, such as the previously characterized valencene, β-farnesene and linalool/nerolidol synthases (AAQ04608, Q94JS8 and BAP75561, respectively).

Besides, there were other 28 predicted proteins, encoded by 21 different genes, presumably being functional sesquiterpene synthases. However, protein encoded by Cs3g16210.1 lacked conserved RDR and DDXXD motifs, so as these amino acids are essential for terpene synthase activity, the protein most probably would lack this enzymatic ability (FIG. 15). Proteins encoded by transcripts 1 and 2 of Cs4g12110 (SEQ ID NO:185 and SEQ ID NO:186, respectively) are identical, but that corresponding to transcript 2 lacks 63 amino acids in the N-terminal portion. Cs4g12110.1 is 98.94% identical to a characterized linalool/nerolidol synthase (BAP75561), with 4 non-conserved and 2-conserved amino acid changes between them, none of them affecting any conserved TPS motif (FIG. 12). As any of these amino acid changes could be derived from mistakes in the nucleotide annotation, it was considered that most probably Cs4g12110 encodes a bona fide linalool/nerolidol synthase. Proteins encoded by predicted transcripts 1 and 2 of Cs5g12900 (SEQ ID NO:173 and SEQ ID NO:174, respectively) are identical between them and 99.57% identical to that encoded by Cs5g12880.1 (SEQ ID NO:172), being found among them just 4 non-conserved and 3-conserved aminoacid substitutions (FIG. 12). Both proteins, Cs5g12900.1 (SEQ ID NO:173) and Cs5g12880.1, are very similar (99.6 and 98.4% identical, respectively) to a characterized valencene synthase (AAQ04608), thus envisaging their most probable catalytic activity. Proteins encoded by Cs4g12120 (transcripts 1 and 2, SEQ ID NO:189 and SEQ ID NO:190, respectively, identical except for a deletion of 47 amino acids in the protein encoded by transcript 1) and Cs4g12090.1 (SEQ ID NO:188) are nearly identical to a characterized citrus germacrene synthase-A (unpublished results), thus they most likely catalyze the synthesis of this sesquiterpene compound from FPP.

Finally, as sesquiterpene synthase (SQS) genes tend to be arranged on tandems in chromosomes, genes Cs2g23470 (SEQ ID NO:102), Cs3g21560 (SEQ ID NO:103), and Cs3g21590 (SEQ ID NO:104) were discarded. As such, 12 genes located on chromosomes 4 (6 genes) and 5 (4 genes) or with unknown localization (4 genes) predicted to encode SQS were selected as putative β-caryophyllene synthases, and, in order to isolate them, primers including start and stop codons were designed for all the corresponding nucleotide sequences (Table 5). Appropriate combinations of these primers were used for PCR amplifications using as a template 1 μL of a 1:1:1: mix of cDNA synthesised with oligo dT18N from flower, leaf and fruit total RNA, obtained following standard laboratory procedures known for any expert in the field. DNA amplification, purification, cloning and insert identity confirmation were performed as described (Example 4 and Example 5). Selected clones were further characterized to determine their possible β-caryophyllene synthase enzymatic activity (Example 10, Example 11 and Example 12).

TABLE 5
Primers employed for amplifying cDNA corresponding to putative citrus
sesquiterpene synthases sequences SEQ ID NO: 75 (B74 and B205), SEQ ID NO: 78
and SEQ ID NO: 79 (B209 and B210), SEQ ID NO: 81 (B27 and B211), SEQ ID NO: 82
(B27 and B28), SEQ ID NO: 85 (B124 and B125), SEQ ID NO: 88 (B118 and B119),
SEQ ID NO: 91 and SEQ ID NO: 92 (B120 and B121), SEQ ID NO: 95 (B112 and B127)
and SEQ ID NO: 98 (B205 and B206). Triplets encoding start and stop codons are
underlined. Primers B205 and B206 were also employed for amplifying the genomic
sequence of orange1.1t04360 (SEQ ID NO: 127). S, Sense; AS, Antisense.
Primer Primer sequence (5′→ 3′) Target gene Orientation
SEQ ID NO: 73 B205 ATGGATCTTAAGAGTCTTCC Cs4g11980 (SEQ ID NO: 75) S
SEQ ID NO: 74 B74 GCTTACATGGGAAGAGGATCAAC Cs4g11980 (SEQ ID NO: 75) AS
SEQ ID NO: 76 B209 ATGGCACTTCAAGATTCAGA Cs4g12050 (SEQ ID NO: 78)/ S
Cs4g12080 (SEQ ID NO: 79)
SEQ ID NO: 77 B210 TCAAAAGGGAACAGGCTTCTC Cs4g12050 (SEQ ID NO: 78)/ AS
Cs4g12080 (SEQ ID NO: 79)
SEQ ID NO: 5 B27 AAAAATGTCCGCTCAAGTTC Cs4g12350 (SEQ ID NO: 81)/ S
Cs4g12400 (SEQ ID NO: 82)
SEQ ID NO: 80 B211 TCATATAGTGACAGGGTCTC Cs4g12350 (SEQ ID NO: 81) AS
SEQ ID NO: 6 B28 TCAGATGGTAACAGGGTCTC Cs4g12400 (SEQ ID NO: 82) AS
SEQ ID NO: 83 B124 ATGTCTACTCCAGTTCCAACAG Cs4g12450 (SEQ ID NO: 85) S
SEQ ID NO: 84 B125 TCATAGAGTAACGGGGTCCT Cs4g12450 (SEQ ID NO: 85) AS
SEQ ID NO: 86 B118 ATGTCTATTCAAGTTCCTCA Cs5g06290 (SEQ ID NO: 88) S
SEQ ID NO: 87 B119 TTATATTGGAACTTGATCTATC Cs5g06290 (SEQ ID NO: 88) AS
SEQ ID NO: 89 B120 ATGTCTTTAGAAGTTTCAGC Cs5g23510 (SEQ ID NO: 91)/ S
Cs5g23540 (SEQ ID NO: 92)
SEQ ID NO: 90 B121 TCATATCGGCACAGGATT Cs5g23510 (SEQ ID NO: 91)/ AS
Cs5g23540 (SEQ ID NO: 92)
SEQ ID NO: 93 B112 ATGTCTACACCAGTTCCAGC orange1.1t00017 (SEQ ID NO: 95) S
SEQ ID NO: 94 B127 TTAGAATGTAACGGGGTCCT orange1.1t00017 (SEQ ID NO: 95) AS
SEQ ID NO: 96 B205 ATGGATCTTAAGAGTCTTCC orange1.1t04360 (SEQ ID NO: 98) S
SEQ ID NO: 97 B206 TTACATGGGAAGAGGATCAA orange1.1t04360 (SEQ ID NO: 98) AS

Example 10

Construction of Expression Plasmids for In Vitro Transcription of Sesquiterpene Synthase

Each expression cassette prepared comprises a transcription initiation or transcriptional control region(s) (e.g. a promoter), the coding region for the protein of interest, and a transcriptional termination region. In order to avoid possible toxicity of the sesquiterpene compound when it is accumulated in a microbial host, an inducible promoter was selected. For functional expression of the sesquiterpene synthases, the cDNAs were sub-cloned in the pF3K WG (BYDV) Flexi® Vector from Promega, designed for in vitro expression of proteins. This vector carries the lethal barnase gene, which is replaced by the DNA fragment of interest and acts as a positive selection for successful ligation of the insert, and a kanamycin resistance gene for selection of bacterial colonies. Additionally, it allows the directional cloning of PCR products in SgfI and PmeI restriction sites. In this plasmid the cDNA is placed downstream of the SP6 promoter.

Inserts were amplified by PCR using an amino-terminal PCR oligonucleotide including the start codon and SgfI site and a carboxy-terminal PCR primer including the stop codon and PmeI site (Table 6). In the forward primer six in-frame histidine codons where added in order to create a N-terminal tagged protein. The amplified cDNAs were purified, and ligated into pF3K WG (Promega) plasmid according to the manufacturer protocol. Constructs were verified by digestion and DNA sequencing.

All amplifications of cDNA for expression were performed using the Pfu DNA polymerase (Promega), in a final volume of 50 μL containing 5 μL of Pfu DNA polymerase 10× buffer, 200 μM each dNTP, 0.4 μM each forward and reverse primer, 2.9 units Pfu DNA polymerase and 5 μL of 1 μL of cDNA (prepared as described above). The thermal cycling conditions were as follows: 2 min at 95° C.; 25 cycles of 30 sec at 95° C., 30 sec at 52° C. and 4 min at 72° C.; and 10 min at 72° C. The PCR products were purified on an agarose gel and eluted using the QIAquick® Gel Extraction Kit (Qiagen).

TABLE 6
Primers employed for cloning SEQ ID NO: 1 in pF3KW
Flexi Vector (Promega) corresponding to sequence 
SEQ ID NO: 9 (SQS5F) and SEQ ID NO: 10 (SQS5R).
 S, Restriction sites are marked in itallics.
Nucleotides encoding HHHHHH are bold-lettered.
The start and stop codons are underlined.
Sense; AS, Antisense.
Primer Primer sequence (5′→ 3′) Orientation
SQS5F GCGATCGCCATGCATCACCATCACCATCAC S
GGATCCGCTCAAGTTCTAGC
(SEQ ID NO: 9)
SQS5R GTTTAAACTCAGATGGTAACAGGGTCTCT AS
(SEQ ID NO: 10)

Example 11

Sesquiterpene Synthase In Vitro Transcription and Enzyme Assays

In a standard protein expression experiment, the expression plasmids containing the sesquiterpene synthase cDNA as well as the empty plasmid (negative control) were transformed into XL1-Blue E. coli cells (Stratagene). Single colonies of transformed E. coli were used to inoculate 5 ml LB medium. Liquid cultures of the bacteria harboring the expression construct or the empty plasmid were grown at 37° C. to an OD600 of 0.8. Plasmid DNA was isolated from bacteria using QIAprep spin miniprep kit (Qiagen) following manufacturer instructions. Two μg of purified plasmid DNA were employed for in vitro transcription/translation in wheat germ extract cell free expression system from Promega (TnT® SP6 High-yield wheat germ protein expression system) in a final volume of 50 μL. Following incubation at 25° C. for 2 hours protein production was confirmed analyzing an aliquot of 1 μL by Sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) and western blotting following standard procedures. Nitrocellulose membranes were probed with monoclonal Anti His G HRP antibody from Invitrogen.

The enzymatic assays were performed in 15 mL Teflon sealed glass tubes using 49 μL of protein extract in a final volume of 1 mL reaction buffer (25 mM potassium phosphate buffer pH 6.8; 10 mM MgCl2; 1 mM MnSO4; 1 mM DTT) supplemented with 100 μM FPP (Sigma). The medium was overlaid with 1 ml pentane to trap volatile products and the tubes incubated overnight at 30° C. The pentane phase, containing the sesquiterpene, was recovered and the medium extracted with a second volume of pentane. Two μL of the combined pentane fractions were analyzed by Gas Chromatography as described above. In this way, caryophyllene synthase activity was attributed to sequence SEQ ID NO:2 (FIG. 13).

Example 12

In Vivo Functional Assays for Identifying β-Caryophyllene Synthase Enzymatic Activity

For functional characterization of the sesquiterpene synthase genes, the coding cDNA sequences of each of the selected genes were recombined as a translational fusion into the pET45b-(+) vector (Novagen), designed for expression of recombinant proteins in E. coli. In this way the expression of the studied gene is under control of bacteriophage T7 strong transcription signal. Required primers were designed using the primer design tool from Clontech (http://www.clontech.com/US/Support/xxcltonlineToolsLoadjsp?citemId=https://www. takaraio.co.jp/infusion_primer/infusion_primer_form.php&section=16260&xxheight=1800). Subcloning of the desired genes from pJET1.2 (Fermentas GMBH) to pET45b-(+) was achieved by using routine methods. For example, clones corresponding to Cs4g12400 (SEQ ID NO:149), Cs4g11980 (SEQ ID NO:142), orange1.1t04360 (SEQ ID NO:132) and BCS from Arabidopsis (SEQ ID NO:21) were PCR-amplified using specific primers (Table 7) and KAPA HiFi HotStart (KAPA Biosystems). The thermal cycler conditions were: 5 min at 95° C.; 25 cycles of 20 sec at 98° C., 15 sec at 60° C. and 90 sec at 72° C.; and finally 10 min at 72° C. Besides, 1 μg of pET45b-(+) vector was subjected to double enzyme restriction with PstI and BamHI (Takara) following the instructions of the manufacturer. The PCR and the digestion products were loaded on a 1% agarose gel and the bands corresponding to the expected sizes were excised from the gel and purified using the QIAquick™ Gel Extraction Kit (Qiagen). Purified products were then subjected to a recombination reaction using an infusion HD cloning kit (Clontech), according to manufacturer instructions. After incubation of 15 minutes at 50° C., 1 μg of the reaction mix was used to transform Escherichia coli DH5α competent cells. Positive colonies were selected and fully sequenced to assess and discard errors introduced by DNA amplification.

Selected recombinant clones were expressed in Escherichia coli BL21 (DE3), an expression host containing a chromosomal copy of the T7 RNA polymerase gene under lacUV5 control, inducible by the addition of IPTG to the bacterial culture. Activity of expressed proteins from at least two sequenced PCR independent clones of each gene was determined enzymatically. In a standard protein expression experiment, single colonies containing the expression plasmids harbouring the sesquiterpene synthase cDNA as well as the empty plasmid (negative control) were used to inoculate 5 ml LB medium supplemented with ampicillin (100 μg/mL) and 1% glucose. Culture was incubated overnight at 37° C. with shaking at 200 rpm and used to inoculate 100 mL of LB medium supplemented as before and grown to OD600 0.4 at 28° C. and 200 rpm. Induction was done by adding isopropyl-1-thio-β-D-galactopyranoside (IPTG) to 1 mM final concentration and maintaining the culture in slow agitation (80 rpm) and 18° C. overnight. Effective induction in each assay was evaluated by visualizing 500 μL of culture in a SDS-Page gel following standard procedures. The cells were collected by centrifugation, resuspended in 4 mL of chilled sesquiterpene synthase assay buffer (SSAB, 100 mMNaPhosphate pH 7.0, 10 mM MgCl2, 1 mM DTT, 10% v/v glycerol) and disrupted by a 3×10 sec treatment with a ultrasonic processor (UP200S, Hielscher). Following centrifugation at 15,000g for 30 min, 500 μL of the supernatant were transferred to a 3 mL Teflon sealed glass tube, supplemented with 10 μg of FPP (Sigma) and incubated overnight at 30° C. and 50 rpm. A solid phase microextraction SPME fiber (100 μm poly(dimethyl) siloxane, Supelco, Bellefonte, Pa.) was placed into the headspace of the tube during a 45-min incubation at 22° C. and, immediately afterwards, fiber was transferred to GC injector (220° C.) and thermal desorption was prolonged to 4 min. GC-MS conditions were set as described before (Example 2) and obtained chromatograms were analysed in order to determine which sesquiterpenes were produced by each clone. In this way, β-caryophyllene synthase activity was attributed to SEQ ID NO:167 (FIG. 14).

TABLE 7
Primers employing for PCR-amplifying from PJET1.2 and cloning in
binary vectors SQS clones SEQ ID NO: 82 (B197F and B198R), SEQ ID NO:
167 and SEQ ID NO: 75 (B199F and B200R) and SEQ ID NO: 21 (B201F and
B202R). The primers for insert amplification have insert-specific
sequences and additional 15-17 bases (depending on the GC content)
overlapping with the vector ends. S, Sense; AS, Antisense.
Primer Primer sequence (5′→ 3′) Orientation
SEQ ID B197F GCAAGCTTGTCGACCTGCAGTCAGATGGTAACAGGGTCTC S
NO: 105
SEQ ID B198R ACAAGAGTCCGGATCCGTCCGCTCAAGTTCTA AS
NO: 106
SEQ ID B199F GCAAGCTTGTCGACCTGCAGTTACATGGGAAGAGGATC S
NO: 107
SEQ ID B200R ACAAGAGTCCGGATCCGAGGGATCTTAAGAGTGTTC AS
NO: 108
SEQ ID B201F GCAAGCTTGTCGACCTGCAGTTAAATGGGTATAGTTTCAATG S
NO: 109
SEQ ID B202R ACAAGAGTCCGGATCCGGGGAGTGAAGTCAACCGTC AS
NO: 110

Example 13

Cloning of Arabidopsis FPPS

With the aim of further increasing sesquiterpene content and emission in transgenic citrus plants, a FPP synthase gene cassette was introduced in binary plasmids for plant transformation (see below). A similar strategy was adopted by Wu et al., “Redirection of cytosolic or plastidic isoprenoid precursors elevates terpene production in plants”, Nature Biotech 24: 1441-1447 (2006), who employed transgenic co-expression of FPP synthase and amorphadiene synthase in plastids for successful, high-level synthesis of amorphadiene in transgenic tobacco (Nicotiana tabacum) plants. In order to select a FPP synthase gene, a search in public NCBI database was performed. FPP synthase protein is highly conserved among dicotyledonous plants. For example, FPP synthase proteins from such unrelated species as Arabidopsis (Acc. No. Q09152), Malus domestica (Acc. No. AAM08927), Vitis vinifera (Acc. No. AAX76910), Gossypum hirsutum (Acc. No. CAA72793) and Hevea brasilensis (Acc. No. AAM98379) showed an overall identity of 79% (89% homology). Identity of FPP synthase proteins from mono and dicotyledonous plants is also high. For example, FPPS from Zea mays (Acc. No. AC634051) is 71% identical (85% similar) to that of Arabidopsis. Finally, the high degree of similarity between FPPS from plants and FPPS from other kingdoms, i.e. Saccharomyces cerevisae FPPS (Acc. No. EDN63217) is 66% homologous to that of Arabidopsis, suggest a good conservation of this protein along evolution. Thus, any FPPS from a dicotyledonous plant was though to be suitable for increasing FPP production in citrus plants. As that from Arabidopsis had been well characterized and its activity demonstrated (Cunill et al., “Arabidopsis thaliana contains two differentially expressed farnesyl diphosphate synthase genes”, J. Biol. Chem. 221: 7774-7780 (1996), primers were designed based on AtFPS1 sequence (Acc. No. X75789) in order to amplify a full length cDNA encoding a functional FPP synthase (FIG. 15). Total RNA was extracted from Arabidosis thaliana (ecotype Columbia) leaves using the Qiagen RNeasy Mini Kit following the manufacturer instructions and cDNA was synthesized as described above.

Amplification of cDNA was performed employing Pfu DNA polymerase (Promega) and the same reaction mix as described above. The thermal cycling conditions were: 2 min at 95° C., 30 cycles of 30 sec and 95° C., 30 sec at 50° C. and 1.5 min at 72° C., and 10 min at 72° C. PCR product was purified from agarose gel with the QIAquick®-Gel extraction Kit (Qiagen), ligatedinto pTZ57R/T (Fermentas GMBF1) and its identity confirmed by sequencing.

Example 14

Cloning of Citrus FPPS

To date, no FPP synthase has been isolated from citrus fruits, although one nucleotide sequence from CFGP (Citrus Functional Genomic Project) database, namely acL9351contig1, presents high identity (78%; 87% homology) with a FPP synthase from Arabidopsis (Acc. No. X75789). In order to isolate a FPP synthase from citrus, a search in CAP database using FPP synthase from Arabidopsis (SEQ ID NO:28, Acc. No. Q09152) as target was done. A candidate gene (SEQ ID NO:136, Cs4g08260) with five predicted putative transcripts was retrieved. Transcripts 1 (SEQ ID NO:137) and 3 (SEQ ID NO:139) encoded identical proteins, while transcripts 2, 4 and 5 (SEQ ID NO:138, SEQ ID NO:140 and SEQ ID NO:141, respectively) encoded proteins lacking intermedium, N-terminal and C-terminal portions of the protein, respectively (FIG. 16). SEQ ID NO:154 (protein encoded by Cs4g08260.3) presented a high homology (81.0 to 84.8%) with FPP synthase proteins from such unrelated species as Arabidopsis (SEQ ID NO:27, Acc. No. Q09152), Malus domestica (SEQ ID NO:142, Acc. No. AAM08927), Medicago sativa (SEQ ID NO:143, Acc. No. ADC32809), Glycine hispida (SEQ ID NO:144, Acc. No. ACU21393), Lupinus albus (SEQ ID NO:145, Acc. No. AAA86687), Vitis vinifera (SEQ ID NO:146, Acc. No. AAX76910), Gossypum hirsutum (SEQ ID NO:147, Acc. No. CAA72793), Euphorbia pekinensis (SEQ ID NO:148, Acc. No. ACN63187), Hevea brasilensis (SEQ ID NO:149, Acc. No. AAM98379), Populus trichocarpa (SEQ ID NO:150, Acc. No. ABK95166), Mentha piperita (SEQ ID NO:151, Acc. No. AAK63847) and Cyclocaria paliurus (SEQ ID NO:152, Acc. No. ACY80695). Thus, SEQ ID NO:137 (Cs4g08260.1) was considered to encode citrus FPP synthase and was thought to be suitable for increasing FPP production in plants. Primers were designed based on SEQ ID NO:137 in order to amplify a full length cDNA encoding a functional FPP synthase (Table 8). Appropriate combinations of these primers were used for PCR amplification using as a template 1 μL of a 1:1:1 mix of cDNA synthesised with oligo dT18N from flower, leaf and fruit total RNA, obtained following standard laboratory procedures known for any expert in the field. DNA amplification, purification, cloning and insert identity confirmation were performed as described in previous examples. The protein coded by the obtained clone (SEQ ID NO:198) presented all the seven domains described as essential for FPPS catalytic activity (Dahr et al., “Farnesyl pyrophosphate synthase: a key enzyme in isoprenoid biosynthetic pathway and potential molecular target for drug development” New Biotechnology 30 (2):114-123 (2013), as FARM (first Aspartate rich motif; domain II) and SARM (second Asp-rich motif; domain VI) motifs, which play a role in determining the product specificity and which interact with the phenyl ring of bisphosphonates. Besides, as along all citrus genome there was just only one good candidate to be encoding for a bona fide FPPS, confirmation of its enzymatic activity was not required as it was obvious to our understanding. However, in other cases in which FPPS functional characterization is needed (for example, for comparing enzymatic activity of two genes of the same organism), the gene to be characterized is cloned in a suitable expression vector and expressed in a convenient E. coli strain, for example pET-45 and BL21, as described above for BCS characterization. Growing of the cultures and protein purification is also done as described above, but, in this case, incubation of the recovered protein is done with appropriate substrates (IPP and DMAPP) as described by different authors (for a review see Dahr et al., “Farnesyl pyrophosphate synthase: a key enzyme in isoprenoid biosynthetic pathway and potential molecular target for drug development”, New Biotechnology 30 (2):114-123 (2013).

TABLE 8
Primers employed for amplifying CsFPPS
corresponding to sequences SEQ ID NO: 136 and
SEQ ID NO: 137 (Cs4g08260). The start and stop
codons are underlined. S, Sense; AS, Antisense.
Primer Orien-
Primer sequence (5′→ 3′) tation
SEQ ID NO: 111 B207 AAATGAGTGATCTGAAGTCA S
SEQ ID NO: 112 B208 CTCACTTCTGTCTCTTGTATATC AS

Example 15

Cloning of Transit Peptides

Shifting sesquiterpene biosynthesis from cytosol to plastids or mitochondria can improve results of metabolic engineering. First, this can avoid possible detrimental effects of sesquiterpene accumulation in cytosol and, second, avoiding competition for cytosolic pool of FFP by introduced sesquiterpene synthase and endogenous FPP-utilizing enzymes can provide a substantial substrate pool for this engineered pathway without compromising plant growth. This strategy has been successfully employed before by Wu et al., “Redirection of cytosolic or plastidic isoprenoid precursors elevates terpene production in plants”, Nature Biotech 24: 1441-1447 (2006) who performed transgenic co-expression of FFP synthase and amorphadiene synthase in plastids for successful, high-level synthesis of amorphadiene in transgenic tobacco (Nicotiana tabacum) plants. Switching the subcellular localization of the introduced sesquiterpene synthase to the mitochondrion has been also previously employed by Kappers et al., “Genetic engineering of terpenoid metabolism attracts bodyguards to Arabidopsis”, Science 309: 2070-2072 (2005), who reported that FPP is readily available in this organele for sesquiterpene biosynthesis.

The transit peptide (TP) of the small sub-unit of Rubisco (SSU) from Pissum sativum (Acc. No. X00806) was synthesised as three overlapping oligonucleotide fragments and subsequently PCR-amplified introducing Ndel and ClaI restriction sites in its 5′- and 3′-ends, respectively. The PCR product was ligated in pTZ57R/T (Fermentas GMBF1) generating pTZ-TPssu plasmid and sequenced. The CoxIV sequence (from Saccahromyces cerevisae, Acc. No. X01048) was synthesized as two complementary oligonucleotide fragments and subsequently PCR-amplified introducing Ndel and ClaI restriction sites in its 5′- and 3′-ends, respectively.

The PCR product was ligated in pTZ57R/T (Fermentas GMBF1) generating pTZ-mtTP plasmid and sequenced.

Example 16

Cloning of Genomic Clones from Citrus Selected Genes

The ability of natural introns to enhance gene expression has been well documented in various organisms, including plants Callis J, Fromm M, Walbot V., “Introns increase gene expression in cultured maize cells”, Genes Dev 1:1183-1200 (1987); Luehrsen K R, Walbot V, “Intron enhancement of gene expression and the splicing efficiency of introns in maize cells”, Mol Gen Genet 225:81-93 (1991); Rose A B, Last R L. Introns act posttranscriptionally to increase expression of the Arabidopsis thaliana tryptophan pathway gene PAT1. Plant J 11:455-464 (1997). As such, it was predicted that using citrus genomic sequences for generating transgenic plants could be a good strategy for increasing β-caryophyllene production in these plants. Consequently, genomics clones corresponding to CsCS and CsFPPS were obtained by routinely methods well known and available to any expert in the field. Briefly, DNA extraction from citrus leaves was achieved as described by Dellaporta et al. (1983). PCR amplification was performed with primers B205 and B206 (Table 5), for citrus BCS (SEQ ID NO:127), and B207 and B208 (Table 8) for citrus FPPS (SEQ ID NO:136). Amplicons of the expected size were purified from agarose gel, ligated into pJET1.2 (Fermentas) and identity was confirmed by sequencing.

Example 17

Expression Vector Construction

For generating the expression vectors, plasmids pMOG 180 (Mogen International, ampicillin resistance) and pROK binary vector (kanamycin resistance, Invitrogen), both carrying the constitutive CaMV 35S promoter and Nopaline synthase (NOS) terminator sequences were employed. The T-DNA from pROK also carried the Neomycin Phosphotransferase II (NPTII) gene under the control of the NOS promoter and terminator sequences.

Cloned sesquiterpene synthases (SEQ ID NO:1 and SEQ ID NO:3) and Arabidopsis FPPS1 (SEQ ID:27) were PCR-amplified from pTZ57R/T (Fermentas GMBH) adding convenient restriction sites for ligation of transit peptides (Ndel, ClaI) and in pMOG vector (BamHI), ligated again in pTZ57R/T (Fermentas GMBH) and sequenced, generating plasmids pTZ-CsCS+rest, pTZ-PgCS+rest, pTZ-CsCoS+rest, pTZ-PgCoS+rest and pTZ-FPPS+rest. All these plasmids and those carrying transit peptides (pTZ-TPssu and pTZ-mtTP, see example above) were 10-fold over digested with Ndel and ClaI restriction enzymes from Takara (Shuzo, Co. Ltd). Digested fragments of adequate size were excised from agarose gel and purified using QIAquick®-Gel extraction Kit (Qiagen) following manufacturer instructions. After plasmids dephosphorilation with Antartic Phosphatase (New England Biolabs), ligation of fragments corresponding to both transit peptides was performed with T4-Ligase (Invitrogen), according to the manufacturer instructions. Correct orientation and maintenance of ORFs from inserts was checked by sequencing and digestion. The resulting plasmids harboring TPssu for plastid import were denominated as pTZ-TPssu-CsCS, pTZ-TPssu-PgCS, pTZ-TPssu-CsCoS, pTZ-TPssu-PgCoS and pTZ-TPssu-FPPS, while those with mitochondrial import signal were named pTZ-mtTP-CsCS, pTZ-mtTP-PgCS, pTZ-mtTP-CsCoS, pTZ-mtTP-PgCoS and pTZ-mtTP-FPPS. Plasmids with FPPS, harboring or not transit peptide, were 10-fold over digested with BamHI and ligated between CaMV 35S promoter and Nopaline synthase (NOS) terminator of pMOG 180 vector. Resulting plasmids were named pMOG-FPPS, pMOG-TPssu-FPPS and pMOG-mtTP-FPPS. Correct orientation and maintenance of ORFs from inserts was checked by sequencing and digestion. Cassettes from these three plasmids were PCR amplified with specific primers for CaMV 35S promoter and NOS terminator containing Asel restriction sites for subcloning purposes. PCR products were over-digested with Asel and ligated in pROK vector, generating pROK-FPPS, pROK-TPssu-FPPS and pROK-mtTP-FPPS vectors. ORFs from sesquiterpene synthase genes were amplified from pTZ-CsCS, pTZ-TPssu-CsCS, pTZ-mtTPCsCS, pTZ-CsCoS, pTZ-TPssu-CsCoS, pTZ-mtTP-CsCoS, pTZ-PgCS, pTZ-TPssu-PgCS, pTZ-mtTP-PgCS, pTZ-PgCoS, pTZ-TPssu-PgCoS and pTZ-mtTP-PgCoS with specific primers for pTZ57R/T plasmid containing Xbal restriction site.

Amplified products were gel-purified, over digested with Xbal (New England Biolabs) and ligated into expression vectors pROK, pROK-FPPS, pROK-TPssu-FPPS and pROK-mtTP-FPPS. Correct orientation and maintenance of ORFs from inserts was checked by sequencing and digestion. Resulting plasmids expressing sesquiterpene synthase peptides directed to cytosol were named pROK-CsCs, pROK-CsCoS, pROK-PgCS, pROK-PgCoS. Resulting plasmids expressing FPPS plus a sesquiterpene synthase peptide, both directed to cytosol, were named pROK-FPPS-CsCs, pROK-FPPS-CsCoS, pROK-FPPS-PgCS, pROK-FPPS-PgCoS. Plasmids expressing sesquiterpene synthase peptides directed to chloroplast were named pROK-TPssu-CsCs, pROK-TPssu-CsCoS, pROK-TPssu-PgCS, pROK-TPssu-PgCoS, while those expressing sesquiterpene synthase peptides directed to mitochondrion were named pROK-mtTP-CsCs, pROK-mtTP-CsCoS, pROK-mtTP-PgCS, pROK-mtTP-PgCoS. Resulting plasmids expressing FPPS plus a sesquiterpene synthase peptide, both directed to chloroplast, were named pROK-TPssu-FPPS-TPssu-CsCs, pROK-TPssu-FPPS-TPssu-CsCoS, pROK-TPssu-FPPS-TPssu-PgCS, pROK-TPssu-FPPS-TPssu-PgCoS. Resulting plasmids expressing FPPS plus a sesquiterpene synthase peptide, both directed to mitochondrion, were named pROK-mtTP-FPPS-mtTP-CsCs, pROK-mtTP-FPPS-mtTP-CsCoS, pROK-mtTP-FPPS-mtTP-PgCS, pROK-mtTP-FPPS-mtTP-PgCoS. Each construct was incorporated by electroporation into A. tumefaciens competent cells. NPTII was used as selectable marker gene as its expression provided to plant cells resistance to aminoglycoside antibiotics, as kanamycin, neomycin, geneticin, and others.

For the rest of constructions, clones of SEQ ID NO:36, SEQ ID NO:98 and SEQ ID NO:127, corresponding to BCS from Arabidopsis (AtCS) and Citrus (CsCS2, cDNA and genomic clones), respectively, and SEQ ID NO:136 and SEQ ID NO:137 corresponding to cDNA and genomic clones of CsFPPS) were employed. For generating CsCS2, CsFPPS and AtCS clones harbouring plastid and mitochondrial transit signals the corresponding peptides (described in detail in Example 15) were PCR amplified using specific primers (Table 9) and recombined in pJET1.2 desired clones. Plasmids pROKII-CsFPPS, pROKII-TPssuCsFPPS and pROKII-mtTPCsFPPS were generated essentially as those harbouring AtFPPS (described above). Primer B98R in combination with B92F, B97F or B106F (Table 9) was used to amplify AtCS, mtTP-AtCS or TPssu-AtCS, respectively, and the amplified products were recombined in SacI digested pROKII and pROKII-AtFPPS, pROKII-mtTPAtFPPS or pROKII-TPssuAtFPPS, respectively. Primers B128F and B129R were used to amplify SEQ ID NO:98 and SEQ ID NO:127 and in order to clone them in ClaI/SalI double digested pTZ-TPssu plasmid, these new generated inserts, after sequence verification, were PCR-amplified with B104F and B132R and recombined in SacI pROKII-TPssuCsFPPS digested vectors. Primers B132 and B133F were used to amplify SEQ ID:135 and SEQ ID:194 and to recombine them in SacI pROKII and pROKII-CsFPPS binary vectors. Primers B132R and B92F were used to amplify mtTP-harbouring clones and to recombine them in SacI-digested pROKII-mtTPCsFPPS binary vectors. Primers B132R and B104F were used to amplify TPssu-harbouring clones and to recombine them in SacI-digested pROKII-TPssuCsFPPS binary vector.

All primers employed were designed using the primer design tool from Clontech (http://www.clontech.com/US/Support/xxcltonlineToolsLoadjsp?citemId=https://www.takaraio. co.jp/infusion_primer/infusion_primer_form.php&section=16260&xxheight=1800). All inserts were PCR-amplified from the cloning plasmid using KAPA HiFi HotStart from KAPA Biosystems. The thermal cycler conditions were: 5 min at 95° C.; 25 cycles of 20 sec at 98° C., 15 sec at 60° C. and 90 sec at 72° C.; and finally 10 min at 72° C. Besides, 1 μg of appropriate vector pROKII, pROKII-CsFPPS, pROKII-TPssuCsFPPS, pROKII-mtTPCsFPPS, pROKII-AtFPPS, pROKII-TPssuAtFPPS or pROKII-mtTPAtFPPS were subjected to enzyme restriction following the instructions of the manufacturer. The PCR and the digestion products were loaded on a 1% agarose gel and the bands corresponding to the expected sizes were excised from the gel and purified using the QIAquick™ Gel Extraction Kit (Qiagen). Purified products were then subjected to a recombination reaction using an infusion HD cloning kit (Clontech), according to manufacturer instructions. After incubation for 15 minutes at 50° C., 1 μL of the reaction mix was used to transform Escherichia coli DH5α competent cells. Positive colonies were selected for plasmid extraction and inserted DNA fragments were then subjected to DNA sequencing in order to confirm insert identity.

TABLE 9
Primers employed for generating binary vectors.
Primer Primer sequence (5′→ 3′) Orientation
SEQ ID 102F TTGCATGCAGGCCTCTGCAGATGTTGTCACTACGT S
NO: 113
SEQ ID 103R TCCCCATATCGGATCCCTGAAGCAGATATCT AS
NO: 114
SEQ ID B104F TTGCATGCAGGCCTCTGCAGATGGCCTCTATGAT S
NO: 115
SEQ ID B105R TCCCCATATCGGATCCGCATTTCACCCTCCC AS
NO: 116
SEQ ID B106F GATCCCCGGGTACCGAGCTCATGCAGGCCTCTGCA S
NO: 117
SEQ ID B92F GATCCCCGGGTACCGAGCTCATGTTGTCACTAC S
NO: 118
SEQ ID B97F GATCCCCGGGTACCGAGCTCATGGGGAGTGAAGTCAAC S
NO: 119
SEQ ID B98R GATCGGGGAAATTCGAGCTCTCAAATGGGTATAGTTTCAAT AS
NO: 120
SEQ ID B128F GGGTGAAATGCATCGATATGAGGGATCTTAAGAG S
NO: 121
SEQ ID B129R GGCCTCTGCAGTCGACTTACATGGGAAGAGG AS
NO: 122
SEQ ID B132R GATCGGGGAAATTCGAGCTCTTACATGGGAAGAGG AS
NO: 123
SEQ ID B133F GATCCCCGGGTACCGAGCTCATGAGGGATCTTAAGAG S
NO: 124
SEQ ID B69bF ATCTGCTTCAGATCGATATGAGGGATCTTAAGAG S
NO: 125
SEQ ID B70bR GACGGCCAGTGAATTCTTACATGGGAAGAGG AS
NO: 126
SEQ ID FPPS-AF GATCCCCGGGTACCGAGCTCATGAGTGATCTGAAG S
NO: 157
SEQ ID FPPS-BR GATCGGGGAAATTCGAGCTCTCACTTCTGTCTCTTG AS
NO: 158
SEQ ID TP-F CGGTACCCGGGGATCCTATGATGGCCTCTATGATCA S
NO: 159
SEQ ID TP-R GGACTCTAGAGGATCCGCATTTCACCCTCCCGCC AS
NO: 160
SEQ ID MT-F CGGTACCCGGGGATCCAAAAGGATCGATCTGAAGCA S
NO: 161
SEQ ID MT-R GGACTCTAGAGGATCCATGATGTTGTCACTACGTCA AS
NO: 162
SEQ ID B218 AGGGCGATGGCCCACTACGTGGAATTCCCGATCTAG S
NO: 163
SEQ ID B219 TGGGTGATGGTTCACGTAGTGAAGCTTGCATGCCTGCA AS
NO: 164

Primers B102F and B103R were used to amplify mtTP and to recombine it in PstI/BamHI digested AtCS pJET1.2 clone. Primers B104F and B105R were used to amplify TPssu and to recombine it in PstI/BamHI digested AtCS pJET1.2 clone. Primers B98R and B92F, B97F and B106F were used to amplify AtCS, mtTP-AtCS and TPssu-AtCS and to recombine them in SacI digested binary vectors (pROKII, pROKII-AtFPPS, pROKII-mtTPAtFPPS or pROKII-TPssuAtFPPS, see Example 9). Primers B128F and B129R were used to amplify SEQ ID NO:197 and SEQ ID NO:127 (CsCS2) and to clone them in ClaI/SalI double digested pTZ-TPssu plasmids. Primers B69bF and B70bR were used to amplify SEQ ID NO:197 and SEQ ID NO:127 and to clone them in ClaI/EcoRI digested pTZ-mtTP plasmid. Primers B132R and B133F were used for amplify SEQ ID NO:197 and SEQ ID NO:127 and to recombine them in SacI-digested pROKII vectors. Primers B132R and B92F and B104 were used for amplify SEQ ID NO:197 and SEQ ID NO:127 and TPssu-harbouring clones, respectively, and to recombine them in SacI site of pROKII. Plasmids pROK-CsFPPS and pROK-gCsFPPS, harbouring ORFs corresponding to CsFPPS genomic and cDNA clones, respectively, were generated by amplifying original clones with FPPS-AF and FPPS-BR. Amplified PCR products were recombined in SacI-digested pROKII vector. TPssu transit peptide (amplified with TP-F and TP-R) and mtTP (amplified with MT-F and MT-R) were recombined in BamHI site of pROK-CsFPPS vector, generating pROK-TPssu-CsFPPS and pROK-mtTP-CsFPPS vectors, respectively. Cassettes harbouring CsFPPS (either genomic or cDNA clones, directed to cytosol, chloroplast or mitochondria) were amplified using B218 and B219 and recombined in DraIII site of pROK-CsCS2, pROK-gCsCS2, pROK-TPssu-CsCS2 and pROK-mtTP-CsCS2 vectors. The primers for insert amplification have insert-specific sequences and additional 15-17 bases (depending on the GC content) overlapping with the vector ends (underlined). S, Sense; AS, Antisense.

Example 18

Transformation of Citrus Plants with a Sesquiterpene Synthase Gene from Arabidopsis or Citrus

The sweet orange (Citrus sinensis L. Osb.) varieties Valencia and Pera were transformed with a β-caryophyllene synthase gene or an α-copaene synthase gene from sweet orange or from Arabidopsis thaliana, under the control of the constitutive CaMV 35S promoter and Nopaline synthase (NOS) terminator.

The strain EHA 105 of A tumefaciens was used in this example for transformation of mature citrus explants. Bacteria were cultured overnight in an orbital shaker at 28° C. and 200 rpm in Luria Broth (LB) medium containing the proper antibiotics to grow the binary systems. Bacterial cells were pelleted at 3500 rpm for 10 min, resuspended and diluted to 4×107 or 4×108 cells/ml in liquid inoculation medium, which consisted of MS salt solution, 0.2 mg/L thiamine hydrochloride, 1 mg/L pyridoxine hydrochloride, 1 mg/L nicotinic acid, and 3% (w/v) sucrose, pH 5.7.

For the transformation of sweet orange mature tissues, buds were collected from trees maintained in a greenhouse and were grafted onto seedlings of a vigorous rootstock under glasshouse conditions (18-27° C.), and newly elongated shoots were used as starting material. Stem pieces (20 cm in length) were stripped of their leaves and thorns disinfected for 10 min in a 2% (v/v) sodium hypochlorite solution and rinsed three times with sterile distilled water. Internodal stem segments (about 1 cm long) were cut transversely and incubated for 15 min in 10-cm-diameter plates containing 15 ml of the bacterial suspension in inoculation medium by gentle shaking. The infected explants were blotted dry on sterile filter paper and placed horizontally on plates with the cocultivation medium for a 3-day co-cultivation period. Inoculation medium consisted of 4.3 g/L MS salts, 10 mL/L vitamin stock solution, 30 g/L sucrose, pH 5.7. 10. Co-cultivation medium consisted of inoculation medium plus 2 mg/L 2,4-D, 2 mg/L IAA, 1 mg/L 2, i-P, 8 g/L agar, pH 5.7.

After co-cultivation, the explants were blotted dry with sterile filter paper and transferred to shoot regeneration medium (SRM), which consisted of MS salts, 0.2 mg/L thiamine hydrochloride, 1 mg/L pyridoxine hydrochloride, 1 mg/L nicotinic acid, 3% (w/v) sucrose, 1% (w/v) agar, pH 5.7, plus 100 mg/L kanamycin for the selection of transgenic shoots, and 250 mg/L vancomycin and 500 mg/L cefotaxime to control bacterial growth. This medium was supplemented with 3 mg/L BAP. Cultures were maintained in the dark for 4 weeks at 26° C. and then were transferred to 16-h photo-period, 45 (xEm-2 s-1 illumination, and 26° C.).

Shoots regenerating from explants cultured in the kanamycin-containing selection medium were excised from the explants and cut in two pieces. The basal portion was PCR-assayed and, if the reaction was positive for the gene of interest, the apical part was grafted in vitro onto a nontransgenic decapitated in vitro-grown seedling. About 3-4 weeks after shoot-tip grafting, plantlets were again grafted on a vigorous seedling rootstock in a greenhouse at 18 to 27° C.

Methods for transforming mature citrus tissues are disclosed in U.S. Pat. No. 6,103,955 to Pena et al. The transgenic nature of the regenerated plants was confirmed by Southern blot analysis. At least 20 independently transformed lines of each variety and construction were selected for further evaluation. Every transgenic line was replicated at least 20 times to have enough plant material for the different experiments and analyses.

Example 19

Production of β-Caryophyllene and a-Copaene and its Use to Repel Diaphorina citri in the Field Through a Slow-Delivery System

β-caryophyllene is a widespread compound in the vegetable kingdom, i.e. it is present in many oleoresins of the majority of conifers of the Pinaceae family. However, this sesquiterpene is typically produced in low abundance in the host organism. The oil of the clove tree Eugenia caryophyllata (Syzygium aromaticum) contains β-caryophyllene in considerable amount and serves as a preparative source for the isolation of this compound, α-copaene is found as a minor component in the essential oils of leaves from various plant species, such as guava, while is abundant in roots and seeds of copaiba (Copaifera officinalis(Jacq) L.) and angelica (Angelica archangelica L.) (Jacobson et al., “Optical isomers of a-copaene derived from several plant sources”, J. Agric. Food Chem 35 (5): 798-800 (1987).

Nowadays, despite using modern techniques, isolation of these sesquiterpenes from plant sources suffers from low yields and high consumption of natural resources (i.e. Quispe-Condori et al., “Obtaining β-caryophyllene from Cordia verbenacea de Candolle by supercritical fluid extraction”, J. of Supercritical Fluids 46:27-32 (2008), Jacobson et al., “Optical isomers of a-copaene derived from several plant sources”, J. Agric. Food Chem 35 (5): 798-800 (1987).

Furthermore, β-caryophyllene and α-copaene concentration in plants depends on factors difficult to control, such as weather conditions and plant diseases. On the other hand, although chemical synthesis of β-caryophyllene had been accomplished decades ago (Corey et al., “Total synthesis of d,l-caryophyllene and d,l-iscaryophyllene”, J. Am. Chem. Soc. 86:485-492 (1964) it is still difficult to scale for industrial production.

Thus, this invention also provides methods for biosynthesis and metabolic engineering of β-caryophyllene and α-copaene with the goal of developing cost effective methods for stable production at laige scale and with consistent quality.

An attractive alternative strategy is to engineer metabolic pathways for production of β-caryophyllene in a diverse host. Even a cell, which cannot synthesize sesquiterpenes, contains farnesyl pyrophosphate if it synthesizes steroids or terpenes. Since every cell contains at least either steroids or terpenes, theoretically almost all hosts are capable of synthesizing sesquiterpenes using the DNA sequences of the present invention as far as a suitable host-vector system is available. Flost-vector systems are known, for example, for plants such as Nicotiana tabacura, Petunia hybrida and the like, microorganisms such as bacteria, for example Escherichia coli, Zymornonas mobilis and the like, yeasts, for example Saccharomyces cerevisiae and the like, and fungus (i.e. ascomycetes and basidiomycetes species).

Engineering of β-caryophyllene production in a heterologous host may require availability of its precursor (FPP) in sufficient amount in order to avoid competition for FPP pool by exogenous and endogenous FPP-utilizing enzymes that could result in detrimental effects. To that end different approaches would be efficient: (i) switching enzyme cellular compartmentation from cytosol to mitochondria or plastid employing known peptide transit signals (i.e. Kappers et al., “Genetic engineering of terpenoid metabolism attracts bodyguards to Arabidopsis”, Science 309: 2070-2072 (2005), (ii) co-expressing β-caryophyllene synthase and FPP synthase genes (i.e. Wu et al., “Redirection of cytosolic or plastidic isoprenoid precursors elevates terpene production in plants”, Nature Biotechnology 24: 1441-1447 (2006)), (iii) engineering the host with a heterologous MVA/MEP pathway (i.e. Yu et al., “Molecular cloning and functional characterization of a-humulene synthase, a possible key enzyme of zerumbone biosynthesis in shampoo ginger Zingiber zerumbet”, Planta 227:1291-1299 (2008), (iv) increasing expression of HMGR, a putative rate-limiting step in the MVA pathway, (v) optimizing the flux through the MEP pathway, i.e. upregulation of DXR in transgenic peppermint plants resulted in a 50% increase of essential oil yield (Mahmoud and Croteau, “Metabolic engineering of essential oil yield and composition in mint by altering expression of deoxyxylulose phosphate reductoisomerase and menthofuran synthase”, Proc. Natl. Acad. Sci. U.S.A. 98: 8915-8920 (2001). Combinations of these approaches, i.e., coexpression of β-caryophyllene synthase and FPP synthase genes while diverting subcellular compartment of both enzymes could also be employed. In addition, optimization of the β-caryophyllene synthase gene to reflect host codon usage bias may increase β-caryophyllene production in some organisms.

In order to express the DNA sequences of the present invention in a host, it is necessary to insert the genes into a vector to introduce it into the host. Any of various known vectors can be used, such as pBIN19, pC2200, pROK or the like for plant cells (Nicotiana tabacura, Petunia hybrida); pUC 19, pET1O1 or the like, and YEp13 or the like for yeast.

Furthermore, it is necessary to transcribe the DNA sequences of the present invention into mRNA in the host. For this purpose, a variety of promoters such as CaMV35S, NOS, TR1′, TR2′ (for plants); lac, Tcr, CAT, trp (for E. coli); Tcr, CAT (for Zymomonas mobilis); ADHI, GALT, PGK, TRP1 (for yeast) and the like can be used in the present invention. In the case of prokaryotic hosts, it is necessary to place a ribosome-binding site (SD sequence in E. coli) several nucleotides upstream from the initiation codon (ATG).

The transformation of the host with the vector thus obtained can be conducted by any appropriate method, which is conventionally used in the fields of genetic manipulation or cell biology. Appropriate publications or reviews can be referenced; for example, for the transformation of microorganisms, T. Maniatis, E. F. Fritsch and J. Sambrook: “Molecular Cloning A Laboratory Manual”, Cold Spring Harbor Laboratory (1982).

Culturing conditions of the transformants are essentially the same as those commonly used for the non-transformed host. Yielding of the microbial cultures could be improved if β-caryophyllene is removed from bioreactors, i.e. using ion exchange resins or pervaporation, thus avoiding possible inhibitory effects on growing. Beta-caryophyllene can be recovered by different methods well known for those skilled in the art, for example, pervaporation of microbial cultures or leaves distillation.

Pure β-caryophyllene is disposed in a PVC resin that preserves and releases the chemical compound. The compound is provided in an amount that is greater than what the plant produces with the amounts of β-caryophyllene being sufficient to repel Diaphorina citri and/or Tryoza erytrae psyllid insects. The same can be performed with α-copaene or combinations of β-caryophyllene and α-copaene. The preferred amounts can be determined by routine testing of different product concentrations, as shown, for example in Table 10. Typically, the amount of compound or compound mixture would be of at least 1 μg/μL.

TABLE 10
Time spent
in odor field (%)
Compound μg/μl n Compound Clean air P2
β-caryophyllene 0.001 42 46 54 0.499 (n.s.)
0.010 33 52 48 0.742 (n.s.)
0.100 39 47 53 0.607 (n.s.)
1.000 42 35 65 0.008**
Table 10. Evaluation, in a four-arm olfactometer, of Diaphorina citri response to different concentrations of pure β-caryophyllene.

The resin is applied directly to citrus trees in the orchards. It has the property of releasing the compound(s) over a period of 3-4 months. PVC-resin dispensers for release rate studies are prepared by mixing 40% by weight vinyl chloride/vinyl acetate emulsion copolymer (Vinnol E5/65C, Wacker Chemicals Ltd., UK) with a 1:1 mixture of the plasticizers Cereclor (S45, ICI Ltd., UK) and di-(2-ethylhexyl)-phthalate (DEHP, Sigma Aldrich Ltd., UK). The chemical compounds of interest are include with antioxidant and UV screener Waxoline Black (WB, ICI Ltd., UK) that are added to the prepolymer as required, typically 1% each by weight. The prepolymer are mixed and degassed on a rotary evaporator for 1 h under vacuum, poured into a mould composed of two glass plates with suitable spacers (0.1 cm) and cured by heating to 150° C. for 15 min. The resulting PVC sheets are removed from the moulds and cut into 1 cm squares.

Example 20

Analysis of Phenotypic Traits in Selected Transgenic Lines

In order to study the influence of transgene insertion and expression on the main phenotypic characteristics of the plants, morphological analyses of the transgenic trees, in comparison with their respective empty vector and non-GM counterparts, were performed. For this purpose, each transgenic line was analysed separately using at least 8 independent clones. Internode length and stem diameter were evaluated in 7 month-old grafted Pera and Valencia transgenic plants harbouring different T-DNAs. As shown in the representative results displayed in FIG. 17, no differences were found between the non-GM/GM controls and the GM lines harboring the genes of interest.

FIG. 17 shows internode length (black bars), stem diameter (grey bars) and number of evaluated clones (white bars) of five different non transformed Pera sweet orange lines (PNT, numbered 3, 4, 5, 6 and 8) transgenic lines (numbered 1 and 2) harbouring different T-DNAs (A (35S::AtCS), TA (35S::TPssu-AtCS), MA (35S::mtTP-AtCS), FA (35S::AtCS/35S::AtFPPS), FTA (35S::TPssu-AtCS/35S::TPssu-AtFPPS), FMA (35S::mtTP-AtCS/35S::mtTP-AtFPPS), C2 (35S::CsCS2), TC2 (35S::TPssu-CsCS2), MC2 (35S::mtTP-CsCS2), FC2 (35S::CsCS2/35S::CsFPPS), FTC2 (35S::TPssu-CsCS2/35S::TPssu-CsFPPS), MC2 (35S::mtTP-CsCS2/35S::mtTP-CsFPPS).

Example 21

Analysis of Transgene Expression in Selected Transgenic Lines

Total RNA was isolated from citrus leaves as described in Example 4 and subsequently treated with DNase (TURBO DNAFree, Life Technologies). The transcripts present in 10 μg of total RNA were reverse-transcribed using ImpromII Reverse Transcriptase (Promega) in a total volume of 20 μL. One μL of a 5 times diluted first-strand cDNA, was used for each amplification reaction. Quantitative real-time PCR was performed on a StepOne Plus (Applied Biosystems), using SYBRGreen PCR Master Mix (Applied Biosystems). Reaction mix and conditions followed the manufacturer's instructions. The real-time PCR amplification protocol consisted of 95° C. for 10 min followed by 45 cycles of 95° C. for 15 s and 60° C. for 1 min. Fluorescent intensity data were acquired during the extension time. Data acquisition and analysis were performed with the thermal cycler's software. Specificity of the PCR reaction was assessed by the presence of a single peak in the dissociation curve performed after the amplification steps. Normalization was performed using the expression levels of the citrus UPL7 (ubiquitin-protein ligase 7) and GAPC2 (glyceraldehyde-3-phosphate dehydrogenase C2) genes based on previous housekeeping selection. The primers employed for the amplification of each gene are described in Table 11. Results were the average of 4 independent replicates. In most transgenic lines analysed, it was found that AtBCS was transcribed at a relatively high level, independently of the subcellular compartment to which it expression was targeted (for representative results, see FIG. 18). Similarly, relatively high expression of transcripts corresponding to AtFPPS was found in most transgenic lines in which this transgene was additionally incorporated (FIG. 18).

FIG. 18 demonstrates Quantitative real-time PCR analyses of genes AtBCS (black bars) and AtFPPS (grey bars) heterologously overexpressed in citrus plants. Transcripts values for individual genes were normalized with respect to the corresponding value of the citrus UPL7 (ubiquitin-protein ligase 7) and GAPC2 (glyceraldehyde-3-phosphate dehydrogenase C2) genes. As no signal for AtBCS and AtFPPS was detected in non-transformed control plants, an arbitrary Ct value of 40 was assigned to them, and the rest of the samples were referred to it. Expression data are representative of two independent experiments.

TABLE 11
Primers employed for analysing by qPCR the
expression level of AtCS (AtCSF and B171), AtFPPS
(B168 and B169), UPL7 (ubiquitin-protein ligase 7)
and GAPC2 (glyceraldehyde-3-phosphate dehydrogenase
C2) in transgenic and non-transformed citrus lines.
S, Sense; AS, Antisense.
Primer Orien-
Primer sequence (5′→ 3′) tation
SEQ ID NO: 128 B168 TGATTTGACTGAGCAAGAGG S
SEQ ID NO: 129 B169 GGTTGACCACGGCGAGTGAC AS
SEQ ID NO: 37 AtCSF ATGGGGAGTGAAGTCAAC S
SEQ ID NO: 130 B137 CGTACTATGCTTCTCTTTG AS
SEQ ID NO: 131 UPL7F CAAAGAAGTGCAGCGAGAGA S
SEQ ID NO: 132 UPL7R TCAGGAACAGCAAAAGCAAG AS
SEQ ID NO: 133 GAPC2F TCTTGCCTGCTTTGAATGGA S
SEQ ID NO: 165 GAPC2R TGTGAGGTCAACCACTGCGACAT AS

Example 22

Analysis of Leaf Volatile Content and Emission from Transgenic Citrus Plants

Volatile content analysis in leaves of selected transgenic citrus lines was performed as described previously (Examples 1 and 2). Volatiles from each transgenic line were analyzed in triplicate at least in 3 independent days. Results showed that in all citrus leaves (transgenic and non-transgenic) more than 80% of total volatiles were monoterpenes (for a representative example, see FIG. 19A). Regarding sesquiterpene content, it was increased in transgenic lines in comparison to non-transformed ones, mainly due to an increase in β-caryophyllene content (for a representative example, see FIG. 19B). In most of the transgenic lines analyzed, the contribution of this sesquiterpene compound to the total percentage of volatiles increased between 2 and 20-fold.

As headspace analysis gives a more realistic picture of the volatile profile emitted by plants and detected by insects that respond to plant volatiles, static headspace sampling with a solid phase microextraction (SPME) device was performed. Leaf samples were enclosed in 3 mL screw-cap Pyrex tubes carrying a septum on the top and containing 1 mL of milli-Q water for avoiding leaf hydric stress. SPME fiber (100 μM poly(dimethyl) siloxane, Supelco, Bellefonte, Pa.) was exposed, at a controlled temperature of 22° C., between 1 and 4 hours. Immediately afterwards, fiber was transferred to GC injector (220° C.) and thermal desorption was prolonged to 4 min. Chromatographic conditions were as described previously (Example 2). As shown in FIG. 20 (A), (B) and (C), the profile of volatile compounds emitted from leaves of transgenic citrus overexpressing BCS genes is very similar to that of non-transformed citrus plants. In both cases, the main compounds are monoterpenes, which are emitted at a very similar rate independently of the line analysed. However, as expected, emission of β-caryophyllene is much higher in transgenic lines (FIG. 20B).

Example 23

Response of D. citri to Transgenic Citrus Volatiles in Olfactometric Assays

The behavioural response of D. citri to transgenic citrus leaf volatiles was investigated using a 4-arm olfactometer. D. citri female adults (8-12 days old) were obtained from continuously reared cultures on Murraya paniculata seedlings maintained in Fundecitrus (Araraquara, Brazil) at 25±1° C., 70±10% relative humidity and a L14:D10 photoperiod. The olfactometer consists of a 2 cm×14 cm×14 cm Teflon stage with extending arms on each of the four sides of the stage. Compressed air was circulated through active charcoal and a deionized water bottle and afterwards separated into four flows (0.4 L min-1) each of which was directed to one exposure chamber containing the volatiles source. Air left the latter through a hole and was pulled through one of the four olfactometer arms, creating four potential odour fields in the chamber, being subsequently evacuated through a central orifice on the floor of the stage. Volatile emitting plants were placed into 2 L plastic chambers and connected with a tube to one of the four olfactometer arms, while arms with chambers receiving air but without test material were regarded as blank or control chambers. Four flow-meters controlled air flow into the chambers containing the test material and carrying volatiles into the olfactometer. A diaphragm pump was used to draw air at constant flow rates to the centre and out of the arena thereby preventing the mixing of volatiles within the assay arena. The odour chambers were daily randomly connected to the four arms of the olfactometer. The olfactometer system was placed into a controlled temperature room at 20±2° C. and homogeneous intensity light (250 lux). Before the beginning of the assays, the system was cleaned with pure ethanol and rinsed with distilled water. At least 40 psyllids were assayed in each experiment, and each experiment was repeated at least in ten different days. The observations were conducted for 5 min, starting when the psyllid was placed at the walking arena. After every five observations, the position of the odor fields was changed. The choice of the tested psyllid was determined by the first area it entered, the time spent in each of the four areas and insect localization at the end of the observation period. Experiments were performed for three different weeks of at least three independent seasons. Results showed that citrus volatiles from some of the transgenic lines overexpressing BCS repelled psyllids (FIG. 21A). Moreover, as exemplified in FIG. 21B, the magnitude of this effect was very similar to that previously found for guava leaves using the same assay.

FIG. 21A depicts the response of D. citri to transgenic (GM) citrus headspace volatiles in a 4-arm olfactometer. Two treatment arms alternated with two clean air control arms. N correspond to the number of psyllids evaluated each independent day.

FIG. 21B shows representative olfactometric response of D. citri adults to volatiles emitted by conventional sweet orange (Citrus), guava and two different genetically modified sweet orange lines (Citrus GM1 and GM2) plants overexpressing BCS. Results demonstrate that psyllids were attracted by conventional sweet orange (versus clean air; 63% attractiveness), while they were repelled by guava plants (68% repellence) under the same experimental conditions. Remarkably, GM1 and GM2 sweet orange plants were able to repel psyllids (71 and 64% repellence, respectively) at levels comparable to those shown by guava plants.

Example 24

Response of D. citri to Transgenic Citrus Volatiles in No-Choice Assays

To evaluate the behaviour of the psyllid to whole transgenic citrus plants, but not just to their volatiles, no-choice assays were accomplished. To that end, a device consisting of a host odour chamber of 57×40×35 cm size with an inflow fan and an inlet funnel at opposite ends was self-manufactured. The plant to be analyzed is placed in the extreme of the fan, while the psyllids are released into the inlet funnel. Position of the psyllids was evaluated 1, 4 and 8 hours after their release in the odour chamber. In each of the tests, a transgenic and a non-transformed control plant were evaluated in parallel, both in the same phenological stage and with the same number of leaves. Assays were conducted into a controlled temperature room at 20±2° C. and homogeneous intensity light (250 lux). Ten 8-12 days female psyllids were assayed in each experiment, and each experiment was conducted at least ten times in different days. Along the first few hours it was observed a lower tendency of the psyllids for approaching and staying at the GM plants overexpressing BCS in relation to the control ones (FIG. 22). After 8 hours since their release, D. citri showed significantly less preference for overproducing β-caryophyllene citrus, as indicated by the fact that up to 20-30% less individuals landed on these plants in relation to non-transformed ones.

FIG. 22 shows Mean (±SE) percentages of psyllids that in a no-choice test were attracted to and landed on non-transformed (black bars) or genetically modified sweet orange plants overexpressing BCS (grey bars) plants. Position of the psyllids was evaluated 1, 4 and 8 hours after their release. Bars with the same letter are not significantly different at P<0.05.

Claims

What is claimed is:

1. A method for controlling Huanglongbing (HLB) in citrus plants comprising genetically modifying the citrus plants so that they express at least one isolated gene encoding a polypeptide having β-caryophyllene synthase (BCS) activity to produce an additional amount of β-caryophyllene over that expressed by an unmodified citrus plant to repel Diaphorina citri and/or Tryoza erytrae psyllid insects so as to control HLB in the genetically modified plant.

2. The method of claim 1, wherein the DNA sequence encodes one of SEQ ID NO:2 or SEQ ID NO:167 (Citrus spp. BCS);

3. The method of claim 1, wherein the DNA sequence encodes one of SEQ ID NO:21 (Arabidopsis thaliana BCS); SEQ ID NO:18 (Artemisia spp. BCS); SEQ ID NO:19 (Mikania spp. BCS); SEQ ID NO:20 (Cucumis sativus BCS); SEQ ID NO:22 (Zea mays BCS); SEQ ID NO:23 (Oryza sativa BCS); SEQ ID NO:29 (Picea spp. BCS); SEQ ID NO:30 (Solanum lycopersicum BCS); SEQ ID NO:31 (Phyla dulcis BCS); SEQ ID NO:32 (Cucumis melo BCS); SEQ ID NO:33 (Matricaria chamomilla BCS); SEQ ID NO:34 (Lavandula spp. BCS); or SEQ ID NO:35 (Origanum vulgare BCS).

4. The method of claim 1, wherein the DNA sequence encoding BCS comprises a newly isolated BCS gene, identified on basis on conserved motifs and for which the enzymatic activity has been confirmed.

5. The method of claim 1, wherein the DNA sequence encoding BCS comprises a newly isolated BCS gene, identified on basis on genome annotation and for which the enzymatic activity has been confirmed.

6. The method of claim 1, wherein the DNA sequence encodes a BCS and presents at least 50, 55, 60, 65, 70, 75, 80, 85, 90, 95 or 100% homology to SEQ ID NO:2, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35 or SEQ ID NO:167.

7. The method of claim 1, wherein the expression of the at least one isolated gene is driven by a constitutive promoter and a terminator region.

8. The method of claim 1, wherein the expression of the at least one isolated gene is driven by a regulatory region providing strong constitutive, tissue-specific or inducible expression.

9. The method of claim 1, wherein the regulatory region provides strong expression in the cytosol, chloroplasts or mitochondria.

10. The method of claim 1, which further comprises expressing a gene encoding a farnesyl pyrophosphase synthase to enhance the accumulation of the β-caryophyllene produced by the polypeptide having β-caryophyllene synthase activity.

11. The method of claim 10, wherein the DNA sequence encodes a farnesyl pyrophosphase synthase from citrus.

12. A method for controlling Huanglongbing (HLB) disease of citrus plants comprising applying an amount of purified β-caryophyllene, α-copaene, or combinations thereof, which repels Diaphorina citri and/or Tryoza erytrae psyllid insects, to citrus plants wherein the amount is greater than what an unmodified citrus plant can express so as to control the HLB disease of citrus plants by repelling the psyllid insects.

13. The method of claim 12, wherein the purified β-caryophyllene, α-copaene, or combinations thereof is purified from an organism selected from the group consisting of plants, bacteria and yeasts, or its genetically modified counterparts able to overproduce β-caryophyllene, α-copaene, or combinations thereof.

14. The method of claim 12, wherein the purified β-caryophyllene, α-copaene, or combinations thereof is purified from the guava plant.

15. The method of claim 12, wherein the purified β-caryophyllene, α-copaene, or combinations thereof is purified from leaf, fruit or stem extracts of the guava plant.

16. The method of claim 12, wherein the purified β-caryophyllene, α-copaene, or combinations thereof is applied to the citrus plants by a delivery system that contains those chemical(s).

17. The method of claim 12, wherein the amount to be applied to the plant is at least 1 μg/μL.

Resources

Images & Drawings included:

Sources:

Similar patent applications:

Recent applications in this class: