Patent application title:

Novel Epitope for Switching to TH2 Cell and Use Thereof

Publication number:

US20160046691A1

Publication date:
Application number:

14/739,763

Filed date:

2015-06-15

Abstract:

The present invention relates to a novel epitope to convert T cell to type 2 helper T (TH2) cell. Specifically, the present invention relates to an epitope constituting the 20th to 30th amino acids (SEQ ID No.2) of extracellular domain (ECD) of activation-inducible tumor necrosis factor receptor (AITR), an antibody recognizing the epitope, a polynucleotide encoding the epitope, a polynucleotide encoding the antibody, an expression vector comprising the polynucleotide encoding the epitope or antibody, a transformant introduced with the vector, a composition comprising the antibody for converting T cell to TH2 cell and a method of conversion, a pharmaceutical composition comprising the antibody for preventing or treating autoimmune disease, and a method for treating autoimmune disease using the antibody.

Inventors:

Interested in similar patents?

Get notified when new applications in this technology area are published.

Classification:

C07K14/7151 »  CPC main

Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans; Receptors; Cell surface antigens; Cell surface determinants for cytokines; for lymphokines; for interferons for tumor necrosis factor [TNF], for lymphotoxin [LT]

C07K14/715 IPC

Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans; Receptors; Cell surface antigens; Cell surface determinants for cytokines; for lymphokines; for interferons

Description

CROSS-REFERENCE TO RELATED PATENT APPLICATIONS

This patent application is a divisional of co-pending U.S. patent application Ser. No. 13/861,675, filed Apr. 12, 2013, which is now pending and which claims priority from Korean Application No. 10-2012-0061791 filed on Jun. 8, 2012, and Korean Application No. 10-2012-0088647 filed on Aug. 13, 2012, all of which are incorporated herein by reference in their entireties

TECHNICAL FIELD

The present invention relates to a novel epitope to convert T cell to type 2 helper T (TH2) cell. Specifically, the present invention relates to an epitope constituting the 20th to 30th amino acids (SEQ ID No.2) of extracellular domain (ECD) of activation-inducible tumor necrosis factor receptor (AITR), an antibody recognizing the epitope, a polynucleotide encoding the epitope, a polynucleotide encoding the antibody, an expression vector comprising the polynucleotide encoding the epitope or antibody, a transformant introduced with the vector, a composition comprising the antibody for converting T cell to TH2 cell and a method of conversion for the same, a pharmaceutical composition comprising the antibody for preventing or treating autoimmune disease, and a method for treating autoimmune disease using the antibody.

BACKGROUND ART

Various types of receptors belonging to the tumor necrosis factor receptor superfamily (TNFR) superfamily are involved in the regulation of cell proliferation, cell differentiation, and cell death. Also, TNFR receptors play an important role in development of immune response, tumor necrosis, and protection against autoimmune diseases. Examples of the TNFR receptors include CD28, 4-1BB, OX40, CD40, or CD27.

Human activation-inducible tumor necrosis factor receptor (AITR) is a member of TNFR superfamily, and is also called glucocorticoid-induced TNFR-related protein (GITR), tumor necrosis factor receptor superfamily member 18 (TNFRSF18), or CD357. AITR is a type I transmembrane protein of TNFR superfamily. Immunoregulatory T cell (Treg cell or CD4+CD25high T cell) constitutively expresses AITR at high level, and when peripheral blood mononuclear cell (PBMC) is activated, expression of GITR is rapidly up-regulated. In particular, a signal transduction through AITR is known to inhibit a suppressive function of Treg cells, which in turn increase a resistance of CD4+ and CD8+ T cells to the suppression by Treg cells, thereby activating the CD4+ and CD8+ T cells. Also, a monoclonal antibody (mAb, e.g., DTA-1) that specifically binds to GITR or a physiological ligand thereof i.e., GITRL is known to enhance antitumor immunity through various in vivo models. On the other hand, activation of GITR inhibits Treg cell which is capable of suppressing the autoreactive T cells, thereby promoting autoimmune response.

Although there has not been much information found about the biological functions of AITR and AITR ligand (AITRL), it is known that AITR is expressed at basal level in a resting T cell, but its expression level rapidly increases upon activation of T cell. Also, it has been reported that AITR expression level was increased in herniated disc tissue cell isolated from lumber disc herniation patients as well as in the Treg cells from active systemic lupus erythematosus patients.

AITR binds with TNFR-associated factors (TRAFs) such as TRAF1, TRAF2 and TRAF3. When AITR interacts with its ligand, this recruits TRAF2 and ultimately activates NF-κB/NIK (Kwon, B. et al., J Biol Chem 274, 6056-6061, 1999). TRAF protein is a type of cytoplasmic adapter protein, and is involved in signal transduction for extracellular proliferation, differentiation, activation and migration. The N-terminal sites of TRAF proteins vary a lot, and all of the TRAF proteins except for TRAF1 possess a RING-finger motif at the N-terminal site thereof. A RING-finger is essential for the TRAF-mediated signal transduction. In the previous study, when the genes encoding all six types of TRAF proteins were knockout in mouse by gene targeting, various phenotypes were observed, suggesting that TRAFs have significantly various biological functions (Ha, H., Curr Protoc Immunol. Chapter 11:Unit11.9D, 2009).

A Ca2+-dependent transcription factor known as nuclear factor of activated T cells (NFATs) regulates not only T cells but also various types of growth factors and cytokines. Also, it regulates cell-to-cell interaction molecules essential for morphogenesis, development, and other functions in various types of cells and organs. Recently, NFAT is shown to be an important factor in induction of specific genetic programs that regulate differentiation to TH lineage and effector or regulatory functions of TH cells, via the transcriptional regulation of TH lineage-specific transcription factors such as T-bet (TH1), GATA-3 (TH2), RORγt (TH17), and Foxp3 (Treg). In addition, it has been reported that NFAT family regulates transcription of various cytokines and cytokine receptors thereof (Macian, F. Nat Rev Immunol. 5, 472-484, 2005).

One of the most important factors determining the fate of CD4+ T cell is cytokine milieu during the TCR-mediated activation of naïve CD4+ T cell. The major signaling pathway triggered by cytokines is an activation of the signaling transducer and activator of transcription (STAT) family proteins. The STAT proteins play an essential role in differentiation and expansion of TH cells. In particular, IFN-γ/NFAT1/STAT-1 pathway activates T-bet which is the master transcription factor specifying the TH1 lineage, while NFAT1/STAT-3 pathway activates RORγ which is the master transcription factor specifying the TH17 lineage. Also, IL-4/NFAT2/STAT-6 pathway activates GATA-3 which is the master transcription factor specifying the TH2 lineage, and NFAT1/STAT-5 pathway activates Foxp3 which is the master transcription factor specifying the Treg lineage. These complex intracellular signaling cascades play an important role in determining the differentiation of TH cell and functions thereof.

Naive CD4 T cell can differentiate into four different types of T cells such as TH1, TH2, TH17, and induced Treg cells. Each of the T cells has different function and among them, TH2 cell which produces IL-4, IL-5, IL-9, IL-10, IL-13, and IL-25 mediates immune response to parasites such as helminthes. Also, Treg cell is involved in regulation of immune response and plays an important role in maintaining self-tolerance. Increasing the number of the Treg cells or promoting a suppressive function of Treg cells are known to be important factors in treatment of autoimmune diseases and prevention of allograft rejection (Jinfang Zhu et al., Blood, 112, 1557-1569, 2008).

DISCLOSURE

Technical Problem

Accordingly, the present inventors have identified a novel epitope of AITR which can convert various T cells to TH2 cells. Also, the present inventors have confirmed that an antibody that specifically binds to the epitope can effectively convert T cells into TH2 cells and it can also promote TGF-β production in Treg cells. Overall, it was confirmed that the antibody of the present invention can be used for TH2 cell conversion and for the prevention or treatment of autoimmune disease, thereby completing the present invention.

Technical Solution

One object of the present invention is to provide a polypeptide which is an epitope, represented by an amino acid sequence of SEQ ID No.2, of activation-inducible tumor necrosis factor receptor (AITR) for converting T cells to TH2 cell.

Another object of the present invention is to provide an antibody specifically recognizing the epitope of AITR, represented by SEQ ID No.2.

Another object of the present invention is to provide a method for preparing the antibody.

Another object of the present invention is to provide a polynucleotide encoding the epitope or antibody, an expression vector comprising the polynucleotide, and a transformant introduced with the vector.

Another object of the present invention is to provide a composition comprising the antibody for converting T cell TH2 cell.

Another object of the present invention is to provide a method for converting T cell to TH2 cell, comprising the step of treating T cell with the antibody.

Another object of the present invention is to provide a pharmaceutical composition comprising the antibody for preventing or treating autoimmune diseases.

Another object of the present invention is to provide a method for treating autoimmune diseases using the antibody.

Advantageous Effects

The present invention has identified a new epitope of AITR, represented by SEQ ID No.2, which can convert T cell to TH2 cell. Also, it was confirmed that an antibody that can specifically recognize the epitope can effectively convert T cell to TH2 cell. Accordingly, the newly identified epitope of the present invention for converting to TH2 cells can be used for treatment of various diseases or research purpose that needs TH2 cells. Furthermore, the antibody of the present invention not only effectively converts T cells to TH2 cells, but also increases the suppressive function of Treg cells effectively. Therefore, the antibody can be effectively used for preventing or treating a disease like autoimmune disease which requires enhancement of the suppressive function of Treg cells.

DESCRIPTION OF DRAWINGS

FIGS. 1A-1D demonstrate the process of generating anti-AITR mAbs from the human antibody library. FIG. 1A shows the Coomassie blue-stained gel showing the presence of anti-AITR Fab clones selected by phage displaying; and bivalent forms of anti-AITR mAbs that were generated from transiently transfected HEK293. FIG. 1B shows flow cytometry analysis results demonstrating the binding of anti-AITR mAbs to AITR in AITR-overexpressed Jurkat cells that were stained with PE-conjugated anti-AITR mAbs. FIG. 1C shows the proportion of AITR-expressing cells (%) in a population of CD4+, CD8+, and CD19+ cells. PBMCs were stimulated with anti-CD3/IL-2 or lipopolysaccharide (LPS) for 2 days and stained with PE-conjugated anti-AITR mAb (clone A41). FIG. 1D shows the expression of AITR in activated CD4+ T cells. The purified CD4+ T cells were stimulated with anti-CD3/IL-2 for 3 days. AITR expression in the activated CD4+ T cells was detected with PE-conjugated anti-AITR mAbs.

FIGS. 2A-2B show the expression of AITR in CD4+ T cells in an activation-dependent manner. Isolated PBMCs were stimulated with anti-CD3/IL-2 or LPS for 2 days. FIG. 2A shows the stimulated cells stained with PE-conjugated anti-AITR mAb (clone A41) in a test group of CD4+, CD8+, and CD19+ cells. Expressions of AITR (arrow pointing) in CD4+ T cells (upper panels), CD8+ T cells (middle panels), and CD19+ cells (down panels) were detected by staining both of the non-treated group or activated group of cells. FIG. 2B shows the stimulated cells stained with PE-conjugated anti-AITR mAb in a group of CD11c+CD14+, BDCA-2+ and CD56+ cells. Expressions of AITR were detected by staining the non-treated group (left panels) or activated group (right panels). The representative flow cytometric profiles are shown as dot plot diagrams. The proportion of AITR-expressing cells in each cell population is indicated. One of the results from three independent experiments is shown in this figure.

FIGS. 3A-3C show the epitope mapping of the anti-AITR mAbs of the present invention. FIG. 3A shows a schematic diagram of full-length AITR and recombinant GST protein lysates used for antibody production and epitope mapping. Top: an intracellular domain (ICD) and an extracellular domain (ECD) of AITR. Bottom: twelve AITR recombinants R1, R2, and R3 to R12 (R3-R12). FIG. 3B shows western blotting analysis demonstrating a specific binding of anti-AITR mAbs to each fragment of AITR-ECD. Fragments of AITR-GST proteins are shown by Coomassie blue staining (Top and left panel). Molecular weight marker and recombinant GST protein size are indicated on the left of panel. FIG. 3C shows the position of each epitope for anti-AITR antibodies (A27, A35, A41, B32, and B62) within the amino acid sequence of AITR-extracellular domain (ECD) (SEQ ID No.1).

FIG. 4A-4B demonstrate the induction of differentiation of CD4+ T cells into different phenotypes by anti-AITR mAbs which recognize different fragments of AITR-ECDs of the present invention. FIG. 4A shows the analysis of cytokine secretion through human TH1/TH2 cytokine bead array and IL-17A ELISA assay. The purified CD4+ T cells were stimulated with anti-CD3/anti-AITR mAbs (clones A27, A35 or A41) for 3 days. FIG. 4B shows the proportions of cytokine-secreting cells, i.e., IL-4+, IFN-γ+, and IL-17A+ cells (%). Purified CD4+ T cells were stimulated with anti-CD3/IL-2 for 3 days and treated with anti-AITR mAb or AITR ligand for additional 7 days. The cultured cells were stained for endogenous IL-4, IFN-γ, and IL-17A, which were then analyzed by flow cytometry. Then the proportion of IL-4+, IFN-γ+, and IL-17A+ cells (%) were calculated. The bar graphs (mean±SD) show the average value of data from three independent experiments, single asterisk, *p<0.05.

FIG. 5 shows the induction of cell division in CD4+ T cells by anti-AITR mAbs. CFSE-labeled CD4+ T cells were seeded in a flat-bottomed 96-well tissue culture plate coated with anti-CD3/IL-2 and treated with anti-AITR mAbs for 3 days. Histograms are shown in a resolution able to show up to five cycles of cell divisions by flow cytometry. The experimental result shown is based on one of the three independent experiments.

FIG. 6A-6C show the induction of expression of TH lineage-specific marker in CD4+ T cells. Purified CD4+ T cells were stimulated with anti-CD3/IL-2 for 3 days (A), and treated with anti-AITR mAbs (B) or AITR ligand (C) for additional 7 days. The cultured cells were stained for endogenous IL-4, IFN-γ, and IL-17A, and the surfaces thereof were stained with PE-conjugated anti-AITR mAb (clone A41). Then the cells were analyzed by flow cytometry. The experimental result shown is based on one of the three independent experiments.

FIGS. 7A-7D demonstrate that the anti-AITR monoclonal antibodies of the present invention recognizing different ECDs of AITR recruit different signaling proteins in CD4+ T cells, thereby demonstrating different activities. Purified CD4+ T cells were stimulated with anti-CD3/IL-2 for 3 days and were further treated with anti-AITR mAbs for 2, 6, 12, and 24 hr. FIG. 7A shows the western blotting analysis demonstrating the expression of TRAFs. After 24 hr of culturing, the cultured cells were lysed and immunoprecipitated with anti-AITR mAbs (clones A27, A35 and A41) and Protein G. Then the immunoprecipitates were immunoblotted with anti-TRAF1, anti-TRAF2, anti-TRAF3, anti-TRAF5, anti-TRAF6, or anti-AITR mAb (clones A27, A35 and A41). FIG. 7B shows the western blotting analysis demonstrating the expression of NFAT1/2, p-p38, p-ERK1/2, p-JNK1/2, and p-NF-κB. The cells were treated with anti-AITR mAbs for the indicated times and lysed. Then the cell lysates were analyzed by western blotting using the antibodies against NFAT1/2, p-p38, p-ERK1/2, p-JNK1/2, and p-NF-κB. The expression level of the target proteins was normalized to β-actin expression level. FIG. 7C shows the flow cytometry analysis showing the expression of STATs. After 24 hours of culturing, the cells were analyzed by flow cytometry using the antibodies against p-STAT-1, p-STAT-3, p-STAT-4, p-STAT-5 and p-STAT-6. FIG. 7D shows the flow cytometry analysis demonstrating the expression of STAT proteins and master transcription factors. After 24 hr of culturing, the cells were stained with T-bet, GATA-3, or RORγ t antibody and analyzed by flow cytometry. Expression of STAT proteins and master transcription factors (filled histograms, arrow pointing) are shown. Numerical values indicated in each panel represent an average of the data (mean±SD) from three independent experiments (compared with control, open histograms).

FIG. 8 shows the recruitment of TRAF protein and activation of signal transduction molecule by anti-AITR mAb in CD4+ T cell and Treg cell.

FIG. 9 shows the activation of STAT protein and master transcription factor by anti-AITR mAb in CD4+ T cell and Treg cell.

FIG. 10 shows the switching effect of anti-AITR mAbs in CD4+ T cells. Purified CD4+ T cells were stimulated with anti-CD3/IL-2 for 3 days for activation. Then the cells were further treated with anti-AITR mAbs for additional 7 days. Subsequently, the treated cells were washed and re-stimulated with media comprising the antibodies having different or same epitopes for 7 days. The cells were stained for endogenous cytokines IFN-γ, IL-4, and IL-17A. Then the effector phenotypes were examined. Also, the number of cell populations was calculated. Data shown are the average of three independent experimental results (mean±SD), single asterisk, *p<0.05 (compared to other groups).

FIG. 11 shows the switching effect of anti-AITR mAbs in CD4+ T cell.

FIGS. 12A-12D show the AITR-mediated conversion of human Treg cell to TH cell and enhancement of immune suppressing function of Treg cell by A41. The sample of CD4+ T cells isolated from healthy subjects and cancer patients were treated with anti-CD3/IL-2 for 2 days for activation. FIG. 12A shows the analysis of the effector phenotypes of cytokines. CD4+CD25high T cells isolated from healthy subjects were treated with anti-AITR mAbs for 7 days. The cultured cells were stained for endogenous cytokines IFN-γ, IL-4, and IL-17A, and the effector phenotypes were examined by flow cytometry. FIG. 12B shows the measurements of the expression level of cytokines. The cell cultures were collected at the indicated times and the level of TGF-β, IFN-γ, IL-4, and IL-17A cytokines therein was measured. FIG. 12C shows the measurements of the expression level and mean fluorescence intensity (MFI) of master transcription factors. The isolated CDeCD25high T cells were stimulated with anti-AITR mAbs. The cell cultures were collected at the indicated times and stained with the antibodies against T-bet, RORγ t, GATA-3 and Foxp3. The expression level and mean fluorescence intensity (MFI) of these transcription factors were measured by using flow cytometry. FIG. 12D shows the analysis of the effector phenotypes of master transcription factors. The CD4+CD25high T cells isolated from cancer patients were stimulated with anti-AITR mAbs for 7 days. Subsequently, the treated cells were stained for endogenous cytokines IFN-γ, IL-4, and IL-17A, and the effector phenotypes thereof were analyzed by flow cytometry. The cells were sorted by using flow cytometry, which were then treated with anti-AITR mAbs for 7 days. The level of endogenous cytokines IFN-γ, IL-4, and IL-17A in the cultured cell was measured by using flow cytometry. The number of cell populations was calculated. The data represents the results from three independent experiments (mean±SD). *p<0.05 (compared to other groups)

FIG. 13A-13B show the confirmation of AITR-mediated conversion of human Treg cells isolated from healthy subjects to TH cells. CD4+ T cells purified from healthy subjects were stimulated with anti-CD3/IL-2 for 5 days. FIG. 13A shows the expression of AITR and Foxp3 in CD4+CD25high T cells (R1) and CD4+CD25T cells (R2). CD4+CD25high T cells (R1) and CD4+CD25 T cells (R2) were sorted by FACS sorter which is a flow cytometry. Then the expression of AITR and Foxp3 was detected in the sorted cells. FIG. 13B shows the analysis of effector phenotype of CD4+CD25high T cells and CD4+CD25T cells. The sorted CD4+CD25high T cells and CD4+CD25 T cells were stimulated with anti-AITR mAbs. The stimulated cells were stained for endogenous cytokines IL-4, IFN-γ, and IL-17A and were examined for effector phenotype by flow cytometry. One of the three independent experimental results is shown.

FIG. 14A-14B show the recruitment of TRAFs and activation of other signal molecules in CD4+CD25high T cells by anti-AITR mAbs. The sorted CD4+CD25high T cells were stimulated with anti-AITR mAbs for 6, 12, or 24 hours. FIG. 14A shows the western blotting analysis of CD4+CD25high T cells for the expression of TRAF proteins. After 24 hours of culturing, cell lysates were prepared, which were then immunoprecipitated with protein G. The immunoprecipitates were immunoblotted with anti-TRAF1, 2, 3, 5 and 6, or anti-AITR mAb. FIG. 14B shows the western blotting analysis of CD4+CD25high T cell lysates prepared at the indicated times for the expression of NFAT1/2, p-p38, p-ERK1/2, p-JNK1/2, p-NF-κB, or β-actin. Cell lysates were prepared at the indicated times and immunoblotted with NFAT1/2, p-p38, p-ERK1/2, p-JNK1/2, p-NF-κB, or β-actin. The results were normalized according to the level of β-actin expression. Data shown here are representative of three independent experiments.

FIGS. 15A and B show the induction and activation of STAT proteins and master transcription factors in CD4+CD25high T cells by anti-AITR mAbs. The sorted CD4+CD25high T cells were stimulated with anti-AITR mAbs. FIG. 15A shows the analysis of STAT protein expression. After 24 hours of culturing, the cultured cells were analyzed by flow cytometry using the antibodies against p-STAT-1, p-STAT-3, p-STAT-4, p-STAT-5 and p-STAT-6. Expressions of STAT proteins are shown as filled histograms (arrow pointing) in comparison to the control group (unfilled histogram). Data are representative of three independent experiments (mean±SD). FIG. 15B shows the flow cytometry analysis of T-bet, GATA-3, RORγ t and Foxp3. Culture cells were collected at the indicated times and stained with T-bet, GATA-3, RORγ t and Foxp3 antibodies, and then analyzed by flow cytometry. One of the three independent experimental results is shown.

BEST MODE

As one aspect, the present invention provides a polypeptide defined by an amino acid sequence of SEQ ID No.2, which is an epitope of activation-inducible tumor necrosis factor receptor (AITR), for converting T cell to type 2 helper T (TH2) cell.

As used herein, “activation-inducible tumor necrosis factor receptor (AITR)” refers to a type of receptor belonging to TNFR superfamily, and can be interchangeably used with glucocorticoid-induced TNFR-related protein (GITR), tumor necrosis factor receptor superfamily member 18 (TNFRSF18), or CD357. The AITR may preferably be human AITR, but is not limited thereto. Information on AITR can be obtained from a well-known database such as NCBI GenBank. For instance, the information on AITR may be found by searching with NCBI Reference Sequence: NP004186, but is not limited thereto. The AITR is expressed constitutively at high level in activated T cell or Treg cell.

As used herein, the term “epitope” refers to a site on antigen determining the antigen specificity, and can be interchangeable used with antigen determining group or antigen determining site. For the purpose of the present invention, the epitope refers to the site corresponding to 20th to 30th amino acids of AITR-ECD, which can convert T cell to TH2 cell or enhance suppressive function of Treg cell, but is not limited thereto as long as the sequence has the same converting activity. Also, the scope of the epitope may include the sequence having at least 80%, 90%, 95%, 98%, or 99% sequence homology to the sequence of 20th to 30th amino acids of AITR-ECD without limitation, as long as it has the same activity as the above-specified sequence. The sequence of 20th to 30th amino acids of AITR-ECD is shown in FIG. 3C and Table 2, and named as SEQ ID No.2. The present inventors identified for the first time that an epitope represented by an amino acid sequence of SEQ ID No.2 is the part that can induce the conversion of T cell TH2 cell or enhance the suppressive function of Treg cell. In an effort to identify the site that can specifically convert T cell to TH2 cell in AITR-ECD constituted of 139 amino acids (SEQ ID No.1), the present inventors have confirmed that when the sequence of 20th to 30th amino acids represented by SEQ ID No.2 is used as an epitope, it can specifically convert T cell to TH2 cell. On the other hand, for the antibodies that recognize other sequences adjacent to 20th to 30th amino acids as an epitope, they did not show the converting activity to TH2 cell, and thus it was identified that the sequence of 20th to 30th amino acids of the AITR-ECD is highly specific for T cell conversion to TH2 cell (Experimental Examples 2 and 4 to 8).

As used herein, “conversion of T cell to type 2 helper T (TH2) cell” refers to converting T cell to TH2 cell through antibody binding to a specific epitope of AITR represented by SEQ ID No.2 or non-antibody protein specifically binding to the same. Preferably the conversion refers to the conversion of T cell to TH2 producing IL-4 through an antibody binding to the epitope of AITR in T cell represented by SEQ ID No.2, but is not limited thereto. The conversion of T cell to TH2 can be identified by observing the expression or secretion of TH2 cell-specific marker, for example cytokines such as IL-4; activation of IL-4/NFAT-2/STAT-6 signal transduction pathway; and expression or activation of transcription factor such as GATA-3. The T cell refers to a T cell expressing AITR, and for example it may be the activated T cell. In one example of the present invention, it was identified that CD4+ T cell and regulatory T cell expressed AITR when stimulated by anti-CD3/IL-2 or LPS. The TH2 cell is an immune cell secreting 1L-4. TH2 cell mediates immune response to parasites. Therefore, a polypeptide of the present invention which is an epitope of AITR represented by SEQ ID No.2 that can convert T cell to TH2 cell can be effectively used in the development of antibody for converting the cells to TH2 cells. In the conversion of T cell to TH2 cell, the T cell includes various types of T cells such as CD4+ T cell, TH1 cell or TH17 cell, but is not limited thereto. In one Example of the present invention, it was confirmed that CD4+ T cell can be converted to TH2 (FIGS. 4A-4B and 6A-6C), and also TH1 cell or TH17 cell with designated cell fate can be converted to TH2 cell by A41 which is an antibody that binds to the epitope of SEQ ID No.2 of the present invention (FIGS. 10 and 11). Thus, epitope of AITR with SEQ ID No.2 is identified as an important site for conversion of various T cells to TH2 cells.

As used herein, “suppressive function of Treg cell” refers to a function of suppressing immune response, that is, inhibiting the activity, proliferation, or function of various types of immune cells such as CD8+ T cells, natural killer (NK) cells, B cells, but is not limited thereto. The Treg cell refers to a type of T cell that can down regulate immune system. Also, a regulatory T cell can be interchangeably used with Treg cell, CD4+CD25high cell, or CD4+CD25highFoxp3+ cell. The Treg cell comprises both of natural or constitutive regulatory T cell and adaptive or inducible regulatory T cell. The suppressive function of Treg cell can be enacted through various pathways. To be specific, the suppressive function can be enacted by 1) suppressing immune response through secreting inhibitory cytokines such as IL-10, IL-35, or TGF-β, 2) binding to CD80/CD86 expressed in effector T cell or APC through CTLA4 and inhibiting the functions thereof, or 3) preventing IL-2 from binding to a receptor of naïve T cells by introducing an alternative IL-2 receptor that has significantly higher affinity to IL-2 than a natural IL-2 receptor present in native T cells, but is not limited thereto. The antibody of the present invention that specifically recognizes the epitope of SEQ ID No.2 acts to enhance the suppressive function of Treg cell. The enhancement of suppressive function can be confirmed by using a conventional method in the art, and the example of such method includes monitoring of the activation of signal transduction pathway such as STAT-5 or the increase of secretion of cytokines such as TGF-β which functions as a main regulatory factor in the suppressive function of Treg cell.

In one example of the present invention, it was confirmed that activated T cell was differentiated into TH2 cell by A41 which is a representative antibody of the present invention that specifically recognizes the epitope of SEQ ID No.2. However, other AITR-specific antibody recognizing the site other than the epitope of SEQ ID No.2 did not show the above converting activity. To be specific, A27 antibody recognizing the sequence of 56st to 65th amino acids and A35 antibody recognizing the sequence of 41th to 50th amino acids could not differentiate T cell to TH2 cell, even though these epitope sites were close to the sequence of 20th to 30th amino acids of AITR-ECD (FIGS. 3A-3C, 4A-4B and 6A-6C). In addition, even after the T cell was converted to the cells that secrete a specific cytokine through treatment with A27 or A35, the cell could be re-converted to IL-4-secreting cell, when treated with A41 antibody recognizing the epitope of SEQ ID No.2 of the present invention (FIGS. 10 and 11). These results suggest that the epitope of SEQ ID No.2 is significantly important site in cell conversion to TH2 cell. Also, in one example of the present invention, a molecular mechanism behind the conversion to TH2 cell through an epitope of SEQ ID No.2 was investigated. NFAT2 is involved in the conversion to TH2 cell and it increases phosphorylation level of STAT-5 and STAT-6 proteins (FIGS. 7A-7D to 9). In addition, it was observed that a representative antibody of the present invention, A41, increased the level of GATA-3 which is a TH2 cell-specific marker (FIG. 7D), thereby confirming that T cell could be efficiently converted to TH2 cell by the present antibody. Also, when Treg cell was treated with a representative antibody of the present invention, A41, the secretion of inhibitory cytokine such as TGF-β was significantly increased (FIG. 12B) and the phosphorylation of STAT-5 was promoted (FIGS. 15A-15B). These results suggest that when the antibody of the present invention acts specifically to AITR of Treg cell, the suppressive function of Treg cell can be effectively enhanced.

As another aspect, the present invention provides an antibody specifically recognizing an epitope of activation-inducible tumor necrosis factor receptor (AITR), wherein the epitope is represented by SEQ ID No.2.

As used herein, the term “antibody” refers to a protein molecule that acts as a receptor recognizing an antigen specifically, comprising an immunoglobulin molecule that responses to a specific antigen immunologically. Also, the antibody comprises all of polyclonal antibody, monoclonal antibody, whole antibody, and antibody fragment. In addition, the scope of antibody includes a chimeric antibody (for example, humanized murine antibody) and bivalent or bispecific molecule (for example, bispecific antibody), diabody, triabody, and tetrabody. The whole antibody is constituted of two full-length light chains and two full-length heavy chains, wherein each of the light chains is connected with heavy chains through disulfide binding. The whole antibody comprises IgA, IgD, IgE, IgM, and IgG. IgG comprises IgG1, IgG2, IgG3, and IgG4 as subtypes thereof. The antibody fragment refers to a fragment capable of binding to antigen, and it comprises Fab, Fab′, F(ab′)2, and Fv. The Fab is constituted of variable regions of light chain and heavy chain, constant region of light chain, and the first constant region of heavy chain (CH1 domain), having one antigen-binding site. Fab′ is different from Fab in that it has a hinge region which comprises more than one cysteine residue at C-terminal of heavy chain CH1 domain. F(ab′)2 antibody is formed through disulfide bonding of cysteine residues in the hinge region of Fab′. A variable fragment (Fv) refers to a minimized antibody fragment having heavy chain variable region and light chain variable region. In a double stranded Fv (dsFv), heavy chain variable region and light chain variable region are connected through disulfide bonding while in a single stranded Fv (scFv), heavy chain variable region and light chain variable region are covalently bonded through peptide linker. These antibody fragments can be obtained by treating the antibody with protease (for example, when a whole antibody is restriction digested with papain, Fab is obtained and when restriction digested with pepsin, F(ab′)2 fragment can be obtained). Preferably, the antibody fragment can be generated by using genetic recombination technique.

As used herein, the term “monoclonal antibody” refers to an antibody molecule that has been obtained from a substantially identical antibody clone, which shows single-binding specificity and affinity for a specific epitope.

Typically, immunoglobulin has heavy chain and light chain and each of the heavy chain and light chain possesses constant region and variable region (also known as domains). A variable region of light chain and heavy chain comprises three variable regions and four framework regions called complementarity-determining region (hereinafter referred to as “CDR”). The CDR mainly acts to bind to an epitope of antigen. CDRs of each chain is conventionally called CDR1, CDR2, and CDR3 successively starting from the N-terminal, and also they are distinguished by the chain at which they are located.

As used herein, the term “human antibody” refers to a molecule derived from human immunoglobulin, in which all of the amino acid sequences constituting the antibody including complementarity-determining regions and framework regions are composed of amino acid sequences of human immunoglobulin. Human antibody is conventionally used for treating human diseases, which has more than three potential advantages. First, human antibody interacts more favorably with human immune system, and thus it can destroy the target cell more efficiently, for example through complement-dependent cytotoxicity (CDC) or antibody-dependent cell-mediated cytotoxicity (ADCC). Secondly, human immune system does not recognize the human antibody as a foreign substance. Thirdly, when smaller dose of drug was administered at lower frequency, half-life of human antibody in human circulation is similar to that of naturally-occurring antibodies. In one example of the present invention, it was confirmed that a human monoclonal antibody specifically recognizing the epitope of SEQ ID No.2 demonstrates a strong affinity toward AITR and thus can effectively convert T cell to TH2 cell and enhance the suppressive function of Treg cells (FIGS. 1A-1D to 15A-15B). The heavy chain and light chain domains of the present antibody having the activity of converting T cell to TH2 cell and enhancing the suppressive function of Treg cells are all human-derived showing lower rate of immunogenicity, and thus the antibody can be effectively used for treating autoimmune disease.

As used herein, “antibody specifically recognizing an epitope of activation-inducible tumor necrosis factor receptor (AITR) represented by SEQ ID No.2” refers to an antibody that can convert T cell to TH2 cell by specifically recognizing an epitope of SEQ ID No.2 or enhance the suppressive function of Treg cell, but is not limited thereto. The antibody particularly enhances the suppressive function of Treg cells, for example, production of inhibitory cytokine, TGF-β, and thus it can be effectively used for preventing or treating autoimmune disease; and for enhancing immunity.

The antibody specifically recognizing the epitope of SEQ ID No.2 may preferably comprise a heavy chain variable region comprising heavy chain complementarity-determining region 1 (CDR1) represented by SEQ ID No.6; heavy chain CDR2 represented by SEQ ID No.7; and heavy chain CDR3 represented by SEQ ID No.8, and a light chain variable region comprising light chain CDR1 represented by SEQ ID No.10; light chain CDR2 represented by SEQ ID No.11; and light chain CDR3 represented by SEQ ID No.12. More preferably, the antibody may comprise an amino acid sequence of heavy chain variable region represented by SEQ ID No.5 and an amino acid sequence of light chain variable region represented by SEQ ID No.9, but is not limited thereto. In one example of the present invention, a human monoclonal antibody comprising the amino acid sequence of heavy chain variable region represented by SEQ ID No.5 and the amino acid sequence of light chain variable region represented by SEQ ID No.9 was named as A41. In addition, the polynucleotide encoding the antibody may comprise a nucleotide sequence of a heavy chain variable region represented by SEQ ID No.13; and a nucleotide sequence of a light chain variable region represented by SEQ ID No.14, but is not limited thereto.

In addition, if the antibody of the present invention comprises a constant region, the constant region may be derived from IgG, IgA, IgD, IgE, and IgM or a combination or hybrid thereof.

As used herein, the term “combination” refers to, when forming a dimer or polymer, a combination of a polypeptide coding for single-chain immunoglobulin constant region of same origin with single-chain polypeptide of different origin. For example, the dimer or polymer can be formed with more than two constant regions selected from the group consisting of constant regions of IgG, IgA, IgD, IgE, and IgM.

As used herein, the term “hybrid” refers to the presence of more than two immunoglobulin heavy chain constant regions of different origins within a single-chain immunoglobulin heavy chain constant region. For example, a hybrid of domains can be formed with 1 to 4 domains selected from the group consisting of CH1, CH2, CH3, and CH4 of IgG, IgA, IgD, IgE, and IgM. Meanwhile, a combination or hybrid of heavy chain constant regions of the subtypes of IgG such as IgG1, IgG2, IgG3, and IgG4 is also possible. The combination and hybrid are the same as described above.

Also, if the antibody of the present invention comprises a light chain constant region, the light chain constant region may be derived from lambda(λ) or kappa(κ) light chain.

In one example of the present invention, A41 that specifically binds to the epitope of AITR with SEQ ID No.2 was selected from a human antibody library (Experimental Example 1), and their specific binding to AITR was confirmed (FIGS. 1A-1D). In addition, the antibody recognition sites on AITR-ECD were identified (FIGS. 3A-3C and Table 2). Also, it was confirmed that unlike other antibodies that recognize other sites of AITR, the above-described antibodies can convert T cell to TH2 cell (FIGS. 4A-4B to 11), and furthermore, even the T cells that were already differentiated into specific T cell, the antibodies can re-convert the cell to TH2 cell (Experimental Examples 7 and 8, and FIGS. 10 and 11). In addition, when the antibody of the present invention acted to Treg cells, it increased the production level of TGF-β in Treg cells, thereby enhancing the suppressive function of Treg cells and at the same time, the phosphorylation level of STAT-5 was also increased (FIGS. 12A-12D to 15A-15B). These results support that the AITR-specific antibody of the present invention that recognizes an epitope of SEQ ID No.2 can be used for prevention or treatment of autoimmune disease that requires efficient conversion of T cell to TH2 cell; and enhancement of suppressive function of Treg cells.

As another aspect, the present invention provides a method for preparing the antibody.

The antibody of the present invention can be easily prepared by a conventional method for production of antibody. For example, a monoclonal antibody can be prepared by generating hybridoma with B lymphocyte obtained from immunized animals (Koeher and Milstein, 1976, Nature, 256:495), and phage display technique, but is not limited thereto. A polyclonal antibody can be easily prepared by a conventional method for production of antibody, and also it can be prepared by using an antigen comprising the epitope of the present invention.

Production of antibody library by using phage display technique is done by obtaining an antibody gene directly from B lymphocyte without producing hybridoma and expressing the antibody on the phage surface. By using the phage display technique, many limitations associated with the production of monoclonal antibody can be overcome by B-cell immortalization. In general, a phage display technique consists of the steps of (1) inserting oligonucleotides of random sequences to the nucleotide sequence corresponding to N-terminal of phage coat protein pHIII (or pIV); (2) expressing a fusion protein of a partial naïve coat protein and a polypeptide coded by the oligonucleotide of random sequence; (3) treating a receptor material that can bind to the polypeptide coded by the oligonucleotide; (4) eluting the peptide-phage particles bound to receptors by lowering pH or using competitive molecules for binding to the receptors; (5) amplifying a phage sample eluted by panning within the host cells; (6) repeating the above process to obtain desired amount of phage products; and 7) determining the sequence of active peptide among the DNA sequences of phage clones selected by panning.

Preferably, production of a monoclonal antibody of the present invention can be done by using phage display technique. Those skilled in the art can easily perform each step of the preparation method of the present invention according to a conventional phage display technique, for example a method described in Barbas et al. (METHODS: A Companion to Methods in Enzymology 2:119, 1991; J. Virol. 2001 July; 75(14):6692-9) and Winter et al. (Ann. Rev. Immunol. 12:433, 1994). A type of phage that can be used for generating antibody library includes filamentous phage such as fd, M13, f1, If1, Ike, Zj/Z, Ff, Xf, Pf1, or Pf3 phage, but is not limited thereto. In addition, a type of vector that can be used for expressing heterologous gene on filamentous phage surface includes a phage vector such as fUSE5, fAFF1, fd-CAT1, or fdtetDOG or a phagemid vector such as pHEN1, pComb3, pComb8, or pSEX, but is not limited thereto. Also, a type of helper phage that can be used for providing a wild-type coat protein which is required for the successful reinfection of recombinant phage for amplification includes M13K07 or VSCM13 helper phage, but is not limited thereto.

The hybridoma-derived monoclonal antibody or polynucleotide encoding phage display clones of the present invention can be easily isolated and analyzed for the sequence thereof through a conventional process. For example, oligonucleotide primers designed to specifically amplify the heavy chain and light chain coding region from hybridoma or phage template DNA can be used. Once the polynucleotide is isolated, it can be inserted to an expression vector, which can be subsequently introduced to a suitable host cell, thereby producing a desired monoclonal antibody from the transformed host cell (i.e., transformant). Therefore, the method for preparing the antibody of the present invention may be a method for preparing antibody comprising the step of amplifying the expression vector comprising polynucleotide encoding the antibody, but is not limited thereto.

As another aspect, the present invention provides a polynucleotide encoding the epitope or antibody, an expression vector comprising the polynucleotide, and a transformant introduced with the vector.

The antibody is the same as described above.

The expression vector of the present invention comprising a polynucleotide encoding the epitope or antibody is not limited to, but may be a vector that can replicate and/or express the polynucleotide in eukaryotic cells including animal cells (for example, human, monkey, rabbit, rat, hamster, and mouse cell etc), plant cell, yeast cell, insect cell, or bacterial cell (for example, E. coli), or prokaryotic cells. Preferably, the vector may be a vector wherein the nucleotide is operably linked to a suitable promoter for the expression thereof in a host cell and at least one selection marker is included. For example, the expression vector of the present invention may be in a form of a phage vector, plasmid vector, cosmid vector, mini-chromosome vector, viral vector, or retroviral vector wherein the polynucleotide is introduced.

The expression vector comprising polynucleotide encoding the antibody may be an expression vector comprising each of polynucleotides encoding the heavy chain or light chain of the antibody, or an expression vector comprising all of polynucleotides encoding heavy chain or light chain.

The transformant of the present invention wherein the expression vector is introduced is not limited to, but may be prepared from bacterial cells such as E. coli, Streptomyces, and Salmonella typhimurium; yeast cells; fungal cells such as Pichia pastoris; insect cells such as Drosophila, Spodoptera Sf9 cell; animal cells such as Chinese hamster ovary (CHO) cells, mouse bone marrow cell SP2/0, human lymphoblastoid, COS, mouse bone marrow cell NSO, 293T, BOW melanoma cell lines, HT-1080, baby hamster kidney (BHK) cells, human embryonic kidney (HEK) cells, human retinal cell PERC.6; or plant cells by transforming the same with the expression vector.

As used herein, the term “introduction” refers to a method of transferring a vector comprising the polynucleotide encoding epitope or antibody to a host cell. Such introduction can be done by using various methods known in the art such as Calcium phosphate-DNA co-precipitation, DEAE-dextran-mediated transfection, polybrene-mediated transfection, electroporation, microinjection, liposome fusion, lipofectamine, and protoplast fusion. Also, transduction refers to a transfer of a target molecule into the cell by using viral particles through infection. Furthermore, a vector can be introduced to the host cell through gene bombardment. In the present invention, the term introduction can be interchangeably used with transfection.

As another aspect, the present invention provides a composition comprising the antibody for converting T cell to type 2 helper T (TH2) cell.

The antibody, T cell, TH2 cell, and conversion of T cell to TH2 cell are the same as described above. The antibody of the present invention specifically recognizing the epitope of AITR represented by SEQ ID No.2 can convert T cell to TH2 cell specifically, and thus a composition comprising the antibody can be used for the conversion of T cell to TH2 cell. Especially, since the composition of the present invention can re-convert the already differentiated cell (e.g., TH1 cell or TH17 cell) to TH2 cell, it can be diversely used depending on the purpose.

As another aspect, the present invention provides a method for converting T cell to type 2 helper T (TH2) cell, comprising treating T cell with the antibody.

The antibody, T cell, TH2 cell, and conversion of T cell to TH2 cell are the same as described above. When the T cell, for example CD4+ T cell, TH1 cell, or TH17 cell, are treated with the antibody of the present invention, it can be effectively converted to TH2 cell, and thus the antibody can be effectively used in the treatment of diseases that need the function of TH2 cell by converting T cell to TH2 cell.

As another aspect, the present invention provides a pharmaceutical composition for preventing or treating autoimmune disease, comprising the antibody.

The antibody is the same as described above.

As used herein, the term “autoimmune disease” refers to diseases that are directly or indirectly caused by an inappropriate immune response against the subject's own antigen. Type of autoimmune diseases is not limited but may include rheumatic arthritis, systemic scleroderma, systemic lupus erythematosus, atopic dermatitis, psoriasis, areata alopecia, asthma, Crohn's disease, Behcet's disease, Sjogren's syndrome, Guilliain-Barre syndrome, chronic thyroiditis, multiple sclerosis, polymyositis, ankylosing spondylitis, encephalomyelitis, fibrositis, or polyarteritis nodosa.

As used herein, the term “prevention” refers to all actions that suppress or delay the onset of autoimmune disease by administering a composition.

As used herein, the term “treatment” refers to all actions that can alleviate or beneficially change the symptoms of autoimmune disease by administering a composition.

The pharmaceutical composition may additionally comprise a pharmaceutically acceptable carrier.

As used herein, the term “pharmaceutically acceptable carrier” refers to a carrier or diluent that does not inhibit a biological activity and feature of the administered compound without irritating an organism. Types of pharmaceutical carriers suitable for a composition of liquid formulation include saline solution, sterile water, Ringer's solution, buffered saline solution, albumin solution, dextrose solution, maltodextrin solution, glycerol, ethanol, and a combination thereof, as a sterilized and acceptable carrier to the organism. If necessary, other conventional additives such as antioxidant, buffer solution, and bacteriostatic agent can be added. Also, the pharmaceutical composition may be formulated into a formulation for injection such as aqueous solution, suspension, emulsion; pill, capsule, granule, and tablet by further adding a diluent, dispersant, surfactant, binder, and lubricant.

The pharmaceutical composition may be in a form of various oral or parenteral formulations. The composition is formulated with conventional diluents or excipients, including fillers, extenders, binders, wetting agents, disintegrants, and surfactants. Solid formulations for oral administration include tablets, pills, powders, granules, and capsules. These solid formulations are prepared by mixing one or more compounds with at least one of excipients, for example, starch, calcium carbonate, sucrose, lactose, and gelatin. Also, other than the simple excipients, lubricants such as magnesium stearate and talc are used. In addition, types of liquid formulation for oral administration include a suspension, solution, emulsion and syrup. To this liquid formulation, not only a commonly used diluent such as water and liquid paraffin may be added, but also various types of excipients such as wetting agents, sweetening agents, flavors, and preservatives can be added. Types of formulations for parenteral administration include sterilized aqueous solutions, non-aqueous solutions, suspensions, emulsions, lyophilized formulation, and suppositories. As non-aqueous solvent and suspending agent, propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable esters such as ethyl oleate may be used. The base composition for suppository may include witepsol, macrogol, tween 61, cacao butter, laurin butter, and glycerinated gelatin.

The pharmaceutical composition of the present invention may be formulated in any one of the forms selected from the group consisting of tablets, pills, powders, granules, capsules, suspension, solutions, emulsions, syrups, sterilized aqueous solution, non-aqueous solution, lyophilized formulation and suppository.

The composition of the present invention is administered in a pharmaceutically effective amount.

As used herein, the term “pharmaceutically effective amount” refers to an amount sufficient to treat a disease, at a reasonable benefit/risk ratio applicable to any medical treatment. The effective dosage level of the composition may be determined by the factors including a type of subject, severity of condition, an age and sex of subject, a type of virus infected, an activity of drug, a sensitivity towards drug, duration and route of administration, excretion rate, duration of treatment, a type of drugs used in combination with the composition, and other factors well-known in the medical field. The composition of the present invention may be administered alone or in combination with other medicines, and it may be administered sequentially or simultaneously with conventional medicines. Also, the present composition may be administered in single or multiple doses. In view of all of these factors, it is important to administer the composition in a minimum amount yielding the maximum possible effect without causing side effects, which can be easily determined by those skilled in the art.

In autoimmune disease, Treg cell takes a key role in the suppression of immune responses, and thus there have been many attempts to increase the number of Treg cells and enhance the suppressive function of Treg cells for treating the autoimmune disease (Kim et al., Korean J Otorhinolaryngol-Head Neck Surg, 53:737-48, 2010). In this regard, the antibody of the present invention recognizing the epitope of AITR with SEQ ID No.2 increases the production of TGF-β which is an inhibitory cytokine of Treg cell having immune suppressive function. Therefore, the antibody of the present invention can be effectively used for the prevention or treatment of autoimmune disease through enhancing the suppressive function of Treg cells.

In one Example of the present invention, it was identified that the antibody of the present invention that binds to the epitope of SEQ ID No.2 increases the production of TGF-β which is an inhibitory cytokine of Treg cells, thereby confirming that the present antibody can be used for the prevention and treatment of autoimmune disease (FIG. 12B).

As another aspect, the present invention provides a method for treating autoimmune disease, comprising administering the antibody to a subject in need thereof.

The antibody and autoimmune disease are the same as described above.

The method for treating autoimmune disease may be a method comprising the step of administering the pharmaceutical composition comprising the antibody and pharmaceutically acceptable carrier in addition to a subject having autoimmune disease or suspected of having autoimmune disease. The pharmaceutically acceptable carrier is the same as described above. The method for treating autoimmune disease may preferably be a method comprising the step of administering the composition comprising the antibody to a subject having autoimmune disease.

The type of subject includes mammals and birds such as cows, pigs, sheep, chickens, dogs, and human, and is not limited as long as autoimmune disease in the subject can be treated by administration of the composition of the present invention.

The composition may be administered in single or multiple doses in a pharmaceutically effective amount. In this regard, the composition may be administered in a form of solutions, powders, aerosols, capsules, enteric-coated tablets or capsules or suppositories. The routes for administration include intraperitoneal, intravenous, intramuscular, subcutaneous, intradermal, oral, topical, intranasal, intrapulmonary and intrarectal administration, but are not limited thereto. However, since peptides are digestible when orally administered, the active ingredients of a composition for oral administration need to be coated or formulated such that they can be protected against degradation in stomach. In addition, a pharmaceutical composition may be administered through a certain apparatus capable of transporting the active ingredients into a target cell.

The pharmaceutical composition of the present invention may comprise an antibody that specifically binds to the epitope of SEQ ID No.2. The antibody can increase the production of TGF-β which is an inhibitory cytokine of Treg cells, thereby enhancing the suppressive function of Treg cells. Therefore, through administering the pharmaceutical composition comprising the antibody into the body, the onset or progression of autoimmune disease can be prevented, thereby preventing or treating autoimmune disease.

MODE FOR INVENTION

Hereinafter, the present invention is described in more detail with reference to Examples. However, these Examples are for illustrative purposes only, and the invention is not intended to be limited by these Examples.

Example 1

Cell Isolation

Peripheral venous blood samples newly collected from healthy individuals and cancer patients were treated with heparin and peripheral-blood mononuclear cells (PBMCs) were isolated by Ficoll-paque gradient centrifugation (GE Healthcare, Piscataway, N.J.). The isolated PBMCs were resuspended in RPMI 1640 medium containing 1% FBS for 2 days. Subsequently, naive CD4+ T cell subsets were collected through positive selection using anti-CD4+ antibodies (Miltenyi Biotec, Gladbach, Germany). The purity of the selected CD4+ T cell fractions was approximately 97%.

In order to obtain high purity of CD4+CD25high/− T cells, the isolated CD4+ T cells were stimulated with 0.1 μg/ml anti-CD3 antibodies (HIT3a; BD PharMingen, San Diego, Calif.) for 7 days, and 100 U/ml IL-2 (Interleukin-2; PeproTech, Rocky Hill, N.J.) was added every 2 days. Subsequently, the cultured CD4+ T cells were stained with the PE-cy5-conjugated anti-CD25 antibody and FITC-conjugated anti-CD4 antibody. Finally, the CD4+CD25high T cells or CD4+CD25T cells were isolated by using FACS Aria (BD Biosciences, San Jose, Calif.).

Example 2

Antibodies and Flow Cytometry

In the flow cytometry experiment, the present inventors used fluorochrome-conjugated antibodies against CD4, CD8, CD11c, IFN-γ, Foxp3, CTLA-4, CD62L, CD45RO, CD45RA (BD Bioscience), CD19, CD56, CD14, CD127, IL-4, IL-17A, GATA-3, T-bet, RORγ t (ebioscience, San Diego, Calif.), and BDCA-2 (Miltenyi Biotec). Also, for anti-AITR antibody, biotinylated AITR-specific antibodies (A27, A35, A41, B32, and B62 clones) were used. Intracellular level of cytokines was measured after 5 hour-long pre-incubation with 50 ng/ml phorbol 12-myristate 13-acetate (PMA), 10 μg/ml ionomycin, and 10 μg/ml Brefeldin A (Sigma-Aldrich, St Louis. Mo.). FACSCalibur flow cytometer (BD Bioscience) was used for all of the flow cytometry analysis and WinMDI software (Ver. 2.9, Scripps. Institute) was used for data analysis.

Example 3

Preparation of Soluble AITR and AITR-Overexpressing Cell

Specific binding of human anti-AITR mAbs was measured by using Enzyme-linked immunosorbent assay (ELISA) or FACS. In order to generate a fusion protein of a water-soluble AITR-ECD (26th to 139th amino acids) and GST protein, a GST-tagged AITR-ECD expression vector (pGEX-6p-1/AITR-ECD) was constructed. First, AITR-coding sequence was amplified by PCR using a sense primer and antisense primer shown in Table 1 and using cDNA extracted from the activated CD4+ T cells as a PCR template. Then the amplified AITR-coding sequence was restriction digested with BamHI/XhoI, and cloned into a vector pGEX-6p-1 to generate a GST-tagged AITR-ECD expression vector (pGEX-6p-1/AITR-ECD).

TABLE 1
SEQ ID
Sequence (5′→3′) No.
Forward AAGCTTGGTCAGCGCCCCACCGGG 49
Primer
Reverse CCGGCAGAGCCGCCTTAACTCGAG 50
Primer

The pGEX-6p-1/AITR-ECD was transformed into E. coli (BL21-DE3-pLyss) and the protein expression was induced by adding 0.20 mM IPTG. The recombinant AITR-GST proteins expressed in E. coli were purified by running them through a glutathione agarose 4B bead column.

For generating AITR-overexpressing cells, the gene fragment encoding AITR-transmembrane domain (TM)-ECD was inserted in-frame with CD5L sequence in a mammalian vector pcDNA3.1(+), i.e. pcDNA3.1(+)/CD5L-AITR-TM-ECD. Then pcDNA3.1(+)/Empty vector or pcDNA3.1(+)/CD5L-AITR-TM-ECD vector was transient transfected into Jurkat cells by electroporation. AITR expression on cell surface was detected by staining with biotin-conjugated anti-AITR mAb.

Example 4

Preparation of Anti-AITR Monoclonal Antibodies (Anti-AITR mAbs)

The pCANTAB5E phagemid vector comprising human Fab antibody cDNA library was transformed into TG1 E. coli cells. Subsequently, the transformants were cultured in 2×YT broth containing 100 μg/ml ampicillin and 50 μg/ml kanamycin, and then superinfected with M13K07 helper phage. After culturing the cells at 30° C. for 24 hours, the cell culture was centrifuged down to collect culture supernatant only. Then the supernatant was added with 3.3% (w/w) polyethylene glycol (Sigma) and 2.3% (w/w) NaCl to precipitate recombinant phage particles obtained. The precipitated phage particles were resuspended in 2×YT broth.

Biopanning was performed using the above-prepared suspension as a library in order to select the phage specific to a human AITR-GST fusion protein by phage display (1 to 4 times biopanning). Among the recombinant phage particles from the culture supernatant of each clone, a positive clone of human AITR-GST fusion protein was selected through ELISA.

In addition, to generate a bivalent form of antibody, Fab genes (VH and VL) obtained from phage displaying were prepared by PCR, and then cloned into a restriction enzyme site of the expression vector pDCMV-DHFR. As a result, an antibody gene and construct thereof of five different clones (A27, A35, A41, B32, and B62) were obtained. To generate a bivalent form of anti-human AITR mAbs, the construct of antibody gene was transiently transfected into HEK293 and CHO cells, and the protein products were purified from the culture supernatant by using a protein G column (GE Healthcare).

Example 5

Epitope Mapping of Anti-AITR Monoclonal Antibodies (Anti-AITR mAbs)

For identifying a precise epitope recognized by the anti-AITR mAbs of the present invention, twelve different fragments (R1 to R12) corresponding to AITR-ECD were prepared and cloned into a GST-vector, pGEX-6p-1 (FIG. 3A).

The pGEX-6p-1/R1-R12 was transformed into E. coli cell line, BL21-DE3-pLyss, and the protein expression was induced by adding 0.20 mM IPTG. The recombinant R1-GST to R12-GST fusion proteins expressed in E. coli were purified by running them through a glutathione agarose 4B bead column (Peptron). At this time, horseradish peroxidase-coupled anti-human IgG was diluted 10,000 times (Sigma Aldrich, St Louis, Mo., USA). Also, chemiluminescence was monitored by using SuperSignal West Pico Chemiluminescence Substrate (Pierce, Rockford, Ill.).

Example 6

Cell Division and Cytokine Analysis

In the present invention, CD4+ T cells were labeled with CFSE (Molecular Probes, Invitrogen). The proliferation of CFSE-labeled CD4+ T cells (5×105 cells/well) was stimulated by treating the cells with anti-CD3 antibody (0.1 μg/ml)/IL-2 (100 U/ml) and 5 μg/ml anti-AITR mAb for 72 hr. After 72 hours of culturing, the cell-free supernatant was separated and analyzed for cytokine level by using TH2/Th2 cytokines bead array kit (BD Bioscience), human TGF-β1 Quantikine ELISA kit (R&D system, Minneapolis, Minn.), and human IL-17A ELISA kit (Abcam, Cambridge, UK).

Example 7

Analysis of Differentiated Effector in CD4+ T Cell

Purified CD4+ T cells (5×105 cells/well) were stimulated with 0.1 μg/ml anti-CD3 antibody and 100 U/ml IL-2 for 3 days. Then, the cultured cells were treated with 5 μg/ml anti-AITR mAbs or 0.1 μg/ml AITR ligand (AITRL) for another 7 days.

Subsequently, the differentiated effector T cell subsets were washed with 1×PBS, and then cultured with a fresh medium containing 5 μg/ml anti-AITR antibody recognizing different epitope for another 7 days while adding 100 U/ml IL-2 for every 2 days. Then the cultured cells were harvested and endogenous IFN-γ, IL-4 and IL-17A were stained for three-color flow cytometry analysis.

Example 8

Analysis of Interaction Between AITR and TRAFs

Purified CD4+ T cells (5×105 cells/well) were stimulated with 0.1 μg/ml anti-CD3 antibody and 100 U/ml IL-2 for 2 days. The cultured cells were treated with 5 μg/ml anti-AITR mAbs for 24 hr. Then the cells were lysed with 100 μl RIPA buffer (50 mM Tris-HCl (pH 7.4), 150 mM NaCl, 1% Nonidet P-40, 0.25% Na-deoxycholate, 1 mM PMSF, protease inhibitors, and phosphatase inhibitors).

For immunoprecipitation, cell lysates were incubated with 20 μl of 1:1 slurry of protein G-sepharose for 1 hour. Then, the precipitate was washed with 1×PBS, and protein complexes were eluted. Western blot analysis of eluate was performed by using anti-TRAFs (TRAF1, TRAF2, TRAF3, TRAF5, and TRAF6) (Santa Cruz Biotechnology, Santa Cruz, Calif.) or anti-AITR mAbs and using horseradish peroxidase-conjugated goat anti-rabbit IgG or anti-human IgG as a secondary antibody.

In a separate experiment, the sorted CD4+CD25high T cells (5×105 cells/well) were stimulated with 5 μg/ml anti-AITR mAbs for 24 hr and the interaction between AITR and TRAF was analyzed by using the same method described above.

Example 9

Analysis of Phosphorylation of Endogenous Signaling Pathway Protein

Purified CD4+ T cells (1×106 cells/well) were stimulated with anti-CD3 antibody and IL-2 for 3 days. The cultured cells were treated with anti-AITR mAbs for 2, 6, 12 and 24 hours. Then the cells were harvested and the suspension thereof was prepared. Levels of phospho-STATs (STAT1, STAT2, STAT3, STAT4, STAT5, and STAT6) and master transcription factors (T-bet, GATA-3, RORγ t and Foxp3) were analyzed by flow cytometry. The cells in the culture were lysed with RIPA buffer. Subsequently, total protein extract was resolved on 8% to 12% SDS-polyacrylamide gel electrophoresis and immunoblotted with antibodies against NFAT1/2, p-p38, p-ERK1/2, p-JNK1/2, and p-NF-κB (Cell Signaling, Danvers, Mass., USA). The same blot was re-probed with an anti-β-actin antibody as a control for protein loading.

In a separate experiment, the sorted CD4+CD25high T cells (5×105 cells/well) were stimulated with 5 μg/ml anti-AITR mAbs and phosphorylation of the proteins involved in intracellular signaling pathway was analyzed by the same method described above.

Example 10

Phenotype Conversion of Human CD4+CD25highFoxp3+ (Treg) Cell to Different Subset

Human Treg cells isolated from healthy subjects and cancer patients were sorted by the method described in Example 1. The cells were stimulated with 5 μg/ml anti-AITR mAbs for 7 days while adding 100 U/ml IL-2 every 2 days. Then the cultured cells were harvested and the expression of AITR, CTLA-4, CD62L, CD127, CD45RO and CD45RA on cell surface was confirmed. Also, endogenous IFN-γ, IL-4 and IL-17A and master transcription factors were stained and the cells were analyzed by flow cytometry. In addition, culture supernatants were collected and the expression of IFN-γ, IL-4, IL-17A, and TGF-β was confirmed.

In a separate experiment, the sorted CD4+CD25(non-Treg) cells (5×106 cells/well) were stimulated with 5 μg/ml anti-AITR mAbs. Culture cells were stained for endogenous IFN-γ, IL-4 and IL-17A and then analyzed by three-color flow cytometry.

Example 11

Statistical Analysis

All experimental data were analyzed with a statistical program called Prism 5.0 GraphPad (San Diego, Calif.). Student's t-test was performed to determine the statistical significance of the difference between test groups.

Experimental Example 1

Generation of Anti-AITR Monoclonal Antibodies

As described in Example 4, five Fab antibodies against AITR were selected from a human Fab antibody library and named as A27, A35, A41, B32, and B62. The antibody A41 comprises a heavy chain variable region of SEQ ID No.5 and a light chain variable region of SEQ ID No.9, and the antibody A27 comprises a heavy chain variable region of SEQ ID No.15 and a light chain variable region of SEQ ID No.19. The antibody B32 comprises a heavy chain variable region of SEQ ID No.25 and a light chain variable region of SEQ ID No.29, and the antibody A35 comprises a heavy chain variable region of SEQ ID No.35 and a light chain variable region of SEQ ID No.39. The antibody B62 comprises a heavy chain variable region of SEQ ID No.45 and a light chain variable region of SEQ ID No.46.

In addition, anti-AITR genes were generated by grafting VH and VL DNA sequences into a human IgG1 backbone. Anti-AITR mAbs A27, A35, A41, B32, and B62, were produced by transient transfection of the antibody constructs into HEK293 cells (FIG. 1A). These antibodies showed similar affinity to AITR in the AITR-overexpressed Jurkat cells (FIG. 1B).

Experimental Example 2

Epitope Mapping of Anti-AITR Monoclonal Antibodies

In this experiment, epitopes recognized by five human anti-AITR mAbs selected in Experimental Example 1 were identified. To confirm the epitope, AITR-GST fusion proteins named as R1 to R12 were used (FIGS. 3A-3C). Immunoblotting results of R0-GST to R12-GST proteins with anti-AITR mAbs demonstrated that the five antibodies were classified into 3 groups based on their recognition site of AITR, i.e., epitope. A27 and B32 specifically bound to R1 and R2 sites; A35 and B62 specifically bound to R1 to R4 and R8 to R11; and A41 specifically bound to R1 to R6, R8, and R9 (FIG. 3B). As a result of investigating the epitope sites more precisely, it was confirmed that A27 and B32 specifically recognized the sequence of 56th to 65th amino acids (AA 56-65) of AITR-ECD;

A35 and B62 specifically recognized the sequence of 41st to 50th amino acids (AA 41-50) of AITR-ECD; and A41 specifically recognized the sequence of 20th to 30th amino acids (AA 20-30) of AITR-ECD (FIG. 3C and Table 2). The epitope site recognized by A41 was named as SEQ ID No.2; the epitope site recognized by A27 and B32 was named as SEQ ID No.3; and the epitope site recognized by A35 and B62 was named as SEQ ID No.4.

TABLE 2
Anti- SEQ ID
body Epitope No.
A41 GTDARCCRVHT (AA 20-30) 2
A27 & HCGDPCCTTC (AA56-65) 3
B32
A35 & ECCSEWDCMC (AA41-50) 4
B62

Experimental Example 3

Expression of AITR in Immune Cell

The expression of AITR was up-regulated after stimulation of PBMCs, but when PBMCs were not stimulated, mRNA of AITR was not detected. Also, the expression of AITR was significantly up-regulated after CD3 stimulation in T cells. Furthermore, the expression of AITR was analyzed in T cells, B cells, NK cells, and monocytes by flow cytometry. The results demonstrated that the human anti-AITR mAbs of the present invention mainly recognized AITR in the activated CD4+ T cells which had nearly 40-fold higher expression of AITR. When the antibodies were used in CD8+ T cells, B cells, NK cells, and monocytes, neither of resting nor activated AITR was detected (FIG. 1C).

These results demonstrate that the anti-AITR mAbs of the present invention recognize rapidly up-regulated AITR expression in the activated CD4+ T cell population, through TCR-mediated activated signal.

Experimental Example 4

Co-Stimulation of Cell Division and Cytokine Production in Differentiated CD4+ T Cell Population by AITR Signaling

After identifying that AITR is expressed mainly in the activated CD4+ T cells (FIG. 1C), the role of AITR was investigated as a co-stimulatory molecule in proliferation and cytokine secretion.

Purified CFSE-labeled CD4+ T cells were stimulated with immobilized anti-CD3 and cultured in the presence of anti-AITR mAbs. Unlike when cultured with anti-CD3 only, when the cells were co-cultured with anti-AITR mAbs and anti-CD3, the proliferation of activated CD4+ T cells was significantly increased (FIG. 5).

Subsequently, the culture supernatant was analyzed to identify a type of cytokine secreted depending on the type of anti-AITR mAbs. The results demonstrated that the antibodies of the present invention recognizing different sites of AITR changed the level of different cytokines. To be specific, cell treatment with a comparative antibody A27 significantly increased the level of TH1 cytokines IL-2 and IFN-γ, whereas treatment with a comparative antibody A35, unlike with A27, increased the level of TH17 cytokine IL-17A. On the other hand, cell treatment with A41 of the present invention significantly increased the level of TH2 cytokines IL-2, IL-4, and IL-5 (FIG. 4A).

In addition, the markers of phenotypic CD4+ T cells for the expression of IFN-γ, IL-17A, and IL-4 in the activated CD4+ T cells were analyzed when the CD4+ T cells were treated with the anti-AITR mAbs or AITRL of the present invention. The results show that when treated with A41 of the present invention, the number of IL-4-producing CD4+ T cells was increased (91.5±6.21%); when treated with a comparative antibody A27, the number of IFN-γ-producing CD4+ T cells was increased (90.2±0.50%); and when treated with a comparative antibody A35, the number of IL-17A-producing CD4+ T cells was increased (37.8±0.11%). Furthermore, the ligand thereof, i.e. AITRL promoted the production of IFN-γ in TH1 CD4+ T cells (FIG. 4B).

Taken together, these results demonstrate that anti-AITR mAbs of the present invention can act as a co-stimulatory signal in CD4+ T cells and promote the cell differentiation to a specific TH cell and cytokine secretion. In particular, these results support that the antibody of the present invention can induce different effects depending on the recognition sites of AITR. To be specific, as A41 antibody of the present invention recognizes the epitope of SEQ ID No.2 among many different sites of AITR in CD4+ T cell, it can differentiate the cell to produce a TH2 cell cytokine, IL-4, among different cytokines.

Experimental Example 5

Interaction Between AITR-Family Proteins and TRAF-Family Proteins and Downstream Signal Transduction

Previous studies have reported that tumor necrosis factor receptor-associated factor (TRAF) proteins are involved in activation of NF-κB and that downstream signaling molecules such as ERK1/2, JNK1/2, and p38 can be activated by TNFR family members. Also, cytoplasmic domain of AITR contains acidic residues that are conserved in mouse or human and are involved in association of AITR with TRAF protein. AITR is known to interact with TRAF1, TRAF2, and TRAF3, but not with TRAF5 and TRAF6 (Kwon B et al., J Biol Chem 274, 6056-6061, 1999; Ha, H et al., Curr Protoc Immunol. Chapter11:Unit11.9D, 2009). Hence, the present inventors investigated the type of TRAF protein that AITR interacts with when AITR is activated by the anti-AITR mAbs of the present invention in the activated CD4+ T cells.

AITR-TRAF complexes were immunoprecipitated with Protein G, from the lysate of activated CD4+ T cell by using anti-AITR mAbs and the immunoprecipitates were immunoblotted with anti-TRAF antibody and anti-AITR mAbs.

The results demonstrate that the antibodies of the present invention recognizing different sites of AITR recruit different types of TRAF protein to AITR (FIG. 7A).

That is, A41 which recognizes the epitope of SEQ ID No.2 of the present invention recruited TRAF3 and TRAF5, whereas a comparative antibody A27 which recognizes the epitope of SEQ ID No.3 of the present invention recruited TRAF1 and TRAF2 to AITR, and a comparative antibody A35 which recognizes the epitope of SEQ ID No.4 recruited TRAF6 to AITR. These results suggest that depending on the site of AITR recognized by each antibody, different cytoplasmic signaling can be induced. Furthermore, A41 of the present invention that recruits TRAF3 and TRAF5 activated p-ERK1/2, whereas a comparative antibody A27 that recruits TRAF1 and TRAF2 activated p-JNK1/2 and p-NF-κB. On the other hand, a comparative antibody A35 of the present invention which recruits TRAF6 activated p-p38 and p-NF-κB (FIGS. 7A, 7B, and 8).

T cells express NFAT1, NFAT2, and NFAT3, and NFAT proteins are essential for producing effector cytokine when TCR is activated in TH cells. T cells also play important roles in regulating TH cell differentiation. For this reason, the present inventors investigated whether NFAT1 or NFAT2 can be activated when CD4+ T cells are treated with anti-AITR mAbs of the present invention. As a result, it was found that a comparative antibody A27 recognizing the epitope of SEQ ID No.3 and A35 recognizing the epitope of SEQ ID No.4 increased the number of activated NFAT1 in a time-dependent manner. Unlike A27 and A35, A41 of the present invention increased the expression of NFAT2, but not NFAT1 (FIG. 7B).

These results suggest that AITR contains a binding domain for TRAFs or adaptor cytoplasmic molecules that can activate downstream signaling. Also, the results demonstrate that depending on the site of AITR recognized by anti-AITR mAbs, different types of TRAF proteins can be recruited, which then activates different cytoplasmic signaling pathways. Moreover, the AITR antibody specific to the epitope of SEQ ID No.2 of the present invention not only activate specific TRAF proteins, but also show specific NFAT activities. This result suggests that depending on the site of AITR recognized by AITR antibody, different NFAT translocates into the nucleus, which then induces different NFAT-dependent gene expression.

These results support that particularly A41 of the present invention recognize the epitope of SEQ ID No.2 among many sites of AITR and recruit TRAF3 and TRAF5 among many different types of TRAFs, which then induce p-ERK1/2-mediated cytoplasmic signaling pathways, thereby converting the cell to the IL-4-producing cell, wherein IL-4 is a cytokine of TH2 cell.

Experimental Example 6

Transcription Factors and STATs Protein Activated Differentiation of CD4+ T Cells with Anti-AITR mAbs

Previous studies have reported that signaling transducer and activation of transcription (STAT) proteins and master transcription factors are essential in fate determination of TH cell and cytokine production (Hermann-Kleiter, N. & Baier G, Blood. 15, 2989-2997, 2010). Hence, the present inventors investigated the activities of STAT proteins and master transcription factors in the CD4+ T cells activated by anti-AITR mAbs of the present invention.

A flow cytometric analysis was performed using the antibodies against p-STATs (p-STAT-1, p-STAT-3, p-STAT-4, p-STAT-5, and p-STAT-6) and T-bet, GATA-3, and RORγ t. As a result, compared to the group treated with anti-CD4 and IL-2 only without anti-AITR antibody, the group treated with A27 showed increased number of activated p-STAT-1 (52.8±0.25%), p-STAT-4 (54.2±0.19%), and T-bet (80.2±0.08%). The group treated with A35 showed increased number of activated p-STAT-3 (63.1±1.24%) and RORγ t (53.4±2.18%), and the group treated with A41 showed increased number of activated p-STAT-5 (85.1±0.38%), p-STAT-6 (79.2±0.12%), and GATA-3 (76.5±0.11%) (FIGS. 7C, 7D, and 9).

These results suggest that the anti-AITR mAbs of the present invention recognizing different sites of AITR can induce different signaling cascades mediated by AITR in CD4+ T cells. Especially, these results support that the A41 antibody of the present invention recognizing the epitope of SEQ ID No.2 mediates the cell fate determination of TH cell via a signaling pathway mediated by STAT-5, STAT-6, and GATA-3.

Experimental Example 7

Conversion of T Cell to TH2 Cell by Anti-AITR mAbs

Experimental Examples 5 and 6 showed that the anti-AITR mAbs of the present invention specifically binding to the epitope of SEQ ID No.2 regulate a specific signal transduction factor involved in TH cell fate determination in CD4+ T cells. That is, according to the epitope sites within AITR, T cell can be converted to a totally different type of TH cell. Hence, the present inventors hypothesized that by targeting different epitope sites recognized by anti-AITR mAbs of the present invention, functional phenotype of CD4+ T cells can be converted. To confirm this, CD4+ T cells were treated with the representative antibodies A27, A35, and A41 which recognize three different sites of AITR to determine the converting activity thereof.

The results showed that a comparative antibody A35 converted IFN-γ-producing cells (99.2±0.21%) that were initially induced by A27, a comparative antibody specific to the epitope of SEQ ID No.2, to IL-17A-producing cells (18.8±0.23%). A41 of the present invention converted IFN-γ-producing cells (99.2±0.21%) to IL-4-producing cells (38.7±0.32%). In addition, A35-induced IL-17A-producing cells (35.2±0.60%) were converted to IFN-γ-producing cells (82.6±1.21%) by a comparative antibody A27, and converted to IL-4-producing cells (70.5±0.62%) by A41 of the present invention. A41-induced IL-4-producing cells (98.2±0.29%) were converted to IFN-γ-producing cells (90.1±0.42%) by A27 antibody, and converted to IL-17A-producing cells (16.9±0.58%) by a comparative antibody A35 (FIGS. 10 and 11).

These results demonstrate that the antibody of the present invention that is specific to the AITR epitope of SEQ ID No.2 can convert the T cell to a specific cytokine-producing cell by recognizing the specific site of AITR, i.e. epitope of SEQ ID No.2 (AA 20-30). Furthermore, these results support that A41 of the present invention recognizing the epitope of SEQ ID No.2 can convert the T cell specifically to IL-4-producing TH2 cell, unlike a comparative antibody A27 that induces cell conversion to IFN-γ-producing TH1 cell, and a comparative antibody A35 that induces cell conversion to IL-17A-producing TH17 cell.

Experimental Example 8

Enhancement of Suppressive Function of CD4+CD25highFoxp3+ (Treg) Cell by Anti-AITR Antibody

It is known that GITR or AITR acts as a co-stimulatory molecule in Treg cell, and the expression thereof remains high intrinsically in Treg cell even without activation. Hence, the present inventors investigated the role of AITR in Treg cells when stimulated by anti-AITR mAbs.

First, after stimulation with anti-CD3 and IL-2, Treg cells (CD4+CD25high cells) and non-Treg cells (CD4+CD25 cells) were isolated from healthy subjects and cancer patients by FACS-sorter. Both of Treg cells isolated from healthy subjects and cancer patients showed constitutive expression of Foxp3 and AITR. Non-Treg cells showed a lower expression of AITR than in Treg cells. The number of Treg cells isolated from cancer patients was three times higher than that from healthy subjects.

Based on the results from the experimental example, it was determined whether the anti-AITR mAbs of the present invention can convert Treg cells. The results showed that A41 recognizing the epitope of SEQ ID No.2 of the present invention could not convert the Treg cells isolated from both healthy subjects and cancer patients. On the other hand, a comparative antibody A35 converted Treg cells from healthy subjects to IL-17A-producing cells (10.4±0.32%), but not the Treg cells from cancer patients. Also, another comparative antibody A27 converted the Treg cells from both healthy subjects and cancer patients to IFN-γ-producing cells (93.9±0.12% and 88.2±0.43% respectively) (FIGS. 12A, 12D, and 13B). In addition, when the secreted cytokines were analyzed, A27 and A35 decreased TGF-β secretion, but increased the secretion of IFN-γ and IL-17A. On the other hand, A41 of the present invention increased TGF-β secretion in a time-dependent manner which is involved in the suppressive function of Treg cells (FIG. 12B). These results support that A41 of the present invention which specifically recognizes the epitope of AITR of SEQ ID No.2 increases the secretion of TGF-β in Treg cells, thereby enhancing the suppressive function of Treg cells.

Furthermore, the mechanisms behind signal transduction were analyzed to investigate the reasons for inducing different effects in Treg cells. As a result, it was observed that as shown in Experimental Example 5, a comparative antibody A27 recruited TRAF1 and TRAF2 and increased the expression of NFAT1, thereby activating p-JNK1/2 and p-NF-kB signaling pathways. A35 recruited TRAF6 and activated p-p38 and p-NF-kB signaling pathways (FIGS. 7A-7D and 14A-14B). These results demonstrate that comparative antibodies A27 and A35 reduce the expression of Foxp3 but increase the expression of T-bet or RORγ t through the above signaling pathways. Through these mechanisms, a comparative antibody A27 can convert Treg cell to TH1 cell, and A35 can convert Treg cell to TH17 cell (FIGS. 9, 12C, and 15A-15B).

On the other hand, when Treg cells were treated with A41 of the present invention, it did not change the expression level of a Treg cell marker, Foxp3, in Treg cell as well as the level of GATA-3 (FIGS. 9, 12C, and 15A-15B). Also, when A41 recruited TRAF protein to AITR in Treg cells, it recruited TRAF3 more strongly than TRAF5, and activated ERK1/2, NF-kB, and STAT5, thereby inducing a signaling cascade through NFAT1 transcription factor. Therefore, it was determined that A41 of the present invention induces different signaling cascade from the antibodies recognizing other epitopes (FIGS. 9 and 14A-14B).

These results support that the antibody of the present invention recognizing the epitope of SEQ ID No.2 can enhance the suppressive function of Treg cell, through different signaling pathway from those of other epitopes.

Based on the above description, it should be understood by those skilled in the art that various alternatives to the embodiments of the invention described herein may be employed in practicing the invention without departing from the technical idea or essential features of the invention as defined in the following claims. In this regard, the above-described examples are for illustrative purposes only, and the invention is not intended to be limited by these examples. The scope of the present invention should be understood to include all of the modifications or modified form derived from the meaning and scope of the following claims or its equivalent concepts.

Claims

1. A polypeptide which is an epitope of activation-inducible tumor necrosis factor receptor (AITR), defined as an amino acid sequence represented by SEQ ID No.2, for converting T cell to type 2 helper T (TH2) cell.

2. A polynucleotide encoding the polypeptide of claim 1.