US20160076000A1
2016-03-17
14/869,218
2015-09-29
Methods of producing induced pluripotent stem (iPS) cells are provided. For example, a method of producing an iPS cell from a differentiated cell, which includes transforming the differentiated cell with a first vector comprising a nucleic acid sequence comprising a nucleic acid sequence encoding an Oct4, a nucleic acid sequence encoding a Sox2, and a nucleic acid sequence encoding a Klf4. Each of the nucleic acid sequences are separated from each other by a first and second viral 2A sequence. The method described can further comprise culturing the transformed cell under conditions that allow for the production of an iPS cell and isolating the cultured iPS cell.
Get notified when new applications in this technology area are published.
C12N5/0696 » CPC main
Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor; Animal cells or tissues; Human cells or tissues; Vertebrate cells Artificially induced pluripotent stem cells, e.g. iPS
C12N2501/602 » CPC further
Active agents used in cell culture processes, e.g. differentation; Transcription factors Sox-2
C12N2501/603 » CPC further
Active agents used in cell culture processes, e.g. differentation; Transcription factors Oct-3/4
C12N2501/604 » CPC further
Active agents used in cell culture processes, e.g. differentation; Transcription factors Klf-4
C12N2510/02 » CPC further
Genetically modified cells Cells for production
C12N2740/15043 » CPC further
Reverse transcribing RNA viruses; Details; Retroviridae; Lentivirus, not HIV, e.g. FIV, SIV; Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
C12N2800/30 » CPC further
Nucleic acids vectors Vector systems comprising sequences for excision in presence of a recombinase, e.g. loxP or FRT
A61K35/28 » CPC further
Medicinal preparations containing materials or reaction products thereof with undetermined constitution; Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells Bone marrow; Haematopoietic stem cells; Mesenchymal stem cells of any origin, e.g. adipose-derived stem cells
C12N15/86 » CPC further
Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor; Recombinant DNA-technology; Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression; Vectors or expression systems specially adapted for eukaryotic hosts for animal cells Viral vectors
This application is a divisional of U.S. application Ser. No. 13/480,753, filed May 25, 2012, which is a divisional of U.S. application Ser. No. 12/640,767, filed Dec. 17, 2009, which claims the benefit of U.S. Provisional Application No. 61/138,260, filed on Dec. 17, 2008, all of which are incorporated herein in their entireties by this reference.
This invention was made with government support under Grant No. RO1-HL057619 from the National Institutes of Health. The United States government has certain rights in this invention.
Embryonic stem (ES) cells have the ability to grow indefinitely while maintaining pluripotency and the ability to differentiate into a multitude of different cell types. Because of these two qualities, human ES cell therapies have been proposed for regenerative medicine and tissue replacement after injury or disease. However, there are ethical difficulties regarding the use of human embryos for the isolation of human ES cells as well as problems with tissue rejection following transplantation of foreign ES cells in patients.
Methods of producing induced pluripotent stem (iPS) cells are provided. For example, methods of producing an iPS cell from a differentiated cell are provided. The methods include the step of transforming the differentiated cell with a first vector comprising a nucleic acid sequence comprising a nucleic acid sequence encoding an Oct4, a nucleic acid sequence encoding a Sox2, and a nucleic acid sequence encoding a Klf4. Each of the nucleic acid sequences are separated by a first and second nucleic acid sequence encoding a viral 2A sequence.
Also provided are methods of producing an iPS cell, wherein the vector used to produce the cell is deleted from the genome of the iPS cell. For example, the methods include the step of transforming the differentiated cell with a first vector comprising a nucleic acid sequence comprising a nucleic acid sequence encoding an Oct4, a nucleic acid sequence encoding a Sox2, and a nucleic acid sequence encoding a Klf4. Each of the nucleic acid sequences are separated by a first and second nucleic acid sequence encoding a viral 2A sequence. The vector further comprises a loxP sequence. The methods further include the step of transforming the iPS cell with a second vector. The second vector comprises a nucleic acid sequence encoding a Cre recombinase. Expression of the Cre recombinase results in the deletion of the first retroviral vector from the genome of the cells.
Also provided are vectors comprising a nucleic acid sequence encoding an Oct4, a nucleic acid sequence encoding a Sox2, and a nucleic acid sequence encoding a Klf4, and cells comprising the vector. Each of the nucleic acid sequences are separated from each other by a first and second nucleic acid sequence encoding a viral 2A sequence.
Also provided are kits comprising a first vector and a second vector. The first vector comprises a nucleic acid sequence encoding an Oct4, a nucleic acid sequence encoding a Sox2, and a nucleic acid sequence encoding a Klf4. Each of the nucleic acid sequences are separated from each other by a first and second viral 2A sequence. The second vector comprises a nucleic acid sequence encoding a Cre recombinase.
Further provided are methods of treating or preventing a disease associated with a genetic mutation in a subject. The methods comprise selecting a subject with a disease associated with a genetic mutation; isolating differentiated cells from the subject; transforming the differentiated cells with a vector comprising an unmutated nucleic acid sequence of interest; culturing the transformed cells under conditions that allow for the production of a population of iPS cells; screening the iPS cells for correction of the genetic mutation; and administering the iPS cells to the subject, wherein administration of the iPS cells treats or prevents the disease associated with the genetic mutation in the subject. The vector comprises a nucleic acid sequence comprising (i) an unmutated nucleic acid sequence of interest and homologous nucleic acid sequences flanking the genetic mutation, (ii) a nucleic acid sequence encoding a Cre recombinase operably linked to an inducible promoter, (iii) a first and second loxP sequence, (iv) a nucleic acid sequence encoding an Oct4, (v) a nucleic acid sequence encoding a Sox2, and (vi) a nucleic acid sequence encoding a Klf4. Each of the nucleic acid sequences, (iv)-(vi), are separated by a first and second nucleic acid sequence encoding a viral 2A sequence.
FIGS. 1A and 1B show the Oct4, Sox2, Klf4 (OSK) lentiviral vector for reprogramming adult skin fibroblasts to iPS cells. FIG. 1A shows a diagram of the vector. FIG. 1B shows the amino acid sequence of the 2A polypeptide with a 3-amino acid GSG linker (SEQ ID NO:1)
FIGS. 2A and 2B show images of iPS cell colonies. FIG. 2A shows immunofluorescent images of iPS cell colonies stained for Nanog and SSEA1 expression. FIG. 2B shows images of iPS cell colonies stained for alkaline phosphatase expression with iPS-1 Cre1 representing a typical colony after Cre recombinase mediated deletion of the OSK vector.
FIGS. 3A and 3B show RT-PCR analysis and Bisulfite sequence analysis of isolated iPS cells. FIG. 3A shows a gel of RT-PCR assays of polycistronic OSK RNA and endogenous Oct4, Sox2, Klf4, Nanog and Cripto RNA in iPS cells from 3 independent colonies (iPS-1, iPS-2, and iPS-3) and from iPS-1 cells post Cre recombinase mediated deletion of the OSK lentiviral vector (iPS-1 Cre1). FIG. 3B shows bisulfite sequencing of the endogenous and Oct4 and Nanog promoters in iPS-1, iPS-2, and iPS-1 Cre1 cells. Filled circles represent methylated CpGs and open circles represent unmethylated CpGs.
FIGS. 4A and 4B show a vector map and Southern blot hybridization of iPS-1 cellular DNA. FIG. 4A shows a map of the OSK vector pre- and post-Cre expression. K represents KpnI cleavage sites. The probe binding site is shown. FIG. 4B shows a Southern Blot demonstrating that iPS-1 cells contain 4 copies of the OSK lentiviral vector, and iPS-1 Cre1 cells contain no copies of the vector after transient Cre expression.
FIGS. 5A-5C show teratomas and chimeras derived from iPS cells. FIG. 5A shows teratomas containing tissue derived from all three germ layers in NOD/SCID IL-2 γR−/−mice injected with isolated iPS cells. a, intestine-like epithelium, with pancreatic acini in iPS-3 teratoma; b, respiratory epithelium; c, skeletal muscle; d, bone, with hyaline cartilage in iPS-2 teratoma; e, nervous tissue; f, skin-like stratified squamous epithelium. FIG. 5B shows chimeric embryos that were obtained following injection of iPS-1 Cre1 and iPS-1 Cre2 cells into wild type blastocysts. The top panel is a gel showing PCR products demonstrating chimeric embryos as iPS cells contain the human β-globin gene as a marker. FIG. 5C shows an adult chimeric animal (right) compared to an adult non-chimeric littermate (left).
FIGS. 6A and 6B show a vector map and Southern blot hybridization of iPS-1 and iPS-2 cellular DNA after OSK vector deletion. FIG. 6A shows a map of the OSK vector pre- and post-Cre expression. The probe binding site is shown. FIG. 6B shows a Southern blot demonstrating that iPS-1 Cre cells contain 4 insertion sites and iPS-2 Cre cells contain 3 insertion sites.
FIGS. 7A-G show the nucleotide (SEQ ID NO:7 for top strand and SEQ ID NO:8 for bottom strand) and amino acid (SEQ ID NO:9) sequences of the polycistron encoded by the vector. Underlined and labeled are primers used to create the polycistron. The Oct4, Sox2, Klf4 and PTV1 2A sequences are denoted.
FIG. 8 shows a brightfield image of an iPS cell colony derived from human keratinocytes using a polycistronic lentiviral vector.
FIG. 9 shows a schematic of a method to correct a β-globin mutation found in sickle cell disease with concomitant formation of iPS cells. The βs-globin locus is depicted at the top of the figure. The βs-globin locus has a single nucleotide, A to T transversion in the first exon. The targeting vector is depicted in the middle of the figure. The vector contains the normal GAG codon in the first exon flanked by sequences to effect homologous recombination. A herpes simplex virus thymidine kinase (HSV tk) gene is located outside of the sequences used to effect homologous recombination. Integrated between the homology arms is a floxed cassette (loxP site on either side of cassette) consisting of a Nanog-responsive (NBS) thymidine kinase (TK) promoter driving expression of Cre recombinase and the EF1α promoter driving expression of the Oct4-Sox2-Klf4 polycistronic sequence. The dashed lines show where the homologous recombination occurs. After homologous recombination occurs, the endogenous Nanog gene is expressed. Nanog binds to the NBS sites and forces Cre recombinase expression. Cre recombinase excises the floxed cassette and leaves behind a correct β-globin locus with a single loxP site in between exons 2 and 3 of β-globin.
A number of studies have been published detailing the production of induced pluripotent stem (iPS) cells from differentiated, embryonic and adult, mammalian cells (Takahashi and Yamanaka, Cell 1126:663-76 (2006); Meissner et al., Nat. Biotech. 25(10):1177-81 (2007); Takahashi et al., Cell 131:861-72 (2007); and Park et al., Nature 451:141-7 (2008)). In each of these publications, four transcription factors, Oct-3/4, Sox2, Klf4, and c-Myc, were introduced to the differentiated cells through retroviral transduction to produce iPS cells from differentiated somatic cells. Alternatively, it was found that another combination of factors, which include Oct-3/4, Sox2, Nanog, and Lin28, were capable of reprogramming somatic cells to iPS cells that exhibit the essential characteristics of embryonic stem (ES) cells (Yu et al., Science 18:1917-20 (2007)).
Oct4 and Sox2 are core transcription factors that function in the maintenance of pluripotency in early embryos and embryonic stem (ES) cells (Nichols et al., Cell 95:379-391 (1998); Niwa et al., Nat. Genet. 24:372-6 (2000); and Avilion et al., Gene Dev. 17:126-40 (2003)). Klf4 has been shown to contribute to the long-term maintenance of the ES cell phenotype and the rapid proliferation of ES cells in culture (Li et al., Blood 105:635-7 (2005)). Nanog is a transcription factor that is important in early development and stem cell pluripotency as it activates ES cell critical factors and represses differentiation-promoting genes (Wang et al., Proc. Natl. Acad. Sci. USA 105:6326-31 (2008)). Lin28 is a marker of undifferentiated human embryonic stem cells and has been shown to bind mRNAs in the cytoplasm as well as block the production of mature let-7 microRNA in mouse embryonic stem cells (Balzer and Moss, RNA Biology 4:16-25 (2007); Viswanathan et al., Science 320:97-100 (2008)). The c-Myc protein is also a transcription factor, as well as a tumor-related factor, and has many targets that enhance proliferation and transformation (Adhikary and Eilers, Nat. Rev. Mol. Cell. Bio. 6:635-45 (2005)) with many of these downstream targets potentially having roles in the generation of iPS cells. Additionally, c-Myc may globally induce histone acetylation (Fernandez et al., Genes Dev. 17:1115-29 (2003)), to allow other transcription factors to bind to their specific target loci. In the case of iPS cell production, expression of c-Myc would result in histone acetylation, thus allowing Oct3/4 and Sox2 to target the genes necessary to create a stem cell-like cell.
The use of retroviruses to incorporate Oct3/4, Sox2, Klf4, and c-Myc into the cells is both advantageous and deleterious. The advantages of using a retrovirus is that the virus integrates into the genome of the cell and thus is genetically transferred to the progeny when the cell undergoes cell division. This allows for the continued expression of these factors as differentiated cells undergo the transition to an iPS cell. In spite of these advantages, Takahashi et al. found that each iPS clone contained three to six retroviral integrations for each factor, creating the possibility of more than 20 retroviral integration sites per iPS clone, which increases the risk of tumorigenesis (Takahashi et al., Cell 131:861-72 (2007)). In fact, approximately 20% of mice derived from iPS cells developed tumors. This was attributable, at least in part, to the reactivation of the c-Myc retrovirus (Okita et al., Nature 448:313-7 (2007)).
The methods and compositions provided herein are designed to produce iPS cells that reduce the risk of insertional mutagenesis by allowing for the removal or deletion of vectors once the iPS cells have been generated or by using vectors that do not integrate into the cellular genome.
As used herein, the term induced pluripotent stem (iPS) cell encompasses any cell that has been reprogrammed to phenotypically resemble a pluripotent stem cell. An iPS cell is derived from a non-pluripotent cell but is capable of reproducing itself. An iPS cell is also capable of terminal differentiation into a cell-type normally found in the relevant system, tissue, or organ. An iPS cell is similar to an ES cell in morphology, proliferation, and pluripotency. For example, an iPS cell and an ES cell express the same markers. Examples of these markers include Oct3/4, Nanog, E-Ras, Cripto, Dax1, Fgf4, stage-specific embryonic antigen 1 (SSEA1), SSEA3, SSEA4, alkaline phosphatase, tumor-related antigen (TRA)-1-60, TRA-1-81, and Zfp296.
Provided herein are vectors for producing iPS cells. Thus, provided herein is a first vector comprising a nucleic acid sequence encoding an Oct4, a nucleic acid sequence encoding a Sox2, and a nucleic acid sequence encoding a Klf4. Each of the nucleic acid sequences are separated by a first and second nucleic acid sequence encoding a viral 2A sequence. The first nucleic acid sequence encoding a viral 2A sequence is the same as or different from the second nucleic acid sequence encoding a viral 2A sequence. Optionally, the first vector comprises SEQ ID NO:7. Optionally, the first vector comprises a nucleic acid sequence encoding SEQ ID NO:9. Optionally, the first vector comprises SEQ ID NO:43. The vector comprising SEQ ID NO:43 was deposited with the American Type Culture Collection, 10801 University Boulevard, Manassas, Va. 20110-2209 in accordance with the Budapest Treaty on Oct. 6, 2009, and has accession number PTA-10385.
Optionally, Oct4, Sox2, and Klf4 are human. Optionally, Oct4, Sox2, and Klf4 are non-human (e.g., rodent, canine, or feline). There are a variety of sequences that are disclosed on Genbank, at www.pubmed.gov and these sequences and others are herein incorporated by reference in their entireties as are individual subsequences or fragments contained therein. As used herein, Oct4 refers to the Oct4 transcription factor and homologs, variants, and isoforms thereof. For example, the nucleotide and amino acid sequences of human Oct4 can be found at GenBank Accession Nos. BC 117435 and AAI17436.1, respectively. Optionally, the nucleotide and amino acid sequences of human Oct4 isoform 1 can be found at GenBank Accession Nos. NM—002701.4 and NP—002692.2, respectively. The nucleotide and amino acid sequences for human Oct4 isoform 2 can be found at GenBank Accession Nos. NM—203289.3 and NP—976034.3, respectively. As used herein, Sox2 refers to the Sox2 transcription factor and homologs, variants, and isoforms thereof. The nucleotide and amino acid sequences of human Sox2 can be found at GenBank Accession Nos. BC013923 and AAH13923.1, respectively. Optionally, the nucleotide and amino acid sequences of human Sox2 can be found at GenBank Accession Nos. NM—003106.2 and NP—003097.1, respectively. As used herein, Klf4 refers to the Klf4 transcription factor and homologs, variants, and isoforms thereof. The nucleotide and amino acid sequences of human Klf4 can be found at GenBank Accession Nos. BC029923 and AAH29923.1, respectively. Optionally, the nucleotide and amino acid sequences of human Klf4 can be found at GenBank Accession Nos. NM—004235.4 and NP—004226.3, respectively. Thus provided are the nucleotide sequences of Oct4, Sox2, and Klf4 comprising a nucleotide sequence at least about 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% or more identical to the nucleotide sequence of the aforementioned GenBank Accession Numbers. Also provided are amino acid sequences of Oct4, Sox2, and Klf4 comprising an amino acid sequence at least about 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% or more identical to the sequences of the aforementioned GenBank Accession Numbers.
Nucleic acids that encode the polypeptide sequences, variants, and fragments thereof are disclosed. These sequences include all degenerate sequences related to a specific protein sequence, i.e., all nucleic acids having a sequence that encodes one particular protein sequence as well as all nucleic acids, including degenerate nucleic acids, encoding the disclosed variants and derivatives of the protein sequences. Thus, while each particular nucleic acid sequence may not be written out herein, it is understood that each and every sequence is in fact disclosed and described herein through the disclosed protein sequences.
As used herein, the term peptide, polypeptide or protein is used to mean a molecule comprised of two or more amino acids linked by a peptide bond. Protein, peptide, and polypeptide are also used herein interchangeably to refer to amino acid sequences. It should be recognized that the term polypeptide or protein is not used herein to suggest a particular size or number of amino acids comprising the molecule and that a polypeptide of the disclosure can contain up to several amino acid residues or more.
As with all peptides, polypeptides, and proteins, including fragments thereof, it is understood that additional modifications in the amino acid sequence of the variant Oct4, Sox2, and Klf4 polypeptides can occur that do not alter the nature or function of the peptides, polypeptides, or proteins. Such modifications include conservative amino acids substitutions and are discussed in greater detail below.
The polypeptides provided herein have a desired function. Oct4 and Sox2 are core transcription factors that regulate the expression of a defined set of target genes to maintain the pluripotency associated with ES cells. Klf4 is a transcription factor that regulates the expression of a defined set of target genes to maintain the long-term ES cell phenotype as well as to drive the proliferation of ES cells. The polypeptides are tested for their desired activity using the in vitro assays described herein.
The polypeptides described herein can be further modified and varied so long as the desired function is maintained. It is understood that one way to define any known modifications and derivatives or those that might arise, of the disclosed genes and proteins herein is through defining the modifications and derivatives in terms of identity to specific known sequences. Specifically disclosed are polypeptides which have at least 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83 , 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 percent identity to Oct4, Sox2, and Klf4 and variants provided herein. Those of skill in the art readily understand how to determine the identity of two polypeptides. For example, the identity can be calculated after aligning the two sequences so that the identity is at its highest level.
Another way of calculating identity can be performed by published algorithms. Optimal alignment of sequences for comparison may be conducted by the local identity algorithm of Smith and Waterman, Adv. Appl. Math 2:482 (1981), by the identity alignment algorithm of Needleman and Wunsch, J. Mol. Biol. 48:443 (1970), by the search for similarity method of Pearson and Lipman, Proc. Natl. Acad. Sci. USA 85:2444 (1988), by computerized implementations of these algorithms (GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group, 575 Science Dr., Madison, Wis.), or by inspection.
The same types of identity can be obtained for nucleic acids by, for example, the algorithms disclosed in Zuker, Science 244:48-52 (1989); Jaeger et al., Proc. Natl. Acad. Sci. USA 86:7706-10 (1989); Jaeger et al., Methods Enzymol. 183:281-306 (1989), which are herein incorporated by reference for at least material related to nucleic acid alignment. It is understood that any of the methods typically can be used and that in certain instances the results of these various methods may differ, but the skilled artisan understands if identity is found with at least one of these methods, the sequences would be said to have the stated identity and to be disclosed herein.
Protein modifications include amino acid sequence modifications. Modifications in amino acid sequence may arise naturally as allelic variations (e.g., due to genetic polymorphism), may arise due to environmental influence (e.g., by exposure to ultraviolet light), or may be produced by human intervention (e.g., by mutagenesis of cloned DNA sequences), such as induced point, deletion, insertion, and substitution mutants. These modifications can result in changes in the amino acid sequence, provide silent mutations, modify a restriction site, or provide other specific mutations. Amino acid sequence modifications typically fall into one or more of three classes: substitutional, insertional, or deletional modifications. Insertions include amino and/or terminal fusions as well as intrasequence insertions of single or multiple amino acid residues. Insertions ordinarily will be smaller insertions than those of amino or carboxyl terminal fusions, for example, on the order of one to four residues. Deletions are characterized by the removal of one or more amino acid residues from the protein sequence. Typically, no more than about from 2 to 6 residues are deleted at any one site within the protein molecule. Amino acid substitutions are typically of single residues, but can occur at a number of different locations at once; insertions usually will be on the order of about from 1 to 10 amino acid residues; and deletions will range about from 1 to 30 residues. Deletions or insertions preferably are made in adjacent pairs, i.e., a deletion of 2 residues or insertion of 2 residues. Substitutions, deletions, insertions or any combination thereof may be combined to arrive at a final construct. The mutations must not place the sequence out of reading frame and preferably will not create complementary regions that could produce secondary mRNA structure. Substitutional modifications are those in which at lease one residue has been removed and a different residues inserted in its place. Such substitutions generally are made in accordance with the following Table 1 and are referred to as conservative substitutions.
| TABLE 1 |
| Amino Acid Substitutions |
| Substitutions | ||
| Amino Acid | (others are known in the art) | |
| Ala | Ser, Gly, Cys | |
| Arg | Lys, Gln, Met, Ile | |
| Asn | Gln, His, Glu, Asp | |
| Asp | Glu, Asn, Gln | |
| Cys | Ser, Met, Thr | |
| Gln | Asn, Lys, Glu, Asp | |
| Glu | Asp, Asn, Gln | |
| Gly | Pro, Ala | |
| His | Asn, Gln | |
| Ile | Leu, Val, Met | |
| Leu | Ile, Val, Met | |
| Lys | Arg, Gln, Met, Ile | |
| Met | Leu, Ile, Val | |
| Phe | Met, Leu, Tyr, Trp, His | |
| Ser | Thr, Met, Cys | |
| Thr | Ser, Met, Val | |
| Trp | Tyr, Phe | |
| Tyr | Trp, Phe, His | |
| Val | Ile, Leu, Met | |
Modifications, including the specific amino acid substitutions, are made by known methods. By way of example, modifications are made by site specific mutagenesis of nucleotides in the DNA encoding the protein, thereby producing DNA encoding the modification, and thereafter expressing the DNA in recombinant cell culture. Techniques for making substitution mutations at predetermined sites in DNA having a known sequence are well known, for example M13 primer mutagenesis and PCR mutagenesis.
Optionally, the vector comprises its various components in any order. Examples include from the 5′ end, a nucleic acid sequence encoding a first polypeptide, the first nucleic acid encoding a viral 2A sequence, a nucleic acid encoding a second polypeptide, the second nucleic acid sequence encoding a viral 2A sequence, and a nucleic acid sequence encoding a third polypeptide. The first nucleic acid sequence encoding a viral 2A sequence is the same as or different from the second nucleic acid sequence encoding a viral 2A sequence. The first, second, and third polypeptides are selected from the group consisting of Oct4, Sox2, and Klf4, and the first, second, and third polypeptides are different from each other. Thus, for example, the first polypeptide is Oct4, the second polypeptide is Sox2, and the third polypeptide is Klf4. By way of another example, the first polypeptide is Sox2, the second polypeptide is Oct4, and the third polypeptide is Klf4.
The vector comprises in order from the 5′ end, a nucleic acid sequence encoding an Oct4, a first nucleic acid sequence encoding a viral 2A sequence, a nucleic acid sequence encoding a Sox2, a second nucleic acid sequence encoding a viral 2A sequence, and a nucleic acid sequence encoding a Klf4. Optionally, the vector comprises in order from the 5′ end, a nucleic acid sequence encoding an Oct4, a first nucleic acid sequence encoding a viral 2A sequence, a nucleic acid sequence encoding a Klf4, a second nucleic acid sequence encoding a viral 2A sequence, and a nucleic acid sequence encoding a Sox2. Optionally, the vector comprises in order from the 5′ end, a nucleic acid sequence encoding a Sox2, a first nucleic acid sequence encoding a viral 2A sequence, a nucleic acid sequence encoding an Oct4, a second nucleic acid sequence encoding a viral 2A sequence, and a nucleic acid sequence encoding a Klf4. Optionally, the vector comprises in order from the 5′ end, a nucleic acid sequence encoding a Sox2, a first nucleic acid sequence encoding a viral 2A sequence, a nucleic acid sequence encoding a Klf4, a second nucleic acid sequence encoding a viral 2A sequence, and a nucleic acid sequence encoding an Oct4. Optionally, the vector comprises in order from the 5′ end, a nucleic acid sequence encoding a Klf4, a first nucleic acid sequence encoding a viral 2A sequence, a nucleic acid sequence encoding an Oct4, a second nucleic acid sequence encoding a viral 2A sequence, and a nucleic acid sequence encoding a Sox2. Optionally, the vector comprises in order from the 5′ end, a nucleic acid sequence encoding a Klf4, a first nucleic acid sequence encoding a viral 2A sequence, a nucleic acid sequence encoding a Sox2, a second nucleic acid sequence encoding a viral 2A sequence, and a nucleic acid sequence encoding an Oct4.
A common strategy of positive-strand RNA viruses is to encode some, or all, of their proteins in the form of a polyprotein translated from one RNA molecule. Viruses have adapted multiple methods to allow for the production of individual protein molecules from a polyprotein. In the case of picornaviruses, all of the proteins are encoded in a single open reading frame. The picornaviral polyproteins undergo a cleavage event between the major domains of the viral genome, which are separated by viral 2A sequences. Viral 2A sequences allow for the translation of multiple polypeptides in a multicistronic RNA molecule by stimulating peptide cleavage between the polypeptides without disengaging the ribosome. The use of viral 2A sequences to produce multiple proteins from a multicistronic message is known, see, e.g., Donnelly et al., J. Gen. Virol. 82:1013-25 (2001); Donnelly et al., J. Gen. Virol. 82:1027-41 (2001); Chinnasamy et al., Virol. J. 3:14 (2006); Holstet al., Nat. Protoc. 1(1):406-17 (2006); and Szymczak et al., Nat. Biotechnol. 22(5):589-94 (2004).
Optionally, the first and second nucleic acid sequences encoding a viral 2A sequence is a picornaviral, a tetraviral 2A sequence, or a combination thereof. Optionally, the picornaviral 2A sequences are selected from the group consisting of the Enteroviral 2A sequences, Rhinoviral 2A sequences, Cardioviral 2A sequences, Aphthoviral 2A sequences, Hepatoviral 2A sequences, Erboviral 2A sequences, Kobuviral 2A sequences, Teschoviral 2A sequences, and the Parechoviral 2A sequences. Optionally, the tetraviral 2A sequences are selected from Betatetraviral 2A sequences or Omegatetraviral 2A sequences. Optionally, the first and second nucleic acid sequences encoding a viral 2A sequence are picornaviral 2A sequences. Optionally, the first and second nucleic acid sequence encoding a viral 2A sequence is a Teschoviral 2A sequence. Optionally, the first nucleic acid sequence encoding a viral 2A sequence is a Cardioviral 2A sequence, and the second nucleic acid sequence encoding a viral 2A sequence is a Hepatoviral 2A sequence. Optionally, the first and second nucleic acid sequences encoding a viral 2A sequence are tetraviridae 2A sequences. Optionally, the first and second nucleic acid sequences encoding a viral 2A sequence is a Betatetraviral 2A sequence. Optionally, the first nucleic acid sequence encoding a viral 2A sequence is a Betatetraviral 2A sequence, and the second nucleic acid sequence encoding a viral 2A sequence is an Omegatetraviral 2A sequence. Optionally, the first nucleic acid sequence encoding a viral 2A sequence is a picornaviral 2A sequence, and the second nucleic acid sequence encoding a viral 2A sequence is a tetraviridae 2A sequence. Optionally, the first nucleic acid sequence encoding a viral 2A sequence is a Teschoviral 2A sequence, and the second nucleic acid sequence encoding a viral 2A sequence is a Betatetraviral 2A sequence. Optionally, the first nucleic acid sequence encoding a viral 2A sequence is a tetraviridae 2A sequence, and the second nucleic acid sequence encoding a viral 2A sequence is a picornaviral 2A sequence. Optionally, the first nucleic acid sequence encoding a viral 2A sequence is a Betatetraviral 2A sequence, and the second nucleic acid sequence encoding a viral 2A sequence is a Teschoviral 2A sequence. Optionally, the first and second nucleic acid sequences encoding a viral 2A sequence comprise a nucleic acid sequence encoding the amino acid sequence ATNFSLLKQAGDVEENPGP (SEQ ID NO:2). Optionally, the first and second nucleic acid sequences encoding a viral 2A sequence comprise a nucleic acid sequence encoding the amino acid sequence EGRGSLLTCGDVEENPGP (SEQ ID NO:3). Optionally the first nucleic acid sequence encoding a viral 2A sequence comprises a nucleic acid sequence encoding the amino acid sequence ATNFSLLKQAGDVEENPGP (SEQ ID NO:2), and the second nucleic acid sequence encoding a viral 2A sequence comprises a nucleic acid sequence encoding the amino acid sequence EGRGSLLTCGDVEENPGP (SEQ ID NO:3).
Optionally the first and second nucleic acid sequences encoding a viral 2A sequence comprises a nucleic acid sequence encoding an amino acid linker. The amino acid linker can be 1 to 10 amino acids in length. The amino acid linker can be 1 to 5 amino acids in length. The amino acid linker can be 1 to 3 amino acids in length. The amino acid linker is preferably 3 amino acids in length. The amino acid linker is, for example, GSG (SEQ ID NO:4). Optionally the first and second nucleic acid sequences encoding a viral 2A sequence with an amino acid linker comprise a nucleic acid sequence encoding the amino acid sequence GSGATNFSLLKQAGDVEENPGP (SEQ ID NO:1). Optionally the first and second nucleic acid sequences encoding a viral 2A sequence with an amino acid linker comprise a nucleic acid sequence encoding the amino acid sequence GSGEGRGSLLTCGDVEENPGP (SEQ ID NO:5).
The provided vector, for example, can be a retroviral vector. Retroviral vectors are able to integrate efficiently into the genomic DNA of cells. Integration into the genomic DNA allows for the continuous expression of the transgene and additionally allows for the transmission of the transgene to progeny cells when the cells divide. Another advantage of retroviral vectors is that they have the ability of being able to transduce a wide range of cell types from different animal species. Examples of retroviral vectors are known. See, e.g., Coffin et al., Retorviruses, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (1997).
Optionally, the retroviral vector is a lentiviral vector. Lentiviral vectors are capable of infecting non-dividing cells. Optionally, the lentiviral vector is a lentiviral self-inactivating (SIN) vector. Lentiviral SIN vectors overcome the risk of activating cellular oncogenes when they are randomly integrated into the host genome. The lentiviral SIN vector is generated by deleting viral enhancer and promoter sequences within the vector, so that integration into the genome does not result in the activation of cellular oncogenes driven by the viral promoter and enhancer sequences. Methods of making and using the lentiviral SIN vectors are known. See, e.g., Miyoshi et al., J. Virol. 72(10):8150-7 (1998) and Zufferey et al., J. Virol. 72(12):9873-80 (1998).
Optionally, the retroviral vector contains a loxP sequence (e.g., ATAACTTCGTATAATGTATGCTATACGAAGTTAT (SEQ ID NO:6)). The loxP nucleic acid sequence is generally a 34 base pair nucleic acid sequence derived from Bacteriophage P1 that is used in combination with Cre recombinase to allow for site specific recombination. When a nucleic acid sequence contains a loxP sequence, the location of the loxP sequence is referred to as a loxP site. Usually, a nucleic acid sequence contains two loxP sites. The loxP sites are located on either side of a nucleic acid sequence to be removed from, for example, the genome of a cell. Expression of Cre recombinase in the cell promotes a recombination event that results in the deletion of the genomic DNA that is present in between the loxP sites. Specifically, the Cre recombinase binds and catalyzes the cleavage and strand exchange of DNA at two loxP sites, excising the nucleic acid between the loxP sites, and leaving a single loxP site in the genome. Examples of the Cre/lox system are known. See, e.g., Sauer, Methods 14(4):381-92 (1998); Florin et al., Genesis 38(3):139-44; and Schnutgen et al., Nat. Biotechnol. 21(5):562-5 (2003).
Optionally, the loxP sequence is located in the 3′ long terminal repeat of the vector. Retroviral integration into the genome of a cell occurs in a three part process. First the retroviral RNA is reverse transcribed by a virally encoded RNA reverse transcriptase to form a RNA-DNA hybrid helix. The reverse transcriptase uses the newly synthesized DNA as a template to synthesize the complementary DNA, while degrading the RNA template. The resulting DNA duplex is integrated into the genome of the cell with the loxP sequence in the 3′ long terminal repeat of the retroviral vector copied into the 5′ long terminal repeat during reverse transcription and then integrated into the genome. This provides a loxP sequence at either end of the integrated lentiviral vector; therefore, making it possible to remove the integrated retroviral vector by expression of Cre recombinase. Optionally, provided is a second vector comprising a nucleic acid encoding a Cre recombinase. Expression of the Cre recombinase results in the deletion of the first vector from the genome of the iPS cells.
Optionally, the vector is designed to correct a genetic mutation associated with a disease and to produce induced pluripotent stem (iPS) cells. The vector comprises a nucleic acid sequence comprising (i) a nucleic acid sequence encoding an Oct4, (ii) a nucleic acid sequence encoding a Sox2, and (iii) a nucleic acid sequence encoding a Klf4. Each of the nucleic acid sequences, (i)-(iii), are separated by a first and second nucleic acid sequence encoding a viral 2A sequence. The first nucleic acid sequence encoding a viral 2A sequence is the same as or different from the second nucleic acid sequence encoding a viral 2A sequence. The vector further comprises an unmutated nucleic acid sequence of interest and homologous nucleic acid sequences flanking the genetic mutation. An unmutated nucleic acid sequence of interest is a nucleic acid sequence lacking the genetic mutation associated with the disease. Optionally, the unmutated nucleic acid sequence of interest comprises the nucleic acid sequence encoding β-globin. Optionally, the vector further comprises a first and second loxP sequence. Optionally, the vector further comprises a nucleic acid sequence encoding a Cre recombinase operably linked to an inducible promoter. The inducible promoter, for example, can comprise a Nanog-responsive thymidine kinase promoter. Optionally, the vector can comprise a selectable marker. Optionally, the vector comprises SEQ ID NO:44.
Optionally, the nucleic acid comprising a nucleic acid sequence encoding an Oct4, a nucleic acid sequence encoding a Sox2, and a nucleic acid sequence encoding a Klf4, wherein the nucleic acid sequences are separated by a first and second nucleic acid sequence encoding a viral 2A sequence is administered by another type of vector comprising the nucleic acid. The vector based delivery is largely broken down into two classes: viral based delivery systems and non-viral based delivery systems. Such methods are known in the art and are readily adaptable for use with the methods described herein.
Provided herein are viral based expression vectors comprising the disclosed nucleic acid. Viral based delivery systems can, for example, include Adenoviral vectors, Adeno-associated viral vectors, Herpes viral vectors, Vaccinia viral vectors, Polio viral vectors, Sindbis viral vectors, and any other RNA viral vectors. Also useful are any viral families that share the properties of these listed viruses and vectors that make them suitable for use as vectors. The construction of replication-defective adenoviruses has been described (Berkner et al., J. Virology 61:1213-20 (1987); Massie et al., Mol. Cell. Biol. 6:2872-83 (1986); Haj-Ahmad et al., J. Virology 57:267-74 (1986); Davidson et al., J. Virology 61:1226-39 (1987); Zhang et al., BioTechniques 15:868-72 (1993)). The viral vectors are limited in the extent to which they can spread to other cell types, since they can replicate within an initial infected cell but are unable to form new infectious viral particles. Recombinant adenoviruses have been shown to achieve high efficiency after direct, in vivo delivery to airway epithelium, hepatocytes, vascular endothelium, CNS parenchyma and a number of other tissue sites. Other useful systems include, for example, replicating and host-restricted non-replicating vaccinia virus vectors.
Provided herein are also non-viral based expression vectors comprising the disclosed nucleic acids. Suitable vector backbones include, for example, plasmids, artificial chromosomes, BACs, YACs, or PACs. Numerous vectors and expression systems are commercially available from such corporations as Novagen (Madison, Wis.), Clonetech (Palo Alto, Calif.), Stratagene (La Jolla, Calif.), and Invitrogen/Life Technologies (Carlsbad, Calif.). Vectors typically contain one or more regulatory regions. Regulatory regions include, without limitation, promoter sequences, enhancer sequences, response elements, protein recognition sites, inducible elements, protein binding sequences, 5′ and 3′ untranslated regions (UTRs), transcriptional start sites, termination sequences, polyadenylation sequences, and introns.
Any of the vectors provided herein can have a promoter sequence that drives the expression of the nucleic acid sequence comprising a nucleic acid sequence encoding a an Oct4, a nucleic acid sequence encoding a Sox2, and a nucleic acid sequence encoding a Klf4. Each of the nucleic acid sequences are separated from each other by a first and second viral 2A sequence. The first viral 2A sequence is the same as or different from the second viral 2A sequence. Preferred promoters controlling transcription from vectors in mammalian host cells may be obtained from various sources, for example, the genomes of viruses such as polyoma, Simian Virus 40 (SV40), adenovirus, retroviruses, hepatitis B virus and most preferably cytomegalovirus, or from heterologous mammalian promoters, e.g. beta actin promoter or EF1 promoter, or from hybrid or chimeric promoters (e.g., cytomegalovirus promoter fused to the beta actin promoter). The early and late promoters of the SV40 virus are conveniently obtained as an SV40 restriction fragment which also contains the SV40 viral origin of replication. The immediate early promoter of the human cytomegalovirus is conveniently obtained as a HindIII E restriction fragment. Of course, promoters from the host cell or related species also are useful herein.
The promoter can be an inducible promoter (e.g. chemically or physically regulated promoter). A chemically regulated promoter can, for example, be regulated by the presence of alcohol, tetracycline, a steroid, or a metal. A physically regulated promoter can, for example, be regulated by environmental factors, such as temperature and light. The promoter can be a cell type specific promoter (e.g. neuronal-specific, renal-specific, cardio-specific, liver-specific, or muscle-specific). A cell-type specific promoter is only expressed in the cell-type in which it is intended to be expressed. The promoter can be a promoter that is expressed independent of cell type. Examples of promoters that can be expressed independent of cell type include the cytomegalovirus (CMV) promoter, the Raus sarcoma virus (RSV) promoter, the adenoviral E1A promoter, and the EF-la promoter. The promoter is preferably the EF-la promoter.
Enhancer generally refers to a sequence of DNA that functions at no fixed distance from the transcription start site and can be either 5′ or 3′ to the transcription unit. Furthermore, enhancers can be within an intron as well as within the coding sequence itself. They are usually between 10 and 300 base pairs in length, and they function in cis. Enhancers usually function to increase transcription from nearby promoters. Enhancers can also contain response elements that mediate the regulation of transcription. While many enhancer sequences are now known from mammalian genes (globin, elastase, albumin, fetoprotein and insulin), typically one will use an enhancer from a eukaryotic cell virus for general expression. Preferred examples are the SV40 enhancer on the late side of the replication origin, the cytomegalovirus early promoter enhancer, the polyoma enhancer on the late side of the replication origin, and adenovirus enhancers.
The vectors also can include, for example, origins of replication, scaffold attachment regions (SARs), and/or markers. A marker gene can confer a selectable phenotype, e.g., antibiotic resistance, on a cell. This marker product is used to determine if the gene has been delivered to the cell and once delivered is being expressed. Examples of marker genes include the E. coli lacZ gene, which encodes B galactosidase, green fluorescent protein (GFP), and luciferase. Examples of suitable selectable markers for mammalian cells are dihydrofolate reductase (DHFR), thymidine kinase, neomycin, neomycin analog G418, hygromycin, blasticidin, and puromycin. When such selectable markers are successfully transferred into a mammalian host cell, the transformed mammalian host cell can survive if placed under selective pressure. In addition, an expression vector can include a tag sequence designed to facilitate manipulation or detection (e.g., purification or localization) of the expressed polypeptide. Tag sequences, such as green fluorescent protein (GFP), glutathione S-transferase (GST), polyhistidine, c-myc, hemagglutinin, or FLAGâ„¢ tag (Kodak, New Haven, Conn.) sequences typically are expressed as a fusion with the encoded polypeptide. Such tags can be inserted anywhere within the polypeptide, including at either the carboxyl or amino terminus.
Provided herein are methods for the production of iPS cells from differentiated cells. The methods include transforming the differentiated cell with a first vector comprising a nucleic acid sequence comprising a nucleic acid sequence encoding an Oct4, a nucleic acid sequence encoding a Sox2, and a nucleic acid sequence encoding a Klf4. Each of the nucleic acid sequences are separated by a first and second nucleic acid sequence encoding a viral 2A sequence. The first nucleic acid sequence encoding a viral 2A sequence can be the same as or different from the second nucleic acid sequence encoding a viral 2A sequence. Optionally, the method further includes transforming the differentiated cell with a second vector comprising a nucleic acid sequence encoding a c-Myc. Optionally, the first vector comprises a nucleic acid sequence comprising a nucleic acid sequence encoding an Oct4, a nucleic acid sequence encoding a Sox2, a nucleic acid sequence encoding a Klf4, and a nucleic acid sequence encoding a c-Myc. Each of the nucleic acid sequences are separated by a first, second, and third nucleic acid sequence encoding a viral 2A sequence. The first nucleic acid sequence encoding a viral 2A sequence can be the same as or different from the second nucleic acid sequence encoding a viral 2A sequence. The second nucleic acid sequence encoding a viral 2A sequence can be the same as or different from the third nucleic acid sequence encoding a viral 2A sequence. Optionally, the first vector comprises a nucleic acid sequence comprising a nucleic acid sequence encoding an Oct4, a nucleic acid sequence encoding a Sox2, and a nucleic acid sequence encoding a Nanog, wherein the nucleic acid sequences are each separated by a first and second nucleic acid sequence encoding a viral 2A sequence. The first nucleic acid sequence encoding a viral 2A sequence can be the same as or different from the second nucleic acid encoding a viral 2A sequence. The method further includes transforming the differentiated cell with a second vector comprising a nucleic acid sequence encoding a Lin28. Optionally, the first vector comprises a nucleic acid sequence comprising a nucleic acid sequence encoding an Oct4, a nucleic acid sequence encoding a Sox2, a nucleic acid sequence encoding a Nanog, and a nucleic acid sequence encoding a Lin28. Each of the nucleic acid sequences are separated by a first, second, and third nucleic acid sequence encoding a viral 2A sequence. The first nucleic acid sequence encoding a viral 2A sequence can be the same as or different from the second nucleic acid sequence encoding a viral 2A sequence. The second nucleic acid sequence encoding a viral 2A sequence can be the same as or different from the third nucleic acid sequence encoding a viral 2A sequence.
As used herein, the term transforming is used broadly to define a method of inserting a vector into a target cell. This can be accomplished, for example, by transfecting the vector into a target cell. Transfecting a vector into a target cell can be accomplished through the use of carriers, which can be divided into three primary classes: (cationic) polymers, liposomes, and nanoparticles. Examples of cationic polymers are DEAE-dextran and polyethylenimine, which bind the negatively charged vector and allows for the vector to be taken up by the cell through endocytosis. Liposomes are small, membrane-bounded bodies that fuse with the cell membrane and allow for the release of the vector into the cell. Nanoparticles are coupled to the vector and are shot directly into the nucleus of a cell using a gene gun. Transfections can further be divided into two categories: stable and transient transfections. Stable transfections result in the vector being permanently introduced into the cell and can be accomplished through the use of selectable marker, e.g., antibiotic resistance, as discussed herein. Transient transfections result in the vector being introduced temporarily to the cell. Alternatively, if the vector is a viral vector, it can be transfected into a host cell to produce virus, and the virus can be harvested and used to transduce the vector into the target cell. Transfection and transduction protocols are known. See, e.g., Sambrook et al., Molecular Cloning: A Laboratory Manual, 3rd Ed., Cold Spring Harbor Press, Cold Spring Harbor, N.Y. (2001); Ausubel et al. (eds.), Current Protocols in Molecular Biology, John Wiley & Sons, Hoboken, N.J. (2004).
The differentiated cell can, for example, be obtained from a subject. The differentiated cell can be obtained and cultured from the subject by a variety of methods known and described, e.g., in Schantz and Ng, A Manual for Primary Human Cell Culture, World Scientific, Hackensack, N.J. (2004); and Human Cell Culture Protocols 2nd Edition, (Ed. Picot, J), Humana Press, Totowa, N.J. (2004).
Optionally, the differentiated cell is a mammalian cell. The mammalian cell is optionally a human cell. Mammalian cells suitable for use in the claimed methods, include, but are not limited to epithelial cells, keratinocytes, fibroblasts, hepatocytes, neurons, osteoblasts, myocytes, kidney cells, lung cells, thyroid cells, and pancreatic cells.
Optionally, the methods further comprise culturing the transformed cell under conditions that allow for the isolation of an iPS cell or a population of iPS cells. For example, transformed cells (e.g., transformed keratinocytes) can be cultured under conditions with relatively high calcium levels. Specifically, prior to transfection, the differentiated cells are cultured under conditions with low calcium levels in the range of 0.01 mM to 0.1 mM. After transformation, the transformed cells are cultured under conditions with high calcium levels in the range of 1.0 mM to 2.0 mM. The high calcium levels promote the death of any untransformed differentiated cells but allow the survival of transformed cells that have undergone the transition to generate iPS cells. Alternatively, the transformed cells can be cultured under conditions that allow for the production of iPS cells through selection based on drug resistance. For example, the transformed vector contains a gene that will provide the transformed cells drug resistance (e.g., blasticidin, zeomycin, hygromycin, or neomycin resistance). Culturing untransformed cells in media supplemented with the selected drug promotes cell death. Culturing the transformed cells in media supplemented with the selected drug allows for the production of iPS cells.
Also provided are methods of producing iPS cells from differentiated cells comprising transforming the differentiated cells with a first retroviral vector comprising a loxP site in the 3′ long terminal repeat of the vector and a nucleic acid sequence comprising a nucleic acid sequence encoding an Oct4, a nucleic acid sequence encoding a Sox2, and a nucleic acid sequence encoding a Klf4 (or any of the nucleic acid sequences described above). The nucleic acid sequences are separated from each other by a first and second nucleic acid sequence encoding a viral 2A sequence. The first nucleic acid sequence encoding a viral 2A sequence can be the same as or different from the second nucleic acid sequence encoding a viral 2A sequence. The method further comprises culturing the transformed cells under conditions that allow for the production of an iPS cell. The method can further comprise transforming the iPS cell with a second vector comprising a nucleic acid sequence encoding a Cre recombinase. Expression of the Cre recombinase results in the deletion of the first vector from the genome of the iPS cell, with the exception of a SIN LTR containing a loxP sequence. Deletion of the first vector from the genome of the iPS cell avoids or reduces the risk of insertional mutagenesis caused by the insertion of the vector into the genome. The method can further comprise isolating a population of the iPS cells lacking the first vector. The iPS cells isolated by this method are physically different from iPS cells produced by other methods, as these iPS cells lack the genomically integrated retroviral vector used to create the iPS cell.
Also provided are methods of correcting a genetic mutation of a differentiated cell prior to producing an iPS cell from the differentiated cell. The methods comprise transforming a differentiated cell with a vector comprising a nucleic acid sequence comprising (i) a nucleic acid sequence encoding an Oct4, (ii) a nucleic acid sequence encoding a Sox2, and (iii) a nucleic acid sequence encoding a Klf4, wherein each of the nucleic acid sequences, (i)-(iii), are separated by a first and second nucleic acid sequence encoding a viral 2A sequence. The vector further comprises a nucleic acid sequence comprising an unmutated nucleic acid sequence of interest and homologous nucleic acid sequences flanking the genetic mutation. Optionally, the vector further comprises a first and second loxP sequence. Optionally, the vector further comprises a nucleic acid sequence encoding a Cre recombinase operably linked to an inducible promoter. The inducible promoter can, for example, comprise a Nanog-responsive thymidine kinase promoter. Optionally, the vector comprises SEQ ID NO:44.
Optionally, the genetic mutation is a mutation in the nucleic acid sequence encoding β-globin, the nucleic acid sequence encoding cystic fibrosis transmembrane conductance regulator, the nucleic acid sequence encoding phenylalanine hydroxylase, and/or the nucleic acid sequence encoding dystrophin.
Optionally, the genetic mutation is a mutation in the nucleic acid sequence encoding β-globin. The mutation in the nucleic acid sequence encoding β-globin can, for example, result in a glutamic acid to valine substitution at the sixth amino acid of the β-globin protein. The glutamic acid to valine substitution can, for example, be caused by an A to T transversion at base pair +20 relative to the A(+1) of the ATG start codon of the nucleic acid sequence encoding β-globin. β-globin is used throughout as an example.
Further provided are iPS cells produced by these methods. iPS cells produced by these methods can, for example, be identified based on morphological characteristics of the cell (e.g., cell shape, cell composition, cellular organelle shape, and cell size). An iPS cell produced by these methods can be identified based on the expression of ES cell markers. ES cell markers can, for example, include Oct3/4, Nanog, E-Ras, Cripto, Dax1, Sox2, Fgf4, stage-specific embryonic antigen 1 (SSEA1), SSEA3, SSEA4, alkaline phosphatase, tumor-related antigen (TRA)-1-60, TRA-1-81, and Zfp296. Optionally, an iPS cell produced by these methods can be identified by comparing CpG methylation patterns in gene promoters of nontransformed, transformed, and ES cells. Optionally, an iPS cell produced by these methods can be identified based on the ability to form a teratoma comprised of cells derived from the endoderm, mesoderm, and ectoderm in an immunocompromised mouse. An iPS cell can be identified by a combination of cell morphological characteristics, expression of ES cell markers, CpG methylation patterns, and the ability to form a teratoma in an immunocompromised mouse.
Examples of analytical techniques useful in determining the expression of ES cell markers include reverse transcription-polymerase chain reaction (RT-PCR), quantitative real-time-PCR (qRT-PCR), one step PCR, RNase protection assay, primer extension assay, microarray analysis, gene chip, in situ hybridization, immunohistochemistry, Northern blot, Western blot, enzyme-linked immunosorbent assay (ELISA), enzyme immunoassay (EIA), radioimmunoassay (RIA), or protein array. These techniques are known. See, e.g., Sambrook et al., Molecular Cloning: A Laboratory Manual, 3rd Ed., Cold Spring Harbor Press, Cold Spring Harbor, N.Y. (2001).
Further provided are kits consisting of any of the first vectors described and a second vector comprising a nucleic acid sequence encoding a Cre recombinase. Optionally, the first vector comprises a nucleic acid sequence comprising a nucleic acid sequence encoding an Oct4, a nucleic acid encoding a Sox2, and a nucleic acid sequence encoding a Klf4. Each of the nucleic acid sequences are separated by a first and second viral 2A sequence. The first viral 2A sequence is the same as or different from the second viral 2A sequence. Optionally, directions to produce an iPS cell from a differentiated cell, a culture plate for producing the iPS cells, and/or containers for the vector or vectors are included in the kit.
Also provided herein, are methods of treating or preventing a disease or disorder in a subject at risk of developing a disease or disorder. The methods comprise isolating differentiated cells from the subject and transforming the differentiated cells with a first vector comprising a nucleic acid comprising a nucleic acid sequence encoding an Oct4, a nucleic acid sequence encoding a Sox2, and a nucleic acid sequence encoding a Klf4. Each of the nucleic acid sequences are separated by a first and second nucleic acid sequence encoding a viral 2A sequence. The first nucleic acid sequence encoding a viral 2A sequence can be the same as or different from the second nucleic acid sequence encoding a viral 2A sequence. The vector may further comprise a nucleic acid sequence comprising a therapeutic agent. Alternatively, the transformed cells may be transformed with a second vector comprising a nucleic acid sequence comprising a therapeutic agent. The method further comprises isolating a population of the iPS cells. The method further comprises administering to the subject the isolated population of iPS cells that are expressing the therapeutic agent.
The therapeutic agent can be an RNA molecule, a protein, or a DNA molecule. An RNA molecule can, for example, comprise an antisense RNA molecule, a ribozyme, a small interfering RNA (siRNA) that mediates RNA interference (RNAi), or a microRNA (miRNA) that mediates miRNA-induced translational repression. In the event the therapeutic agent is a protein, the protein can be a receptor, a signaling molecule, a transcription factor, a factor that promotes or inhibits apoptosis, a DNA replication factor, an enzyme, a structural protein, a neural protein, a heat shock protein, or a histone. In the event that the therapeutic agent is a DNA molecule, the DNA molecule can correct a defective or mutated DNA sequence within the genome of the subject. Ordinary skill in the art determines which therapeutic agents are expressed to treat a subject with or at risk of developing a disease or disorder.
Also provided are methods of treating or preventing a disease associated with a genetic mutation in a subject. The methods comprise selecting a subject with a disease associated with the genetic mutation; isolating differentiated cells from the subject; transforming the differentiated cells with a vector comprising an unmutated nucleic acid sequence of interest; culturing the transformed cells under conditions that allow for the production of a population of iPS cells; screening the iPS cells for correction of the genetic mutation; and administering an effective amount of the iPS cells to the subject. Administration of the iPS cells treats or prevents the disease associated with the genetic mutation in the subject. The vector comprising the unmutated nucleic acid sequence of interest is capable of correcting the genetic mutation associated with the disease and is capable of inducing pluripotent stem (iPS) cells. Optionally, the vector comprises a nucleic acid sequence comprising (i) an unmutated nucleic acid sequence of interest and homologous nucleic acid sequences flanking the genetic mutation, (ii) a nucleic acid sequence encoding a Cre recombinase operably linked to an inducible promoter, (iii) a first and second loxP sequence, (iv) a nucleic acid sequence encoding an Oct4, (v) a nucleic acid sequence encoding a Sox2, and (vi) a nucleic acid sequence encoding a Klf4. Each of the nucleic acid sequences, (iv)-(vi), are separated by a first and second nucleic acid sequence encoding a viral 2A sequence. The first nucleic acid sequence encoding a viral 2A sequence can be the same as or different from the second nucleic acid sequence encoding a viral 2A sequence. Optionally, the inducible promoter comprises a Nanog-responsive thymidine kinase promoter. Optionally, the vector comprises SEQ ID NO:44.
Examples of analytical techniques useful in screening an iPS cell for correction of the genetic mutation include any DNA-based sequencing assay, reverse transcription-polymerase chain reaction (RT-PCR), quantitative real-time-PCR (qRT-PCR), RNase protection assay, Southern blot, Northern blot, and restriction length polymorphism (RFLP) analysis. These techniques are known. See, e.g., Sambrook et al., Molecular Cloning: A Laboratory Manual, 3rd Ed., Cold Spring Harbor Press, Cold Spring Harbor, N.Y. (2001).
Optionally, administration of the isolated iPS cells to the subject can be done after the isolated iPS cells have been differentiated to specific types of stem cells (e.g., hematopoietic stem cells). Administration of the differentiated iPS cells to the subject can be done systemically (e.g., injection of iPS cells into the circulatory system) or it can be localized to an organ or tissue (e.g., injection of iPS cells or delivery of stem cells, optionally, on or in a scaffold/matrix to specified organ or tissue). Thus, the administered iPS cells are designed so they interact with the tissue or organ or with target cells. The method of administration is determined by one of skill in the art to be consistent with the treatment of the disease or disorder that the subject has or is at risk of developing.
Optionally, the differentiated cell is selected from the group consisting of a(n) epithelial cell, keratinocyte, fibroblast, hepatocyte, neuron, osteoblast, myocyte, kidney cell, lung cell, thyroid cell, and pancreatic cell. Optionally, the differentiated cell is a keratinocyte.
The disease associated with a genetic mutation can, for example, be selected from the group consisting of sickle cell disease, thalassemia, cystic fibrosis, phenylketonuria, and Duchenne muscular dystrophy. The genetic mutation can be corrected via targeted gene replacement and the disease is amenable to a gene/cell therapy approach.
As used herein, a subject can be a vertebrate, more specifically a mammal (e.g., a human, horse, pig, rabbit, dog, sheep, goat, non-human primate, cow, cat, guinea pig or rodent), a fish, a bird or a reptile or an amphibian. The term does not denote a particular age or sex. Thus, adult and newborn subjects, as well as fetuses, whether male or female, are intended to be covered. As used herein, patient or subject may be used interchangeably and can refer to a subject with or at risk of developing a disease or disorder. The term patient or subject includes human and veterinary subjects.
A subject at risk of developing a disease or disorder can be genetically predisposed to the disease or condition, e.g., have a mutation in a gene that causes the disease or disorder or have a family history of the disease or disorder. Additionally, a subject at risk of developing a disease or disorder may have symptoms or signs of early onset for the disease or condition. A subject with a disease or disorder has one or more symptoms of the disease or disorder or has been diagnosed with the disease or disorder.
According to the methods taught herein, the subject is administered an effective amount of the therapeutic agent and/or iPS cells. The terms effective amount and effective dosage are used interchangeably. The term effective amount is defined as any amount necessary to produce a desired physiologic response. Effective amounts and schedules for administering the therapeutic agent and/or iPS cells may be determined empirically, and making such determination is within the skill in the art. The dosage ranges for administration are those large enough to produce the desired effect in which one or more symptoms of the disease or disorder are affected (e.g., reduced or delayed). The dosage should not be so large as to cause substantial adverse side effects, such as unwanted cross-reactions, anaphylactic reactions, and the like. Generally, the dosage will vary with the age, condition, sex, type of disease, the extent of the disease or disorder, route of administration, or whether other drugs are included in the regimen, and can be determined by one or skill in the art. The dosage can be adjusted by the individual physician in the event of any contraindications. Dosages can vary, and can be administered in one or more dose administrations daily, for one or several days. Guidance can be found in the literature for appropriate dosages for given classes of pharmaceutical products.
As used herein the terms treatment, treat, or treating refer to a method of reducing the effects of a disease or condition or one or more symptoms of the disease or condition. Thus in the disclosed method, treatment can refer to a 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% reduction in the severity of an established disease or condition or one or more symptoms of the disease or condition. For example, a method for treating a disease is considered to be a treatment if there is a 10% reduction in one or more symptoms of the disease in a treated subject as compared to a control. A control can refer to an untreated subject. Alternatively, a control can comprise samples from the subject prior to treatment (i.e., the levels of one or more symptoms of the disease in the subject are determined prior to treatment and compared to the levels of one or more symtpoms of the disease in the subject after treatment). Thus the reduction can be a 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, or any percent reduction in between 10% and 100% as compared to native or control levels. It is understood that treatment does not necessarily refer to a cure or complete ablation of the disease, condition, or symptoms of the disease or condition.
As used herein, the terms prevent, preventing, and prevention of a disease or disorder refers to an action, for example, administration of a therapeutic agent, that occurs before or at about the same time a subject begins to show one or more symptoms of the disease or disorder, wherein the administration inhibits or delays onset or exacerbation of one or more symptoms of the disease or disorder. As used herein, references to decreasing, reducing, or inhibiting include a change of 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or greater as compared to a control level. Such terms can include but do not necessarily include complete elimination.
Disclosed are materials, compositions, and components that can be used for, can be used in conjunction with, can be used in preparation for, or are products of the disclosed methods and compositions. These and other materials are disclosed herein, and it is understood that when combinations, subsets, interactions, groups, etc. of these materials are disclosed that while specific reference of each various individual and collective combinations and permutation of these compounds may not be explicitly disclosed, each is specifically contemplated and described herein. For example, if a method is disclosed and discussed and a number of modifications that can be made to a number of molecules including the method are discussed, each and every combination and permutation of the method, and the modifications that are possible are specifically contemplated unless specifically indicated to the contrary. Likewise, any subset or combination of these is also specifically contemplated and disclosed. This concept applies to all aspects of this disclosure including, but not limited to, steps in methods of using the disclosed compositions. Thus, if there are a variety of additional steps that can be performed it is understood that each of these additional steps can be performed with any specific method steps or combination of method steps of the disclosed methods, and that each such combination or subset of combinations is specifically contemplated and should be considered disclosed.
Publications cited herein and the material for which they are cited are hereby specifically incorporated by reference in their entireties.
The examples below are intended to further illustrate certain aspects of the methods and compositions described herein, and are not intended to limit the scope of the claims.
The complete nucleotide sequence of pKP332 (the OSK polycistronic lentiviral vector) is given by SEQ ID NO:43. The pKP332 vector was deposited with the American Type Culture Collection, 10801 University Boulevard, Manassas, Va. 20110-2209 in accordance with the Budapest Treaty on Oct. 6, 2009, and has accession number PTA-10385. The complete nucleotide and amino acid map of the polycistron encoded by the vector used is given by SEQ ID NO:7 (top strand) and SEQ ID NO:9, respectively (FIG. 7). Construction of the polycistron using PTV1 2A sequences and fusion PCR was performed essentially as described (Holst et al., Nature Protocols 1:406-17 (2006)). Briefly, human Oct4 cDNA (Open Biosystems Clone 40125986) (Open Biosystems; Huntsville, Ala.) was PCR amplified and modified with primers OCT4-F: cacacagcggccgcatttaaatccaccatggcgggacacctggcttc (SEQ ID NO:10) and OCT4-R: agaggacgaacgaaattgtctctcttcaagcaccgaggcaaacttacgtaccctctcgg (SEQ ID NO:11) to contain Not I and Swa I restriction sites at the 5′ end and a Kozak consensus sequence. At the 3′ end, the Oct4 stop codon was eliminated and replaced with nucleotides (nt) from PTV 1 2A that will form a 22-nt overlap with the 5′ end of the Sox2 amplicon. Human Sox2 cDNA (Open Biosystems Clone 2823424) (Open Biosystems; Huntsville, Ala.) was PCR amplified and modified with primers SOX2-F: ctctgttaaagcaagcaggagatgttgaagaaaaccccgggcctatgtacaacatgatggagacgg (SEQ ID NO:12) and SOX2-R: agaggacgaacgaaattgtctctcttcaagcaccgaggcctagggtacacactctccccgtcac (SEQ ID NO:13) to overlap with the 3′ end of the Oct4 amplicon and to append 2A nt sequences upstream of the Sox2 ATG. At the 3′ end, the Sox2 stop codon was eliminated and replaced with nt from PTV 1 2A that will form a 22-nt overlap with the 5′ end of the Klf4 amplicon. Human Klf4 cDNA (Open Biosystems Clone 5111134) (Open Biosystems; Huntsville, Ala.) was PCR amplified and modified with primers KLF4-F: ctctgttaaagcaagcaggagatgttgaagaaaaccccgggcctatggctgtcagcgacgcgc (SEQ ID NO:14) and KLF4-R: gtgtgtcagctgtaaatttaaatttttacggagaagtacacatt (SEQ ID NO:15) to overlap with the 3′ end of the Sox2 amplicon and to append 2A nt sequences upstream of the Klf4 ATG. At the 3′ end, the Klf4 stop codon was retained and Swa I and Sal I restriction sites were added. After PCR, the individual amplicons were gel purified and used in a three-element fusion PCR at a 1:100:1 (Oct4:Sox2:Klf4) molar ratio along with primers OCT4-F (SEQ ID NO:10) and KLF4-R (SEQ ID NO:15) to produce a 3623 base pair (bp) amplicon containing the polycistron. The polycistron was gel purified and cloned into the general cloning vector pKP114 using the NotI and SalI restriction sites to produce pKP330 and sequenced for authenticity. Subsequently, the polycistron was removed from pKP330 as a Swa I (Roche; Indianapolis, Ind.) fragment and subcloned into a Swa I site downstream of the EF1α promoter in the lentiviral vector pDL 171 (Levasseur et al., Blood 102:4312-9 (2003)) to produce the OSK polycistronic lentiviral vector pKP332, which was sequenced for authenticity.
By the same strategy, a second polycistronic lentival vector, pKP333, was produced that substitutes the PTV1 2A peptide between Sox2 and Klf4 with the Thosea asigna virus 18 amino acid 2A-like sequence and a GSG linker (underlined): GSGEGRGSLLT CGDVEENPGP (SEQ ID NO:5).
The complete nucleotide sequence of pKP360 (the OSK polycistronic lentiviral vector designed to correct β-globin mutation) is given by SEQ ID NO:44. To create this vector, a 6938 base pair (bp) loxP-SalI-NBS-TK-Cre/GFP-EF1a-OCT4-2A-SOX2-2A-KLF4-AscI-loxP DNA fragment is inserted into the second intron of the human β-globin gene contained within a bacterial artificial chromosome (BAC) by recombineering in DY380 E. coli cells. In a second recombineering step, a capture vector containing an MC1-driven herpes simplex virus thymidine kinase (HSV tk) gene is used to extract a 16,890 bp sequence from the BAC. The captured sequence consists of 5602 bp of human β-globin 5′ homology, the 6938 bp insert sequence, and 4350 bp of human β-globin 3′ homology. The first and second β-globin exons are contained within the 5′ homology and the third exon is contained within the 3′ homology. pKP360 contains a unique NotI restriction site at nucleotide #21049 for vector linearization prior to transfection. The HSV tk gene is used as a negative selection marker for random integration of the vector. Briefly, following transfection with pKP360 of differentiated cells isolated from a sickle cell disease (SCD) patient, 3 classes of cells results: (1) cells that do not receive the vector; these cells remain differentiated and eventually die in culture due to a limited replicative life span; (2) cells that integrate the vector in a non-targeted location; these cells could become iPS cells but will be selected against by gancyclovir because they contain the HSV tk gene; and (3) cells that integrate the vector by homologous recombination into the β-globin locus; these cells have lost the HSV tk marker and will therefore survive gancyclovir selection to become iPS cells with a corrected β-globin gene.
PCR reactions were performed using PrimeStar polymerase (Takara Bio Inc.; Otsu, Shiga, Japan). All of the oligos used in this study were synthesized by Integrated DNA Technologies (IDT; Coralville, Iowa) and all DNA gel extractions were performed using QIAquick Gel Extraction Kits (Qiagen; Valencia, Calif.).
Embryonic stem (ES) and induced pluripotent stem (iPS) cells were cultured on irradiated murine embryonic fibroblasts (MEFs) in ES cell media consisting of DMEM supplemented with 1× non-essential amino acids, 1× penicillin-streptomycin, 1× L-glutamine (Mediatech; Manassas, Va.), 1× nucleosides (Chemicon; Temecula, Calif.), 15% Fetal Bovine Serum (FBS) (Hyclone; Logan, Utah), 2-ME (Sigma; St. Louis, Mo.) and Leukemia Inhibitory Factor (LIF) (laboratory preparation).
For preparation of lentivirus, 140 μg of the polycistronic vector (pKP332), 70 μg of the envelope plasmid (pMDG), and 105 μg of the packaging plasmid (pCMBVdR8.9.1) were co-transfected into 1.7×107 293T cells by the CaCl2 method as previously described (Levasseur et al., Blood 102:4312-9 (2003)). Virus-containing supernatant was collected 2 days after transfection, passed through a 0.45 μm filter and concentrated by centrifugation at 26,000 rpm for 90 minutes at 8° C. in an SW-28 rotor using a Beckman XL-100 ultracentrifuge (Beckman; Fullerton, Calif.).
For iPS cell induction, 3×105 mouse tail-tip fibroblasts (TTFs) were seeded onto one well of a 6-well plate. The next day, 2.5 μL of the concentrated virus was mixed with 2 mL of ES cell medium containing 8 μg/mL polybrene and added to the TTFs. Forty-eight hours later, the TTFs were trypsinized and transferred to a 100 mm dish without MEFs and continuously cultured on the same dish for 3 weeks with daily media changes. Potential iPS cell colonies started to appear after 2-3 weeks. These colonies were individually picked and expanded on MEFs for analysis.
To remove the integrated lentiviral and polycistronic sequences, iPS cells were either electroporated with a Cre-expressing plasmid (pCAGGS-Cre) or infected with a Cre-expressing adenovirus (rAd-Cre-IE). Individual colonies were picked and Cre-mediated removal of floxed sequences was verified by PCR and southern blot analysis.
For the construction of rAd-Cre-IE (rAd-Cre-IRES-EGFP), Cre cDNA was PCR amplified from pCAGGS-Cre and inserted between the NheI and EcoRI sites of the expression vector pEC-IE, which contains an IRES-EGFP downstream of the MCS. The Cre-IE expression cassette is flanked by attL1 and attL2 sites, thus allowing transfer of the Cre-IE sequence from pEC-IE to pAd/p1-DEST (Invitrogen; Carlsbad, Calif.) by the LR reaction. The recombinant adenovirus was packaged in 293A cells according to the manufacturer's instructions.
Primary human keratinocytes were isolated from a patient skin biopsy. Briefly, the biopsied tissue was placed into Keratinocyte-SFM (9K-SFM; Invitrogen; Carlsbad, Calif.) supplemented with 10 mg/ml Dispase and 2× Antibiotics/Antimycotics (CELLnTEC CnT-ABM) and incubated overnight at 4° C. The next day, the keratinocyte-containing epidermal layer was isolated from the fibroblast-containing dermal layer with forceps and then trypsinized for 20 minutes at room temperature. Cell clumps were triturated with a pipet and then centrifuged at 200×g for 5 minutes. Cells were resuspended in K-SFM and 1× Antibiotics/Antimycotics, transferred to one well of a six-well plate, and incubated at 37° C. with daily media changes. For transduction, 3×105 keratinocytes were seeded into one well of a six-well plate in K-SFM. The next day the media was removed and replaced with 2 ml of K-SFM containing 5 mg/ml of polybrene and the polycistronic lentivirus. After 24 hours, the transduced cells were trypsinized, centrifuged, resuspended in K-SFM and transferred into a 10 cm tissue culture dish containing γ-irradiated CF-1 murine embryonic fibroblasts (MEFs). The next day, the medium was changed to human ES cell medium (DMEM/F-12, 20% Knockout SR, 2 mM L-glutamine, 1× Pen/Strep, 1× nonessential amino acids (all from Invitrogen; Carlsbad, Calif.), 0.5 mM β-mercaptoethanol (Sigma; St. Louis, Mo.), and 4 ng/ml bFGF (Calbiochem; San Diego, Calif.)). Cells were incubated at 37° C. with daily media changes and after 10 days, CF-1 conditioned medium was added. iPS colonies appeared after about 30 days.
With the exception of the pKP332 construction, all of the PCRs performed used ExTaq polymerase (Takara Bio Inc.; Otsu, Shiga, Japan). All of the sequencing was performed by the Genomics Core Facility of the Howell and Elizabeth Heflin Center for Human Genetics of the University of Alabama at Birmingham using the BigDye Terminator v3.1 Cycle Sequencing Ready Reaction kit as per the manufacture's instructions (Applied Biosystems; Foster City, Calif.). The sequencing products were run following standard protocols on an Applied Biosystems 3730 Genetic Analyzer with POP-7 polymer.
iPS cells were cultured on cover slips pretreated with FBS, fixed with 4% paraformaldehyde and permeabilized with 0.5% Triton X-100. Cells were stained with DAPI and primary antibodies against Nanog and SSEA1 (R&D Systems; Minneapolis, Minn.) and incubated with fluorophore-labeled secondary antibodies (Jackson Immunoresearch; West Grove, Pa.).
For AP staining, 100-200 iPS cells were seeded onto one well of a six-well plate and cultured for one week. iPS cells were then stained using the Vector Blue Alkaline Phosphatase Substrate Kit III (Vector Laboratories; Burlingame, Calif.) according to the manufacturer's instructions.
Total RNA was isolated from cells with Trizol reagent (Invitrogen; Carlsbad, Calif.). RNA was pretreated with RQ1 RNase-free DNase (Promega; Madison, Wis.) and reverse transcribed with SuperScript First-Strand Synthesis System (Invitrogen; Carlsbad, Calif.) using oligo d(T)n. Primers for PCR amplification of the cDNA were: polycistronic transgene F, gatgaactgaccaggcacta (SEQ ID NO:16) and polycistronic transgene R, gattatcggaattccctcgag (SEQ ID NO:17); Nanog F, accaaaggatgaagtgcaag (SEQ ID NO:18) and Nanog R, agttttgctgcaactgtacg (SEQ ID NO:19); Oct4 F, agcttgggctagagaaggat (SEQ ID NO:20) and Oct4 R, tcagtttgaatgcatgggag (SEQ ID NO:21); Sox2 F, tgcacatggcccagcacta (SEQ ID NO:22) and Sox2 R, ttctccagttcgcagtccag (SEQ ID NO:23); Cripto F, aacttgctgtctgaatggag (SEQ ID NO:24) and Cripto R, tttgaggtcctggtccatca (SEQ ID NO:25); Klf4 F, cagcagggactgtcaccctg (SEQ ID NO:26) and Klf4 R, ggtcacatccactacgtgggat (SEQ ID NO:27); and Natl F, ggagagtgcgattgcagaag (SEQ ID NO:28) and Natl R, ggtcacatccactacgtggga (SEQ ID NO:29).
Bisulfite treatment of DNA was performed with the CpGenome Fast DNA Modification Kit (Chemicon; Temecula, Calif.) according to the manufacturer's instructions. The Oct4 and Nanog gene promoter regions were amplified by nested PCR using the Oct4 primers F1, gttgttttgttttggttttggatat (SEQ ID NO:30), Oct4 F2, atgggttgaaatattgggtttattta (SEQ ID NO:31) and Oct4 R, ccaccctctaaccttaacctctaac (SEQ ID NO:32) or the Nanog primers F1, gaggatgttttttaagtttttttt (SEQ ID NO:33), Nanog F2, aatgtttatggtggattttgtaggt (SEQ ID NO:34) and Nanog R, cccacactcatatcaatataataac (SEQ ID NO:35). Amplified PCR products were purified using a QIAgen Gel Extraction Kit (Qiagen; Valencia, Calif.), cloned into a Topo TA vector (Invitrogen; Carlsbad, Calif.), and sequenced with T7 and Ml3R primers.
Ten μg of genomic DNA were digested with BamHI or KpnI (Roche; Indianapolis, Ind.), separated on a 0.8% agarose gel and blotted onto Hybond-N+ membrane (Amersham Biosciences; Piscataway, N.J.). The polycistronic vector served as template to PCR amplify a 0.3 kb SIN LTR probe using the primers SIN LTR F, gctcggtacctttaagaccaatgac (SEQ ID NO:36) and SIN LTR R, atgctgctagagattttccacactg (SEQ ID NO:37). To produce the internal probe, the polycistronic vector was digested with SalI and XhoI (Roche; Indianapolis, Ind.) and the 1 kb fragment containing the EF1α promoter was gel purified. Probes were labeled using the Random Primed DNA Labeling Kit (Roche; Indianapolis, Ind.) with 32P-α-dCTP and blots were hybridized in MiracleHyb solution (Stratagene; La Jolla, Calif.).
One to two μg of total genomic DNA were digested with the tetranucleotide-recognizing restriction enzymes MseI or AluI (New England Biolabs (NEB); Ipswich, Mass.). The digested fragments were diluted and incubated with T4 DNA Ligase (Roche; Indianapolis, Ind.) to obtain self-ligated monomers, which were then linearized with the hexanucleotide-recognizing restriction enzymes NcoI or XmnI (NEB; Ipswich, Mass.). These fragments were isolated by ethanol precipitation and used as templates in PCR reactions using the primers 5LentiR1, tgaattgatcccatcttgtcttcg (SEQ ID NO:38) and SLentiF1, tgctgctttttgcttgtactgg (SEQ ID NO:39). PCR products were run on a 2% agarose gel in the presence of ethidium bromide (0.5 μg/mL). All bands visible under UV light were gel purified and sequenced.
One million iPS cells in a 100 μL volume of PBS were injected via a 21 G needle into the dorsal flanks of SCID mice. Teratomas were recovered 4-5 weeks postinjection and processed for histological analysis.
C57BL/6 blastocysts were injected with iPS cells and then transferred to pseudopregnant CD-1 females. After two weeks, embryos were collected for photographs and analyzed for chimerism using PCR. Embryos were individually minced and lysed overnight at 55° C. in a solution of Proteinase K and SDS. DNA was then purified from the lysate by phenol/chloroform extraction and ethanol precipitation. PCR was performed using the primers mbeta KI F, ttgagcaatgtggacagagaagg (SEQ ID NO:40), mbeta KI R, gtcagaagcaaatgtgaggagca (SEQ ID NO:41) and 1400gamma R, aattctggcttatcggaggcaag (SEQ ID NO:42).
FIG. 1A illustrates the lentiviral vector constructed for transduction of adult skin fibroblasts. Human Oct4, Sox2 and Klf4 cDNAs (OSK) were linked with porcine teschovirus-1 (PTV1) 2A sequences that function as cis-acting hydrolase elements (CHYSELs) to trigger ribosome skipping (Donnelly et al., J. Gen. Virol. 82:1013-25 (2001); Chinnasamy et al., Virol. J. 3:14 (2006)). The 2A peptide sequences (FIG. 1B) are cleaved during translation and produce Oct4 and Sox2 proteins containing an additional 21 amino acids at the carboxy-termini. A single proline is also appended to the amino-termini of Sox2 and Klf4. The OSK polycistron was subcloned downstream of an EF1α promoter in a self-inactivating (SIN) lentiviral vector containing a loxP site in the truncated 3′ LTR (Zuffferey et al., J. Virol. 72:9873-80 (1998); Levasseur et al., Blood 102:4312-9 (2003)). After lentivirus production, one million adult skin fibroblasts derived from tail tips of humanized sickle mice were transduced with the polycistronic vector, and four colonies with highly defined borders and tightly packed cells were picked at 19 to 30 days post-transduction. These colonies were expanded and stained for alkaline phosphatase, Nanog and SSEA1, which are characteristic markers of pluripotent stem cells. FIGS. 2A and 2B illustrate the staining pattern of typical colonies (iPS-1 and iPS-2). The colonies stained intensely for alkaline phosphatase and strongly with antibodies to Nanog and SSEA1.
Reverse transcription-polymerase chain reaction (RT-PCR) assays for expression of additional iPS cell markers are shown in FIG. 3A. iPS-1, -2, and -3 cells expressed polycistronic OSK RNA and endogenous Oct4, Sox2, Klf4, Nanog and Cripto RNA (FIG. 3A). Consistent with these results, bisulfite sequencing of the endogenous Oct4 and Nanog promoters in iPS-1 and iPS-2 cells demonstrated effective demethylation of these sequences (FIG. 3B). CpGs in the endogenous Oct4 and Nanog promoters of tail tip fibroblasts (TTFs) were highly methylated (FIG. 3B) and endogenous Oct4, Sox2, Nanog and Cripto RNAs were not detected (FIG. 3A).
When these iPS cells were injected into the dorsal flanks of nonobese diabetic (NOD)/SCID IL-2 γR−/−mice, teratomas containing tissue derived from all three germ layers were obtained (FIG. 5A). These results demonstrate that the polycistronic OSK lentiviral vector effectively reprograms adult skin fibroblasts to induced pluripotent stem cells.
The polycistronic vector was deleted by electroporation of iPS cells with a Cre recombinase-expressing plasmid or by infection of iPS cells with adenovirus that expresses Cre recombinase (Adeno/Cre). Subsequently, individual colonies were picked, expanded and iPS cell DNA was analyzed by Southern blot hybridization (FIG. 4B). DNA isolated before (iPS-1) and after (iPS-1 Cre) Cre expression was digested with Kpn I, which cuts once within the OSK polycistron, and probed with a DNA fragment containing EF1α sequences. Four bands are observed for iPS-1 DNA indicating that four copies of the polycistronic OSK vector are integrated into the genome (also see FIG. 6B, iPS-2 cells contain 3 copies of the vector). None of these four bands are observed in iPS-1 Cre DNA; only a band representing endogenous EF1α sequences is detected. These results demonstrate that transient Cre expression effectively deletes all copies of the polycistronic OSK lentiviral vector.
Junctions of the four iPS-1 insertion sites were cloned by inverse PCR and sequenced (Pawlik et al., Gene 165:173-81 (1995); Silver and Keerikatte, J. Virol. 63:1924-8 (1989)). Table 2 lists the locations of these sites. Three of the insertion sites are within introns, and one is located in an intergenic region that is 2 megabases (Mb) downstream of the transcription start site (TSS) of the NMBr gene and 1 Mb upstream of the TSS of the Cited2 gene. These results demonstrate that iPS cells can be readily obtained by this procedure without interruption of coding sequences, promoters or known regulatory elements. Cloning and sequencing of the insertion sites from iPS-1 Cre cells demonstrated that only the 291 base pair (bp) 3′ LTR of the polycistronic vector remains in the genome. This small SIN LTR does not contain a promoter or enhancer; therefore, the probability of insertional activation or inactivation of endogenous genes is low.
| TABLE 2 |
| OSK lentiviral integration sites. |
| iPS Clones | No: | Chrom. | Gene Name | Gene ID | Location | Base from TSS |
| iPS-1 | 1 | CH2 | RAB14 | MGI:1915615 | Intron | +8,129 |
| 2 | CH8 | Cadherin 13 | MGI:99551 | Intron | +24,738 | |
| 3 | CH10 | Cbp/p300-interacting | MGI:1306784 | Intergenic | −966,513 | |
| transactivator | ||||||
| 4 | CH14 | F-box protein 34 | MGI:1926188 | Intron | +52,366 | |
| iPS-2 | 1 | CH5 | Ribokinase | MGI:1918586 | Intron | +38,503 |
| 2 | CH15 | Estrogen receptor-binding | MGI:1859920 | Intron | +20,439 | |
| fragment associated gene 9 | ||||||
| 3 | CH15 | Angiopoietin 1 | MGI:108448 | Intron | +21,069 | |
FIGS. 2A and 2B demonstrate that iPS-1 Cre cells continue to stain positive for alkaline phosphatase, Nanog and SSEA1 after OSK deletion, and FIG. 3A demonstrates that expression of endogenous Oct4, Sox2, Klf4, Nanog and Cripto was maintained in the absence of OSK expression. As expected, the endogenous Oct4 and Nanog promoters remained demethylated after OSK deletion (FIG. 3B).
Finally, two iPS-1 Cre cell lines were injected into wild-type blastocysts, and these blastocysts were transferred into the uteri of pseudo-pregnant female mice. After two weeks, embryos were analyzed for chimerism by PCR with primers specific for human and mouse β-globin genes. FIG. 5B demonstrates that several high-level chimeras were obtained; most tissues of these embryos were derived from iPS-1 Cre cells which contain only human β-globin genes. One pregnancy was allowed to proceed to term, and FIG. 5C shows an adult high-level chimera (right) derived from iPS-1 Cre 2 cells. These results demonstrate that adult skin fibroblasts can be effectively reprogrammed to iPS cells with the polycistronic lentiviral vector and that tissues from all three germ layers can be derived from these cells.
To determine whether iPS cells were produced from primary human keratinocytes, primary human keratinocytes were cultured from a patient skin biopsy. The cultured cells were transduced with the vector described above. After 24 hours, the transduced cells were trypsinized, centrifuged, resuspended in media and transferred into a tissue culture dish containing murine embryonic fibroblasts (MEFs). After about 30 days in culture, iPS colonies were produced. The iPS cells from the human keratinocytes were sustainable in culture and were capable of multiple passages. FIG. 8 shows a brightfield image of one of the iPS cell colonies produced. The iPS cell colony was stained with SSEA-4, which is an antibody that recognizes human embryonic stem cells, but not differentiated cells, to confirm the presence of embryonic stem cells comprising the iPS cell colony. The same iPS colony was stained with DAPI, which is a general nuclear stain, to confirm the presence of nuclei in the cells of the iPS cell colony.
FIG. 9 shows a schematic of a method to correct a βs-globin mutation in a cell from a subject with sickle cell disease (SCD) while dedifferentiating the cell to a pluripotent state. The method is applicable to a range of genetic mutations.
To determine whether the β-globin locus of a subject with SCD is corrected, cells from a human subject with SCD are collected and expanded in culture. The mutated βs-globin locus is depicted at the top of FIG. 9. The βs-globin mutation is a single nucleotide, A to T transversion, that changes the normal GAG codon to a GTG codon in exon 1 of β-globin. As a result, the sixth amino acid of the βs-globin is a valine instead of the normal glutamic acid.
Once the cells are expanded in culture, the targeting vector (middle of FIG. 9) is introduced into the cells from the subject with SCD. The vector contains the normal GAG nucleotide sequence in the first exon and flanking sequences to effect homologous recombination within the target locus. A herpes simplex virus thymidine kinase (HSV tk) gene is located outside of the sequences used to effect homologous recombination. Integrated between the flanking homology arms is a floxed cassette consisting of a Nanog-responsive thymidine kinase promoter driving expression of a Cre recombinase and the EF1α promoter driving expression of the Oct4-Sox2-Klf4 polycistronic sequence. Alternatively, the floxed cassette can contain a marker gene that can either be an addition to the polycistron or have its own promoter. The marker can be used as a positive selection to select cells that have incorporated the vector.
The targeting vector homologously recombines with the mutated βs-globin locus incorporating the corrected GAG codon. The Oct4-Sox2-Klf4 polycistron is expressed, resulting in the dedifferentiation of the cells. While Oct4, Sox2, and Klf4 are expressed from the EF1α promoter, the TK promoter remains silent. Once the cell begins to dedifferentiate, the endogenous Nanog gene is expressed. Expression of Nanog results in the activation of the TK promoter, which is Nanog responsive. Activation of the TK promoter results in the expression of Cre recombinase. Cre recombinase binds to the loxP sites to effect the deletion of the floxed cassette, resulting in a corrected β-globin locus containing a single loxP site in between the second and third exons of the corrected β-globin locus (bottom of FIG. 9). Excision of the floxed cassette is important for two reasons: (1) it prevents the disregulation of the corrected β-globin gene, and (2) it halts the expression of the vector-introduced reprogramming factors, as their continued expression inhibits the reprogramming process.
1. A method of producing an induced pluripotent stem (iPS) cell from a differentiated cell comprising transforming the differentiated cell with a first vector, wherein the first vector comprises a nucleic acid sequence comprising (i) a nucleic acid sequence encoding an Oct4, (ii) a nucleic acid sequence encoding a Sox2, and (iii) a nucleic acid sequence encoding a Klf4, wherein each of the nucleic acid sequences, (i)-(iii), are separated by a first and second nucleic acid encoding a viral 2A sequence.
2. The method of claim 1, wherein the vector comprises SEQ ID NO:7.
3. The method of claim 1, wherein the vector comprises a nucleic acid sequence encoding SEQ ID NO:9.
4. The method of claim 1, further comprising culturing the transformed cell under conditions that allow for the production of a population of iPS cells.
5. The method of claim 1, further comprising isolating the population of iPS cells.
6. (canceled)
7. (canceled)
8. (canceled)
9. (canceled)
10. (canceled)
11. (canceled)
12. The method of claim 1, wherein the differentiated cell is a mammalian cell.
13. The method of claim 12, wherein the mammalian cell is a human cell.
14. The method of claim 13, wherein the mammalian cell is selected from the group consisting of a(n) epithelial cell, keratinocyte, fibroblast, hepatocyte, neuron, osteoblast, myocyte, kidney cell, lung cell, thyroid cell, and pancreatic cell.
15. The method of claim 14, wherein the mammalian cell is a keratinocyte.
16. (canceled)
17. (canceled)
18. (canceled)
19. The method of claim 1, wherein the first and second nucleic acid sequences encoding a viral 2A sequence comprises a nucleic acid sequence encoding the amino acid sequence ATNFSLLKQAGDVEENPGP (SEQ ID NO:2) or EGRGSLLTCGDVEENPGP (SEQ ID NO:3).
20. The method of claim 1, wherein the first nucleic acid sequence encoding a viral 2A sequence comprises a nucleic acid sequence encoding the amino acid sequence ATNFSLLKQAGDVEENPGP (SEQ ID NO:2) and the second nucleic acid sequence encoding a viral 2A sequence comprises a nucleic acid sequence encoding the amino acid sequence EGRGSLLTCGDVEENPGP (SEQ ID NO:3).
21. The method of claim 1, wherein the first vector is a plasmid, an adenoviral vector or a retroviral vector.
22. The method of claim 21, wherein the retroviral vector is a lentiviral vector.
23. The method of claim 22, wherein the lentiviral vector is a lentiviral SIN vector.
24. The method of claim 21, wherein the retroviral vector comprises a 3′ long terminal repeat.
25. The method of claim 24, wherein the retroviral vector further comprises a loxP sequence.
26. The method of claim 25, wherein the loxP sequence is in a 3′ long terminal repeat of the lentiviral vector.
27. The method of claim 25, further comprising transforming the iPS cell with a second vector, wherein the second vector comprises a nucleic acid encoding a Cre recombinase, wherein expression of the Cre recombinase results in the deletion of the first vector from the genome of the iPS cells.
28. The method of claim 27, further comprising isolating a population of iPS cells lacking the first vector.
29. An isolated iPS cell produced by the method described in claim 28.
30. The method of claim 1, further comprising correcting a genetic mutation in the differentiated cell, wherein the first vector further comprises a nucleic acid sequence comprising an unmutated nucleic acid sequence of interest and homologous nucleic acid sequences flanking the genetic mutation to be corrected.
31. The method of claim 30, wherein the genetic mutation is a mutation in the nucleic acid sequence encoding β-globin, the nucleic acid sequence encoding cystic fibrosis transmembrane conductance regulator, the nucleic acid sequence encoding phenylalanine hydroxylase, and the nucleic acid sequence encoding dystrophin.
32. The method of claim 31, wherein the genetic mutation is a mutation in the nucleic acid sequence encoding β-globin.
33. The method of claim 32, wherein the mutation in the nucleic acid sequence encoding β-globin results in a glutamic acid to valine substitution at the sixth amino acid of the β-globin protein.
34. The method of claim 33, wherein the glutamic acid to valine substitution is caused by an A to T transversion at base pair +20 relative to the A(+1) of the ATG start codon of the nucleic acid sequence encoding β-globin.
35. The method of claim 30, wherein the first vector further comprises a first and second loxP sequence.
36. The method of claim 35, wherein the first vector further comprises a nucleic acid sequence encoding a Cre recombinase operably linked to an inducible promoter.
37. The method of claim 36, wherein the inducible promoter comprises a Nanog-responsive thymidine kinase promoter.
38. The method of claim 30, wherein the first vector comprises SEQ ID NO:44.
39-70. (canceled)
71. A method of treating or preventing a disease associated with a genetic mutation in a subject, the method comprising:
(a) selecting a subject with a disease associated with a genetic mutation;
(b) isolating differentiated cells from the subject;
(c) transforming the differentiated cells with a vector comprising an unmutated nucleic acid sequence of interest;
(d) culturing the transformed cells under conditions that allow for the production of a population of iPS cells;
(e) screening the iPS cells for correction of the genetic mutation; and
(f) administering the iPS cells to the subject, wherein administration of the iPS cells treats or prevents the disease associated with the genetic mutation in the subject.
72. The method of claim 71, wherein the vector comprises a nucleic acid sequence comprising (i) an unmutated nucleic acid sequence of interest and homologous nucleic acid sequences flanking the genetic mutation, (ii) a nucleic acid sequence encoding a Cre recombinase operably linked to an inducible promoter, (iii) a first and second loxP sequence, (iv) a nucleic acid sequence encoding an Oct4, (v) a nucleic acid sequence encoding a Sox2, and (vi) a nucleic acid sequence encoding a Klf4, wherein each of the nucleic acid sequences, (iv)-(vi), are separated by a first and second nucleic acid sequence encoding a viral 2A sequence.
73. The method of claim 72, wherein the inducible promoter comprises a Nanog-responsive thymidine kinase promoter.
74. The method of claim 71, wherein the disease caused by the mutation in the genome is selected from the group consisting of sickle cell disease, thalassemia, cystic fibrosis, phenylketonuria, and Duchenne muscular dystrophy.
75. The method of claim 74, wherein the disease is sickle cell disease.
76. The method of claim 75, wherein the vector comprises SEQ ID NO:44.
77. The method of claim 71, wherein the differentiated cell is selected from the group consisting of a(n) epithelial cell, keratinocyte, fibroblast, hepatocyte, neuron, osteoblast, myocyte, kidney cell, lung cell, thyroid cell, and pancreatic cell.
78. The method of claim 77, wherein the differentiated cell is a keratinocyte.