US20170029798A1
2017-02-02
14/809,279
2015-07-27
Macromolecule intracellular transduction technology based on improved cell-permeable Parkin recombinant protein (iCP-Parkin) has been developed as a protein-based anti-neurodegenerative agent for efficient BBB-penetration to effectively deliver the recombinant protein into the brain. Parkin protein, a dopaminergic neuronal cell death inhibitor, has been fused with a newly developed advanced macromolecule transduction domain (aMTD) and solubilization domain (SD) to increase the solubility/yield and cell-/tissue-permeability of the recombinant protein. In addition, our newly developed aMTD/SD-fused recombinant iCP-Parkin protein has shown BBB-permeability. Both in vitro and in vivo, our iCP-Parkin recombinant protein improved motor skills, a typical phenotype of Parkinson's disease, by increasing dopamine level in the brain by suppressing apoptosis of dopaminergic neuron cells. In conclusion, iCP-Parkin could be applicable in clinical studies as a protein-based anti-neurodegenerative agent to treat Parkinson's disease by protecting dopaminergic neuron cells and regulating the secretion of dopamine.
Get notified when new applications in this technology area are published.
C12N9/93 » CPC main
Enzymes; Proenzymes; Compositions thereof ; Processes for preparing, activating, inhibiting, separating or purifying enzymes Ligases (6)
C12Y603/02019 » CPC further
Ligases forming carbon-nitrogen bonds (6.3); Acidâamino-acid ligases (peptide synthases)(6.3.2) Ubiquitin-protein ligase (6.3.2.19), i.e. ubiquitin-conjugating enzyme
G01N2333/9015 » CPC further
Assays involving biological materials from specific organisms or of a specific nature; Enzymes; Proenzymes Ligases (6)
C12N9/00 IPC
Enzymes; Proenzymes; Compositions thereof ; Processes for preparing, activating, inhibiting, separating or purifying enzymes
G01N33/573 » CPC further
Investigating or analysing materials by specific methods not covered by groups -; Biological material, e.g. blood, urine ; Haemocytometers; Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing; Immunoassay; Biospecific binding assay; Materials therefor for enzymes or isoenzymes
1. Technical Field
The present invention relates to new protein-based therapeutic agents specially targeted for neurodegenerative disorder based on macromolecule intracellular transduction technology (MITT) enabled with newly advanced hydrophobic CPPs providing cell-permeability of macromolecules in vitro and in vivo. The recombinant protein of this invention has new technical advantages as an intracellular protein therapy for the treatment of Parkinson's disease in that it could resolve blood-barrier permeability, tissue-permeability, and bio-transfer function.
2. Background Art
Parkinson's disease is one of leading neurodegenerative disease that occurs by instable generation and secretion of dopamine (1). In patients with Parkinson's disease, there has been damage in dopaminergic neuron in the midbrain; pathological features, such as a formation of lewy body; mobility defect, such as bradykinesia, rest tremor, and rigidity; and non-motor symptoms, such as depression, dementia, and insomnia (2-4).
Parkinson's disease is a neurodegenerative disease found mostly in older generations. Statistically, Approximately 1% of people aged more than 55 and 3% in people aged more than 75 have been diagnosed with the disease (5). As the population of aged people increases, patients diagnosed with Parkinson's disease are ever growing in number. Globally, the population of patients with this disease has been projected to increase from 4.1 million individuals in 2005 to 8.7 million individuals by 2030 (6, 7).
The cause of Parkinson's disease has been unclear; however, previous studies reported that it's caused by both genetic and environmental factors in combination; especially, mutation of parkin gene has the highest prevalence among the various genetic factors that cause Parkinson's disease. Parkin gene has been first discovered Japanese stock that has autosomal recessive juvenile Parkinsonism (ARJP) (8). Parkin gene mutation could be discovered from approximately 50% in early-onset hereditary Parkinson's disease and 18% in sporadic patients below the age of 50 (9).
Parkin is comprised of 465 amino acid sequences that functions has E3-ligase in ubiquitin-proteasome system. Parkin protein functions to reduce the oxidative stress in the cell by removing damaged, oxidized, and/or irregularly structured protein inside the cell.
When Parkin mutation occurs, it loses its property as an E3-ligase; inclusion body and/or irregular proteins are accumulated inside the cell that lead to reduced secretion of dopamine and apoptosis of dopaminergic neuron (10). There has been a recent study pertaining to Parkinson's disease using the fruit flies that have shown decrease in motor function by the decrease in dopamine secretion due to an inactivation of dopaminergic neuron in which the function of Parkin and PINK1 was revealed (11). Moreover, when Parkin was overexpressed in the fruit fly that did not express PINK1, Parkinson's disease-related symptoms caused by PINK1, such as mitochondrial dysfunction and degradation of dopaminergic neuron, were confirmed to be recovered (11-13). Based on these factors, Parkin protein may successfully act as a target protein-based agent to treat Parkinson's related diseases by functioning as a main enzyme in the ubiquitin-proteasome system to destroy inclusion body and suppress apoptosis of dopaminergic neuron by maintaining the function of mitochondria from oxidative stress.
Macromolecule, such as Parkin protein, cannot be translocated across the cell membrane; furthermore, it cannot transpose through the blood-brain-barrier to be delivered into the brain. Therefore, macromolecule intracellular transduction technology (MITT), which enables the translocation of macromolecules into the cell/tissue, has been devised to deliver Parkin protein into the cells.
This membrane translocating technology, macromolecule intracellular transduction technology (MITT) using hydrophobic CPP demonstrated its effect in delivering biologically active therapeutic cargo proteins, such as Parkin, into cultured cells and animal tissues.
In the previous studies, MITT-based hydrophobic CPPs named membrane translocating sequence (MTS) and membrane translocating motif (MTM), derived from the hydrophobic signal peptide of fibroblast growth factor 4 (FGF4) have been reported and used to deliver biologically active peptides and proteins systemically in animals. After screening 1,500 hydrophobic signaling peptides, subsequently modified macromolecule transduction domain (MTD) has been synthetically developed, and these hydrophobic MTD sequences appeared to penetrate the plasma membrane directly after inserting them into the membranes.
Based on the MTD, we developed the cell-permeable protein-based therapeutics for Parkinson's disease. In order to develop cell-/tissue-permeable and BBB-permeable Parkin recombinant protein, Parkin has been previously fused to a hydrophobic cell-penetrating peptide (CPP) named macromolecule transduction domain (MTD) to develop MTD-fused Parkin recombinant protein (CP-Parkin). Cell-/tissue-/BBB-permeable CP-Parkin recombinant protein has proven to have an effect to treat Parkinson's disease by suppressing apoptosis of neuron cells, increasing the secretion of dopamine, and recovering the motor skills. However, CP-Parkin was not clinically applicable due to its relatively low solubility and yield.
In order to overcome this limitation, newly improved cell-permeable Parkin recombinant protein (iCP-Parkin) has been developed with an advanced macromolecule transduction domain (aMTD) and solubilization domain (SD). Newly advanced macromolecule transduction domain (aMTD) sequences have been artificially developed based on seven critical factors that were selected from the in-depth analysis of previously developed CPPs. To improve overall solubility and yield of the recombinant protein, solubilization domain (SD) has also been fused to aMTD-fused Parkin recombinant protein. The present invention is devised to develop much enhanced BBB-penetrable Parkin recombinant protein to effectively improve decrease in motor skills from Parkinson's disease by protecting dopaminergic neurons and recovering the formation and secretion of dopamine. In addition, this invention, iCP-Parkin, has a technical advantage over other previously developed anti-neurodegenerative agents by resolving the setbacks of blood brain barrier penetration and low solubility/yield.
An aspect of the present invention pertains to cell-permeable recombinant protein for the treatment of Parkinson's disease based on advanced macromolecule transduction domain (aMTD) sequences capable of mediating the transduction of biologically active macromolecules into live cells.
An aspect of the present invention relates to Parkin recombinant proteins fused aMTD and SD improved to high solubility and high yield for clinical application possible level.
An aspect of the present invention also, cell-permeable Parkin recombinant proteins comprised of aMTD sequences artificially developed with seven critical factors (CFs) and optimized based on in-depth analysis of Parkin and aMTDs association from selected 10 aMTDs and 10 random peptides (rPs or rPeptides).
An aspect of the present invention is related to a list of amino acid sequences of the Parkin recombinant proteins fused to newly invented hydrophobic cell-penetrating peptides (CPPs)âadvanced macromolecule transduction domains (aMTDs) and solubilization domain (SD)
An aspect of the present invention is related to a list of cDNA sequences of the Parkin recombinant proteins fused to newly invented hydrophobic cell-penetrating peptides (CPPs)âadvanced macromolecule transduction domains (aMTDs) and solubilization domain (SD)
An aspect of the present invention is related to a result of analysis with previously developed hydrophobic cell-penetrating peptides (CPPs), namely advanced macromolecule transduction domains (aMTDs)
An aspect of the present invention is related to a result of analysis with newly invented hydrophobic cell-penetrating peptides (CPPs), namely advanced macromolecule transduction domains (aMTDs)
An aspect of the present invention is related to a method for development of the new hydrophobic cell-penetrating peptides (CPPs), namely advanced macromolecule transduction domains (aMTDs)
An aspect of the present invention is related to a method for analysis with previously developed hydrophobic cell-penetrating peptides (CPPs), namely advanced macromolecule transduction domains (aMTDs)
An aspect of the present invention is related to a method for preparation of the Parkin recombinant proteins fused to newly invented hydrophobic cell-penetrating peptides (CPPs), namely advanced macromolecule transduction domains (aMTDs) and solubilization domain (SD)
An aspect of the present invention is related to a method for determination of solubility, yield, cell- and tissue-permeability of the Parkin recombinant proteins fused to newly invented hydrophobic cell-penetrating peptides (CPPs), namely advanced macromolecule transduction domains (aMTDs) and solubilization domain (SD)
Other aspects of the present invention relate to cell-/tissue-/BBB-permeable protein-based therapeutics for Parkinson's disease based on an efficient use of aMTD sequences for drug delivery, protein therapy, intracellular protein therapy, protein replacement therapy and peptide therapy.
With enhanced solubility and yield, aMTD/SD-fused Parkin recombinant protein could be produced in large quantities. In addition, effective BBB-permeability of the recombinant protein overcomes the limitations of previously developed anti-neurodegenerative treatments. Therefore, the present invention, iCP-Parkin, would allow practical applications to efficiently treat Parkinson's related diseases.
FIG. 1 shows aMTD321-Mediated Cell-Permeability Compared to Negative Control (rP38) and Previously Developed CPP (MTM12 and MTD85). Cell-permeable potency of a negative control (rPeptide 38) and previously developed hydrophobic CPPs (MTM12 and MTD85) are shown as the references. The cell-permeable potency of aMTD321 was visually compared to that of a SDA only (HSA). The area formed by the graph with the legend of âVehicleâ represents untreated RAW 264.7 cells (vehicle); the line with the legend of âIFTC onlyâ represents FITC-fused cells (FITC only); the line with the legend of âHSAâ indicates Histidine fused with SDA with FITC-labeling (HSA); and the line with the legend of âHMSAâ shows the negative control (rP38), previously developed CPPs (MTM12 and MTD85), and aMTD-recombinant proteins (HM321SA).
FIG. 2 shows aMTD321-Mediated Intracellular Localization Compared to Negative Control (rP38) and Previously Developed CPP (MTM12 and MTD85). Each of NIH3T3 cells was incubated for 1 hour at 37° C. with 10 â˘M FITC-conjugated recombinant proteins. Cell-permeability of His-aMTD-SDA Parkin recombinant proteins was visualized by utilizing confocal microscopy LSM700 version (top). Nomarski image of the same cells (bottom).
FIG. 3 shows Schematic Diagram of His-aMTD/SD-Fused Parkin Recombinant Proteins. A schematic Diagram of His-aMTD-SD-Parkin recombinant protein having cell-permeability is illustrated and constructed according to the present invention. Designs (Set 1) of recombinant Parkin fusion proteins contained histidine tag for affinity purification (MGSSHHHHHHSSLVPRGSH (SEQ OD NO: 2), with the legend of âHisâ), cargo (Parkin, with the legend of âParkinâ), aMTD321 (IVAVALPALAVP (SEQ OD NO: 4), with the legend of âaMTDâ), SDA (with the legend of âSDAâ) and SDB (with the legend of âSDBâ).
FIG. 4 shows Agarose Gel Electrophoresis Analysis After Cloning of Parkin Recombinant Proteins. These figures show the agarose gel electrophoresis analysis showing plasmid DNA fragments insert encoding aMTD-SD-Fused Parkin cloned into the pET28a (+) vector according to the present invention.
FIG. 5 shows Expression and Purification of Parkin Recombinant Proteins. Expression of Parkin recombinant Protein in E. coli. SDS-PAGE analysis of cell lysates before (â) and after (+) IPTG induction; aliquots of Ni2+ affinity purified proteins (P); and molecular weight standards (M). The size (number of amino acids), yield (mg/L) and solubility of each recombinant protein are indicated. Solubility was scored on a 5-point scale from highly soluble, with little tendency to precipitate (+++++), to largely insoluble proteins (+).
FIG. 6 shows Relative Yield of Parkin Recombinant Proteins Compared to Negative Control (HP). The figure shows graphs comparing the yield of aMTD-SD-fused Parkin recombinant proteins with His-Parkin recombinant protein without aMTD (HP).
FIG. 7 shows Determination of aMTD-Mediated Cell-Permeability of Parkin Recombinant Proteins. Protein uptake of Parkin recombinant proteins by RAW264.7 cells. Cells were incubated for 1 hour at 37° C. with 10 â˘M FITC-conjugated Parkin recombinant proteins (FITC-HP, FITC-HM321P, FITC-HM321PSA and FITC-HM321PSB), an equimolar concentration of unconjugated FITC (FITC only) or vehicle (culture medium, DMEM), treated to remove cell-associated but non-internalized protein, and analyzed by flow cytometry.
FIG. 8 shows Determination of aMTD-Mediated Intracellular Localization of Parkin Recombinant Proteins. Each of NIH3T3 cells was incubated for 1 hour at 37° C. with 10 â˘M FITC-conjugated Parkin recombinant proteins (FITC-HP, FITC-HM321P, FITC-HM321PSA and FITC-HM321PSB), an equimolar concentration of FITC only or vehicle. Cell-permeability of Parkin recombinant proteins was visualized by utilizing fluorescence confocal microscopy LSM700 version (top). Nomarski image of the same cells (bottom).
FIG. 9 shows Tissue Distribution of Parkin Recombinant Proteins In Vivo. Cryosections (20 uM) of organs were prepared from ICR mice 2 hours after intraperitoneal injection of diluent, FITC only and 600 ug FITC-conjugated Parkin recombinant proteins (FITC-HP, FITC-HM321P, FITC-HM321PSA and FITC-HM321PSB). Tissue distribution of the Parkin recombinant proteins (green staining) was analyzed with fluorescence microscopy.
FIG. 10 shows Inhibition of Apoptosis in Dopaminergic CATH.a Cells. CATH.a cells at 70% confluence were incubated with 50 uM 6-hydroxydopamine (6-OHDA, Agonist) for 1 hr, treated for 2.5 hrs with 2.5 uM HP, HM321P, HM321PSA or HM321PSB and assessed for apoptosis by TUNEL staining. The micrographs are representative of three independent experiments, plotted (bottom) as meansÂąS.D. Experimental differences between groups were assessed by a Student's two-paired t-test (*p, 0.05).
FIG. 11 shows Inhibition of Apoptosis in Dopaminergic SH-SY5Y Cells. SH-SY5Y cells at 70% confluence were incubated with 100 uM 6-hydroxydopamine (6-OHDA, Agonist) for 6 hr, treated for 2.5 hrs with 2.5 uM HP, HM321P, HM321PSA or HM321PSB and assessed for apoptosis by TUNEL staining. The micrographs are representative of three independent experiments, plotted (bottom) as meansÂąS.D. Experimental differences between groups were assessed by a Student's two-paired t-test (*p, 0.05).
FIG. 12 shows Schematic Diagram of His-aMTD/SDB-Fused Parkin Recombinant Proteins. A schematic Diagram of His-aMTD/SD-Parkin recombinant protein having cell-permeability is illustrated and constructed according to the present invention. Designs (Set 2) of Parkin recombinant proteins contained histidine tag for affinity purification (with the legend of âHis-Tagâ), cargo (Parkin, with the legend of âParkinâ), aMTD321 (with the legend of âaMTDâ) and SDB (with the legend of âSDBâ).
FIG. 13 shows Expression and Purification of Parkin Recombinant Proteins. Expression of Parkin recombinant proteins in E. coli. SDS-PAGE analysis of cell lysates before (â) and after (+) IPTG induction; aliquots of Ni2+ affinity purified proteins (P); and molecular weight standards (M). The size (number of amino acids), yield (mg/L) and solubility of each recombinant protein are indicated. Solubility was scored on a 5-point scale from highly soluble, with little tendency to precipitate (+++++), to largely insoluble proteins (+).
FIG. 14 shows Relative Yield of SDB-Fused Parkin Recombinant Proteins (HPSB) Compared to Negative Control (HP). The figure shows structures of SDB-fused Parkin recombinant proteins and graphs comparing the yield of SDB-fused Parkin recombinant proteins (HPSB) with His-Parkin recombinant protein without aMTD (HP).
FIG. 15 shows Determination of aMTD-Mediated Cell-Permeability of HM321PSB. Protein uptake of Parkin recombinant proteins by NIH3T3 cells. Cells were incubated for 1 hour at 37° C. with 10 â˘M FITC-conjugated Parkin recombinant proteins with or lacking aMTD321 sequence (FITC-HPSB and FITC-HM321PSB), an equimolar concentration of unconjugated FITC (FITC only) or vehicle (culture medium, DMEM), treated to remove cell-associated but non-internalized protein, and analyzed by flow cytometry.
FIG. 16 shows Determination of aMTD-Mediated Intracellular Localization of HM321PSB. Each of NIH3T3 cells was incubated for 1 hour at 37° C. with 10 â˘M FITC-conjugated Parkin recombinant proteins (FITC-HPSB and FITC-HM321PSB), an equimolar concentration of FITC only or vehicle. Cell-permeability of Parkin recombinant proteins was visualized by utilizing fluorescence confocal microscopy LSM700 version (top). Nomarski image of the same cells (bottom).
FIG. 17 shows In Vivo Cellular Uptake of HM321PSB in PBMC. FACS analysis of PBMC isolated from whole blood of ICR mice 15 min (top) and 30 min (bottom) after intraperitoneal injection of diluent, FITC only and FITC-conjugated Parkin recombinant proteins (600 ug, FITC-HPSB and FITC-HM321PSB).
FIG. 18 shows Tissue Distribution of HM321PSB In Vivo. Cryosections (20 uM) of organs were prepared from ICR mice 2 hours after intraperitoneal injection of diluent, FITC only and 600 ug FITC-conjugated Parkin recombinant proteins (600 ug, FITC-HPSB and FITC-HM321PSB). Tissue distribution of the Parkin recombinant proteins (green staining) was analyzed with fluorescence microscopy.
FIG. 19 shows Delivery of aMTD-Mediated Parkin Recombinant Protein to the Brain Determined by Western Blot Analysis. Western blot analysis of brain Parkin. Lysates were prepared from brain samples 2 hrs after IP administration of diluent alone or 600 ug His-tagged Parkin recombinant proteins without aMTD or lacking aMTD sequences and analyzed by western blotting using anti-Parkin and anti-b-actin antibodies.
FIG. 20 shows Delivery of aMTD-Mediated Parkin Recombinant Protein to the Brain Determined by Immunoblot. Immunoblotting of Parkin recombinant proteins in the cerebellum. Sagittal sections through the cerebellum were immunostained with anti-Parkin antibody 2 hrs after IP injection of 600 ug of diluent alone or His-tagged Parkin recombinant proteins without aMTD or lacking aMTD sequences.
FIG. 21 shows Protocol of MPTP-Induced PD Mouse Model. 8-week-old C57BL/6 male and female mice were received intraperitoneal injections of MPTP (15 mg/kgĂ3 times/day, 2 h interval) for three consecutive days. After 3 days, mice were received IP injection of Parkin recombinant proteins (HPSB and HM321PSB, 600 ug/head, a time/day) for five consecutive days, respectively. Urine and brain dopamine levels, gross motor function and brain lesions (TH immunostaining) were analyzed on subsequent days as indicated.
FIG. 22 shows Dopamine of Urine in MPTP-Induced PD mice Treated with Recombinant Proteins. Dopamine levels in the urine of MPTP-lesioned mice. Urine dopamine levels in MPTP-lesioned mice were measured by ELISA 10 hrs after HPSB and HM321PSB protein treatment. Experimental differences between groups were assessed by a Student's two-paired t-test (*p<0.05).
FIG. 23 shows 3 Dopamine of Brain in MPTP-Induced PD mice Treated with Recombinant Protein. Striatal dopamine levels in MPTP-lesioned mice. Dopamine levels in striatal biopsies were determined by ELISA in lesioned mice without protein treatment or after daily treatments with HM321PSB as shown in FIG. 11. Dopamine levels in groups of 4 mice are presented as meansÂąS.D. Experimental differences between groups were assessed by a Student's two-paired t-test (*p<0.05).
FIG. 24 shows Preservation of Gross Motor Function in MPTP-Lesioned Mice Treated with Parkin Recombinant Proteins. HM321PSB preserves gross motor function of MPTP-lesioned mice. 9 hrs after the last MPTP treatment mice were treated for 3 hrs with 600 ug proteins (IP, HPSB or HM321PSB), and motor ability was assessed by placing the animals in a water bath and video recording subsequent movements. The percentage of time of the mice in each treatment group were engaged in 4 legged motion is presented as meansÂąS.D. The number of mice in each group was as follows: Diluent, 12; MPTP only, 7; MPTP+HPSB, 14; MPTP+HM321PSB, 12. Experimental differences between groups were assessed by a Student's two-paired t-test (*p<0.05).
FIG. 25 shows Determination of Footprint Pattern using Gait Test. Parameters measured in footprint analysis with dotted lines representing the direction of progression (DoP) of walking are shown. Footprints of MPTP-lesioned mice were evaluated for stride length (cm) and sway length (cm).
FIG. 26 shows Stride Length in Gait Test by Parkin Recombinant Protein. Histograms represent differences in: stride length in groups of 4 mice are presented as meansÂąS.D. Experimental differences between groups were assessed by a Student's two-paired t-test (*p<0.05).
FIG. 27 shows Sway Length in Gait Test by Parkin Recombinant Protein. Histograms represent differences in: sway length in groups of 4 mice are presented as meansÂąS.D. Experimental differences between groups were assessed by a Student's two-paired t-test (*p<0.05).
FIG. 28 shows Dopaminergic Neuron in Substantia Nigra and Striatum by Parkin Recombinant Protein. HM321PSB reduces MPTP-induced dopaminergic toxicity. MPTM-lesioned mice were treated with Parkin recombinant proteins for 5 days as shown in FIG. 11 (IP, 15 mg/kg) and loss/preservation of dopaminergic neurons was determined by tyrosine hydroxylase (TH) staining.
FIG. 29 shows Recovery Effect of Dopaminergic Neuron in Substantia Nigra by Parkin Recombinant Protein. The percentage of TH-positive cells in each treatment group was calculated. Experimental differences between groups were assessed by a Student's two-paired t-test (*p<0.05).
The present invention relates to protein-based therapeutics for Parkinson's disease having cell-permeability applicable for the clinical studies that facilitate the transduction of biologically active macromolecules including proteins across the cell membrane. The cell-permeable Parkin recombinant protein of the present invention based on aMTD is artificially developed.
In this invention, the aim is to develop iCP-Parkin by adopting novel hydrophobic CPPs formatted based on the seven critical factors determined based on in-depth analysis to facilitate protein translocation across the membrane. These seven critical factors include the amino acid length (9-13), bending potential based on the proline position and location (6â˛, 7â˛, 8Ⲡin the middle and 12Ⲡat the end), rigidity/flexibility (II: 40-60), structural formation (AI: 180-220), amino acid composition (A, V, I, L, and P), and the secondary structure (helix formation recommended). Based on these critical factors analyzed with selected published CPPs, the novel hydrophobic CPPsâaMTDsâhave been designed for the development of iCP-Parkin proteins to enhance its ability to transduce across the cell membrane.
1-1. Selection of aMTD for Cell-Permeability
Various hydrophobic CPP have been used to enhance the delivery of protein cargoes to mammalian cells and tissues. Similarly, aMTD321 had been discovered to enhance the uptake of a His-tagged coding sequence of solubilization domain A (SDA) in RAW264.7 cells as assessed by flow cytometry. Relative levels of protein uptake was 7 times that of a reference MTM12 protein, which contained 1st generation CPP (membrane translocating motif) and was 2.9 times that of a MTD85 reference protein, which contained 2nd generation CPP (macromolecule transduction domain). In addition, relative to 8.1-fold higher protein uptake was observed with a random peptide recombinant protein (rP38)-fused with SDA, a peptide sequence, which had an opposite property of that of aMTD FIG. 1. Similar results were obtained in NIH3T3 cells using fluorescent microscopy to monitor the protein uptake. These aMTD321-mediated intracellular delivered into cells were displayed in FIG. 2 and information of aMTD321 displayed in TABLE 1.
| TABLEâ1â |
| [CharacteristicsâofâaMTD321] |
| Rigidity/ | Struc- | ||||
| Flexi- | tural | Hydro- | |||
| aMTD | A/s | bility | Feature | pathy | |
| ID | Sequence | Length | (II) | (AI) | (GRAVY) |
| 321 | IVAVALPALAVP | 12 | 50.2 | 203.3 | 2.4 |
| (SEQâIDâNO:â4) | |||||
Recombinant cargo (parkin) proteins fused to hydrophobic CPP could be expressed in bacteria system, purified with single-step affinity chromatography, but protein dissolved in physiological buffers (e.g. PBS, DMEM or RPMI1640 etc.) was highly insoluble and had extremely low yield as a soluble form. Therefore, an additional non-functional protein domain (solubilization domain: SD) has been applied to fuse with the recombinant protein for improving the solubility, yield and eventually cell and tissue permeability.
According to the specific aim, the selected domains are SDA and SDB (TABLE 2). The aMTD/SD-fused recombinant proteins have been determined for their stability and stability.
The solubilization domains (SDs) and aMTDs have greatly influenced in increasing solubility/yield and cell-/tissue-permeability of the protein. Therefore, we have developed highly soluble and highly stable Parkin recombinant protein fused with SD (SDA and SDB) and aMTDs for the clinical application.
| TABLE 2 |
| [Characteristics of Solubilization Domain] |
| Instability | Hydropathy | |||||
| SD | Origin | Length | PI | Index (II) | (GRAVY) | |
| A | Bacteria | 23 | 4.6 | 48.1 | â0.1 | |
| B | Pansy | 11 | 4.9 | 43.2 | â0.9 | |
We designed 4 different types of recombinant proteins with or without the aMTD and solubilization domains for Parkin protein. Protein structures were labeled as follows: (i) a cargo protein only, (ii) a cargo protein fused with aMTD, (iii) a cargo protein fused with aMTD and solubilization domain A (SDA) and (iv) a cargo protein fused with aMTD and solubilization domain B (SDB) (FIG. 3).
Each Parkin recombinant protein was successfully induced by adding IPTG and purified (FIG. 5). We observed a significant increase of solubility of Parkin fused with either SDA (HM321PSA) or SDB (HM321PSB), which were compared to a cargo protein only (HP) or cargo protein fused with only aMTD (HM321P). Moreover, the solubilization domains (SDA and SDB) successfully improved relative yield of proteins compared to HP, where HM321PSA and HM321PSB showed 4 folds increase of solubility (FIG. 6). Therefore, these results suggested that the Parkin recombinant proteins fused with SDs displayed a significant improvement of solubility and yields. In order to solve the problem with low solubility and yield of negative control protein (HP), additional set of structures for recombinant proteins were designed as shown in FIG. 12. Recombinant proteins in set 2 were fused with SDB on C-terminal with (HM321PSB) or lacking aMTD (HPSB). These Parkin recombinant proteins improve the solubility and yield by using these strategies FIGS. 13 and 14.
The aMTD321/SD-fused Parkin recombinant proteins have significantly higher cell-, tissue-permeability as compared to the Parkin recombinant proteins lacking aMTD321 sequence (HP and HPSB). Collectively, even though these aMTD321/SD-fusion Parkin recombinant proteins (HM321PSA and HM321PSB) have similar solubility and yield, cellular and systemic delivery activity of aMTD321/SDB-fused Parkin recombinant protein was higher than Parkin recombinant protein lacking aMTD321 sequence. Therefore, aMTD321/SD-fused Parkin recombinant protein was determined as the most stable structure of the recombinant proteins.
We investigated in the cell/tissue-permeability and biological activity of developed Parkin recombinant proteins. Cell permeability of Parkin recombinant proteins was evaluated in RAW 264.7 cells after 1 hour of protein treatment. FITC-labeled Parkin recombinant proteins lacking aMTD (HP and HPSB) was not detectable in RAW cells. In contrast, the aMTD-bearing Parkin recombinant proteins, HM321P, HM321PSA and HM321PSB, showed high cell permeability (FS. 7 and 15). Similar results were obtained in NIH3T3 cells, using fluorescence confocal laser scanning microscopy to monitor protein intracellular localization. (FIGS. 8 and 16). In particular, the aMTD/SD-fused Parkin recombinant proteins (HM321PSA and HM321PSB) showed the highest cell permeability. These results showed that the aMTD successfully abled the proteins to penetrate into the cells within short time (1 hour) and improved the solubility of proteins that positively affect cell-permeability.
Next, we determined in vivo tissue-permeability of Parkin recombinant proteins after 15 min and 30 min of intraperitoneal injection of FITC-labeled proteins (FIG. 17). The PBMC analyzed by FACS showed a gain in fluorescence, indicative of the presence of FITC-labeled proteins as compared with control animals that received FITC-labeled HPSB or unconjugated FITC. One of the two Parkin recombinant proteins, HM321PSB, showed a higher intracellular signal in PBMC. The distribution of FITC-labeled proteins in different organs in cryosections analyzed by fluorescence microscopy (FIGS. 9 and 18). Similar results, the Parkin recombinant proteins lacking aMTD (HP and HPSB) showed limited tissue permeability in various organs (brain, heart, lung, liver, spleen and kidney). In contrast, aMTD321 enhanced the systemic delivery of Parkin recombinant proteins in tissues (heart, lung, liver and kidney).
To determine the blood-brain-barrier permeability by using immunohistochemical labeling (immunohistochemistry), tissues were immunohistochemically processed using anti-Parkin (1:200, Santa Cruz Biotechnology) monoclonal antibodies. Parkin positive immunoreactivity was observed in brain of the HM321PSB-treated mice, but it was not observed in brain of the HPSB-treated mice (FIG. 20). In the result of western blot, Parkin antibody-positive band was only observed in group administered HM321PSB recombinant protein (FIG. 29). The results have demonstrated that the aMTD321/SD-fused Parkin recombinant protein could be efficiently delivered to the brain by penetrating the blood-brain barrier permeability.
To determine the protective effect of Parkin recombinant protein on the neuronal death caused by the neurotoxin, CATH.a and SH-SY5Y cells were treated with 6-hydroxydopamine (6-OHDA). After treatment of 6-OHDA, these cells were pre-treated with Parkin recombinant proteins and TUNEL assays were conducted. A large number of cell death were observed in 6-OHDA only treated group. Similarly to 6-OHDA-treated group, HP lacking aMTD has shown similar percentage of apoptotic cell death with the agonist only group. Contrastingly, aMTD321/SD-fused Parkin recombinant proteins (HM321PSA and HM321PSB) have suppressed apoptosis to 19.7 and 14.2% in CATH.a and SH-SY5Y cells, respectively (*p<0.05). Similar results have been obtained in both CATH.a cells and SH-SY5Y cells. These results have demonstrated that aMTD321/SD-fused Parkin recombinant proteins have neuroprotective effects in cultured neuronal cells (FIGS. 10 and 11).
In order to determine the effect of Parkin recombinant proteins in vivo, we developed a Parkinson's diseaseâ(PD-) animal model that mimics physiological and mental symptoms of Parkinson's disease by using a neural toxin. To induce Parkinson's disease-like symptoms, the neural toxin, MPTP (1-methyl-4-phenyl-1,2,3,6-tetrahydrophyridine) was used. This MPTP is converted to a toxic agent MPP+ after it gets activated by monoamine oxidase (MAO-B) in the inner mitochondrial membrane, and this selectively targets dopaminergic neuron to induce Parkinson's disease.
To assess the motor function recovery effect of Parkin recombinant proteins, swimming test was conducted. Swimming activity (4 legged) of each group (Diluent, MPTP only, MPTP+HPSB and MPTP+HM321PSB) was measured and expressed as a percentage of the unlesioned diluent control. MPTP only group showed significant decrease in the swimming activity as compared to the diluent group. Similarly, HPSB-treated group showed similar result of MPTP only group with 6-OHDA treated group. Contrastingly, HM321PSB-treated group showed improved motor activity. Therefore, we have determined that aMTD321/SD-fused Parkin recombinant protein recovered motor function in acute MPTP-induced Parkinson disease mouse model (FIG. 24).
To assess the motor function recovery effect of Parkin recombinant proteins, gait test was performed (FIG. 25). In this experiment, the stride distance and sway distance were measured. The stride distance was significantly reduced in the MPTP only and HPSB-treated group, while the sway distance was increased as compared to the diluent group. However, the HM321PSB-treated mice showed the stride distance (FIG. 26) of similar levels as the normal group and they showed significantly reduced sway distance (FIG. 27) as compared to the MPTP only and HPSB-treated group. Therefore, we have determined that aMTD321/SD-fused Parkin recombinant protein improves gait function in acute MPTP-induced Parkinson diseased mouse model.
To measure the dopamine level in urine, urine was collected from mice in all groups 10 h after the first treatment of Parkin recombinant proteins. These urine samples have been measured by ELISA. There has been statistically significant difference between MPTP only and HM321PSB-treated group in the result after 10 h. While MPTP only group has shown decreased urine level, HM321PSB-treated group have shown similar urine level as compared with the diluent group. The results have demonstrated that the aMTD321/SD-fused Parkin recombinant protein stimulates dopamine level in urine. (FIG. 22).
To measure the dopamine level in the brain, dopamine level of striatal regions in all groups have been measured by ELISA. Striatal dopamine level in HM321PSB-treated group was more than double compared to the MPTP only and HPSB-treated group. Therefore, we have determined that aMTD321/SD-fused Parkin recombinant protein causes an increase of striatal dopamine level, decreased by MPTP treatment (FIG. 23).
To determine the protective efficacy of dopaminergic neuron by Parkin recombinant protein, immunohistochemistry was performed using an antibody for tyrosine hydroxylase, which is a marker enzyme in dopamine neurons. The number of dopaminergic neurons in the substantia nigra and the striatum region of the mice treated with aMTD321/SD-fused Parkin recombinant protein were observed and compared to the MPTP only and HPSB administrated group. Therefore, we have determined that aMTD321/SD-fused Parkin recombinant protein could have a neuroprotective function (FIGS. 28 and 29).
For this invention, cell-permeable Parkin recombinant proteins have been designed and developed with the aMTD. All Parkin recombinant proteins fused with aMTD and control recombinant proteins lacking aMTD have been confirmed for their quantitative, visual cell-/tissue-permeability and BBB-permeability. We were able to confirm that the cell-permeable aMTD321/SD-fused Parkin recombinant proteins had relatively high cell-/tissue-permeability (FIGS. 7, 8, 9, 15, 16, 17 and 18), as well as efficient in the brain tissue delivery by penetrating through BBB (FIGS. 19 and 20). To determine the biological activity of cell-permeable Parkin recombinant protein, we carried out a variety of functional tests. We confirmed that the cell-permeable Parkin recombinant protein has anti-apoptotic effect on the neuronal cell death caused by a neurotoxin (6-OHDA) (FIGS. 10 and 11), and it has a recovery effect in the PD-mice model that displayed movement dysfunction induced by neurotoxin (MPTP) (FIGS. 24, 25, 26 and 27).
Many human diseases are caused by proteins with deficiency or over-expression that causes mutations such as gain-of-function or loss-of-function. We are developing protein-based therapeutics that can be efficiently delivered into the brain through the BBB penetration based on Macromolecule intracellular transduction technology. It could be a new therapeutic treatment of Parkinson's disease in which it regulates the function of proteins changed by various genetic causes.
The following examples are presented to aid practitioners of the invention, to provide experimental support for the invention, and to provide model protocols. In no way are these examples to be understood to limit the invention.
Our newly developed technology, aMTD-based MITT, has enabled us to improve the method for developing cell-permeable recombinant proteins. The expression vectors were designed for Parkin proteins fused with aMTD321 and solubilization domain A (SDA) or solubilization domain B (SDB). To acquire expression vectors for recombinant proteins, polymerase chain reaction (PCR) had been devised to amplify these recombinant proteins.
The PCR reactions (100 ng genomic DNA, 10 pmol each primer, each 0.2 mM dNTP mixture, 1Ă reaction buffer and 2.5 U Pfu(+) DNA polymerase (Doctor protein, Korea)) was digested on the restriction enzyme site between BamHI (5â˛) and HindIII (3â˛) involving 35 cycles of denaturation (95° C.) for 30 seconds, annealing (60° C.) for 30 seconds, and extension (72° C.) for 2 min each. For the last extension cycle, the PCR reactions remained for 5 minutes at 72° C. Then, they were cloned into the site of pET-28a (+) vectors (Novagen, Madison, Wis., USA). DNA ligation was performed using T4 DNA ligase at 4° C. overnight. These plasmids were mixed with competent cells of E. coli DH5⢠strain on the ice for 10 minutes. This mixture was placed on the ice for 2 minutes after it was heat shocked in the water bath at 42° C. for 90 seconds. Then, the mixture added with LB broth media was recovered in 37° C. shaking incubator for 1 hour. Transformant was plated on LB broth agar plate with kanamycin (50 â˘g/mL) (Biopure, Johnson, Tenn.) before incubating at 37° C. overnight. From a single colony, plasmid DNA was extracted, and after the digestion of BamHI and HindIII restriction enzymes, digested DNA was confirmed by using 1.2% agarose gels electrophoresis (FIG. 3). PCR primers for the His-tagged Parkin recombinant proteins fused to aMTD and SD are summarized in TABLE 3.
| TABLEâNO:â3â |
| [PCRâPrimersâforâHis-taggedâParkinâProteins] |
| Protein | Recombinant | PrimerâSequence | |
| Cargo | Protein | (5â˛-3â˛) | |
| Parkin | HP | Forward | ATAGGATCCATGATAGTGTTT |
| Gâ(SEQâIDâNO:â11) | |||
| Reverse | TATAAGCTTCCTACACGTCGA | ||
| (SEQâIDâNO:â12) | |||
| HM321P | Forward | GGGTTTGGATCCATTGTGGCG | |
| GTGGCGCTGCCGGCGCTGGCG | |||
| GTGCCGATGATAGTGTTTG | |||
| (SEQâIDâNO:â13) | |||
| Reverse | TATAAGCTTCCTACACGTCGA | ||
| (SEQâIDâNO:â14) | |||
| HM321PSA | Forward | GGGTTTGGATCCATTGTGGCG | |
| GTGGCGCTGCCGGCGCTGGCG | |||
| GTGCCGATGATAGTGTTTG | |||
| (SEQâIDâNO:â15) | |||
| Reverse | TATAAGCTTGCACGTCGAACC | ||
| (SEQâIDâNO:â16) | |||
| HM321PSB | Forward | GGGTTTGGATCCATTGTGGCG | |
| GTGGCGCTGCCGGCGCTGGCG | |||
| GTGCCGATGATAGTGTTTG | |||
| (SEQâIDâNO:â17) | |||
| Reverse | TATAAGCTTGCACGTCGAACC | ||
| (SEQâIDâNO:â18) | |||
| HPSB | Forward | ATAGGATCCATGATAGTGTTT | |
| Gâ(SEQâIDâNO:â19) | |||
| Reverse | TATAAGCTTGCACGTCGAACC | ||
| (SEQâIDâNO:â20) | |||
Denatured recombinant proteins were lysed using denature lysis buffer (8 M Urea, 10 mM Tris, 100 mM NaH2PO4) and purified by adding Ni-NTA resin. Resin bound to proteins were washed 3 times with 30 mL of denature washing buffer (8 M Urea, 10 mM Tris, 20 m imidazole, 100 mM NaH2PO4). Proteins were eluted 3 times with 30 mL of denature elution buffer (8 M Urea, 10 mM Tris, 250 mM imidazole). After purification, they was dialyzed twice against a refolding buffer (550 mM Guanidine-HCl, 440 mM L-Arginine, 50 mM Tris, 100 mM NDSB, 150 mM NaCl, 2 mM reduced glutathione and 0.2 mM oxidized glutathione). Finally, they were dialyzed against a physiological buffer such as DMEM at 4° C. until the dialysis was over 300Ă105 times. Concentration of purified proteins was quantified using Bradford assay according to the manufacturer's instructions. After purification, they were dialyzed against DMEM as indicated above. Finally, SDS-PAGE analysis was conducted to confirm the presence of target protein.
The aMTD321-fused Parkin proteins containing SDA or SDB are cloned, expressed, purified, and prepared in a soluble form. Each recombinant protein fused to aMTD and/or SD was determined for their solubility and yield. Solubility was scored on a 5-point scale ranging from highly soluble proteins with little tendency to precipitate (*****) to largely insoluble proteins (*) by measuring their turbidity (A450). Yield (mg/L) in physiological buffer condition of each recombinant protein was also determined. The cell-permeable Parkin recombinant proteins were observed as a single band, where the amount of the final purified protein was 13 mg/L (FIG. 3).
Recombinant proteins purified under the denatural condition were analyzed on 10% SDS-PAGE gel and stained with Coomassie Brilliant Blue.
Parkin recombinant proteins were conjugated to fluorescein isothiocyanate (FITC) according to the manufacturer's instructions (Sigma-Aldrich, St. Louis, Mo.). RAW 264.7 cells were treated with 10 â˘M FITC-labeled recombinant proteins for 1 hour at 37° C., washed three times with cold PBS, treated with proteinase K (5 â˘g/ml) for 10 min at 37° C. to remove cell-surface bound proteins. Cell-permeability of these recombinant proteins were analyzed by flow cytometry (FACSCalibur; BD, Franklin Lakes, N.J.) using the FlowJo analysis software.
For a visual reference of cell-permeability, NIH3T3 cells were cultured for 24 hours on a coverslip in 24-wells chamber slides, treated with 10 ÎźM FITC-conjugated recombinant proteins for 1 hour at 37° C., and washed three times with cold PBS. Treated cells were fixed in 4% paraformaldehyde (PFA, Junsei, Tokyo, Japan) for 10 minutes at room temperature, washed three times with PBS, and mounted with VECTASHIELD Mounting Medium (Vector laboratories, Burlingame, Calif.) with DAPI (4â˛,6-diamidino-2-phenylindole) for nuclear staining. The intracellular localization of the fluorescent signal was determined by confocal laser scanning microscopy (LM700, Zeiss, Germany).
For in vivo delivery, ICR mouse (5 weeks old, female) were injected intraperitoneally (IP, 600 ug/head) with FITC only or FITC-conjugated proteins. After 15 min and 30 min, PBMC were isolated from whole blood in mice, were analyzed by flow cytometry (BD, GUABA).
For a visual reference of tissue-permeability, 600 Îźg of FITC-labeled Parkin recombinant proteins was administered to ICR mice (5 weeks old, female). Two hours later, the mice are sacrificed, and liver, kidney, spleen, lung, heart and brain were isolated and embedded with an OCT compound (Sakura, Alphen anden Rijn, Neetherlands), frozen, and then sectioned to a thickness of 20 Îźm. The Tissue specimens are mounted on a glass and observed by fluorescence microscopy (Nikon, Tokyo, Japen).
For immunohistochemistry, 6-week-old ICR female mice were injected intraperitoneally with diluent (PBS) or with 600 â˘g His-tagged Parkin recombinant proteins. After 2 h, mice was perfused with 0.9% NaCl and fixed with cold 4% paraformaldehyde. After the brains were removed, they were post-fixed with 4% paraformaldehyde and transferred to 30% sucrose. The brains were cut into 30 Îźm coronal sections using a freezing microtome. Brain cryosections (30 â˘m) are immunostained with anti-Parkin (1:100, Santa Cruz Biotechnology) monoclonal antibodies, followed by biotin-conjugated goat anti-mouse secondary antibody (Vector Laboratories), and developed with Avidin-Biotin Complex kit (Vectastain kit, Vector Laboratories). For western blot analysis, mice treated with proteins were perfused with 0.9% NaCl. Brains were isolated, and striatal region was dissected and homogenized in lysis buffer (Intron, Seongnam, Korea). Supernatant from the centrifugation (13,000 rpm for 10 min at 4° C.) is analyzed by western blot that is probed with antibodies against parkin (1:200) and â˘-actin (1:2,000). The secondary antibody is goat anti-mouse IgG-HRP (all antibodies were from Santa Cruz Biotechnology).
Terminal dUTP nick-end labeling (TUNEL) assays are conducted according to the manufacturers' instructions (Roche). Mouse dopaminergic neuronal (CATH.a) cells (ATCC: American Type Culture Collection) are plated (3Ă104/well) and pre-treated with 50 â˘M 6-hydroxydopamine (6-OHDA) for 1 h at 37° C. followed by the treatment with 2.5 â˘M Parkin recombinant proteins for 2.5 h at 37° C., analyzing the changes in cell survival. Human brain tumor (SH-SY5Y) cells (Korea Cell Line Bank) are also cultured, plated (3Ă104/well) and pre-treated with 100 â˘M 6-hydroxydopamine (6-OHDA) for 6 h followed by the treatment with 2.5 â˘M Parkin recombinant proteins for 2.5 h at 37° C., analyzing the alteration.
8-week-old C57BL/6 male and female mice housed in plastic cages in a temperatureâand humidityâcontrolled room with a 12-h light/12h-dart cycle. Mice were randomly assigned to one of four experimental groups (Diluent, MPTP only, MPTP+HPSB and MPTP+HM321PSB). Three groups of mice except for diluent were received intraperitoneal injections of MPTP (15 mg/kgĂ3 times/day, 2 h interval) for three consecutive days. The neurotoxin, 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (Sigma-Aldrich, St. Louis, Mo.) was dissolved in 0.9% NaCl. Controls are treated with 0.9% NaCl for the same time period. After 3 days, mice in MPTP+HPSB and MPTP+HM321PSB groups were received intraperitoneal injection of HPSB, HM321PSB recombinant protein (600 Îźg/head, a time/day) for five consecutive days, respectively. We confirm that animal experiments are performed in accordance with the guidelines of the Institutional Animal Care and Use Committee.
For measurement of dopamine synthesized in the urine, we collected the urine of mice in all groups on the first day of treatment of Parkin recombinant protein. Dopamine synthesized in the urine is measured by using a commercial ELISA kit according to instructions provided by the manufacturer (GenWay, San Diego, Calif.). In brief, rabbit anti-dopamine antibody is added to urine or tissue extract, and the immune complexes are recovered in wells coated with goat anti rabbit antibody. A second enzyme conjugated anti-dopamine antibody directed against a different epitope produces the reaction products proportional to the amount of antigen as compared against a standard curve.
Dopamine synthesized in the brain extracts is measured by using a commercial ELISA kit according to instructions provided by the manufacturer (GenWay, San Diego, Calif.). In brief, rabbit anti-dopamine antibody is added to urine or tissue extract, and the immune complexes are recovered in wells coated with goat anti rabbit antibody. A second enzyme conjugated anti-dopamine antibody directed against a different epitope produces the reaction products proportional to the amount of antigen as compared against a standard curve.
Gross motor functions of MPTP-lesioned mice are assessed by using a swim test. Mice are placed in a 37° C. water bath and video recorded. Unlesioned mice have swum using all 4 legs 98% of the time. The percent of time of each group (MPTP only, MPTP+HPSB or MPTP+HM321PSB) spent swimming (4 legged) is measured and expressed as a percentage of the unlesioned diluent control.
The mice were allowed to walk along a 50 cm long, 10 cm wide runway with 10 cm high walls into an enclosed box. Stride length and sway length were measured as the average distance of forward movement between each stride and sway.
On the last day of treatment of Parkin recombinant protein, mice was perfused with 0.9% NaCl and fixed with cold 4% paraformaldehyde. And then, brains were removed, post-fixed with 4% paraformaldehyde, and transferred to 30% sucrose. The brains were cut into 30 Îźm coronal sections using a freezing microtome. Dopaminergic neuronal cell marker in brain-tyrosine hydroxylase (TH) is immunostained with anti-TH (1:50, Thermo Scientific, Rockford, USA) monoclonal antibody, followed by biotin-conjugated goat anti-rabbit secondary antibody (1:100, Santa Cruz Biotechnology, Santa Cruz, Calif.) and developed with ABC kit (Vectastain kit, Vector Laboratories, Burlingame, Calif.).
All experimental data using cultured cells are expressed as means S.D. for at least three independent experiments. Statistical significance is evaluated using a two-tailed Student's t-test or ANOVA method. Experimental differences between groups are assessed using paired Student's t-tests. For animal experiments, ANOVA is used for comparing between and within groups to determine the significance. Differences with p<0.05 are considered to be statistically significant.
| [cDNAâSequenceâofâHistidineâTag] | |
| SEQâIDâNO:â1 | |
| ATGGGCAGCAGCCATCATCATCATCATCACAGCAGCGGCCTGGTGCCGCGCGGCAGC | |
| [AminoâAcidâSequenceâofâHistidineâTag] | |
| SEQâIDâNO:â2 | |
| MetâGlyâSerâSerâHisâHisâHisâHisâHisâHisâSerâSerâGlyâLeu | |
| ValâProâArgâGlyâSer | |
| [cDNAâSequencesâofâaMTD321] | |
| SEQâIDâNO:â3 | |
| ATTGTGGCGGTGGCGCTGCCGGCGCTGGCGGTGCCG | |
| [AminoâAcidâSequencesâofâaMTD321] | |
| SEQâIDâNO:â4 | |
| IleâValâAlaâValâAlaâLeuâProâAlaâLeuâAlaâValâPro | |
| [cDNAâSequenceâofâhumanâParkin] | |
| SEQâIDâNO:â5 | |
| ATGATAGTGTTTâGTCAGGTTCAACâTCCAGCCATGGTâTTCCCAGTGGAG | |
| GTCGATTCTGACâACCAGCATCTTCâCAGCTCAAGGAGâGTGGTTGCTAAG | |
| CGACAGGGGGTTâCCGGCTGACCAGâTTGCGTGTGATTâTTCGCAGGGAAG | |
| GAGCTGAGGAATâGACTGGACTGTGâCAGAATTGTGACâCTGGATCAGCAG | |
| AGCATTGTTCACâATTGTGCAGAGAâCCGTGGAGAAAAâGGTCAAGAAATG | |
| AATGCAACTGGAâGGCGACGACCCCâAGAAACGCGGCGâGGAGGCTGTGAG | |
| CGGGAGCCCCAGâAGCTTGACTCGGâGTGGACCTCAGCâAGCTCAGTCCTC | |
| CCAGGAGACTCTâGTGGGGCTGGCTâGTCATTCTGCACâACTGACAGCAGG | |
| AAGGACTCACCAâCCAGCTGGAAGTâCCAGCAGGTAGAâTCAATCTACAAC | |
| AGCTTTTATGTGâTATTGCAAAGGCâCCCTGTCAAAGAâGTGCAGCCGGGA | |
| AAACTCAGGGTAâCAGTGCAGCACCâTGCAGGCAGGCAâACGCTCACCTTG | |
| ACCCAGGGTCCAâTCTTGCTGGGATâGATGTTTTAATTâCCAAACCGGATG | |
| AGTGGTGAATGCâCAATCCCCACACâTGCCCTGGGACTâAGTGCAGAATTT | |
| TTCTTTAAATGTâGGAGCACACCCCâACCTCTGACAAGâGAAACATCAGTA | |
| GCTTTGCACCTGâATCGCAACAAATâAGTCGGAACATCâACTTGCATTACG | |
| TGCACAGACGTCâAGGAGCCCCGTCâCTGGTTTTCCAGâTGCAACTCCCGC | |
| CACGTGATTTGCâTTAGACTGTTTCâCACTTATACTGTâGTGACAAGACTC | |
| AATGATCGGCAGâTTTGTTCACGACâCCTCAACTTGGCâTACTCCCTGCCT | |
| TGTGTGGCTGGCâTGTCCCAACTCCâTTGATTAAAGAGâCTCCATCACTTC | |
| AGGATTCTGGGAâGAAGAGCAGTACâAACCGGTACCAGâCAGTATGGTGCA | |
| GAGGAGTGTGTCâCTGCAGATGGGGâGGCGTGTTATGCâCCCCGCCCTGGC | |
| TGTGGAGCGGGGâCTGCTGCCGGAGâCCTGACCAGAGGâAAAGTCACCTGC | |
| GAAGGGGGCAATâGGCCTGGGCTGTâGGGTTTGCCTTCâTGCCGGGAATGT | |
| AAAGAAGCGTACâCATGAAGGGGAGâTGCAGTGCCGTAâTTTGAAGCCTCA | |
| GGAACAACTACTâCAGGCCTACAGAâGTCGATGAAAGAâGCCGCCGAGCAG | |
| GCTCGTTGGGAAâGCAGCCTCCAAAâGAAACCATCAAGâAAAACCACCAAG | |
| CCCTGTCCCCGCâTGCCATGTACCAâGTGGAAAAAAATâGGAGGCTGCATG | |
| CACATGAAGTGTâCCGCAGCCCCAGâTGCAGGCTCGAGâTGGTGCTGGAAC | |
| TGTGGCTGCGAGâTGGAACCGCGTCâTGCATGGGGGACâCACTGGTTCGACâGTGTAG | |
| [AminoâAcidâSequenceâofâhumanâParkin] | |
| SEQâIDâNO:â6 | |
| MetâIleâValâPheâValâArgâPheâAsnâSerâSerâHisâGlyâPheâProâVal | |
| GluâValâAspâSerâAspâThrâSerâIleâPheâGlnâLeuâLysâGluâValâVal | |
| AlaâLysâArgâGlnâGlyâValâProâAlaâAspâGlnâLeuâArgâValâIleâPhe | |
| AlaâGlyâLysâGluâLeuâArgâAsnâAspâTrpâThrâValâGlnâAsnâCysâAsp | |
| LeuâAspâGlnâGlnâSerâIleâValâHisâIleâValâGlnâArgâProâTrpâArg | |
| LysâGlyâGlnâGluâMetâAsnâAlaâThrâGlyâGlyâAspâAspâProâArgâAsn | |
| AlaâAlaâGlyâGlyâCysâGluâArgâGluâProâGlnâSerâLeuâThrâArgâVal | |
| AspâLeuâSerâSerâSerâValâLeuâProâGlyâAspâSerâValâGlyâLeuâAla | |
| ValâIleâLeuâHisâThrâAspâSerâArgâLysâAspâSerâProâProâAlaâGly | |
| SerâProâAlaâGlyâArgâSerâIleâTyrâAsnâSerâPheâTyrâValâTyrâCys | |
| LysâGlyâProâCysâGlnâArgâValâGlnâProâGlyâLysâLeuâArgâValâGln | |
| CysâSerâThrâCysâArgâGlnâAlaâThrâLeuâThrâLeuâThrâGlnâGlyâPro | |
| SerâCysâTrpâAspâAspâValâLeuâIleâProâAsnâArgâMetâSerâGlyâGlu | |
| CysâGlnâSerâProâHisâCysâProâGlyâThrâSerâAlaâGluâPheâPheâPhe | |
| LysâCysâGlyâAlaâHisâProâThrâSerâAspâLysâGluâThrâSerâValâAla | |
| LeuâHisâLeuâIleâAlaâThrâAsnâSerâArgâAsnâIleâThrâCysâIleâThr | |
| CysâThrâAspâValâArgâSerâProâValâLeuâValâPheâGlnâCysâAsnâSer | |
| ArgâHisâValâIleâCysâLeuâAspâCysâPheâHisâLeuâTyrâCysâValâThr | |
| ArgâLeuâAsnâAspâArgâGlnâPheâValâHisâAspâProâGlnâLeuâGlyâTyr | |
| SerâLeuâProâCysâValâAlaâGlyâCysâProâAsnâSerâLeuâIleâLysâGlu | |
| LeuâHisâHisâPheâArgâIleâLeuâGlyâGluâGluâGlnâTyrâAsnâArgâTyr | |
| GlnâGlnâTyrâGlyâAlaâGluâGluâCysâValâLeuâGlnâMetâGlyâGlyâVal | |
| LeuâCysâProâArgâProâGlyâCysâGlyâAlaâGlyâLeuâLeuâProâGluâPro | |
| AspâGlnâArgâLysâValâThrâCysâGluâGlyâGlyâAsnâGlyâLeuâGlyâCys | |
| GlyâPheâAlaâPheâCysâArgâGluâCysâLysâGluâAlaâTyrâHisâGluâGly | |
| GluâCysâSerâAlaâValâPheâGluâAlaâSerâGlyâThrâThrâThrâGlnâAla | |
| TyrâArgâValâAspâGluâArgâAlaâAlaâGluâGlnâAlaâArgâTrpâGluâAla | |
| AlaâSerâLysâGluâThrâIleâLysâLysâThrâThrâLysâProâCysâProâArg | |
| CysâHisâValâProâValâGluâLysâAsnâGlyâGlyâCysâMetâHisâMetâLys | |
| CysâProâGlnâProâGlnâCysâArgâLeuâGluâTrpâCysâTrpâAsnâCysâGly | |
| CysâGluâTrpâAsnâArgâValâCysâMetâGlyâAspâHisâTrpâPheâAspâVal | |
| [cDNAâSequencesâofâSDA] | |
| SEQâIDâNO:â7 | |
| ATGGCAAATATTâACCGTTTTCTATâAACGAAGACTTCâCAGGGTAAGCAG | |
| GTCGATCTGCCGâCCTGGCAACTATâACCCGCGCCCAGâTTGGCGGCGCTG | |
| GGCATCGAGAATâAATACCATCAGCâTCGGTGAAGGTGâCCGCCTGGCGTG | |
| AAGGCTATCCTGâTACCAGAACGATâGGTTTCGCCGGCâGACCAGATCGAA | |
| GTGGTGGCCAATâGCCGAGGAGTTGâGGCCCGCTGAATâAATAACGTCTCC | |
| AGCATCCGCGTCâATCTCCGTGCCCâGTGCAGCCGCGCâATGGCAAATATT | |
| ACCGTTTTCTATâAACGAAGACTTCâCAGGGTAAGCAGâGTCGATCTGCCG | |
| CCTGGCAACTATâACCCGCGCCCAGâTTGGCGGCGCTGâGGCATCGAGAAT | |
| AATACCATCAGCâTCGGTGAAGGTGâCCGCCTGGCGTGâAAGGCTATCCTC | |
| TACCAGAACGATâGGTTTCGCCGGCâGACCAGATCGAAâGTGGTGGCCAAT | |
| GCCGAGGAGCTGâGGTCCGCTGAATâAATAACGTCTCCâAGCATCCGCGTC | |
| ATCTCCGTGCCGâGTGCAGCCGAGG | |
| [AminoâAcidâSequencesâofâSDA] | |
| SEQâIDâNO:â8 | |
| MetâAlaâAsnâIleâThrâValâPheâTyrâAsnâGluâAspâPheâGlnâGlyâLys | |
| GlnâValâAspâLeuâProâProâGlyâAsnâTyrâThrâArgâAlaâGlnâLeuâAla | |
| AlaâLeuâGlyâIleâGluâAsnâAsnâThrâIleâSerâSerâValâLysâValâPro | |
| ProâGlyâValâLysâAlaâIleâLeuâTyrâGlnâAsnâAspâGlyâPheâAlaâGly | |
| AspâGlnâIleâGluâValâValâAlaâAsnâAlaâGluâGluâLeuâGlyâProâLeu | |
| AsnâAsnâAsnâValâSerâSerâIleâArgâValâIleâSerâValâProâValâGln | |
| ProâArgâMetâAlaâAsnâIleâThrâValâPheâTyrâAsnâGluâAspâPheâGln | |
| GlyâLysâGlnâValâAspâLeuâProâProâGlyâAsnâTyrâThrâArgâAlaâGln | |
| LeuâAlaâAlaâLeuâGlyâIleâGluâAsnâAsnâThrâIleâSerâSerâValâLys | |
| ValâProâProâGlyâValâLysâAlaâIleâLeuâTyrâGlnâAsnâAspâGlyâPhe | |
| AlaâGlyâAspâGlnâIleâGluâValâValâAlaâAsnâAlaâGluâGluâLeuâGly | |
| ProâLeuâAsnâAsnâAsnâValâSerâSerâIleâArgâValâIleâSerâValâPro | |
| ValâGlnâProâArg | |
| [cDNAâSequencesâofâSDB] | |
| SEQâIDâNO:â9 | |
| ATGGCAâGAACAAAGCGâACAAGGATGTâGAAGTACTACâACTCTGGAGGâAGATTCAGAA | |
| GCACAAAGACâAGCAAGAGCAâCCTGGGTGATâCCTACATCATâAAGGTGTACG | |
| ATCTGACCAAâGTTTCTCGAAâGAGCATCCTGâGTGGGGAAGAâAGTCCTGGGC | |
| GAGCAAGCTGâGGGGTGATGCâTACTGAGAACâTTTGAGGACGâTCGGGCACTC | |
| TACGGATGCAâCGAGAACTGTâCCAAAACATAâCATCATCGGGâGAGCTCCATC | |
| CAGATGACAGâATCAAAGATAâGCCAAGCCTTâCGGAAACCCTâT | |
| [AminoâAcidâSequencesâofâSDB] | |
| SEQâIDâNO:â10 | |
| MetâAlaâGluâGlnâSerâAspâLysâAspâValâLysâTyrâTyrâThrâLeuâGlu | |
| GluâIleâGlnâLysâHisâLysâAspâSerâLysâSerâThrâTrpâValâIleâLeu | |
| HisâHisâLysâValâTyrâAspâLeuâThrâLysâPheâLeuâGluâGluâHisâPro | |
| GlyâGlyâGluâGluâValâLueâGlyâGluâGlnâAlaâGlyâGlyâAspâAlaâThr | |
| GluâAsnâPheâGluâAspâValâGlyâHisâSerâThrâAspâAlaâArgâGluâLeu | |
| SerâLysâThrâTyrâIleâIleâGlyâGluâLeuâHisâProâAspâAspâArgâSer | |
| LysâIleâAlaâLysâProâSerâGluâThrâLue |
1. A method for development of the new hydrophobic cell-penetrating peptides (CPPs), namely advanced macromolecule transduction domains (aMTDs)
2. A method for analysis with previously developed hydrophobic cell-penetrating peptides (CPPs), namely advanced macromolecule transduction domains (aMTDs)
3. A method for preparation of the Parkin recombinant proteins fused to newly invented hydrophobic cell-penetrating peptides (CPPs), namely advanced macromolecule transduction