Patent application title:

HIGH INTENSITY FOCUSED ULTRASOUND AND METHODS OF PERFORMING NON-INVASIVE BIOPSIES USING SAME

Publication number:

US20170071515A1

Publication date:
Application number:

15/122,394

Filed date:

2015-04-02

Abstract:

The present disclosure provides methods of performing a liquid molecular biopsy on a subject using high intensity focused ultrasound (HIFU) energy. The present disclosure also provides methods of diagnosing a disease or a risk of a disease, such as a cancer, in a subject. The present disclosure further provides methods of treating one or more tissue masses (e.g., nodules, tumors, cysts, lesions, cells of unknown significance etc.) in a subject. In some embodiments, the methods are non-invasive or minimally invasive.

Inventors:

Interested in similar patents?

Get notified when new applications in this technology area are published.

Classification:

A61B5/14546 »  CPC main

Measuring for diagnostic purposes ; Identification of persons; Measuring characteristics of blood , e.g. gas concentration, pH value; Measuring characteristics of body fluids or tissues, e.g. interstitial fluid, cerebral tissue for measuring analytes not otherwise provided for, e.g. ions, cytochromes

A61B5/4836 »  CPC further

Measuring for diagnostic purposes ; Identification of persons; Other medical applications Diagnosis combined with treatment in closed-loop systems or methods

A61B5/14507 »  CPC further

Measuring for diagnostic purposes ; Identification of persons; Measuring characteristics of blood , e.g. gas concentration, pH value; Measuring characteristics of body fluids or tissues, e.g. interstitial fluid, cerebral tissue specially adapted for measuring characteristics of body fluids other than blood

A61B10/0038 »  CPC further

Other methods or instruments for diagnosis, e.g. instruments for taking a cell sample, for biopsy, for vaccination diagnosis ; Sex determination; Ovulation-period determination ; Throat striking implements Devices for taking faeces samples; Faecal examination devices

A61B10/007 »  CPC further

Other methods or instruments for diagnosis, e.g. instruments for taking a cell sample, for biopsy, for vaccination diagnosis ; Sex determination; Ovulation-period determination ; Throat striking implements; Devices for taking samples of body liquids for taking urine samples

A61N7/022 »  CPC further

Ultrasound therapy; Localised ultrasound hyperthermia intracavitary

A61B2010/0077 »  CPC further

Other methods or instruments for diagnosis, e.g. instruments for taking a cell sample, for biopsy, for vaccination diagnosis ; Sex determination; Ovulation-period determination ; Throat striking implements; Devices for taking samples of body liquids Cerebrospinal fluid

A61B5/145 IPC

Measuring for diagnostic purposes ; Identification of persons Measuring characteristics of blood , e.g. gas concentration, pH value; Measuring characteristics of body fluids or tissues, e.g. interstitial fluid, cerebral tissue

A61N7/02 IPC

Ultrasound therapy Localised ultrasound hyperthermia

A61B5/15 »  CPC further

Measuring for diagnostic purposes ; Identification of persons Devices for taking samples of blood

A61B5/00 IPC

Measuring for diagnostic purposes ; Identification of persons

A61B10/00 IPC

Other methods or instruments for diagnosis, e.g. instruments for taking a cell sample, for biopsy, for vaccination diagnosis ; Sex determination; Ovulation-period determination ; Throat striking implements

Description

CROSS-REFERENCE TO RELATED APPLICATION(S)

The present application claims the benefit of pending U.S. Provisional Patent Application No. 61/974,317, filed Apr. 2, 2014, and U.S. Provisional Patent Application No. 62/072,915, filed Oct. 30, 2014, both of which are incorporated herein by reference in their entireties.

STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH OR DEVELOPMENT

This invention was made with government support under grant no. 1K01EB015745, awarded by the National Institutes of Health, Transformative R01 Grant no. DK-085714, awarded by the National Institutes of Health, and P50-CA-097186, awarded by Pacific Northwest Prostate Cancer SPORE. The government has certain rights in the invention.

TECHNICAL FIELD

The present disclosure relates to methods of performing a biopsy on a subject using high intensity focused ultrasound (HIFU) energy. The present disclosure also provides methods of diagnosing a disease or a risk of a disease, such as a cancer, in a subject using HIFU.

BACKGROUND

The clinical evaluation of tissue masses (e.g., nodules, solid tumors, fibroids, cysts, etc.) typically includes performing a needle biopsy, which can provide diagnostic (benign vs. cancer) and molecular information (targetable mutations, drug resistance, etc). This procedure has several diagnostic limitations, most notably, the potential to miss the mutations only millimeters away. In response to these limitations, the concept of “liquid biopsy” has emerged in recent years: the detection of nucleic acid cancer biomarkers, such as tumor-derived microRNAs (miRNAs) and circulating tumor DNA (ctDNA). These biomarkers have shown high diagnostic value and could guide the selection of appropriate targeted therapies. However, the abundance of these biomarker classes in the circulation is often too low to be detectable—even with the most sensitive techniques—because of their low levels of release from the tumor.

Presently, the standard prostate biopsy strategy for diagnosing prostate cancer (PCA) utilizes an invasive transrectal procedure to obtain 12 needle-core specimens randomly sampled from the prostate. This approach has several diagnostic limitations and is associated with a significant and increasing number of infectious complications attributable to its invasive transrectal technique. A need exists for methods of performing biopsies that reduce or eliminate such complications.

BRIEF DESCRIPTION OF THE DRAWINGS

FIG. 1 is a partially schematic view of a liquid biopsy HIFU system configured to apply HIFU energy to a target tissue mass or an abscess of a patient or subject in accordance with an embodiment of the present technology.

FIG. 2 is a partially schematic view of a method of applying HIFU energy to a target tissue mass or an abscess of a patient or subject using the system of FIG. 1.

FIG. 3A shows repeatability of tissue cavities generated by ex vivo application of HIFU (10 ms pulse at 1 Hz for 50 seconds) to bovine liver, viewed in cross-section.

FIG. 3B shows repeatability of tissue cavities generated by ex vivo application of HIFU (10 ms pulse at 1 Hz for 50 seconds) to bovine liver, viewed in the focal plane.

FIG. 4A is a representation of a histotripsy HIFU waveform according to one embodiment of the present technology.

FIG. 4B is a representation of a histotripsy HIFU regime for causing release of a biomarker from a tissue mass according to one embodiment of the present technology.

FIG. 4C shows cavities formed in bovine liver tissue when the histotripsy HIFU regime of FIG. 4B is applied ex vivo at 1 MHz, 2 MHz and 3 MHz.

FIG. 5A is a representation of a boiling histotripsy waveform measured in deaerated water according to one embodiment of the present technology.

FIG. 5B shows a B-mode monitoring image of tissue being treated with the boiling histotripsy waveform of FIG. 5A with a pulse duration of 1 ms at 1 MHz and for a treatment duration of 30 seconds.

FIG. 6 is a representation of a mild thermal (heating) HIFU waveform measured in deaerated water according to one embodiment of the present technology.

FIG. 7A shows the amount of miR-9 biomarker in blood samples obtained over time from tumor-implanted rats treated with liquification HIFU, thermal HIFU, permeabilization (histotripsy) HIFU, or mock treatment. *P≦0.05, **P≦0.01, ***P≦0.001, p-values calculated against mock treated, Dunns Multiple Comparison post-test.

FIG. 7B shows the amount of miR-34c biomarker in blood samples obtained over time from tumor-implanted rats treated with liquification HIFU, thermal HIFU, permeabilization (histotripsy) HIFU, or mock treatment. *P≦0.05, **P≦0.01, ***P≦0.001, p-values calculated against mock treated, Dunns Multiple Comparison post-test.

FIG. 7C shows the amount of miR-100 biomarker in blood samples obtained over time from tumor-implanted rats treated with liquification HIFU, thermal HIFU, permeabilization (histotripsy) HIFU, or mock treatment. *P≦0.05, **P≦0.01, ***P≦0.001, p-values calculated against mock treated, Dunns Multiple Comparison post-test.

FIG. 7D shows the amount of miR-129 biomarker in blood samples obtained over time from tumor-implanted rats treated with liquification HIFU, thermal HIFU, permeabilization (histotripsy) HIFU, or mock treatment. *P≦0.05, **P≦0.01, ***P≦0.001, p-values calculated against mock treated, Dunns Multiple Comparison post-test.

FIG. 7E shows the amount of miR-196a biomarker in blood samples obtained over time from tumor-implanted rats treated with liquification HIFU, thermal HIFU, permeabilization (histotripsy) HIFU, or mock treatment. *P≦0.05, **P≦0.01, ***P≦0.001, p-values calculated against mock treated, Dunns Multiple Comparison post-test.

FIG. 7F shows the amount of miR-16 biomarker in blood samples obtained over time from tumor-implanted rats treated with liquification HIFU, thermal HIFU, permeabilization (histotripsy) HIFU, or mock treatment. *P≦0.05, **P≦0.01, ***P≦0.001, p-values calculated against mock treated, Dunns Multiple Comparison post-test.

FIG. 8A displays relative copies of miR-9 biomarker in blood samples obtained more frequently over a shorter time course than those shown in FIG. 7A when the HIFU is a liquification regime. *P≦0.05, p-values calculated against pre-treatment miRNA abundance, Dunns Multiple Comparison post-test.

FIG. 8B displays relative copies of miR-34c biomarker in blood samples obtained more frequently over a shorter time course than those shown in FIG. 7B when the HIFU is a liquification regime. *P≦0.05, p-values calculated against pre-treatment miRNA abundance, Dunns Multiple Comparison post-test.

FIG. 8C displays relative copies of miR-100 biomarker in blood samples obtained more frequently over a shorter time course than those shown in FIG. 7C when the HIFU is a liquification regime. *P≦0.05, p-values calculated against pre-treatment miRNA abundance, Dunns Multiple Comparison post-test.

FIG. 8D displays relative copies of miR-129 biomarker in blood samples obtained more frequently over a shorter time course than those shown in FIG. 7D when the HIFU is a liquification regime. *P≦0.05, p-values calculated against pre-treatment miRNA abundance, Dunns Multiple Comparison post-test.

FIG. 8E displays relative copies of miR-196a biomarker in blood samples obtained more frequently over a shorter time course than those shown in FIG. 7E when the HIFU is a liquification regime. *P≦0.05, p-values calculated against pre-treatment miRNA abundance, Dunns Multiple Comparison post-test.

FIG. 8F displays relative copies of miR-16 biomarker in blood samples obtained more frequently over a shorter time course than those shown in FIG. 7F when the HIFU is a liquification regime. *P≦0.05, p-values calculated against pre-treatment miRNA abundance, Dunns Multiple Comparison post-test.

DETAILED DESCRIPTION

The present technology is directed toward systems and methods for selectively inducing release of a marker from a tissue mass. In several embodiments, for example, an ultrasound source can pulse HIFU energy toward a tissue mass or suspected tissue mass that includes one or more markers (e.g., a biomarker such as an miRNA), generally referred to herein as a “liquid molecular biopsy” technique. The pulsed HIFU waves can induce release of at least a portion of one or more markers into a fluid of a subject (e.g., the subject's blood stream), which can then be detected by conventional means. In some embodiments, the fluid is blood, such as a fluid and/or non-fluid fraction or derivative of blood like whole blood, cells, plasma, serum, microvesicles, and/or cryoprecipitate. In some embodiments, the HIFU energy is applied to the tissue mass or suspected tissue mass in a non-invasive or minimally invasive manner. The terms “tissue mass” and “suspected tissue mass” are used herein to describe various collections of cells which may be abnormal (including benign abnormal masses), such as nodules, cysts, tumors (e.g., prostate tumors). A single blood test can facilitate detection of the marker(s), and the resulting marker expression profile can be used to diagnose a condition (e.g., PCA) in a subject and provide critical individualized prognostic information for the subject. Systems and methods configured in accordance with embodiments of the present technology are expected to provide effective minimally invasive (e.g., non-invasive) diagnosis and/or treatment of tissue masses, and facilitate better informed, potentially personalized treatment related decisions while reducing risks commonly associated with conventional methods such as needle biopsy.

In some embodiments, a method of diagnosing a disease or an increased risk of a disease in a subject according to the present technology comprises applying high intensity focused ultrasound (HIFU) energy to a target mass of the subject to cause release of a marker from the mass; and thereafter determining a concentration of the marker in a fluid of the subject.

In other embodiments, a method of characterizing two or more masses in a human or non-human animal subject (collectively, the “subject”) according to the present technology comprises optionally determining a baseline concentration of a first marker and/or a second marker in fluid of the subject; applying a first high intensity focused ultrasound (HIFU) energy to a first mass of the subject to cause release of a first marker from the mass; thereafter determining a concentration of the first marker in a first fluid sample of the subject; after a period of time, for example a period of time sufficient for the concentration of the first marker in the blood to return to or near a pre-HIFU baseline level, applying a second HIFU energy to a second mass of the subject to cause release of a second marker from the mass; thereafter determining a concentration of the second marker in a second fluid sample of the subject; and characterizing the first and second masses based, at least in part, on the concentrations of the first and second markers in the first and second fluid samples, respectively. In some embodiments, the first marker comprises a plurality of markers related to the first mass, and/or the second marker comprises a plurality of markers related to the second mass (e.g., multiplex biomarkers).

In other embodiments, a method of treating a target tissue mass in a human or non-human animal subject (collectively, the “subject”) according to the present technology comprises optionally determining a baseline concentration of a biomarker in a fluid sample of the subject; performing a procedure on the target tissue mass of the patient; applying high intensity focused ultrasound (HIFU) energy to the target tissue mass; determining a concentration of the biomarker in a fluid sample of the subject after applying HIFU energy to the target tissue mass; and repeating the performing, applying, and determining until a concentration of the biomarker in the fluid sample falls below a threshold value.

In still other embodiments, a method of treating two or more tissue masses in a human or non-human animal subject (collectively, the “subject”) according to the present technology comprises (a) optionally determining a baseline concentration of a first marker and/or second marker in fluid of the subject; (b) performing a first procedure on a first tissue mass of the subject; (c) applying high intensity focused ultrasound (HIFU) energy to the first tissue mass to cause a first marker to release from the first tissue mass; (d) thereafter, determining a concentration of the first marker in a first fluid sample of the subject; (e) after a first period of time, performing a second procedure on a second tissue mass of the subject; (f) applying HIFU energy to the second tissue mass to cause a second marker to release from the second tissue mass; (g) thereafter, determining a concentration of the second marker in a second fluid sample of the subject; and (h) after a second period of time, repeating: (1) steps (b) to (d) if the concentration of the first marker exceeds a first threshold value; (2) steps (e) to (g) if the concentration of the second marker exceeds a second threshold value; or (3) steps (b) to (g) if the concentration of the first marker exceeds the first threshold value and the concentration of the second marker exceeds the second threshold value.

In some embodiments, a method of inducing release of a marker from target tissue of a human or non-human animal subject according to the present technology comprises non-invasively applying high intensity focused ultrasound (HIFU) energy to the target tissue.

Certain specific details are set forth in the following description and in FIGS. 1-8F to provide a thorough understanding of various embodiments of the technology. For example, several embodiments of HIFU treatments that induce release of marker(s) from a tissue mass or suspected tissue mass are described in detail below. The present technology, however, may be used in conjunction with other therapy, such as a surgical procedure, immunotherapy (e.g., antitumor immunotherapy), ablation therapy (e.g., RF, cryotherapy, microwave therapy, laser therapy), radiation therapy, chemotherapy, brachytherapy, drug therapy (e.g., targeted drug therapy, chemotherapy, and/or non-chemotherapy), and the like. Other details describing well-known structures and systems often associated with ultrasound systems and associated devices have not been set forth in the following disclosure to avoid unnecessarily obscuring the description of the various embodiments of the technology. A person of ordinary skill in the art, therefore, will accordingly understand that the technology may have other embodiments with additional elements, or the technology may have other embodiments without several of the features shown and described below with reference to FIGS. 1-8F.

For ease of reference, throughout this disclosure identical reference numbers are used to identify similar or analogous components or features, but the use of the same reference number does not imply that the parts should be construed to be identical. Indeed, in many examples described herein, the identically-numbered parts are distinct in structure and/or function. Further, the headings provided herein are for convenience only.

For ease of reference, throughout this disclosure systems and methods of treatment may refer to “a mass” or “a tissue mass.” Unless the context clearly dictates otherwise, these terms may refer to a collection of cells (e.g., a tissue or a portion of a tissue), a region of one or more organs, a sarcoma, a tumor, a nodule, a cyst, or a combination thereof.

Selected Embodiments of HIFU Systems for Performing Non-Invasive Biopsies and Associated Methods

FIG. 1 is a partially schematic view of a liquid biopsy HIFU system 10 (“system 10”) configured in accordance with an embodiment of the present technology. The system 10 can include an ultrasound source 400 operably coupled to a function generator 100 and, optionally, an amplifier 200. The ultrasound source 400 can be an ultrasound transducer that emits high levels of ultrasound energy toward a focus 485. The focus 485 can be a point, plane, region, or volume at which the intensity of the ultrasound energy emitted by the ultrasound source 400 is the highest. For example, the ultrasound source 400 generally has a focal depth equal to the diameter of the ultrasound transducer. The function generator 100 and the amplifier 200 can drive the ultrasound source 400 to radiate HIFU waves that induce boiling bubbles or cavitation proximate to the focus 485 to mechanically disrupt (e.g., reversibly disrupt or damage) the tissue mass or suspected tissue mass. Alternatively, the function generator 100 and the amplifier 200 can drive the ultrasound source 400 to radiate HIFU waves that heat or cause mild hyperthermia or irreversible heat damage to the tissue mass or suspected tissue mass. Accordingly, the system 10 can implement a pulsing protocol in which ultrasound frequency, pulse repetition frequency, pulse length, duty cycle, pressure amplitude, and/or other parameters associated with the HIFU emissions can be adjusted to generate HIFU waves to mechanically disrupt tissue at and/or in proximity to the focus 485.

The system 10 also includes an ultrasound source 400 configured for delivering the high-intensity ultrasound waveform to the target tissue mass or suspected tissue mass of the patient (see FIG. 2). In some embodiments, the system 10 further comprises a second transducer 430 for obtaining an ultrasound image of the tissue mass or suspected tissue mass. The second transducer 430 (when present) may comprise, for example, a diagnostic ultrasound transducer. Although the first ultrasound source 400 and second transducer 430 are shown in FIG. 1 within a single transducer housing (ultrasound wand), one of skill in the art will recognize that the second transducer 430 may also be housed in a separate transducer housing from the first ultrasound source 400 in other embodiments.

The system 10 may also comprise an optional controller 300 in operative communication with the function generator 100, the amplifier 200, and the ultrasound source 400. The system 10 may also include an optional display 500 in operative communication with the function generator 100, the amplifier 200, the ultrasound source 400, and the optional controller 300 (when present).

As noted previously, the system 10 is configured to deliver powerful, controlled ultrasound waves that are focused inside the patient's body to ablate the targeted tissue at the focus, without affecting or significantly affecting surrounding tissue or organ(s). In some embodiments, the HIFU waves are sent in short, infrequent but powerful bursts, causing mechanical disruption of tissue at the focus without any significant thermal effects (e.g., thermal damage). Without wishing to be bound by theory, it is believed that the mechanical disruption is achieved at least in part by the formation of small gas bubbles in the targeted tissue. These bubbles grow and collapse in response to the ultrasound wave, a phenomenon commonly referred to as cavitation. Depending on the pulsing protocol employed, the outcome can range from small holes in cell membranes and capillaries to complete liquefaction of a small region of tumor.

As shown in FIG. 1, the ultrasound source 400, the function generator 100, and/or other components of the system 10 can be coupled to a processor or controller 300 (shown schematically) that can be used to control the function and movement of various features of the system 10. In certain embodiments, the function generator 100 and the controller 300 can be integrated into a single device. The controller 300 can be processing device, such as a central processing unit (CPU) or computer. The controller 300 can include or be part of a device that includes a hardware controller that interprets the signals received from input devices (e.g., the ultrasound source 400, the function generator 100, user input devices, etc.) and communicates the information to the features of the system 10 using a communication protocol.

The controller 300 may be a single processing unit or multiple processing units in a device or distributed across multiple devices. The controller 300 may communicate with the hardware controller for devices, such as for a display that displays graphics and/or text (e.g., LCD display screens—not shown). The controller 300 can also be in communication with a memory that includes one or more hardware devices for volatile and non-volatile storage, and may include both read-only and writable memory. For example, a memory may comprise random access memory (RAM), read-only memory (ROM), writable non-volatile memory, such as flash memory, hard drives, floppy disks, CDs, DVDs, magnetic storage devices, tape drives, device buffers, and so forth. A memory is not a propagating electrical signal divorced from underlying hardware, and is thus non-transitory. In certain embodiments, the controller 108 can also be coupled to a communication device capable of communicating wirelessly or wire-based with a network node. The communication device may communicate with another device or a server through a network using, for example, TCP/IP protocols.

The controller 300 can execute automated control algorithms to initiate, terminate, and/or adjust operation of one or more features of the system 10 and/or receive control instructions from a user. The controller 300 can further be configured to provide feedback to a user based on the data received from the system 10 via an evaluation/feedback algorithm. This information can be provided to the users via a display (e.g., a monitor on a computer, tablet computer, or smart phone; not shown) communicatively coupled to the controller.

In various embodiments, the system 10 can further include a positioning device 110 coupled to the ultrasound source 400 to aid in positioning the focus 485 of the ultrasound source 400 at a desired target site in the tissue. For example, the positioning device 110 can include a three-axis computer-controlled positioning system. The positioning device 110 can also manipulate the ultrasound source 400 to move the focus 485 to different regions in the tissue to mechanically damage larger portions of the tissue 112. In other embodiments, the system 10 can include additional devices and/or some of the devices may be omitted from the system 10.

In operation, the ultrasound source 400 is positioned proximate to a volume of tissue 112 (e.g., an organ), and the focus 485 of the ultrasound source 400 is aligned with a target site within the tissue 112 using the positioning device 110. For example, the ultrasound source 400 can be positioned such that its focus 485 is a depth within an ex vivo or in vivo liver, kidney, heart, and/or other tissue mass and aligned with a tumor, cancerous tissue region, and/or other volume of tissue that a clinician would like to mechanically damage. HIFU energy can be delivered from the ultrasound source 400 to the target site in the tissue 112 in a sequence of pulses (e.g., coordinated by the function generator 100 and/or the controller 300) rather than continuous-wave HIFU exposures, which can reduce undesirable thermal effects on the surrounding tissue. Larger target sites can be treated by scanning the focus 485 of the ultrasound source 400 over the treatment region (e.g., using the positioning device 110) while pulsing HIFU energy toward the tissue 112.

In various embodiments, the system 10 can deliver a pulsing protocol to provide boiling histotripsy that mechanically fractionates the tissue. During boiling histotripsy, the ultrasound source 400 propagates millisecond-long bursts of non-linear HIFU waves toward the focal region 485 in the tissue 112, and the accumulation of the harmonic frequencies produces shock fronts proximate to the focal region 485. This results in rapid heating of tissue and boiling bubbles at the focal region 485 that liquefy and otherwise mechanically damages the tissue 112.

In certain embodiments, the function generator 100 can initiate a pulsing protocol to generate shock waves with peak positive amplitudes of about 5 MPa to about 100 MPa at the focus 485, about 15 MPa to about 90 MPa at the focus 485, about 25 MPa to about 80 MPa at the focus 485, about 35 MPa to about 70 MPA at the focus 485, or about 45 MPa to about 60 MPa at the focus 485, for example 5 MPa, about 10 MPa, about 15 MPa, about 20 MPa, about 25 MPa, about 30 MPa, about 35 MPa, about 40 MPa, about 45 MPa, about 50 MPa, about 55 MPa, about 60 MPa, about 65 MPa, about 70 MPa, about 75 MPa, about 80 MPa, about 85 MPa, about 90 MPa, about 95 MPa, or about 100 MPa at the focus 485. In other embodiments, the shock wave amplitudes may differ depending, at least in part, on the power driving the ultrasound source 400.

In certain embodiments, the function generator 100 can initiate a pulsing protocol to generate shock waves with peak negative pressures of about −3 MPa to about −25 MPa at the focus 485, about −5 MPa to about −20 MPa at the focus 485, or about −10 MPa to about −15 MPa at the focus 485, for example about −3 MPa, about −4 MPa, about −5 MPa, about −6 MPa, about −7 MPa, about −8 MPa, about −9 MPa, about −10 MPa, about −11 MPa, about −12 MPa, about −13 MPa, about −14 MPa, about −15 MPa, about −16 MPa, about −17 MPa, about −18 MPa, about −19 MPa, about −20 MPa, about −21 MPa, about −22 MPa, about −23 MPa, about −24 MPa, or about −25 MPa at the focus 485.

In certain embodiments, the function generator 100 can initiate a pulsing protocol to generate shock waves including a single frequency of ultrasound energy or more than one frequency of ultrasound energy. In some embodiments, for example, the ultrasound waveform comprises an ultrasound frequency of about 1 MHz to about 3 MHz at the focus 485, or about 1.5 MHz to about 2.5 MHz at the focus 485, for example about 1 MHz, about 1.1 MHz, about 1.2 MHz, about 1.3 MHz, about 1.4 MHz, about 1.5 MHz, about 1.6 MHz, about 1.7 MHz, about 1.8 MHz, about 1.9 MHz, about 2 MHz, about 2.1 MHz, about 2.2 MHz, about 2.3 MHz, about 2.4 MHz, about 2.5 MHz, about 2.6 MHz, about 2.7 MHz, about 2.8 MHz, about 2.9 MHz, or about 3 MHz at the focus 485. In some embodiments, the frequency is selected to provide a focal area that is smaller than the size of the tissue mass or suspected tissue mass and/or to provide an attenuation (e.g., depth) sufficient to contact the tissue mass or suspected tissue mass with the ultrasound energy.

The function generator 100 is also configured to provide a specific form (e.g., shape, pulse pattern, etc.) to the ultrasound energy. In some embodiments, for example, the function generator 100 is configured to provide an ultrasound energy waveform comprising periodic pulse sequences, non-periodic pulse sequences, or a combination thereof. For example, in some embodiments the function generator 100 is configured to provide an ultrasound energy waveform comprising a sinusoidal waveform. In other embodiments, the function generator 100 is configured to provide an ultrasound energy waveform comprising a square waveform. In still further embodiments, the function generator 100 is configured to provide an ultrasound energy waveform comprising a peaked waveform. In yet other embodiments, the function generator 100 may be configured to provide an ultrasound energy waveform comprising a combination of any of the foregoing.

In certain embodiments, the function generator 100 can initiate a pulsing protocol to generate shock waves with a pulse-average intensity of about 10 kW/cm2 to about 60 kW/cm2 at the focus 485, about 20 kW/cm2 to about 50 kW/cm2 at the focus 485, or about 30 kW/cm2 to about 40 kW/cm2 at the focus 485, for example about 10 kW/cm2, about 11 kW/cm2, about 12 kW/cm2, about 13 kW/cm2, about 14 kW/cm2, about 15 kW/cm2, about 16 kW/cm2, about 17 kW/cm2, about 18 kW/cm2, about 19 kW/cm2, about 20 kW/cm2, about 21 kW/cm2, about 22 kW/cm2, about 23 kW/cm2, about 24 kW/cm2, about 25 kW/cm2, about 26 kW/cm2, about 27 kW/cm2, about 28 kW/cm2, about 29 kW/cm2, about 30 kW/cm2, about 31 kW/cm2, about 32 kW/cm2, about 33 kW/cm2, about 34 kW/cm2, about 35 kW/cm2, about 36 kW/cm2, about 37 kW/cm2, about 38 kW/cm2, about 39 kW/cm2, about 40 kW/cm2, about 41 kW/cm2, about 42 kW/cm2, about 43 kW/cm2, about 44 kW/cm2, about 45 kW/cm2, about 46 kW/cm2, about 47 kW/cm2, about 48 kW/cm2, about 49 kW/cm2, about 50 kW/cm2, about 51 kW/cm2, about 52 kW/cm2, about 53 kW/cm2, about 54 kW/cm2, about 55 kW/cm2, about 56 kW/cm2, about 57 kW/cm2, about 58 kW/cm2, about 59 kW/cm2, or about 60 kW/cm2 at the focus 485.

In certain embodiments, the function generator 100 can initiate a pulsing protocol to generate shock waves with a pulse duration of about 1 microsecond (μs) to about 100 miliseconds (ms), about 10 μs to about 10 ms, or about 100 μs to about 1 ms, for example about 1 μs, about 5 μs, about 10 μs, about 15 μs, about 20 μs, about 25 μs, about 30 μs, about 35 μs, about 40 μs, about 45 μs, about 50 μs, about 55 μs, about 60 μs, about 65 μs, about 70 μs, about 75 μs, about 80 μs, about 85 μs, about 90 μs, about 95 μs, about 100 μs, about 125 μs, about 150 μs, about 175 μs, about 200 μs, about 225 μs, about 250 μs, about 275 μs, about 300 μs, about 325 μs, about 350 μs, about 375 μs, about 400 μs, about 425 μs, about 450 μs, about 475 μs, about 500 μs, about 525 μs, about 550 μs, about 575 μs, about 600 μs, about 625 μs, about 650 μs, about 675 μs, about 700 μs, about 725 μs, about 750 μs, about 775 μs, about 800 μs, about 825 μs, about 850 μs, about 875 μs, about 900 μs, about 925 μs, about 950 μs, about 975 μs, about 1 ms, about 5 ms, about 10 ms, about 15 ms, about 20 ms, about 25 ms, about 30 ms, about 35 ms, about 40 ms, about 45 ms, about 50 ms, about 55 ms, about 60 ms, about 65 ms, about 70 ms, about 75 ms, about 80 ms, about 85 ms, about 90 ms, about 95 ms, or about 100 ms.

In certain embodiments, the function generator 100 can initiate a pulsing protocol to generate shock waves with a duty cycle of about 0.1% to about 5%, about 0.5% to about 3%, or about 1% to about 2%, for example about 0.1%, about 0.2%, about 0.3%, about 0.4%, about 0.5%, about 0.6%, about 0.7%, about 0.8%, about 0.9%, about 1%, about 1.1%, about 1.2%, about 1.3%, about 1.4%, about 1.5%, about 1.6%, about 1.7%, about 1.8%, about 1.9%, about 2%, about 2.1%, about 2.2%, about 2.3%, about 2.4%, about 2.8%, about 2.9, about 3%, about 3.1%, about 3.2%, about 3.3%, about 3.4%, about 3.5%, about 3.6%, about 3.7%, about 3.8%, about 3.9%, about 4%, about 4.1%, about 4.2%, about 4.3%, about 4.4%, about 4.5%, about 4.6%, about 4.7%, about 4.8%, about 4.9%, or about 5%.

The amplifier 200 may also be configured to output an amplified ultrasound energy waveform that is nonlinearly distorted at the focus 485. Further, the amplifier 200 may be configured to output an amplified ultrasound energy waveform having more than one peak pressure.

In certain embodiments, the function generator 100 can initiate a pulsing protocol to generate shock waves with a peak negative pressure of about −3 MPa to about −25 MPa, a peak positive pressure of about 5 MPa to about 100 MPa, a frequency of about 1 MHz to about 3 MHz, and a pulse duration of about 1 μs to about 100 ms. In some embodiments, the waveform further has a duty cycle of about 0.1% to about 5%. In some embodiments, the waveform further is nonlinearly distorted at the focal point.

The ultrasound source 400 is operatively coupled with one or more components of the system 10 and is configured to administer (e.g., apply, deliver, etc.) the amplified ultrasound energy waveform to a tissue mass or a suspected tissue mass. In some embodiments, such as that shown in FIG. 2, the ultrasound source 400 includes a transducer head 420 including one or more transducer elements 425 and configured to focus the amplified ultrasound energy waveform within a tissue mass or within a suspected tissue mass of a subject. In some embodiments, the ultrasound source 400 may additionally include a second transducer head 430 for obtaining an image of the tissue mass or suspected tissue mass for monitoring application of the amplified ultrasound energy waveform to the tissue mass or suspected tissue mass. In other embodiments, the second transducer head 430 is housed in a second, separate transducer. In other embodiments, the ultrasound source 400 includes a single transducer head 420 for focusing the amplified ultrasound energy waveform (e.g., HIFU) and for obtaining an image of the tissue mass or suspected tissue mass for monitoring application of the amplified ultrasound energy waveform to the tissue mass or suspected tissue mass. In such embodiments, the transducer head 420 may include a linear array of transducer elements 425 which may provide focused amplified ultrasound energy (e.g., HIFU) at a desired depth by generating multiple pulses of the energy from each transducer element 425, wherein the multiple pulses are separated in time (e.g., delayed) according to methods known to those in the art.

The transducer head 420 is arranged to provide the amplified ultrasound energy waveform with an adjustable focus. In some embodiments, for example, the transducer head 420 includes an array of transducer elements 425, each of which may be energized in a pattern sufficient to provide the amplified ultrasound energy waveform having a focus located at a preselected distance from the ultrasound source 400. FIG. 2, for example, is a partially schematic view of a method of applying HIFU energy to a tissue mass or suspected tissue mass T using the system 10. As shown in the embodiment of FIG. 2, the transducer head 420 has a generally concave shape, providing an array of transducer elements 425 in a generally concave pattern. The resulting amplified ultrasound energy waveform 480 provided by the ultrasound source 400 includes a focal point 485 located a predetermined focal distance D from the ultrasound source 400. The focal distance D may be selected to correspond to the location (e.g., depth) of a tissue mass or suspected tissue mass T, such that the focal point 485 is located within the tissue mass or suspected tissue mass T of a patient P. One of skill in the art will recognize, however, that other arrangements of transducer elements 425 are possible. For example, linear arrays of transducer elements 425 or transducer elements 425 arranged in other suitable patterns may also be used. In addition, the focal distance D may be determined or adjusted by altering the phasing of the amplified ultrasound energy waveform provided to each of the transducer elements 425.

Referring to FIGS. 1 and 2 together, and as noted previously, the controller 300 is in operative communication with the function generator 100, the amplifier 200, and the ultrasound source 400. The controller 300 may be used, for example, to receive input from a clinician regarding the focal distance D required, the extent of amplification required by the amplifier 200, and/or the shape of the ultrasound energy waveform generated by the function generator 100. In some embodiments, the controller 300 is configured to receive data (e.g., imaging data) from a second transducer 430 and determine a focal distance D based on the data. The controller 300 may also be configured to automatically determine and/or automatically adjust the extent of amplification provided by the amplifier, the shape of the waveform provided by the function generator 100, and/or a pattern of energizing one or more transducer elements 425 as a function of imaging data showing the tissue mass or suspected tissue mass T to be treated (e.g., including a depth of the tissue mass or suspected tissue mass T below the surface of the patient P's skin.

In any of the embodiments disclosed herein, the system 10 may be configured to be portable. In such embodiments, the system 10 may further include a battery (not shown) for providing power to the system 10. In further embodiments, one or more of the components of the system 10 may be wirelessly coupled to the other components of the system 10. Additionally, the system 10 may include one or more additional features or the components may have a different arrangement relative to each other.

Methods of diagnosing and/or treating a tissue mass or suspected tissue mass T may include the use of the systems and/or components described herein (such as the system 10 described above with reference to FIGS. 1 and 2) or other suitable HIFU systems. In some embodiments, for example, the present technology provides a method of diagnosing and/or treating a tissue mass or suspected tissue mass associated with a subject by applying ultrasound energy to the tissue mass or suspected tissue mass sufficient to cause one or more biomarkers to be released from the target tissue, for example by stimulating, perturbing or disrupting (e.g., reversibly disrupting) at least a portion of the tissue mass or suspected tissue mass. The biomarker may be associated with a particular type of cancer.

In some embodiments, for example, the tissue mass or suspected tissue mass may be associated with prostate cancer. In such embodiments, the corresponding marker(s) (e.g., biomarker(s)) is also associated with prostate cancer. In some embodiments, the biomarker is hsa-miR-9-5p (SEQ ID NO:1). In some embodiments, the biomarker is hsa-miR-196a-5p (SEQ ID NO:2). In some embodiments, the biomarker is hsa-miR-34c-5p (SEQ ID NO:3). In some embodiments, the biomarker is hsa-miR-129-5p (SEQ ID NO:4). In some embodiments, the biomarker is hsa-miR-100-5p (SEQ ID NO:5). In some embodiments, the biomarker is hsa-miR-16-5p (SEQ ID NO:6). In some embodiments, the marker is a DNA, an RNA or a protein. In other embodiments, the biomarker is a known prostate cancer biomarker, such as prostate cancer antigen 3 (PCA3) RNA, a TMPRSS2-ERG fusion (e.g., DNA or RNA), a diagnostic androgen receptor (AR) DNA or RNA or protein, a phosphatase and tensin homolog (PTEN) (e.g., a PTEN RNA or DNA), TP53 (p53) RNA or DNA, a Kirsten rat sarcoma viral oncogene homolog (KRAS), an NKX3.1 DNA or RNA, a CDH1 (aka Ecad, E-cadherin) DNA or RNA or protein, an APC DNA or RNA, a BRAF DNA or RNA, an src DNA or RNA, an abl DNA or RNA, an raf DNA or RNA, an erbA DNA or RNA, or an myc DNA or RNA.

In other embodiments, the tissue mass or suspected tissue mass and corresponding marker (e.g., biomarker) may be associated with ovarian cancer. For example, in some embodiments, the biomarker is hsa-miR-9-5p (SEQ ID NO:1). In some embodiments, the biomarker is hsa-miR-196a-5p (SEQ ID NO:2). In some embodiments, the biomarker is hsa-miR-34c-5p (SEQ ID NO:3). In some embodiments, the biomarker is hsa-miR-129-5p (SEQ ID NO:4). In some embodiments, the biomarker is hsa-miR-100-5p (SEQ ID NO:5). In some embodiments, the biomarker is hsa-miR-16-5p (SEQ ID NO:6). In other embodiments, the biomarker is a known ovarian cancer biomarker, such as a TP53 (aka p53) RNA or DNA, BRCA1 or BRCA2 (DNA or RNA), an src DNA or RNA, a raf DNA or RNA, an erbA DNA or RNA, or a myc DNA or RNA.

In other embodiments, the tissue mass or suspected tissue mass and corresponding marker (e.g., biomarker) may be associated with breast cancer. For example, in some embodiments, the biomarker is hsa-miR-9-5p (SEQ ID NO:1). In some embodiments, the biomarker is hsa-miR-196a-5p (SEQ ID NO:2). In some embodiments, the biomarker is hsa-miR-34c-5p (SEQ ID NO:3). In some embodiments, the biomarker is hsa-miR-129-5p (SEQ ID NO:4). In some embodiments, the biomarker is hsa-miR-100-5p (SEQ ID NO:5). In some embodiments, the biomarker is hsa-miR-16-5p (SEQ ID NO:6). In other embodiments, the biomarker is a known breast cancer biomarker, such as a TP53 (aka p53) RNA or DNA, an APC DNA or RNA, a BRAF DNA or RNA, an src DNA or RNA, a raf DNA or RNA, an erbA DNA or RNA, a myc DNA or RNA, BRCA1 or BRCA2 (DNA or RNA), or an HER2/neu (DNA and RNA).

In still other embodiments, the tissue mass or suspected tissue mass and corresponding marker (e.g., biomarker) may be associated with renal cell carcinoma. In some embodiments, for example, the biomarker is hsa-miR-9-5p (SEQ ID NO:1). In some embodiments, the biomarker is hsa-miR-196a-5p (SEQ ID NO:2). In some embodiments, the biomarker is hsa-miR-34c-5p (SEQ ID NO:3). In some embodiments, the biomarker is hsa-miR-129-5p (SEQ ID NO:4). In some embodiments, the biomarker is hsa-miR-100-5p (SEQ ID NO:5). In some embodiments, the biomarker is hsa-miR-16-5p (SEQ ID NO:6). In other embodiments, the biomarker is a known renal cell carcinoma biomarker, such as a phosphatase and tensin homolog (PTEN) RNA or DNA, a von Hippel-Lindau syndrome (VHL) DNA or RNA, a TP53 (aka p53) RNA or DNA, an src DNA or RNA, a raf DNA or RNA, or an erbA DNA or RNA.

In further embodiments, the tissue mass or suspected tissue mass and corresponding marker (e.g., biomarker) may be associated with a uterine fibroid. For example, in some embodiments, the biomarker is hsa-miR-9-5p (SEQ ID NO:1). In some embodiments, the biomarker is hsa-miR-196a-5p (SEQ ID NO:2). In some embodiments, the biomarker is hsa-miR-34c-5p (SEQ ID NO:3). In some embodiments, the biomarker is hsa-miR-129-5p (SEQ ID NO:4). In some embodiments, the biomarker is hsa-miR-100-5p (SEQ ID NO:5). In some embodiments, the biomarker is hsa-miR-16-5p (SEQ ID NO:6). In other embodiments, the biomarker is a known uterine fibroid biomarker, such as gene mediator subcomplex 12 (MED 12) DNA or RNA.

In some embodiments, methods according to the present technology can further include introducing an ultrasound contrast agent to the tissue mass or suspected tissue mass (e.g., by administering an antibody-microbubble conjugate or a peptide-microbubble conjugate to the subject, or by administering a systemic ultrasound contrast agent to the subject) before applying HIFU energy to the target tissue. Without wishing to be bound by theory, the ultrasound contrast agent is expected to enhance the effect of the applied ultrasound energy (e.g., HIFU), for example, by enabling an enhanced amount of a biomarker to be released from the tissue mass or suspected tissue mass.

When used in conjunction with a therapeutic protocol (e.g., anti-tumor therapies), the present technology is also expected to significantly enhance a clinician's ability to assess and monitor the effectiveness of treatment. For example, when using therapeutic techniques that often require more than one application of a therapy (e.g., radiation), the present technology enables a clinician to apply a first round of therapy to a tissue mass, assess the effectiveness of the therapy by applying an amplified ultrasound energy wave (e.g., HIFU) to the tissue mass and measuring an amount of a selected biomarker in a fluid sample (e.g., a blood sample, such as a fluid and/or non-fluid fraction or derivative of blood like whole blood, cells, plasma, serum, microvesicles, and/or cryoprecipitate) obtained from the subject, and determine (based on the amount of the biomarker in the fluid sample) whether additional round(s) of therapy are warranted. Because methods according to the current technology cause rapid release of the biomarker from the tissue mass (e.g., within 10 minutes or within 5 minutes), the tissue mass can be conveniently be treated multiple times within a single procedure (e.g., single visit to a treatment clinic).

EXAMPLES

Example 1

HIFU was applied to prostate cancer tumors implanted under the skin of laboratory rats. Conventional ultrasound imaging was used or image guidance and targeting. Blood samples were collected immediately before and at periodic intervals after HIFU treatment (boiling histotripsy and cavitation regimes), and were tested for the presence of microRNAs (“miRNAs”) that are associated with rat prostate cancer, shown in Table 1.

TABLE 1
Putative miRNA biomarker sequences.
miRNA* RNA sequence (human and rat)
miR-9-5p UCUUUGGUUAUCUAGCUGUAUGA (SEQ ID NO: 1)
miR-196a-5p UAGGUAGUUUCAUGUUGUUGGG (SEQ ID NO: 2)
miR-34c-5p AGGCAGUGUAGUUAGCUGAUUGC (SEQ ID NO: 3)
miR-129-5p CUUUUUGCGGUCUGGGCUUGC (SEQ ID NO: 4)
miR-100-5p AACCCGUAGAUCCGAACUUGUG (SEQ ID NO: 5)
miR-16-5p UAGCAGCACGUAAAUAUUGGCG (SEQ ID NO: 6)
*Equivalent miRNA species may be referred to herein with or without the “Sp” suffix.

The levels of these miRNAs were elevated up to 30-fold within minutes after the ultrasound procedure, and then declined over the course of several hours. The effects on tissue were evaluated in the resected tumors, and only micron-sized areas of hemorrhage scattered through otherwise intact tissue were found when the HIFU was applied as a cavitation regime, suggesting damage to small capillaries. Liquefaction HIFU caused substantial disruption to the tissue in corollary experiments. These data provided the proof of principle for the technology disclosed herein directed to “ultrasound-aided liquid molecular biopsy”.

Example 2

Objectives: The ability of ultrasound to stimulate the release of cancer-specific protein biomarkers into the circulation was recently reported, however, physical and biological mechanisms behind it are unclear. In addition, the protein biomarker in that study (carcinoembryonic antigen, CEA) is expressed on the cell surface, thus providing no proof of principal for releasing biomarker molecules from within the cell. Here, the release of a recently established class of intracellular nucleic acid-based cancer biomarkers—microRNAs (miRNAs)—by high intensity focused ultrasound (HIFU) was investigated in a rat prostate cancer model. The benefits of three different HIFU treatment protocols causing localized tissue lysis (histotripsy), bubble-induced reversible permabilization (cavitation), or mild hyperthermia in stimulation of miRNA release were compared to untreated controls.

Methods: Copenhagen rats were implanted subcutaneously on the hind limb with the syngeneic MatLyLu prostate cancer cell line. HIFU exposures at 1.1 MHz, optimized for either partial lysis of the tumor tissue or sublethal heating thereof (ISPPA=120 W/cm2, 50% duty cycle, 1-minute exposure) were performed in two groups of animals (n=8) after the tumor reached 12 mm in diameter. The control group received sham exposure. Lysis of the tumor tissue was performed using boiling-histotripsy, in which boiling is induced in several milliseconds at the transducer focus by a high amplitude nonlinear HIFU pulse, and the interaction of the boiling bubble with HIFU field leads to tissue emulsification. Blood withdrawals were performed before and immediately after each exposure, and at several post treatment points: 30 minutes, 1, 3 and 24 hours. Specimens were immediately processed into plasma (the cell-free, liquid portion of blood prevented from coagulating), from which miRNA was extracted. Prospective tumor-specific biomarkers were identified by qRT-PCR array profiling of 375 known miRNAs (microRNA Ready-to-Use PCR Panel I, Exiqon) in the cell line, filtering away those known to be broadly expressed in normal tissue or abundant in untreated rat plasma.

Results: The number of copies of tumor-specific miRNAs (miR-34c, miR-9, miR-129-5p, miR-100, miR-196a) were substantially increased (2-fold to 34-fold) within 15 minutes after HIFU-induced tumor lysis or HIFU-induced cavitation of the tumor tissue, but not after HIFU-induced mild hyperthermia. This increase returned to baseline within 1-3 hours. The concentration of a broadly expressed miR-16 was used as a negative control and did not change significantly.

This study demonstrates that HIFU-induced localized tissue lysis may be used to enhance the diagnostic yield of the tumor-specific nucleic acid biomarkers, and thus serve as a “non-invasive biopsy” of undiagnosed tissue masses. Furthermore, these data demonstrate that HIFU-induced cavitation of tumor tissue may be used to enhance the diagnostic yield of the tumor-specific nucleic acid biomarkers, and thus serve as a “non-invasive biopsy” of undiagnosed tissue masses without common patient risks associated with the histotripsy HIFU regime used to induce localized tissue lysis.

Example 3

An experiment to determine the effect of HIFU frequency on the lesion shape and size using repetitive millisecond boiling caused by shock wave heating was performed ex vivo using bovine liver tissue. An acrylic water tank at room temperature (20° C.) was filled with purified water that was degassed using a multiple pinhole degasser to 25% of saturation, as measured by a dissolved oxygen meter (WTW Oxi 330i, Weilheim, Germany). The HIFU source used in the majority of the experiments was a single-element, air-backed, custom-built piezoceramic transducer of 2.158 MHz frequency, 44 mm aperture, and focal length (f-number=1). The transducer was driven by a function generator (Agilent 33250A, Agilent, Palo Alto, Calif.) and a rf amplifier (300W, ENI A-300, ENI, Rochester, N.Y.). In addition, two other HIFU transducers with frequencies of 1.1 and 3.4 MHz were used in a small set of experiments to investigate the effect of frequency on the resulting tissue damage. The 1.1 MHz source (also 44 mm aperture and focal length) was driven by a separate rf amplifier (1000W, RFG-1000, JJ&A Instruments, Duvall, Wash.). The 3.4 MHz transducer (H-102 model, outer aperture 64 mm and focal length 62.6 mm, Sonic Concepts, Bothell, Wash.) was driven with the same electronics as the 2 MHz source. A timing board (NI 6608, National Instruments, Austin, Tex.) was used to trigger the function generator for various pulsing protocols and was controlled using a custom Labview program (National Instruments, Austin, Tex.). The HIFU source was attached to a three-axis positioning system (Velmex Inc., Bloomfield, N.Y.) to align the focus with the desired position within the exposure sample. B-mode ultrasound imaging was performed during experiments using an HDI-1000 scanner with a CL10-5 scanhead (Philips Medical Systems, Bothell, Wash.). The excitation voltage at the HIFU source was monitored using a 10× Lecroy high-voltage probe in parallel with the HIFU transducer. The voltage was recorded using a digital oscilloscope (LT344, Lecroy, Chestnut Ridge, N.Y.) and fluctuations in the rms voltage were used to indicate the onset of boiling at the focus. The fluctuations in the voltage are caused by transduction of ultrasound energy that is backscattered from boiling bubbles at the focus. A high-speed camera (Fastrax APX-RS, Photron, San Diego, Calif.) was used simultaneously with the ultrasound imaging system for viewing heating effects and bubbles in transparent gel phantoms. The camera was operated at a pixel resolution of 1024×1024 and a Nikon 105 mm lens (Nikon, Melville, N.Y., USA) was used with a bellows extension to obtain a field of view of 10 mm×10 mm (10 μm/pixel). The frames were recorded at 20,000 frames per second (fps) with a 4 μs shutter speed.

Gel phantoms were prepared using polyacrylamide with 7% bovine serum albumin (BSA). These gels are optically transparent and have similar acoustic properties to tissue except for the attenuation coefficient, which is about three times lower than most tissues (0.15 dB/cm/MHz). Localized heating of the gels causes the BSA to denature and form an opaque region above temperatures of about 60° C. that can be visualized optically. To prepare the samples, the liquid mixture of gel constituents was degassed for 1 h in a desiccant chamber, then poured into a custom mold and polymerized. A 1 mm needle was attached to the mold and placed within the gel for alignment purposes. Tissue samples were prepared from bovine heart or liver tissue. The tissue was obtained from an abattoir on the same day as experiments and stored in phosphate buffered saline and on ice until experiments were performed. The tissue was cut into samples to fit in a custom-designed tissue holder (8 cm wide by 8 cm tall by 2.7 cm deep) and was degassed for 1 h in a desiccant chamber immediately prior to experiments. The heart tissue samples were oriented so that the ultrasound was incident perpendicularly to the muscle fibers. For positioning the HIFU focus at a depth of 12 mm within the sample, a removable “pointer” was attached to the transducer before each exposure. The pointer was also used to position the ultrasound imaging probe so that the HIFU axis was aligned with the B-mode imaging plane. After exposures, the tissue was sectioned and photographed to observe the lesion morphology.

For gel phantoms, a fiber-optic probe hydrophone of 100 μm diameter and 100 MHz bandwidth (FOPH 2000, RP Acoustics, Leutenbach, Germany) was embedded at the depth of the HIFU focus in the gel before polymerization. Pressure waveforms were measured at increasing source power levels at the spatial maximum of the peak positive pressure. Measured waveforms were deconvolved using the FOPH impulse response provided by the manufacturer and the sensitivity of the FOPH was corrected to account for the slightly different acoustical properties of gel as compared to water.

Sonications were performed using 1.06, 2.158, and 3.42 MHz transducers. The transducers were operated to produce approximately the same peak positive and negative pressure levels in water as measured with the FOPH. For the 2 MHz transducer, the corresponding power setting was the same as for exposure 3. The equivalent in situ pressure level for each transducer was generated by varying the depth of focus location within the tissue to account for the increase in attenuation with frequency; therefore, the focus was positioned 20, 12, and 6 mm below the tissue surface for the 1, 2, and 3 MHz transducers.

The exposure parameters at the focus were the same for all three exposures: the in situ focal pressure was p+=74 MPa, p=13 MPa, the duty factor was 0.01, and the total HIFU on time was 500 ms. The pulse duration used in all of these experiments was approximately three times longer than the time to initiate boiling for each frequency: 20 ms (1 MHz), 10 ms (2 MHz), and 5 ms (3 MHz).

FIG. 4A shows a portion of a histotripsy HIFU waveform; FIG. 4B shows a series of histotripsy HIFU waveforms used to induce boiling in bovine liver tissue to release of a biomarker from a tissue mass according to one embodiment of the present technology. As shown in FIG. 4C, the histotripsy HIFU energy induces cavities in the bovine liver tissue of decreasing size when the frequency of the histotripsy HIFU wave increases from 1.1 MHz, 2.158 MHz and 3.4 MHz.

Example 4

In order to determine if ultrasound stimulation is sufficient for the release of intercellular biomarkers, Copenhagen rats bearing MatLyLu subcutaneous tumors were surgically modified with jugular vein catheters for simplified, repeatable, clean blood draws. HIFU was applied to the modified rats using various regimes shown in Table 2 using a 1.5 MHz transducer, under B-mode guidance, in tank of water.

TABLE 2
HIFU regimes for rat model studies.
Treatment type p+, MPa p, MPa Tp, ms PRF, Hz Time/spot, s
Liquification 90 17 10 1 30
(histotripsy)
Permeabilizaiton 78 16 1 1 30
(cavitation)
Mild heating 2.5 2.3 2 250 30
(thermal)

The modified rats were divided into three separate HIFU treatment groups, according to the ultrasound regimen utilized for treatment: liquification (histotripsy N=11), mild heating (thermal, N=9) and permeabilization (cavitation, N=6), in addition to a mock-treated control group (which did receive anesthesia and other manipulations inherent to the protocol but no ultrasound exposure, N=9). Blood was collected immediately prior to treatment and over a subsequent time course (up to 24 hours).

Prospective tumor-specific biomarkers were identified by qRT-PCR array profiling (Exiqon) of RNA extracts derived from the grafted cell line and untreated rat plasma. miRNAs that were abundant in untreated rat plasma were filtered from the list of those detected in the cell line (Table 1). To control the pre-analytic variability encountered in plasma due to blood cell contaminants introduced during plasma processing, miRNA biomarker candidates were then filtered against a list of miRNAs known to be abundant in blood cells. This process identified miRNAs miR-9, miR-34c, miR-100, miR-129, and miR-196a as putative, tumor-specific miRNAs in this system.

As shown in FIGS. 7A-7E, the abundances of tumor-specific miRNAs in the plasma (miR-9, miR-34c, miR-100, miR-129, miR-196a) were markedly increased within 15 minutes after HIFU-induced liquification (histotripsy) and HIFU-induced tumor cell lysis (permeabilization), but not after HIFU-induced hyperthermia (thermal) or in mock-treated control rats (mock). The concentration of the broadly expressed, non-tissue specific miR-16 was not commensurately increased in HIFU-treated or in control animals (FIG. 7F), indicating that the increase in plasma miRNA abundance was specific and not global.

FIGS. 8A-8F show relative copies of the miRNAs on a shorter time scale than FIGS. 7A-7F. As shown in FIG. 8A-8E, peak release of miR-9, miR-34c, miR-100, miR-129 and miR-196a occurs within just a few minutes of application of the liquification (histotripsy) HIFU.

These data indicate that liquification (histotripsy) HIFU and permeabilization (cavitation) HIFU, but not thermal HIFU, significantly increased prostate cancer biomarker release from prostate tumors in rats.

FURTHER EXAMPLES

Example 1

A method of diagnosing a disease or an increased risk of a disease in a subject, the method comprising:

    • applying high intensity focused ultrasound (HIFU) energy to a target mass of the subject to cause release of a marker from the mass; and
    • thereafter determining a concentration of the marker in a fluid of the subject.

Example 2

The method of Example 1 wherein the disease is a cancer, and wherein the marker is a DNA, an RNA (e.g., an miRNA), a protein or a small molecule.

Example 3

The method of Example 1 or Example 2 further comprising determining that the subject has the disease or the increased risk of the disease if the concentration of the marker in the fluid exceeds a threshold value.

Example 4

The method of Example 3 wherein the threshold value is an amount that is significantly greater than a baseline amount of the marker in fluid determined before applying HIFU energy to the target mass, optionally wherein the threshold value is about 2 times greater than the baseline amount.

Example 5

The method of any one of Examples 1 to 4, wherein applying HIFU energy to a target mass of the subject is non-invasive.

Example 6

The method of any one of Examples 1 to 5 wherein applying HIFU energy to a target mass of the subject comprises inducing cavitation bubble activity in tissue of the target mass.

Example 7

The method of any one of Examples 1 to 5 wherein applying HIFU energy to a target mass of the subject comprises inducing boiling histotripsy in tissue of the target mass.

Example 8

A method of characterizing two or more masses in a subject, the method comprising:

    • optionally determining a baseline concentration of a first marker and/or a second marker in fluid of the subject;
    • applying a first high intensity focused ultrasound (HIFU) energy to a first mass of the subject to cause release of a first marker from the mass;
    • thereafter determining a concentration of the first marker in a first fluid sample of the subject;
    • after a period of time, applying a second HIFU energy to a second mass of the subject to cause release of a second marker from the mass;
    • thereafter determining a concentration of the second marker in a second fluid sample of the subject; and
    • characterizing the first and second masses based, at least in part, on the concentrations of the first and second markers in the first and second fluid samples, respectively.

Example 9

The method of Example 8 wherein the period of time is sufficient for the concentration of the first marker in fluid of the subject to return to a concentration substantially the same as a baseline concentration of the first marker associated with the fluid before applying the second HIFU energy to the second mass.

Example 10

The method of Example 9 wherein the period of time is no more than about 2 hours.

Example 11

The method of Example 9 wherein the period of time is no more than about 1 hour.

Example 12

The method of Example 9 wherein the period of time is no more than about 20 minutes.

Example 13

The method of any one of Examples 8 to 12 wherein applying the first HIFU energy to the first mass induces boiling histotripsy (e.g. liquification) in the first mass, and applying the second HIFU energy to the second mass induces boiling histotripsy (e.g. liquification) in the second mass.

Example 14

The method of any one of Examples 8 to 12, wherein applying the first HIFU energy to the first mass induces cavitation (e.g., permeabilization) in the first mass, and applying the second HIFU energy to the second mass induces cavitation (e.g., permeabilization) in the second mass.

Example 15

A method of treating a target tissue mass in a subject, the method comprising:

    • optionally determining a baseline concentration of a biomarker in a fluid sample of the subject;
    • performing a procedure on the target tissue mass of the subject;
    • applying high intensity focused ultrasound (HIFU) energy to the target tissue mass;
    • determining a concentration of the biomarker in a fluid sample of the subject after applying HIFU energy to the target tissue mass; and
    • repeating the performing, applying, and determining until a concentration of the biomarker in the fluid sample falls below a threshold value.

Example 16

The method of Example 15 wherein a period of time between applying HIFU energy to the target tissue mass and determining the concentration of the predetermined biomarker is no more than about 2 hours.

Example 17

The method of Example 15 wherein a period of time between applying HIFU energy to the target tissue mass and determining the concentration of the predetermined biomarker is no more than about 1 hour.

Example 18

The method of Example 15 wherein a period of time between applying HIFU to the target tissue mass and determining the concentration of the predetermined biomarker is no more than about 20 minutes.

Example 19

A method of treating two or more tissue masses in a subject, the method comprising:

    • (a) optionally determining a baseline concentration of a first marker and/or second marker in fluid of the subject;
    • (b) performing a first procedure on a first tissue mass of the subject;
    • (c) applying high intensity focused ultrasound (HIFU) energy to the first tissue mass to cause a first marker to release from the first tissue mass;
    • (d) thereafter, determining a concentration of the first marker in a first fluid sample of the subject;
    • (e) after a first period of time, performing a second procedure on a second tissue mass of the subject;
    • (f) applying HIFU energy to the second tissue mass to cause a second marker to release from the second tissue mass;
    • (g) thereafter, determining a concentration of the second marker in a second fluid sample of the subject; and
    • (h) after a second period of time, repeating:
      • (1) steps (b) to (d) if the concentration of the first marker exceeds a first threshold value;
      • (2) steps (e) to (g) if the concentration of the second marker exceeds a second threshold value; or
      • (3) steps (b) to (g) if the concentration of the first marker exceeds the first threshold value and the concentration of the second marker exceeds the second threshold value.

Example 20

The method of Example 19 wherein the first threshold value is significantly greater than the baseline concentration of the first marker in fluid of the subject determined before step (c), optionally wherein the threshold value is about 2 times greater than the baseline concentration of the first marker.

Example 21

The method of Example 19 or Example 20 wherein the second threshold value is significantly greater than the baseline concentration of the second marker in fluid of the subject determined before step (f), optionally wherein the threshold value is about 2 times greater than the baseline concentration of the second marker.

Example 22

The method of any one of Examples 19 to 21 wherein applying HIFU energy to the first mass and applying HIFU energy to the second tissue mass induces boiling histotripsy or cavitation.

Example 23

The method of any one of Examples 19 to 22 wherein the fluid sample is obtained from the subject while applying HIFU energy to the subject.

Example 24

A method of inducing release of a marker from target tissue of a subject, the method comprising non-invasively applying high intensity focused ultrasound (HIFU) energy to the target tissue.

Example 25

The method of Example 24 wherein the target tissue is a tumor and the marker is an miRNA.

Example 26

The method of Example 24 or Example 25 wherein a maximum amount of the marker is released from the target tissue in no more than about 5 minutes after application of the HIFU energy.

Example 27

The method of Example 24 or Example 25 wherein a maximum amount of the marker is released from the target tissue in no more than about 3 minutes after application of the HIFU energy.

Example 28

The method of Example 26 or Example 27 wherein the marker is released into a fluid of a subject, and the amount of the marker released from the target tissue is determined by determining a concentration of the marker in a fluid of the subject, wherein the fluid is optionally selected from the group consisting of blood (e.g., fluid and/or non-fluid fractions or derivatives of blood such as whole blood, cells, plasma, serum, microvesicles, and/or cryoprecipitate), plasma, serum, subcellular vesicles, lymph fluid, ascites, urine, cerebrospinal fluid, seminal fluid, breast milk, breast secretions, breast aspirates, and feces.

Example 29

The method of Example 28 wherein the fluid is blood, a blood fraction, or a blood derivative.

Example 30

The method of Example 26 or Example 27 wherein the maximum amount of the marker is significantly greater than the baseline amount of the marker in the fluid before application of the HIFU energy, optionally at least about 2 times greater than the baseline amount.

Example 31

The method of any one of Examples 8 to 13 and 19 to 23 wherein the first marker and the second marker are the same.

Example 32

The method of any preceding Example wherein the marker comprises SEQ ID NO:1.

Example 33

The method of any preceding Example wherein the marker comprises SEQ ID NO:2.

Example 34

The method of any preceding Example wherein the marker comprises SEQ ID NO:3.

Example 35

The method of any preceding Example wherein the marker comprises SEQ ID NO:4.

Example 36

The method of any preceding Example wherein the marker comprises SEQ ID NO:5.

Example 37

The method of any preceding Example wherein the marker comprises SEQ ID NO:6.

Example 38

The method of any preceding Example wherein the subject is human.

Example 39

The method of any preceding Example wherein the subject is a non-human animal.

CONCLUSION

The above detailed descriptions of embodiments of the technology are not intended to be exhaustive or to limit the technology to the precise form disclosed above. Although specific embodiments of, and examples for, the technology are described above for illustrative purposes, various equivalent modifications are possible within the scope of the technology, as those skilled in the relevant art will recognize. For example, while steps are presented in a given order, alternative embodiments may perform steps in a different order. The various embodiments described herein may also be combined to provide further embodiments.

From the foregoing, it will be appreciated that specific embodiments of the invention have been described herein for purposes of illustration, but well-known structures and functions have not been shown or described in detail to avoid unnecessarily obscuring the description of the embodiments of the technology. Where the context permits, singular or plural terms may also include the plural or singular term, respectively.

Moreover, unless the word “or” is expressly limited to mean only a single item exclusive from the other items in reference to a list of two or more items, then the use of “or” in such a list is to be interpreted as including (a) any single item in the list, (b) all of the items in the list, or (c) any combination of the items in the list. Additionally, the term “comprising” is used throughout to mean including at least the recited feature(s) such that any greater number of the same feature and/or additional types of other features are not precluded. It will also be appreciated that specific embodiments have been described herein for purposes of illustration, but that various modifications may be made without deviating from the technology. Further, while advantages associated with certain embodiments of the technology have been described in the context of those embodiments, other embodiments may also exhibit such advantages, and not all embodiments need necessarily exhibit such advantages to fall within the scope of the technology. Accordingly, the disclosure and associated technology can encompass other embodiments not expressly shown or described herein.

Unless the context clearly requires otherwise, throughout the description and the claims, the words ‘comprise’, ‘comprising’, and the like are to be construed in an inclusive sense as opposed to an exclusive or exhaustive sense; that is to say, in the sense of “including, but not limited to”. Words using the singular or plural number also include the plural and singular number, respectively. Additionally, the words “herein,” “above,” and “below” and words of similar import, when used in this application, shall refer to this application as a whole and not to any particular portions of the application.

The description of embodiments of the disclosure is not intended to be exhaustive or to limit the disclosure to the precise form disclosed. While the specific embodiments of, and examples for, the disclosure are described herein for illustrative purposes, various equivalent modifications are possible within the scope of the disclosure, as those skilled in the relevant art will recognize.

Specific elements of any foregoing embodiments can be combined or substituted for elements in other embodiments. Furthermore, while advantages associated with certain embodiments of the disclosure have been described in the context of these embodiments, other embodiments may also exhibit such advantages, and not all embodiments need necessarily exhibit such advantages to fall within the scope of the disclosure.

Claims

1-14. (canceled)

15. A method of treating a target tissue mass in a subject, the method comprising:

optionally determining a baseline concentration of a biomarker in a fluid sample of the subject;

performing a procedure on the target tissue mass of the subject;

applying high intensity focused ultrasound (HIFU) energy to the target tissue mass;

determining a concentration of the biomarker in a fluid sample of the subject after applying HIFU energy to the target tissue mass; and

repeating the performing, applying, and determining until a concentration of the biomarker in the fluid sample falls below a threshold value.

16. The method of claim 15 wherein a period of time between applying HIFU energy to the target tissue mass and determining the concentration of the predetermined biomarker is no more than about 2 hours.

17. The method of claim 15 wherein a period of time between applying HIFU energy to the target tissue mass and determining the concentration of the predetermined biomarker is no more than about 1 hour.

18. The method of claim 15 wherein a period of time between applying HIFU to the target tissue mass and determining the concentration of the predetermined biomarker is no more than about 20 minutes.

19. A method of treating two or more tissue masses in a subject, the method comprising:

(a) optionally determining a baseline concentration of a first marker and/or second marker in fluid of the subject;

(b) performing a first procedure on a first tissue mass of the subject;

(c) applying high intensity focused ultrasound (HIFU) energy to the first tissue mass to cause a first marker to release from the first tissue mass;

(d) thereafter, determining a concentration of the first marker in a first fluid sample of the subject;

(e) after a first period of time, performing a second procedure on a second tissue mass of the subject;

(f) applying HIFU energy to the second tissue mass to cause a second marker to release from the second tissue mass;

(g) thereafter, determining a concentration of the second marker in a second fluid sample of the subject; and

(h) after a second period of time, repeating:

(1) steps (b) to (d) if the concentration of the first marker exceeds a first threshold value;

(2) steps (e) to (g) if the concentration of the second marker exceeds a second threshold value; or

(3) steps (b) to (g) if the concentration of the first marker exceeds the first threshold value and the concentration of the second marker exceeds the second threshold value.

20. The method of claim 19 wherein the first threshold value is significantly greater than the baseline concentration of the first marker in fluid of the subject determined before step (c), optionally wherein the threshold value is about 2 times greater than the baseline concentration of the first marker.

21. The method of claim 19 wherein the second threshold value is significantly greater than the baseline concentration of the second marker in fluid of the subject determined before step (f), optionally wherein the threshold value is about 2 times greater than the baseline concentration of the second marker.

22. The method of claim 19 wherein applying HIFU energy to the first mass and applying HIFU energy to the second tissue mass induces boiling histotripsy or cavitation.

23. The method of claim 19 wherein the fluid sample is obtained from the subject while applying HIFU energy to the subject.

24. A method of inducing release of a marker from target tissue of a subject, the method comprising non-invasively applying high intensity focused ultrasound (HIFU) energy to the target tissue.

25. The method of claim 24 wherein the target tissue is a tumor and the marker is an miRNA.

26. The method of claim 24 wherein a maximum amount of the marker is released from the target tissue in no more than about 5 minutes after application of the HIFU energy.

27. (canceled)

28. The method of claim 26 wherein the marker is released into a fluid of a subject, and the amount of the marker released from the target tissue is determined by determining a concentration of the marker in a fluid of the subject, wherein the fluid is optionally selected from the group consisting of blood, a blood fraction, a blood derivative, a fluid fraction of blood, a non-fluid fraction of blood, whole blood, blood cells, microvesicles, cryoprecipitate, plasma, serum, subcellular vesicles, lymph fluid, ascites, urine, cerebrospinal fluid, seminal fluid, breast milk, breast secretions, breast aspirates, and feces.

29. The method of claim 28 wherein the fluid is blood, a blood fraction, or a blood derivative.

30. The method of claim 26 wherein the maximum amount of the marker is significantly greater than the baseline amount of the marker in the fluid before application of the HIFU energy, optionally at least about 2 times greater than the baseline amount.

31. The method of claim 19 wherein the first marker and the second marker are the same.

32. The method of claim 15 wherein the marker comprises any one of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, or SEQ ID NO:6.

33. The method of claim 19 wherein the marker comprises any one of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, or SEQ ID NO:6.

34. The method of claim 24 wherein the marker comprises any one of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, or SEQ ID NO:6.

35-37. (canceled)

38. The method of claim 15 wherein the subject is human.

39. The method of claim 15 wherein the subject is a non-human animal.

40. The method of claim 19 wherein the subject is human.

41. The method of claim 19 wherein the subject is a non-human animal.

42. The method of claim 24 wherein the subject is human.

43. The method of claim 24 wherein the subject is a non-human animal.