US20170357750A1
2017-12-14
15/645,739
2017-07-10
The present invention provides a method for evaluating (predicting, etc.) an individual difference (the tendency of every individual) in terms of drug sensitivity and disease vulnerability, comprising using a gene polymorphism of a cyclic AMP responsive element binding protein gene or the like. The method for evaluating drug sensitivity and the method for evaluating disease vulnerability according to the present invention comprise associating a gene polymorphism of a cyclic AMP responsive element binding protein gene or a haplotype constituted by the gene polymorphism with the drug sensitivity and disease vulnerability of an individual.
Get notified when new applications in this technology area are published.
C12Q1/6883 » CPC further
Measuring or testing processes involving enzymes, nucleic acids or microorganisms ; Compositions therefor; Processes of preparing such compositions involving nucleic acids; Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
C12Q2600/156 » CPC further
Oligonucleotides characterized by their use Polymorphic or mutational markers
C12Q2600/106 » CPC further
Oligonucleotides characterized by their use Pharmacogenomics, i.e. genetic variability in individual responses to drugs and drug metabolism
C12Q1/68 IPC
Measuring or testing processes involving enzymes, nucleic acids or microorganisms ; Compositions therefor; Processes of preparing such compositions involving nucleic acids
This application is a Continuation of copending application Ser. No. 14/347,500, filed on Mar. 26, 2014, which is the National Phase under 35 U.S.C. §371 of PCT International Application No. PCT/JP2012/076054, filed on Oct. 1, 2012, which claims priority under 35 U.S.C. §119(a) to Patent Application No. 2011-217104, filed in JAPAN on Sep. 30, 2011, all of which are hereby expressly incorporated by reference into the present application.
The present invention relates to a method for evaluating drug sensitivity and disease vulnerability, comprising analyzing a cyclic AMP responsive element binding protein (cAMP responsive element binding protein; CREB) gene. Specifically, the present invention relates to a method for evaluating drug sensitivity and disease vulnerability, comprising associating a gene polymorphism of a CREB gene or a haplotype constituted by the gene polymorphism with the drug sensitivity and disease vulnerability of an individual. More specifically, the present invention relates to a method for evaluating a tendency in the presence or absence of the drug sensitivity and disease vulnerability of an individual, based on the results from the analysis of the above-described gene polymorphism or haplotype.
Pain is a pathology which is most frequently observed in the medical field, and it is often the case that the pain accompanying a disease is serious for the patient rather than the disease itself. The pain sensation plays an important role in terms of a biological warning system, however, excessive pain would significantly decrease QOL (quality of life) unless it is properly controlled. Recently, the importance of pain control has been recognized, and palliative care including pain therapy has remarkably progressed, and there is a tendency of increasing the frequency and amount of use of various analgesics.
It has been previously known that narcotic analgesics including morphine as a representative example act on a protein known as an “opioid receptor,” so as to cause analgesic action. The opioid receptor includes three types of receptors, a μ-type opioid receptor, a δ-type opioid receptor, and a κ-type opioid receptor, and all of these receptors are related to analgesic action. Since these receptors are Gi/o protein-coupled receptors, they activate a GIRK channel and suppression of a calcium channel through the mediation of a Gi-o protein. In addition, the receptors suppress adenylate cyclase (Non Patent Literature 1: Pierce K. et al., Seven-transmembrane receptors, Nat Rev Mol Cell Biol, (2002) 3: 639-650; Non Patent Literature 2: Bokoch G M. et al., Purification and properties of the inhibitory guanine nucleotide-binding regulatory component of adenylate cyclase, J Biol Chem, (1984) 259: 3560-3567). Activation of adenylate cyclase activates cyclic AMP-dependent protein kinase, and it causes activation of a cyclic AMP responsive element binding protein (CREB) through phosphorylation of the serine residue at position 133 of the protein (Non Patent Literature 3: Gonzalez G A. et al., Cyclic AMP stimulates somatostatin gene transcription by phosphorylation of CREB at serine 133, Cell, (1989) 59: 675-680). The activated CREB binds to a CREB-binding protein acting as an activation cofactor (Non Patent Literature 4: Chrivia J C, et al., Phosphorylated CREB binds specifically to the nuclear protein CBP., Nature, (1993) 365: 855-859), and it binds to the cyclic AMP responsive element of genomic DNA, thereby promoting gene expression (Non Patent Literature 5: Montminy M R. et al., Identification of a cyclic-AMP-responsive element within the rat somatostatin gene., Proc Natl Acad Sci USA, (1986) 83: 6682-6686).
The objective of the present invention is to provide a method for evaluating (predicting, etc.) an individual difference (the tendency of every individual) in terms of drug sensitivity and disease vulnerability, comprising using a gene polymorphism of a cyclic AMP responsive element binding protein (CREB) gene or the like.
The present inventors focused on the cyclic AMP responsive element binding protein (CREB) gene and conducted extensive examinations based on conventional findings and clinical data. As a result, the inventors identified several useful gene polymorphisms by analyzing the association of each CREB gene polymorphism with sensitivity to drugs such as analgesics, and with disease vulnerability including pain sensitivity. Thereafter, the inventors found linkage disequilibrium among the thus identified gene polymorphisms, and we also revealed a significant correlation between drug sensitivity and disease vulnerability (more specifically, a change in the required administration amount of an analgesic and a change in the threshold value of pain sensitivity due to a difference in specific CREB gene polymorphisms), thereby accomplishing the present invention.
Thus, the present invention relates to the following:
1. A method for evaluating drug sensitivity, comprising associating a gene polymorphism of a cyclic AMP responsive element binding protein gene or a haplotype constituted by the gene polymorphism with an individual drug sensitivity.
The above-described evaluation method includes a method for evaluating a tendency in the presence or absence of an individual drug sensitivity based on the results from the analysis of the gene polymorphism or the haplotype.
2. The method according to 1 above, comprising the following steps: (1) a step of performing linkage disequilibrium analysis and haplotype analysis on a healthy subject and selecting gene polymorphisms in a linkage disequilibrium block; (2) a step of analyzing the association between the genotypes of the gene polymorphisms and drug sensitivity in a test subject; and (3) a step of using the gene polymorphism that has been significantly associated with drug sensitivity in the test subject for evaluation of the drug sensitivity.
3. A method for evaluating disease vulnerability, comprising associating a gene polymorphism of a cyclic AMP responsive element binding protein gene or a haplotype constituted by the gene polymorphism with an individual disease vulnerability.
The above-described evaluation method includes a method for evaluating a tendency in the presence or absence of an individual disease vulnerability is evaluated based on the results from the analysis of the gene polymorphism or the haplotype.
4. The method according to 3 above, comprising the following steps: (1) a step of performing linkage disequilibrium analysis and haplotype analysis on a healthy subject and selecting gene polymorphisms in a linkage disequilibrium block; (2) a step of analyzing the association between the genotypes of the gene polymorphisms and pain sensitivity; and (3) a step of using the gene polymorphism that has been significantly associated with pain sensitivity in the test subject for evaluation of the disease vulnerability.
5. The method according to 3 or 4 above, wherein the disease vulnerability is pain sensitivity or vulnerability to substance dependence (in particular, vulnerability to drug dependence).
6. The method according to any one of 1 to 5 above, wherein the gene polymorphism is at least one selected from the group consisting of a single nucleotide polymorphism, an insertion polymorphism, a deletion polymorphism, and a nucleotide repeat polymorphism.
7. The method according to any one of 1 to 6 above, wherein the gene polymorphism is at least one selected from among: rs16839837, rs2360969, rs10932200, rs2253206, rs2551640, rs11904814, rs16839883, rs6740584, rs3770704, rs2254137, rs2551645, rs2551946, rs4234080, rs2952768, rs2709386, rs7591784, and rs7594560 of a CREB1 subtype gene (which is a CREB1 gene as a subtype of the CREB gene (the same shall apply hereafter); rs1243872, rs2145925, rs2025126, rs1885373, rs1885374, GA007473, rs2295794, rs4879926, GA007477, rs867194, rs11541908, rs741917, rs7862485, rs2756894, rs2249250, rs2295795, rs877365, rs2737273, rs2295797, rs2295798, rs1534847, rs7873822, rs2737274, rs10972567, rs3763630, rs10814274, rs3750434, rs1570246, GA025684, rs1570248, rs1570249, rs34478611, rs1322045, rs1951432, GA025687, rs10814275, rs10758320, rs4878628, rs10758321, and rs10758322 of a CREB3 subtype gene (which is a CREB3 gene as a subtype of the CREB gene (the same shall apply hereafter); rs4722778, rs177479, rs177480, rs11981754, rs177486, rs177498, rs2175738, rs17156579, rs17156603, rs17642145, rs10229500, rs10243659, rs4722785, rs16874503, rs11772815, rs6958133, rs16874525, rs17715174, rs6953524, rs10239810, rs17156649, rs1811248, rs887623, rs740988, rs7794304, rs6952227, rs42695, rs1029897, rs4722793, rs10233653, rs6955105, rs17156685, rs17156694, rs17156699, rs177572, rs177573, rs177574, rs177576, rs13437706, rs177580, rs177581, rs12666636, rs177584, rs177585, rs216715, rs10951197, rs160335, rs1008262, rs310353, rs310359, rs41273, rs1637457, rs17156919, rs41276, rs160375, rs917275, rs41348, rs886816, rs17157048, rs6462098, rs10951201, rs13311248, rs12540480, rs10265166, rs7798774, rs7799246, rs6972081, rs12533079, rs7806547, rs6462100, rs6979352, rs6950574, rs4722835, rs2066979, rs10486591, rs721993, rs2237351, rs3735566, rs11975539, rs6462107, rs2190306, rs4719955, and rs10228137 of a CREB5 subtype gene (which is a CREB5 gene as a subtype of the CREB gene (the same shall apply hereafter); and rs1153711, rs1153702, rs7583431, rs1153699, rs2302663, rs3845744, rs212349, rs212347, rs12693057, rs1153685, rs212360, rs212361, rs2072538, rs1205399, rs1153676, rs7566401, rs7578569, rs3755490, rs13388308, rs11888507, rs10497434, rs268214, rs166531, rs268228, rs268229, rs268230, rs268231, rs10497435, rs1982235, rs268237, rs13030474, and rs268174 of an ATF2 subtype gene (which is an ATF2 gene as an alias of a CREB2 gene that is a subtype of the CREB gene (the same shall apply hereafter)).
8. The method according to any one of 1 to 7 above, wherein the haplotype is at least one selected from the following table.
It is to be noted that haplotypes constituted by a combination of any given number and type of various gene polymorphisms according to 7 above can also be selected as haplotypes used in the evaluation method and the like of the present invention.
| TABLE 1 |
| Gene name CREB1 |
| Linkage disequilibrium block No. | |
| 1 | |
| Gene polymorphism name () |
| 1 | 2 | 3 | 12 | 13 | 17 | ||||||||||||
| Haplotype No. | Tag | Tag | Tag | 4 | 5 | 6 | 7 | 8 | 9 | 10 | 11 | Tag | Tag | 14 | 15 | 16 | Tag |
| H1 | C | C | C | A | G | G | G | T | C | C | C | C | C | C | A | A | T |
| H2 | C | C | A | G | A | T | A | C | T | A | T | C | C | T | G | G | T |
| H3 | C | T | C | A | G | G | A | T | T | C | C | C | C | C | A | A | T |
| H4 | T | C | A | G | A | T | A | C | T | A | T | C | A | T | G | G | C |
| H5 | C | C | A | G | A | T | A | C | T | A | T | A | C | C | A | A | T |
| H6 | T | C | A | G | A | T | A | C | T | A | T | C | C | T | G | G | T |
| H7 | T | C | A | G | A | T | A | C | T | A | T | C | A | T | G | G | T |
| . . . | Haplotypes which are estimated to occur at a frequency of less than 1% |
| () 1~17: (in this order)rs16839837, rs2360969, rs10932200, rs2253206, rs2551640, rs11904814, rs16839883, rs6740584, rs3770704, rs2254137, rs2551645, rs2551946, rs4234080, rs2952768, rs2709386, rs7591784 and rs7594560 |
| TABLE 2 |
| Gene name CREB3 |
| Linkage disequilibrium block No. | |
| 1 | |
| Gene polymorphism name () |
| 1 | 2 | 3 | 9 | 11 | ||||||||||||||||||||
| Haplotype No. | Tag | Tag | Tag | 4 | 5 | 6 | 7 | 8 | Tag | 10 | Tag | 12 | 13 | 14 | 15 | 16 | 17 | 18 | 19 | 20 | 21 | 22 | 23 | 24 |
| H1 | G | C | G | T | A | T | T | T | C | T | C | C | G | C | T | G | T | G | T | C | A | G | G | A |
| H2 | G | C | G | T | A | T | T | T | T | T | C | C | G | C | T | G | T | G | T | C | A | G | G | A |
| H3 | T | T | A | T | A | T | C | T | C | T | T | C | G | A | G | A | C | A | C | C | G | T | G | C |
| H4 | T | T | A | T | A | T | C | T | C | T | C | C | G | A | G | A | C | A | C | C | G | T | G | C |
| H5 | T | C | G | C | C | C | C | C | C | T | C | C | A | A | G | G | C | A | T | C | A | T | A | C |
| H6 | T | T | G | T | A | T | C | T | C | C | C | T | G | A | T | G | C | G | T | C | A | G | G | C |
| H7 | T | C | A | T | A | T | C | T | C | T | T | C | G | A | G | A | C | A | C | C | G | T | G | C |
| . . . | Haplotypes which are estimated to occur at a frequency of less than 1% |
| Linkage disequilibrium block No. | |
| 2 | |
| Gene polymorphism name () |
| 25 | 26 | 29 | 36 | 38 | 39 | |||||||||||
| Haplotype No. | Tag | Tag | 27 | 28 | Tag | 30 | 31 | 32 | 33 | 34 | 35 | Tag | 37 | Tag | Tag | 40 |
| H8 | C | C | G | G | G | C | G | G | G | A | T | A | C | C | G | C |
| H9 | C | T | A | T | G | T | A | G | A | G | A | A | T | C | A | T |
| H10 | T | C | G | G | C | T | G | A | A | G | A | A | T | C | G | C |
| H11 | C | T | A | G | G | T | A | G | A | G | A | A | T | C | G | T |
| H12 | C | C | G | G | C | T | G | A | A | G | A | A | T | C | G | C |
| H13 | C | T | A | T | G | T | A | G | A | G | A | G | T | C | A | T |
| H14 | C | C | G | G | G | C | G | G | G | A | T | A | C | T | G | C |
| . . . | Haplotypes which are estimated to occur at a frequency of less than 1% |
| () 1~40: (in this order)rs1243872, rs2145925, rs2025126, rs1885373, rs1885374, GA007473, rs2295794, rs4879926, GA007477, rs867194, rs11541908, rs741917, rs7862485, rs2756894, rs2249250, rs2295795, rs877365, rs2737273, rs2295797, rs2295798, rs1534847, rs7873822, rs2737274, rs10972567, rs3763630, rs10814274, rs3750434, rs1570246, GA025684, rs1570248, rs1570249, rs34478611, rs1322045, rs1951432, GA025687, rs10814275, rs10758320, rs4878628, rs10758321 and rs10758322 |
| TABLE 3 |
| Gene name CREB5 |
| Linkage disequilibrium block No. |
| 1 | 5 | 6 | 9 | 10 |
| Gene polymorphism name () |
| 1 | 2 | 5 | 6 | 7 | 8 | 9 | 11 | 13 | 14 | 15 | 16 | 17 | 18 | |||||||||
| Haplotype (H) No. | Tag | Tag | 3 | 4 | Tag | Tag | H No. | Tag | Tag | Tag | 10 | Tag | 12 | H No. | Tag | Tag | H No. | Tag | Tag | H No. | Tag | Tag |
| H1 | C | T | A | A | G | C | H6 | C | C | G | C | A | G | H11 | T | G | H14 | T | A | H17 | G | T |
| H2 | G | C | G | A | G | T | H7 | C | A | A | C | G | G | H12 | C | C | H15 | C | A | H18 | G | G |
| H3 | G | C | G | A | A | T | H8 | C | C | G | C | G | G | H13 | C | G | H16 | C | G | H19 | A | G |
| H4 | C | C | G | A | G | T | H9 | T | A | A | C | G | A | . . . | . . . | . . . | ||||||
| H5 | G | C | G | A | G | C | H10 | C | C | A | C | G | G |
| . . . | Haplotypes which are estimated to occur at a frequency of less than 1% |
| Linkage disequilibrium block No. |
| 11 | 12 | 13 | 15 | 16 |
| Gene polymorphism name () |
| 19 | 20 | 21 | 22 | 23 | 24 | 25 | 26 | 27 | 28 | 29 | 30 | 31 | |||||||
| Haplotype (H) No. | Tag | Tag | H No. | Tag | Tag | Tag | H No. | Tag | Tag | H No. | Tag | Tag | Tag | H No. | Tag | Tag | Tag | 32 | 33 |
| H20 | T | A | H24 | G | C | C | H28 | A | A | H31 | G | T | C | H35 | C | C | C | G | C |
| H21 | T | G | H25 | G | C | T | H29 | G | A | H32 | A | C | T | H36 | T | C | A | G | C |
| H22 | C | G | H26 | A | C | T | H30 | G | G | H33 | A | T | T | H37 | C | C | A | G | C |
| H23 | C | A | H27 | G | T | T | . . . | H34 | A | T | C | H38 | T | T | C | A | T |
| . . . | Haplotypes which are estimated to occur at a frequency of less than 1% |
| Linkage disequilibrium block No. |
| 25 | 26 | 27 | 32 |
| Gene polymorphism name () |
| 34 | 35 | 36 | 37 | 38 | 39 | 40 | 42 | 43 | 44 | 45 | 47 | 50 | ||||||||
| Haplotype (H) No. | Tag | Tag | H No. | Tag | Tag | Tag | Tag | H No. | Tag | 41 | H No. | Tag | Tag | Tag | Tag | 46 | Tag | 48 | 49 | Tag |
| H39 | T | A | H42 | G | A | G | G | H47 | A | A | H49 | A | T | C | G | T | G | T | T | T |
| H40 | C | G | H43 | G | A | A | A | H48 | G | G | H50 | A | T | C | G | T | G | T | T | C |
| H41 | T | G | H44 | A | G | G | A | . . . | H51 | A | T | A | C | C | G | T | C | C | ||
| . . . | H45 | G | A | G | A | H52 | C | T | A | C | T | T | C | T | C | |||||
| H46 | G | G | G | A | H53 | C | T | A | C | T | G | C | T | C | ||||||
| . . . | H54 | A | C | C | G | T | G | T | T | T | ||||||||||
| H55 | A | T | A | G | T | G | T | T | C |
| Haplotypes which are estimated to occur at a frequency of less than 1% | |
| Linkage disequilibrium block No. |
| 33 | 35 | 40 |
| Gene polymorphism name () |
| 51 | 52 | 53 | 54 | 57 | 58 | 59 | ||||||||||
| Haplotype (H) No. | Tag | Tag | Tag | Tag | 55 | 56 | H No. | Tag | Tag | H No. | Tag | 60 | 61 | 62 | 63 | 64 |
| H56 | T | G | G | C | A | A | H61 | C | T | H64 | G | G | C | T | T | C |
| H57 | T | A | A | T | G | C | H62 | T | C | H65 | A | A | T | C | C | A |
| H58 | G | A | A | C | G | C | H63 | T | T | . . . | ||||||
| H59 | T | A | G | C | A | A | . . . | |||||||||
| H60 | T | A | A | C | G | C |
| . . . | Haplotypes which are estimated to occur at a frequency of less than 1% |
| () 1~64: (in this order) rs4722778, rs177479, rs177480, rs11981754, rs177486, rs177498, rs10229500, rs10243659, rs4722785, rs16874503, rs11772815, rs6958133, rs16874525, rs17715174, rs6953524, rs10239810, rs17156649, rs1811248, rs887623, rs740988, rs6952227, rs42695, rs1029897, rs10233653, rs6955105, rs17156699, rs177572, rs177573, rs177580, rs177581, rs12666636, rs177584, rs177585, rs1008262, rs310353, rs41273, rs1637457, rs17156919, rs41276, rs160375, rs917275, rs17157048, rs6462098, rs10951201, rs13311248, rs12540480, rs10265166, rs7798774, rs7799246, rs6972081, rs12533079, rs7806547, rs6462100, rs6979352, rs6950574, rs4722835, rs721993, rs2237351, rs3735566, rs11975539, rs6462107, rs2190306, rs4719955 and rs10228137 |
| TABLE 4 |
| Gene name ATF2 |
| Linkage disequilibrium block No. |
| 1 | 2 |
| Gene polymorphism name () |
| 1 | 2 | 3 | 4 | 5 | ||||||||||||
| Haplotype No. | Tag | Tag | Tag | Tag | Tag | 6 | 7 | 8 | 9 | 10 | 11 | 12 | 13 | 14 | 15 | 16 |
| H1 | T | C | A | A | G | C | C | A | G | C | G | T | C | A | A | A |
| H2 | G | C | A | G | G | T | T | G | A | T | A | C | A | C | C | G |
| H3 | T | T | C | G | A | T | T | G | A | T | A | C | A | C | C | G |
| H4 | T | T | A | G | A | T | T | G | A | T | A | C | A | C | C | G |
| G | G | T | T | G | A | T | A | C | A | C | C | G |
| . . . | Haplotypes which are estimated to occur at a frequency of less than 1% |
| Linkage disequilibrium block No. | |
| 2 | |
| Gene polymorphism name () |
| 21 | 28 | ||||||||||||||
| Haplotype No. | 17 | 18 | 19 | 20 | Tag | 22 | 23 | 24 | 25 | 26 | 27 | Tag | 29 | 30 | 31 |
| H5 | C | T | T | C | C | C | G | A | C | A | C | T | T | G | T |
| H6 | T | C | C | T | T | T | A | G | A | C | T | G | C | G | C |
| H7 | T | C | C | T | T | T | A | G | A | C | T | T | C | G | C |
| H8 | T | C | C | T | T | T | A | G | A | C | T | G | C | G | C |
| H9 | T | C | C | T | C | C | G | A | C | A | C | T | T | G | T |
| . . . | Haplotypes which are estimated to occur at a frequency of less than 1% |
| () 1~31: (in this order)rs1153711, rs1153702, rs7583431, rs2302663, rs3845744, s212349, rs212347, rs12693057, rs1153685, rs212360, rs212361, rs2072538, rs1205399, rs1153676, rs7566401, rs7578569, rs3755490, rs13388308, rs11888507, rs10497434, rs268214, rs166531, rs268228, rs268229, rs268230, rs268231, rs10497435, rs1982235, rs268237, rs13030474 and rs268174 |
9. A method for determining the type, amount, and/or frequency of administration of a drug to be administered to an individual, comprising using the result from the evaluation by the method according to any one of 1 to 8 above as an index.
10. A method for predicting a side effect of a drug to be administered to an individual, comprising using the result from the evaluation by the method according to any one of 1 to 8 above as an index.
11. The method according to any one of 1, 2, 5, 9, and 10 above, wherein the drug is an opioid receptor function modulator and/or a cyclic AMP responsive element binding protein function modulator.
12. The method according to 11 above, wherein the opioid receptor function modulator is at least one selected from the group consisting of methamphetamine, methylenedioxymethamphetamine, amphetamine, dextroamphetamine, dopamine, morphine, DAMGO, codeine, methadone, carfentanil, fentanyl, heroin, cocaine, naloxone, naltrexone, nalorphine, levallorphan, pentazocine, pethidine, buprenorphine, oxycodone, hydrocodone, levorphanol, etorphine, dihydroetorphine, hydromorphone, oxymorphone, tramadol, diclofenac, indomethacin, ethanol, methanol, diethyl ether, propanol, butanol, flupirtine, laughing gas, F3 (1-chloro-1,2,2-trifluorocyclobutane), halothane, estradiol, dithiothreitol, thioridazine, pimozide, fluoxetine, paroxetine, desipramine, imipramine, clomipramine, tetramide, isoflurane, ginsenoside, ifenprodil, bupivacaine, tertiapin, clozapine, haloperidol, SCH23390, and cocaine; and the cyclic AMP responsive element binding protein function modulator is at least one selected from the group consisting of phosphodiesterase 4 (PDE4), calcineurin, protein kinase A, protein kinase C, p90 ribosome S6 kinase 1 (RSK1), calmodulin kinase, glycogen synthase kinase 3β, and CREB-regulated transcription coactivator 1 (CRTC1).
13. The method according to any one of 1 to 12 above, comprising using an oligonucleotide consisting of a nucleotide sequence of at least 10 nucleotides comprising the 51st nucleotide of the nucleotide sequence represented by any one of SEQ ID NOS: 1 to 172, or a complementary nucleotide sequence thereto, which can specifically hybridize to a DNA fragment comprising a gene polymorphism of a cyclic AMP responsive element binding protein gene.
14. The method according to 13 above, wherein the oligonucleotide spans a length of 10 to 150 nucleotides.
15. The method according to 13 or 14 above, wherein the oligonucleotide is selected from the group consisting of the nucleotide sequence represented by any one of SEQ ID NOS: 1 to 38 and a complementary nucleotide sequence thereto.
16. A gene polymorphism marker for evaluating a tendency in the presence or absence of an individual drug sensitivity, comprising a gene polymorphism of a cyclic AMP responsive element binding protein gene or a haplotype constituted by the gene polymorphism. Examples of the drug applied herein are the same as those described in 11 and 12 above.
17. A gene polymorphism marker for evaluating a tendency in the presence or absence of an individual disease vulnerability, comprising a gene polymorphism of a cyclic AMP responsive element binding protein gene or a haplotype constituted by the gene polymorphism.
According to the present invention, there can be provided: a gene polymorphism of a cyclic AMP responsive element binding protein gene or a haplotype constituted by the gene polymorphism, which is capable of evaluating an individual difference in terms of drug sensitivity and disease vulnerability; a method for evaluating drug sensitivity and disease vulnerability, comprising using the gene polymorphism or the haplotype; etc. According to this evaluation method, it becomes possible to readily know or predict a proper prescribed amount, a proper prescribed schedule, and the like, associated with a narcotic drug such as morphine, and hence the method is extremely useful for personalized pain therapy, drug dependence therapy and the like.
FIG. 1 is a schematic view showing gene polymorphisms identified regarding a CREB1 subtype gene and a linkage disequilibrium found among them. In the figure, high-color squares indicate SNPs showing strong linkage with each other. In addition, the square found at the intersection of squares continued from each SNP to the lower left direction or the lower right direction indicates the calculation value (percentage) of D′ that is an index of the linkage disequilibrium of a SNP and another SNP. For example, the calculation value of D′ between rs16839837 and rs2551640 is 0.91.
FIG. 2 is a schematic view showing gene polymorphisms identified regarding a CREB1 subtype gene and a linkage disequilibrium found among them. In the figure, high-color squares indicate SNPs showing strong linkage with each other. In addition, the square found at the intersection of squares continued from each SNP to the lower left direction or the lower right direction indicates the calculation value (percentage) of r2 that is an index of the linkage disequilibrium of a SNP and another SNP. For example, the calculation value of r2 between rs16839837 and rs2551640 is 0.12.
FIG. 3 is a schematic view showing gene polymorphisms identified regarding a CREB3 subtype gene and a linkage disequilibrium found among them. In the figure, high-color squares indicate SNPs showing strong linkage with each other. In addition, the square found at the intersection of squares continued from each SNP to the lower left direction or the lower right direction indicates the calculation value (percentage) of D′ that is an index of the linkage disequilibrium of a SNP and another SNP. For example, the calculation value of D′ between rs1243872 and rs2025126 is 0.97.
FIG. 4 is a schematic view showing gene polymorphisms identified regarding a CREB3 subtype gene and a linkage disequilibrium found among them. In the figure, high-color squares indicate SNPs showing strong linkage with each other. In addition, the square found at the intersection of squares continued from each SNP to the lower left direction or the lower right direction indicates the calculation value (percentage) of r2 that is an index of the linkage disequilibrium of a SNP and another SNP. For example, the calculation value of r2 between rs1243872 and rs2025126 is 0.67.
FIG. 5 is a schematic view showing gene polymorphisms identified regarding a CREB5 subtype gene and a linkage disequilibrium found among them. In the figure, high-color squares indicate SNPs showing strong linkage with each other. In addition, the square found at the intersection of squares continued from each SNP to the lower left direction or the lower right direction indicates the calculation value (percentage) of D′ that is an index of the linkage disequilibrium of a SNP and another SNP. For example, the calculation value of D′ between rs4722778 and rs177479 is 0.93.
FIG. 6 is a schematic view showing gene polymorphisms identified regarding a CREB5 subtype gene and a linkage disequilibrium found among them. In the figure, high-color squares indicate SNPs showing strong linkage with each other. In addition, the square found at the intersection of squares continued from each SNP to the lower left direction or the lower right direction indicates the calculation value (percentage) of r2 that is an index of the linkage disequilibrium of a SNP and another SNP. For example, the calculation value of r2 between rs4722778 and rs177479 is 0.85.
FIG. 7 is a schematic view showing gene polymorphisms identified regarding a ATF2 subtype gene and a linkage disequilibrium found among them. In the figure, high-color squares indicate SNPs showing strong linkage with each other. In addition, the square found at the intersection of squares continued from each SNP to the lower left direction or the lower right direction indicates the calculation value (percentage) of D′ that is an index of the linkage disequilibrium of a SNP and another SNP. For example, the calculation value of D′ between rs1153711 and rs1153700 is 0.86.
FIG. 8 is a schematic view showing gene polymorphisms identified regarding a ATF2 subtype gene and a linkage disequilibrium found among them. In the figure, high-color squares indicate SNPs showing strong linkage with each other. In addition, the square found at the intersection of squares continued from each SNP to the lower left direction or the lower right direction indicates the calculation value (percentage) of r2 that is an index of the linkage disequilibrium of a SNP and another SNP. For example, the calculation value of r2 between rs1153711 and rs1153700 is 0.14.
FIG. 9 is a graph showing the effect (overall average±standard deviation) of a polymorphism (rs10932200) of a CREB1 subtype gene on the required administration amount (μg/kg) of analgesic in 24 hours after surgery, in all patients who were administered with analgesic in the surgery (orthognathic surgery).
FIG. 10 is a graph showing the effect (overall average±standard deviation) of a polymorphism (rs10932200) of a CREB1 subtype gene on the measurement results (sec) of pain sensitivity before surgery, in all patients who were administered with analgesic in the surgery (orthognathic surgery).
FIG. 11 is a graph showing the effect (overall average±standard deviation) of a polymorphism (rs10932200) of a CREB1 subtype gene on the measurement results (mm) of VAS (the intensity of pain on a visual analogue scale) 24 hours after surgery, in male patients who were administered with analgesic in the surgery (orthognathic surgery).
FIG. 12 is a graph showing the effect (overall average±standard deviation) of a polymorphism (rs7583431) of an ATF2 subtype gene on the measurement results (sec) of a difference in threshold of pain perception latency before surgery, in all patients who were administered with analgesic in the surgery (orthognathic surgery).
FIG. 13 is a graph showing the effect (overall average±standard deviation) of a polymorphism (rs2952768) of a CREB1 subtype gene on the required administration amount (μg/kg) of analgesic in 24 hours after surgery, in all patients who were administered with analgesic in the surgery (orthognathic surgery).
FIG. 14 is a graph showing the effect (overall average±standard deviation) of a polymorphism (rs2952768) of a CREB1 subtype gene on the required administration amount (μg/kg) of analgesic in 24 hours after surgery, in all patients who were administered with analgesic in the surgery (abdominal surgery).
FIG. 15 is a graph showing the effect (overall average±standard deviation) of a polymorphism (rs2952768) of a CREB1 subtype gene on the reward dependence (RD) score (average) of Temperament and Character Inventory (TCI) in all healthy subjects.
FIG. 16 is a graph showing the effect (overall average±standard deviation) of a polymorphism (rs2952768) of a CREB1 subtype gene on the expression level of a CREB1 subtype gene in postmortem brain tissue donors at the Stanley Foundation Brain Bank.
Hereinafter, the present invention will be described in detail. However, the scope of the invention is not limited to the description, and changes and modifications can be made therein without departing from the spirit of the invention other than the following examples.
It is to be noted that the present specification includes all of the contents as disclosed in the specification and/or drawings of Japanese Patent Application No. 2011-217104 (filed on Sep. 30, 2011), which is a priority document of the present application. Moreover, all publications cited in the present specification, including prior art documents and patent literatures such as patent laid-open applications or patent publications, are incorporated herein by reference in their entirety.
Cyclic AMP responsive element binding protein (cAMP responsive element binding protein; CREB) is a protein, which includes a signaling system downstream of G protein-coupled receptor such as a μ-type opioid receptor, is activated depending on an intracellular cyclic AMP concentration, and binds to a cyclic AMP responsive element (cAMP responsive element) of nuclear genomic DNA, so that it is associated with regulation of gene expression. The cyclic AMP responsive element binding protein is present in various tissues and/or organs such as cardiac muscle, various types of smooth muscle, fat cells, skeletal muscle and brain, and it is also associated with neurogenesis, memory, dependence, etc., through the expression of various genes.
Narcotic analgesics including morphine as a representative example act on a protein known as an “opioid receptor,” so as to cause analgesic action. The opioid receptor includes three types of receptors, a μ-type opioid receptor, a δ-type opioid receptor, and a κ-type opioid receptor, and all of these receptors are related to analgesic action. Since these receptors are Gi/o protein-coupled receptors, they activate a GIRK channel and suppression of a calcium channel through the mediation of a Gi-o protein. In addition, the receptors suppress adenylate cyclase. Activation of adenylate cyclase activates cyclic AMP-dependent protein kinase, and it causes activation of a cyclic AMP responsive element binding protein (CREB) through phosphorylation of the serine residue at position 133 of the protein. The activated CREB binds to a CREB-binding protein acting as an activation cofactor, and it binds to the cyclic AMP responsive element of genomic DNA, thereby promoting gene expression.
Herein, the cyclic AMP responsive element binding protein will be described. The cyclic AMP responsive element binding protein is distributed in various tissues and/or organs including brain and heart, and plays an important role for neurogenesis, memory, the expression of dependence, etc., through the expression of various types of genes. The cyclic AMP responsive element binding protein has a domain structure comprising a Q-rich domain, a kinase-inducible domain (KID), a basic region/leucine zipper (bZIP), etc. The protein binds to genomic DNA.
The cyclic AMP responsive element binding protein functions as a dimer formed from two subunits. The type of a receptor subtype is broadly classified into CREB1, CREB3, CREB5, ATF2 and the like, and their homologs have also been known. These subtypes are expressed in various tissues and/or organs including brain and heart.
The present inventors identified gene polymorphisms (such as SNP) of the subtypes CREB1, CREB3, CREB5 and ATF2 (CREB2) capable of constituting a cyclic AMP responsive element binding protein in healthy subjects (FIGS. 1 to 8). Further, a linkage disequilibrium analysis was carried out as needed, and a block exhibiting a strong linkage disequilibrium (a haplotype block) was identified.
Here, the linkage equilibrium means a case where the relationship between two gene polymorphisms on the chromosome is independent, and the linkage disequilibrium means a case where a gene polymorphism is linked to the other gene polymorphism thereby deviating from the equilibrium situation according to Mendel's law of independence. Further, the haplotype means a genetic structure of such as genes or gene polymorphisms located in the vicinity of each other in one allele of a set of alleles (a gene derived from one of the parents).
Gene polymorphisms or the like located in the vicinity on a genome are inherited in a haplotype block. In other words, a haplotype also refers to a combination of the arrangement of the same gene in this haplotype block.
In the case where several gene polymorphisms appear in association with a certain phenotype in the cyclic AMP responsive element binding protein genes, even if not all the respective gene polymorphisms are typed, by analyzing several gene polymorphisms constituting a haplotype, a relationship between the genotype and the phenotype of a patient can be elucidated.
The present inventors analyzed the cyclic AMP responsive element binding protein CREB1 subtype gene, and as a result, they found 4 and 6 gene polymorphisms in the 5′ and 3′ flanking regions, respectively, and also found 7 gene polymorphisms in the intron region (see Table 5).
In addition, with regard to the CREB3 subtype gene, the inventors found 25 and 14 gene polymorphisms in the 5′ and 3′ flanking regions, respectively, and also found 1 gene polymorphism in the intron region (see Table 5).
Moreover, with regard to the CREB5 subtype gene, the inventors found 9 and 5 gene polymorphisms in the 5′ and 3′ flanking regions, respectively, and also found 241 gene polymorphisms in the intron region and 2 gene polymorphisms (rs2190305 and rs3735566) in the noncoding region of exon (see Table 6).
Furthermore, with regard to the ATF2 subtype gene, the inventors found 11 and 6 gene polymorphisms in the 5′ and 3′ flanking regions, respectively, and also found 16 gene polymorphisms in the intron region and 1 gene polymorphism (rs10497434) in the noncoding region of exon (see Table 5).
According to the present invention, by analyzing gene polymorphisms of the cyclic AMP responsive element binding protein gene or haplotypes constituted by the gene polymorphisms, an individual difference in phenotypes regarding sensitivity to drugs (i.e. drug sensitivity), such as the effectiveness of a drug, the side effects of a drug, and an effective duration of a drug (e.g. the required number of administration of analgesic, the total amount of analgesic, prolongation of stimulant-induced psychosis, etc.), and in phenotypes regarding the development of a disease including pain sensitivity, vulnerability to substance dependence (in particular, vulnerability to drug dependence), etc., can be easily evaluated. The results of evaluating drug sensitivity and disease vulnerability can be important information for determining the administration number, amount, type or the like of drugs to be administered to an individual, and predicting side effects. Therefore, the present invention provides a method for evaluating drug sensitivity and disease vulnerability based on the results obtained by analyzing gene polymorphisms of the cyclic AMP responsive element binding protein or haplotypes constituted by the gene polymorphisms, and specifically, a method for evaluating (specifically, knowing in advance or predicting) a tendency in the presence or absence of drug sensitivity and disease vulnerability (more specifically, the presence or absence of the genetic factor thereof) in an individual (an individual person). In addition, the present invention also provides a gene polymorphism marker used for evaluating (specifically, knowing in advance or predicting) a tendency in the presence or absence of drug sensitivity and disease vulnerability (more specifically, the presence or absence of the genetic factor thereof) in an individual (an individual person), wherein the gene polymorphism marker comprises gene polymorphisms of the cyclic AMP responsive element binding protein or haplotypes constituted by the gene polymorphisms.
In particular, because morphine, a stimulant or the like may cause a big social problem depending on the usage, it is important to know in advance an appropriate amount of drugs to be administered to an individual before administering the drugs. Therefore, the present invention is extremely useful for personalized pain therapy or drug dependence therapy.
Moreover, according to the present invention, by analyzing gene polymorphisms of the cyclic AMP responsive element binding protein or haplotypes constituted by the gene polymorphisms, an individual difference in terms of dependence-prone personality can be easily evaluated. The results of evaluating dependence-prone personality can be information for determining whether reward dependence is high or low about the personality of an individual. Therefore, the present invention provides a method for evaluating dependence-prone personality based on the results obtained by analyzing gene polymorphisms of the cyclic AMP responsive element binding protein or haplotypes constituted by the gene polymorphisms, and specifically, a method for evaluating (specifically, knowing in advance or predicting) a tendency in the presence or absence of dependence-prone personality (high reward dependence or low reward dependence) (more specifically, the presence or absence of the genetic factor thereof) in an individual (an individual person). In addition, the present invention also provides a gene polymorphism marker used for evaluating (specifically, knowing in advance or predicting) a tendency in the presence or absence of dependence-prone personality (high reward dependence or low reward dependence) (more specifically, the presence or absence of the genetic factor thereof) in an individual (an individual person), wherein the gene polymorphism marker comprises gene polymorphisms of the cyclic AMP responsive element binding protein or haplotypes constituted by the gene polymorphisms. Herein, with regard to the types of a gene polymorphism and a haplotype constituted by the gene polymorphism that can be applied to the above-described evaluation of dependence-prone personality, the same gene polymorphisms and haplotypes as those that can be applied to the above-described method for evaluating drug sensitivity and disease vulnerability can be used. Moreover, with regard to oligonucleotides used for the above described evaluation of dependence-prone personality as well, the same oligonucleotides as those used for the above-described method for evaluating drug sensitivity and disease vulnerability can be used.
Furthermore, according to the present invention, by analyzing gene polymorphisms of the cyclic AMP responsive element binding protein or haplotypes constituted by the gene polymorphisms, an individual difference in terms of the expression level of a CREB1 gene can be easily evaluated. The results of evaluating the expression level of a CREB1 gene can be information for predicting whether the expression level of a CREB1 gene in an individual is high or low. Therefore, the present invention provides a method for evaluating the high or low expression level of a CREB1 gene based on the results obtained by analyzing gene polymorphisms of the cyclic AMP responsive element binding protein or haplotypes constituted by the gene polymorphisms, and specifically, a method for evaluating (specifically, knowing in advance or predicting) a tendency in the presence or absence of the high or low expression level of a CREB1 gene (more specifically, the presence or absence of the genetic factor thereof) in an individual (an individual person). In addition, the present invention also provides a gene polymorphism marker used for evaluating (specifically, knowing in advance or predicting) a tendency in the presence or absence of the high or low expression level of a CREB1 gene (more specifically, the presence or absence of the genetic factor thereof) in an individual (an individual person), wherein the gene polymorphism marker comprises gene polymorphisms of the cyclic AMP responsive element binding protein or haplotypes constituted by the gene polymorphisms. Herein, with regard to the types of a gene polymorphism and a haplotype constituted by the gene polymorphism that can be applied to the above-described evaluation of the high or low expression level of a CREB1 gene, the same gene polymorphisms and haplotypes as those that can be applied to the above-described method for evaluating drug sensitivity and disease vulnerability can be used. Moreover, with regard to oligonucleotides used for the above described evaluation of the high or low expression level of a CREB1 gene as well, the same oligonucleotides as those used for the above-described method for evaluating drug sensitivity and disease vulnerability can be used.
The human cyclic AMP responsive element binding protein gene polymorphisms of the present invention mainly include single nucleotide polymorphisms (hereinafter also referred to as “SNP”), however it is not limited to this, and insertion polymorphisms, deletion polymorphisms, and nucleotide repeat polymorphisms can also be included.
The single nucleotide polymorphism [SNP (SNPs)] means a gene polymorphism caused by substitution of a specific one nucleotide of a gene with another nucleotide. The insertion/deletion polymorphism means a gene polymorphism caused by deletion/insertion of one or more nucleotides.
Further, the nucleotide repeat polymorphism means a gene polymorphism caused by a difference in the number of repeats of nucleotide sequence. The nucleotide repeat polymorphism is divided into a microsatellite polymorphism (the number of nucleotides: about 2 to 4 nucleotides) and a VNTR (variable number of tandem repeat) polymorphism (repeated nucleotides: several to several tens of nucleotides) according to the difference in the number of repeated nucleotides, and the number of repeats varies depending on individuals.
The information of human cyclic AMP responsive element binding protein gene polymorphisms (SNPs in the CREB1 subtype gene, the CREB3 subtype gene, the CREB5 subtype gene and the ATF2 subtype gene observed on the genome of Japanese healthy subjects) elucidated by the present invention is shown in Table 5 and Table 6. The gene polymorphisms shown in Table 5 and Table 6 include the cyclic AMP responsive element binding protein gene polymorphisms of the present invention.
| TABLE 5 | ||
| CREB1 gene polymorphism | CREB3 gene polymorphism | ATF2 gene polymorphism |
| Gene | Major | Gene | Major | Gene | Major | |||
| polymorphism | allele:minor | polymorphism | allele:minor | polymorphism | allele:minor | |||
| Position | name | allele | Position | name | allele | Position | name | allele |
| 5′ Flanking | rs16839837 | C:T | 5′ Flanking | rs1243872 | G:T | 5′ Flanking | rs268174 | C:T |
| region | rs2360969 | C:T | region | rs2145925 | C:T | region | rs13030474 | G:T |
| rs10932200 | A:C | rs2025126 | G:A | rs268237 | C:T | |||
| rs2253206 | G:A | rs1885373 | T:C | rs1982235 | T:G | |||
| Intron | rs2551640 | A:G | rs1885374 | A:C | rs10497435 | T:C | ||
| rs11904814 | T:G | GA007473 | T:C | rs268231 | C:A | |||
| rs16839883 | A:G | rs2295794 | T:C | rs268230 | A:C | |||
| rs6740584 | C:T | rs4879926 | T:C | rs268229 | G:A | |||
| rs3770704 | T:C | GA007477 | C:T | rs268228 | A:G | |||
| rs2254137 | A:C | rs867194 | T:C | rs166531 | T:C | |||
| rs2551645 | T:C | rs11541908 | C:T | rs268214 | T:C | |||
| 3′ Flanking | rs2551946 | C:A | rs741917 | C:T | Exon | rs10497434 | T:C | |
| region | rs4234080 | C:A | rs7862485 | G:A | Intron | rs11888507 | C:T | |
| rs2952768 | T:C | rs2756894 | C:A | rs13388308 | C:T | |||
| rs2709386 | G:A | rs2249250 | T:G | rs3755490 | T:C | |||
| rs7591784 | G:A | rs2295795 | G:A | rs7578569 | G:A | |||
| rs7594560 | T:C | rs877365 | T:C | rs7566401 | C:A | |||
| rs2737273 | G:A | rs1153676 | C:A | |||||
| rs2295797 | T:C | rs1205399 | A:C | |||||
| rs2295798 | C:T | rs2072538 | C:T | |||||
| rs1534847 | A:G | rs212361 | A:G | |||||
| rs7873822 | G:T | rs212360 | T:C | |||||
| rs2737274 | G:A | rs1153685 | A:G | |||||
| rs10972567 | A:C | rs12693057 | G:A | |||||
| rs3763630 | C:T | rs212347 | T:C | |||||
| Intron | rs10814274 | C:T | rs212349 | T:C | ||||
| 3′ Flanking | rs3750434 | G:A | rs3845744 | A:G | ||||
| region | rs1570246 | G:T | rs2302663 | G:A | ||||
| GA025684 | G:C | 3′ Flanking | rs35507277 | T:G | ||||
| rs1570248 | T:C | region | rs1153699 | G:T | ||||
| rs1570249 | G:A | rs1153700 | C:G | |||||
| rs34478611 | G:A | rs7583431 | A:C | |||||
| rs1322045 | A:G | rs1153702 | T:C | |||||
| rs1951432 | G:A | rs1153711 | T:G | |||||
| GA025687 | A:T | |||||||
| rs10814275 | A:G | |||||||
| rs10758320 | T:C | |||||||
| rs4878628 | C:T | |||||||
| rs10758321 | G:A | |||||||
| rs10758322 | C:T | |||||||
| TABLE 6 |
| CREB5 gene polymorphism |
| Gene | Major | ||
| polymorphism | allele:minor | ||
| Position | name | allele | |
| 5′ Flanking | rs4722778 | C:G | |
| region | rs177479 | T:C | |
| rs177480 | A:G | ||
| rs11981754 | A:G | ||
| rs177486 | G:A | ||
| rs177498 | C:T | ||
| rs849322 | A:G | ||
| rs177505 | T:G | ||
| rs2175738 | G:A | ||
| Intron | rs4719932 | A:C | |
| rs10258745 | C:T | ||
| rs1013900 | G:T | ||
| rs6955393 | G:A | ||
| rs6953880 | A:G | ||
| rs17156573 | T:C | ||
| rs6960209 | C:T | ||
| rs17156577 | T:C | ||
| rs7811922 | A:C | ||
| rs6973453 | T:C | ||
| rs17156579 | C:T | ||
| rs1073298 | T:C | ||
| rs6961801 | C:T | ||
| rs6977728 | C:A | ||
| rs6978238 | C:T | ||
| rs13230543 | C:A | ||
| rs12673465 | A:G | ||
| rs10251129 | T:C | ||
| rs2391656 | T:C | ||
| rs6971345 | A:G | ||
| rs17156603 | A:G | ||
| rs7806362 | C:A | ||
| rs17642145 | T:C | ||
| rs10229500 | C:T | ||
| rs10243659 | C:A | ||
| rs4722785 | G:A | ||
| rs16874503 | C:T | ||
| rs11772815 | G:A | ||
| rs6958133 | G:A | ||
| rs16874525 | C:T | ||
| rs17715174 | G:C | ||
| rs10242868 | T:G | ||
| rs12700884 | G:A | ||
| rs17156635 | G:A | ||
| rs10239606 | C:T | ||
| rs16874528 | G:A | ||
| rs7799687 | C:A | ||
| rs714218 | G:A | ||
| rs1860759 | A:G | ||
| rs997908 | G:A | ||
| rs12112050 | C:T | ||
| rs2191827 | A:G | ||
| rs4498447 | T:C | ||
| rs10254657 | G:A | ||
| rs6953524 | C:T | ||
| rs10239810 | A:G | ||
| rs17156649 | G:A | ||
| rs1811248 | T:G | ||
| rs887623 | T:C | ||
| rs740988 | A:G | ||
| rs7794304 | T:C | ||
| rs42694 | A:G | ||
| rs6952227 | G:A | ||
| rs42695 | C:T | ||
| rs1029897 | T:C | ||
| rs42699 | A:C | ||
| rs4722793 | C:A | ||
| rs735101 | T:C | ||
| rs10233653 | G:A | ||
| rs6955105 | G:A | ||
| rs2286841 | C:A | ||
| rs979915 | C:T | ||
| rs7794347 | C:T | ||
| rs16874562 | G:T | ||
| rs17156685 | A:G | ||
| rs174024 | C:T | ||
| rs6949786 | G:A | ||
| rs7793437 | A:G | ||
| rs3757677 | T:C | ||
| rs6462085 | T:G | ||
| rs17717216 | T:C | ||
| rs17156694 | G:A | ||
| rs17156699 | A:G | ||
| rs177572 | T:C | ||
| rs177573 | T:C | ||
| rs6977204 | A:G | ||
| rs177574 | A:G | ||
| rs177576 | T:C | ||
| rs177578 | G:A | ||
| rs13437706 | C:T | ||
| rs177580 | C:T | ||
| rs177581 | C:T | ||
| rs12666636 | C:A | ||
| rs177584 | G:A | ||
| rs177585 | C:T | ||
| rs177588 | G:A | ||
| rs6462088 | G:A | ||
| rs7796539 | C:T | ||
| rs1859020 | A:G | ||
| rs1011384 | A:G | ||
| rs6462090 | G:T | ||
| rs12671247 | T:C | ||
| rs217508 | T:C | ||
| rs4719936 | G:T | ||
| rs217509 | G:T | ||
| rs217510 | T:C | ||
| rs17718257 | G:A | ||
| rs149591 | C:A | ||
| rs1910553 | C:A | ||
| rs217517 | G:A | ||
| rs217519 | G:A | ||
| rs2391668 | T:G | ||
| rs4722804 | G:T | ||
| rs618776 | A:G | ||
| rs217503 | C:T | ||
| rs217513 | C:T | ||
| rs65264 | C:T | ||
| rs441355 | G:T | ||
| rs2391670 | C:T | ||
| rs2391671 | A:G | ||
| rs216708 | A:G | ||
| rs11980665 | C:T | ||
| rs11980669 | C:T | ||
| rs11984308 | T:C | ||
| rs160346 | G:A | ||
| rs150607 | A:G | ||
| rs177594 | G:A | ||
| rs6969064 | A:G | ||
| rs150610 | A:G | ||
| rs216715 | T:C | ||
| rs10951197 | T:C | ||
| rs12539927 | A:G | ||
| rs216720 | A:G | ||
| rs17156823 | G:A | ||
| rs2078980 | G:A | ||
| rs216730 | T:G | ||
| rs13228899 | G:T | ||
| rs160335 | G:A | ||
| rs10951200 | G:A | ||
| rs10486588 | G:A | ||
| rs216735 | G:A | ||
| rs216737 | C:T | ||
| rs216743 | G:A | ||
| rs216744 | A:G | ||
| rs216747 | C:T | ||
| rs1976489 | A:G | ||
| rs150613 | C:T | ||
| rs17156878 | G:A | ||
| rs767834 | C:G | ||
| rs4722820 | G:A | ||
| rs160337 | C:A | ||
| rs160338 | G:A | ||
| rs1008262 | T:C | ||
| rs310353 | G:A | ||
| rs310359 | T:C | ||
| rs310361 | C:T | ||
| rs13233942 | A:G | ||
| rs310338 | T:C | ||
| rs41273 | G:A | ||
| rs1637457 | A:G | ||
| rs17156919 | G:A | ||
| rs41276 | A:G | ||
| rs160375 | A:G | ||
| rs917275 | A:G | ||
| rs160342 | A:G | ||
| rs160343 | T:C | ||
| rs41295 | C:T | ||
| rs160357 | A:G | ||
| rs41298 | G:A | ||
| rs41305 | G:A | ||
| rs41307 | C:T | ||
| rs10228740 | A:G | ||
| rs3888613 | G:A | ||
| rs41320 | C:T | ||
| rs41321 | A:G | ||
| rs41322 | A:G | ||
| rs7780656 | G:T | ||
| rs41327 | A:G | ||
| rs42322 | T:C | ||
| rs41333 | A:G | ||
| rs9655280 | A:G | ||
| rs9655281 | G:A | ||
| rs4719945 | A:G | ||
| rs6945988 | A:G | ||
| rs10258405 | T:G | ||
| rs10243376 | G:A | ||
| rs41334 | T:C | ||
| rs10245004 | C:T | ||
| rs41339 | G:T | ||
| rs982947 | C:T | ||
| rs982950 | A:G | ||
| rs16874653 | A:G | ||
| rs41346 | G:T | ||
| rs41348 | A:G | ||
| rs9969149 | C:T | ||
| rs6968464 | G:A | ||
| rs886816 | G:A | ||
| rs757980 | A:G | ||
| rs41351 | G:A | ||
| rs9691873 | A:C | ||
| rs17157048 | A:C | ||
| rs6462098 | T:C | ||
| rs10951201 | C:A | ||
| rs13311248 | G:C | ||
| rs12540480 | T:C | ||
| rs10265166 | G:T | ||
| rs7798774 | T:C | ||
| rs7799246 | T:C | ||
| rs6972081 | T:C | ||
| rs7777929 | T:C | ||
| rs12533079 | T:G | ||
| rs7806547 | G:A | ||
| rs6462100 | G:A | ||
| rs6979352 | C:T | ||
| rs6950574 | A:G | ||
| rs4722835 | A:C | ||
| rs9648352 | A:G | ||
| rs879593 | A:C | ||
| rs879591 | G:T | ||
| rs2299110 | C:T | ||
| rs2237349 | C:T | ||
| rs2066979 | T:C | ||
| rs10486589 | A:G | ||
| rs10486591 | G:A | ||
| rs6462103 | C:T | ||
| rs721993 | C:T | ||
| rs2237351 | T:C | ||
| rs740315 | G:A | ||
| rs2237353 | A:C | ||
| rs2073537 | T:C | ||
| rs4722844 | G:T | ||
| rs17730621 | C:T | ||
| rs2282907 | G:A | ||
| rs10238623 | G:A | ||
| rs2299116 | C:A | ||
| rs2299117 | T:C | ||
| rs2237355 | A:G | ||
| rs2237360 | T:G | ||
| rs2237361 | T:C | ||
| rs2237362 | T:C | ||
| rs7791555 | G:T | ||
| rs2237364 | A:G | ||
| rs2282909 | T:G | ||
| rs2282910 | C:T | ||
| rs2282911 | T:C | ||
| rs1544470 | A:G | ||
| rs1964240 | A:C | ||
| rs17669844 | T:C | ||
| rs886750 | A:G | ||
| rs12531253 | G:A | ||
| rs10951205 | A:G | ||
| Exon | rs2190305 | A:G | |
| rs3735566 | G:A | ||
| 3′ Flanking | rs11975539 | G:A | |
| region | rs6462107 | C:T | |
| rs2190306 | T:C | ||
| rs4719955 | T:C | ||
| rs10228137 | C:A | ||
In Table 5 and Table 6, “CREB1” (italic form) indicates a CREB1 subtype gene (a CREB1 gene as a subtype of the cyclic AMP responsive element binding protein (CREB) gene), “CREB3” (italic form) indicates a CREB3 subtype gene (a CREB3 gene as a subtype of the CREB gene), “CREB5” (italic form) indicates a CREB5 subtype gene (a CREB5 gene as a subtype of the CREB gene), and “ATF2” (italic form) indicates an ATF2 subtype gene (an ATF2 gene that is an alias of a CREB2 gene as a subtype of the CREB gene).
“Position” means a position on the genome of a cyclic AMP responsive element binding protein gene, and indicates a 5′ flanking region, a 3′ flanking region, intron, and exon.
“Gene polymorphism name” is the name of SNP at a position on the genome, and it has been registered in the dbSNP database (which is accessible from the NCBI website dbSNP Short Genetic Variations) (the same shall apply in the present specification). Basically, the ID “rs” is given before four or more digit numbers, so that the type of SNP can be identified.
“Major allele” indicates an allele occurring in the majority of the genomes of Japanese healthy subjects, and “minor allele” indicates an allele occurring in the minority of the genomes of Japanese healthy subjects.
In the present invention, a method of obtaining gene polymorphism information is as follows, for example.
(1) Genomic DNA is purified from a blood specimen collected from a human using the phenol method and the like. At this time, a commercially available genomic DNA extraction kit such as GFX Genomic Blood DNA Purification Kit (manufactured by GE Healthcare Bio-Sciences KK) or a device may be used.
(2) Then, the obtained genomic DNA is dissolved in TF buffer (10 mM Tris-HCl, 1 mM EDTA, pH 8.0) and the concentration of the obtained solution is adjusted to 100 ng/μl.
(3) Total genome genotyping is carried out by an infinium assay II method or the like, using iScan system (manufactured by Illumina, San Diego, Calif.), in accordance with the protocols provided by the manufacturer.
(4) Total genome genotyping data are analyzed using BeadStudio Genotyping module v3.3.7 (Illumina) or the like, and the quality of gene polymorphism data of each sample is evaluated (quality control).
(5) Based on these total genome genotyping data, gene polymorphism included in the gene regions and flanking regions of a gene of interest are selected, using the annotation information of the name of the gene of interest as a key, and all information regarding such gene polymorphisms is extracted using an output function of BeadStudio Genotyping module v3.3.7 (Illumina) or the like.
The present invention provides an oligonucleotide, which contains any one of CREB1 subtype gene polymorphisms (rs16839837, rs2360969, rs10932200, rs2253206, rs2551640, rs11904814, rs16839883, rs6740584, rs3770704, rs2254137, rs2551645, rs2551946, rs4234080, rs2952768, rs2709386, rs7591784 and rs7594560), CREB3 subtype gene polymorphisms (rs1243872, rs2145925, rs2025126, rs1885373, rs1885374, GA007473, rs2295794, rs4879926, GA007477, rs867194, rs11541908, rs741917, rs7862485, rs2756894, rs2249250, rs2295795, rs877365, rs2737273, rs2295797, rs2295798, rs1534847, rs7873822, rs2737274, rs10972567, rs3763630, rs10814274, rs3750434, rs1570246, GA025684, rs1570248, rs1570249, rs34478611, rs1322045, rs1951432, GA025687, rs10814275, rs10758320, rs4878628, rs10758321 and rs10758322), CREB5 subtype gene polymorphisms (rs4722778, rs177479, rs177480, rs11981754, rs177486, rs177498, rs2175738, rs17156579, rs17156603, rs17642145, rs10229500, rs10243659, rs4722785, rs16874503, rs11772815, rs6958133, rs16874525, rs17715174, rs6953524, rs10239810, rs17156649, rs1811248, rs887623, rs740988, rs7794304, rs6952227, rs42695, rs1029897, rs4722793, rs10233653, rs6955105, rs17156685, rs17156694, rs17156699, rs177572, rs177573, rs177574, rs177576, rs13437706, rs177580, rs177581, rs12666636, rs177584, rs177585, rs216715, rs10951197, rs160335, rs1008262, rs310353, rs310359, rs41273, rs1637457, rs17156919, rs41276, rs160375, rs917275, rs41348, rs886816, rs17157048, rs6462098, rs10951201, rs13311248, rs12540480, rs10265166, rs7798774, rs7799246, rs6972081, rs12533079, rs7806547, rs6462100, rs6979352, rs6950574, rs4722835, rs2066979, rs10486591, rs721993, rs2237351, rs3735566, rs11975539, rs6462107, rs2190306, rs4719955 and rs10228137), and ATF2 subtype gene polymorphisms (rs1153711, rs1153702, rs7583431, rs1153699, rs2302663, rs3845744, rs212349, rs212347, rs12693057, rs1153685, rs212360, rs212361, rs2072538, rs1205399, rs1153676, rs7566401, rs7578569, rs3755490, rs13388308, rs11888507, rs10497434, rs268214, rs166531, rs268228, rs268229, rs268230, rs268231, rs10497435, rs1982235, rs268237, rs13030474 and rs268174), and which is capable of being specifically hybridized to a DNA fragment containing a gene polymorphism of the cyclic AMP responsive element binding protein gene. The gene polymorphic site is the 51st nucleotide in the nucleotide sequence represented by any one of SEQ ID NOS: 1 to 172.
It is preferred that the oligonucleotide of the present invention has at least 10 nucleotides, preferably 10 to 150 nucleotides, more preferably 10 to 45 nucleotides, further more preferably 14 to 25 nucleotides.
Examples of the oligonucleotide of the present invention include oligonucleotides having a nucleotide sequence represented by any one of SEQ ID NOS: 1 to 172 containing the above-mentioned gene polymorphism of the cyclic AMP responsive element binding protein gene or a nucleotide sequence complementary to the nucleotide sequence (Tables 7 to 10).
The oligonucleotides of the present invention can be used as a probe or a primer specific to a cyclic AMP responsive element binding protein gene in the detection of cyclic AMP responsive element binding protein gene polymorphism described in the below-mentioned 6.
| TABLE 7 | ||||
| Gene | ||||
| Gene | polymorphism | SEQ | ||
| name | Position | name | Sequence | ID NO: |
| CREB1 | 5′ Flanking region | rs16839837 | ATTTAAAGAAGACCAGCAGAAAAATATTTATGAACTTATTTTCAACTTGT | 1 |
| [T/C]CCCATTTTTGAACTTTTTTATCAGTGAAGAAATGGAAACATTTTT | ||||
| TCAAT | ||||
| rs2360969 | ATGAAAAACTGGGGATGAGGGCCAGTCATCTGTATTTCAACAAGTCTTGC | 2 | ||
| [T/C]GGTGATTCCGATGCACGCCATAGCGTGAGAACCAGTATAGCAATA | ||||
| AAACC | ||||
| rs10932200 | AATAGGGAGAGCAAAAGAGCAAAGAGGTGGTTGTTCGGTGATCAATTTCC | 3 | ||
| [A/C]CCAGAGTAGTAAGGAAAGGCCTCACAGAAACAGGAGCATTTGAGC | ||||
| AAAGA | ||||
| rs2253206 | ACAAATAATGAGAAGTAGGAATTGGAAAAGAAAGTGATAAGTTACAGTTA | 4 | ||
| [A/G]GTAGGAGGAATGGGTGACAGAAAAAAATTCCAGGGGAAGGGAAGG | ||||
| GCATG | ||||
| Intron | rs2551640 | TTATAATACCTTATACAGTGCCTGCCCATCACTTGACTCTTATGGGTTCA | 5 | |
| [A/G]CATAGGAGTCAGCATGCAGCAAATTCAAGCTTTACTTCTGGGACT | ||||
| TGGGG | ||||
| rs11904814 | AAGATAGTGTTGTGCATGTAAAGATCTAAGAACTTGATATTTCTATGAAA | 6 | ||
| [T/G]CACAATGACTGAGCAATAGTCCTTTGCCTTAGTTTTTATTCCATT | ||||
| GAGTG | ||||
| rs16839883 | CGAGGGATAGTACTTAAGTTTCCAAAGGACCATATATAGGTTTAGGAAAC | 7 | ||
| [A/G]TCGAATATTACCATTGTTTTGATTGGTTCTAGTTACTTTATAGTT | ||||
| TATTT | ||||
| rs6740584 | GTACTTAAGTTTCCAAAGGACCATATATAGGTTTAGGAAACATCGAATAT | 8 | ||
| [T/C]ACCATTGTTTTGATTGGTTCTAGTTACTTTATAGTTTATTTTAAA | ||||
| ATTTC | ||||
| rs3770704 | AAAATTTAATTTAAAAATTAGATGATTTATTTGGAAGAAGCATTTTTAGA | 9 | ||
| [T/C]AGGTGGCAATATCCTCTCTAGACAATTCTCCCTGTAGGGGTCAAG | ||||
| CTTTT | ||||
| rs2254137 | AAACCTTTAACTTAAAATTAGAAGCAAGTCTGATCAAGAAGTCTCAAGCA | 10 | ||
| [A/C]AGGCTGAGTAGTAATATTTAAGACAACACTGCTTACTAAAGAAAA | ||||
| GAGTT | ||||
| rs2551645 | AGGTCATATGTACTAAAACAGTTTATCCAAAAAGGCCTTTCTAAGACACA | 11 | ||
| [T/C]TATTTTCAAACTCAAAAGTCAAAAACAAAGAAAAAATTCTTATGG | ||||
| AACCA | ||||
| 3′ Flanking region | rs2551946 | GTGTTTATGTAATACATATATAATCACTGAAAAATTACTGAATTGTATGA | 12 | |
| [A/C]AGTAATGTAAGTGAAAATACTTGTTCTTTAAGTGGTAAGTTAAAG | ||||
| TTGTT | ||||
| rs4234080 | ATTTCTGCAACCCAAATTCCGTGGTCTCCTCATAGGGCACGAGGGCCATT | 13 | ||
| [A/C]CGCCTGCACCCCGCCCTCTGCTCAGACCTGCCGTGCAAAAGAATC | ||||
| CTGGG | ||||
| rs2952768 | CTCTGTCTCAAAAAAAAAAAAAATAGTGCTTTTTACTTTTATCTGAATGA | 14 | ||
| [T/C]TGAAATGTCCTTTTCCCAATCCTATGATGCCTGACTGCAAAATAA | ||||
| TGGTA | ||||
| rs2709386 | AACACTGACTTCCTATCACTGACTGTAAATATACAACTGATACATTATCA | 15 | ||
| [A/G]TTTTCTTGTTATCTTTAACGTGAAAGCAGTATAGAGAGAGTGTGT | ||||
| TCAAA | ||||
| rs7591784 | CTGGCTGTCCAGTCCCCACTCCACACCACAGAGCAACACCTAGCCAAAGA | 16 | ||
| [A/G]GGTAGGTAAGAAAAGCTAAACACCCAGGGATATGAAACCAGCCTT | ||||
| CACAG | ||||
| rs7594560 | TGGCAATTTTTGAATAAAAAGATTAACTACTAATTCTGAGGCAGTGGAGA | 17 | ||
| [T/C]TGAGGAGAATAAGAAAGATGGCCAGCACTGCTTGCTTCTCTGGCT | ||||
| GTCCA | ||||
| TABLE 8 | ||||
| Gene | ||||
| polymorphism | SEQ | |||
| Gene name | Position | name | Sequence | ID NO: |
| Gene name | 5′ | rs1243872 | AGTCCTCCTGTTCCCTGTGAGAGCACTTCAAGTGCTGGGGCCAG | 18 |
| Flanking | GTCTGA[T/G]GCAGCTCTGATTCCTACACAGCAAAGCCTGGCC | |||
| region | CAGGTAAGGGGATGGGA | |||
| Gene name | rs2145925 | GGAGACGCGGTGTGTGTAGGGGCGCTACTAAGATTTGGAGGCTA | 19 | |
| CTGGGA[T/C]GGAAGCGGAATAACATAAAAGGGACAGTACAGT | ||||
| CAAGGGTACTGGTGGGA | ||||
| Gene name | rs2025126 | GTTGCCAACCTAAGACGACTGTCAGAGAGTCCATGCATTATGGA | 20 | |
| CAGAGT[A/G]GCTGGATGGGGACGTGGAAGCACACAGCATCCA | ||||
| CCTCTCTGACTGCCTCT | ||||
| Gene name | rs1885373 | CCCCCTCTAACAATAAATTCTCACACCTGGGTCAAGCTCTTCAC | 21 | |
| TTTTAG[T/C]GCTACCCTAGGCAGGAGTGTCCCAACCCAATCA | ||||
| AGAGCGGTGCCTACCCG | ||||
| Gene name | rs1885374 | AATGTCCTGGTAGCCACAAGGAACTGTGGTAGCTGCTGTCCCAG | 22 | |
| CAGCAG[A/C]AGAACGACACTTTGTGAGGCTTAGGTGCTGGCC | ||||
| AGGGAGGTGAGGATAAC | ||||
| Gene name | GA007473 | GATAGTATCAAAAAACGGTGAAGAGAGCTGATGAGGCTGTGGGG | 23 | |
| ACTGGC[T/C]GGAAGCTGCTGGCAGGGTGGAGTGGGCTGGGGC | ||||
| CCCGGCAGATTCAGATC | ||||
| Gene name | rs2295794 | AGCTTTAGGCCCCGCAGATCCCTACAGTTTCTCTCCCACTATGT | 24 | |
| TCTGGC[T/C]CAAAGCTGCCTCACGGAAATGCCTCAAGGATTT | ||||
| CTACCTTGCAAGCCCGA | ||||
| Gene name | rs4879926 | GAACTTGGACTTTTACATAATATGTGAAAGTCATAAAATATTTT | 25 | |
| GATGTA[T/C]GGGTTCAATCTGCAAACATTTATTAAAGATCAG | ||||
| CTAGGTGGCAGATTCTA | ||||
| Gene name | GA007477 | CTCCCAGCTGCGTTTTGCACCAGGACCTTGGTGTCCTCCACCAG | 26 | |
| CACCTT[T/C]GCAGTCTTCAGGATGCCCTCCCTGAGGGAGGGC | ||||
| CCAGCTTAGTCAGATCT | ||||
| Gene name | rs867194 | CATAACCCCATACAGGCCACATGGTAATCCACGGCCCTCTGATT | 27 | |
| CCCACA[T/C]TCAAGCATAAAGTGCTCCTCCCCTTCTCCCCAC | ||||
| TGTGCTTAACACAATCC | ||||
| Gene name | rs11541908 | GTGGATTACCAAACAACTATGGTGCGGACAGCCAAGGCCATTGC | 28 | |
| AGTGAC[T/C]GTTCAGGAGATGGTGAGTTTGGGCGAGTCCCAG | ||||
| AGGACTGCCCTCGGAGA | ||||
| Gene name | rs741917 | TGCCCATCCTCCATTCTGCCACAATGTATGCCCCCCAGCCACAC | 29 | |
| TGGTTC[T/C]CCATCCCTCAATACCTCATGCTTGTAATTAGCT | ||||
| TCTTGATGGAGTCTGAG | ||||
| Gene name | rs7862485 | CAGAGATACCCAAAGATGAACTGGGCATGGGAGAGGAAAGACAT | 30 | |
| ACTAAT[A/G]GAGAAACCATAAGAGGGCATGTGGGAGAGTAAG | ||||
| CTCGAACATCTACAGAG | ||||
| Gene name | rs2756894 | ATGTTGGGTCTTAGAGTGAAAAGTATGGCTTACTGTAAGTAGCA | 31 | |
| GTAAAA[A/C]GTTTGAGAGCCATATATAAATACACACCTTTGT | ||||
| GCACACAAGCAAAGCCT | ||||
| Gene name | rs2249250 | GAGCTTCTTGAAATGTCCCAGTGCTAGGAGGAAGCTGCAAGGTG | 32 | |
| AGAGGG[T/G]AAGTCAGACAGAAGAGTGGGGAATGATGCAGGG | ||||
| AGAAGTCTGGTAAAGGA | ||||
| Gene name | rs2295795 | CTGGCATTCTTTGACTCCTACGTTCCCCCACCCCCTACCGTCCT | 33 | |
| CCTACC[A/G]AGTCACTCAGGAGTCGCTTGCTGGCATCTCCAA | ||||
| CTGCCCTCAGGGCATTA | ||||
| Gene name | rs877365 | CCAGCTCCCATTTTCCTACCTCCCTCACAATATGCCCCATGCCT | 34 | |
| GGCTCT[T/C]TGCCCACATACCTGCATAATTCTCATTGCCCTG | ||||
| GGCAACCTCTCCCAGTA | ||||
| Gene name | rs2737273 | CCTCCCGAAGTGTTAGGATTGCAGGCATGAGCCACCACACCTGG | 35 | |
| CCTAAA[A/G]TTATTTTTTAATTGACATAATTTTACATATTCA | ||||
| TGAGGTACATAGTGACA | ||||
| Gene name | rs2295797 | ATGGGGAAGAATTTAGCAAAGAGTTTCATATCACAGCTAAGGAA | 36 | |
| TTAAGG[T/C]TGGATGCTAACTCTAACGAGAGAGAATTATGGG | ||||
| GACACTGGAAAGGTTGA | ||||
| Gene name | rs2295798 | TCAGATTATGCTACCTCATTTGATCCTATCAGTCCTACACGGGG | 37 | |
| CAAGTA[T/C]TGTTATCCCAAATCAGAGGTAAATAAAAGATTA | ||||
| CAAGAATATTGAACTGA | ||||
| Gene name | rs1534847 | ATGTAGTTCAGTATCTCTGCCCCTACCCCCATCTCTGAAGCAAG | 38 | |
| CATGTC[A/G]CTCTTTTTTGAGATTATCTGAAGAATTTTGCTG | ||||
| CAGTAGCCAGAGGGAAA | ||||
| Gene name | rs7873822 | TTATCTGGTCAACTCTTGTGTTTTGGAGAAGGGGAAATAGACTC | 39 | |
| TGGGAG[T/G]CCAGGAAACATTTTCAAGACAGGCCAGAGAAAG | ||||
| GACCCAGTCCCTGTAAC | ||||
| Gene name | rs2737274 | TCTCACCAGAGGCTTCCGTGCTTGAGGAGGAAGGGGGTGTCTAA | 40 | |
| GTGTCC[A/G]GAGGAAATGGGGGGAGACATGCAGTTTCAGCTT | ||||
| AGTGTGAAGGGTCCTTT | ||||
| Gene name | rs10972567 | ACAAGTATGAGTAGAAGCTAGCTCATTCCTCCTTTGGCCTGAGA | 41 | |
| ACTTTG[A/C]TCCCTTTTCCATTGTGTTTGATGGAACAGCAAC | ||||
| TCCCCACTGCCGTGTCC | ||||
| Gene name | rs3763630 | GGTCCCTATTTCCCACCTATGTTGTCTGTAAACAACACAGTCCA | 42 | |
| GAATCT[T/C]TGTCCCCTAACTGTGGTGGCCACAGCAAGGGCC | ||||
| TTGGGCTTAGAGAATGG | ||||
| Gene name | Intron | rs10814274 | TTTTTTTAATAGTTTAAAATGGTCTGGCTTGTTAGGGTTAACAC | 43 |
| CTGGTC[T/C]GTGGAGGCATTCAGAAAGAATCTGAATGCCTGT | ||||
| TGGTCAGGGAAGCTGTA | ||||
| Gene name | 3′ | rs3750434 | AAGGAACATGTACCTCCCAAGATGGAAAGGATTTGGGGGTTCAG | 44 |
| Flanking | CAGAGT[A/G]GGATCATCAAATGAATCCCAGTGCAAGTCTACT | |||
| region | GACTTTGGTGGGTGGAG | |||
| Gene name | rs1570246 | ATTCCAGATGCGGGCGCCGGTCGTTGTTAGGTATCGTCCCGGAG | 45 | |
| GGCCGG[T/G]CGTTGGGGAAAGCTTAAATGAGCTGGTGTTTCA | ||||
| GTGGAGCCGGGGAGCTC | ||||
| Gene name | GA025684 | TTGGCTGGGGAGGCGCTGGAGTGTGTAGTGACCGTCACCAACCC | 46 | |
| CCTTCC[C/G]CCCACGGCCACTTCTGCATCCAGGTGGGGATGC | ||||
| TGGCACTGAAGGTGGTG | ||||
| Gene name | rs1570248 | TTTAGCCATCTCATGTTAGAATCTAAAACCCTAACCTCTACTCT | 47 | |
| CATCTC[T/C]GTTCCCTCTCAGCATTACCTCTCCACTCATTCT | ||||
| TTCTCTAGGCCTTCAGG | ||||
| Gene name | rs1570249 | GAGGGTGTAATGGATCCTGATTCCTTATACACACTCCCAGACAT | 48 | |
| ACCCAC[A/G]TCTAGCCTCTGACCCGGAACAGTTTCTCAGACC | ||||
| TTCAACCTCTTCCTGTT | ||||
| Gene name | rs34478611 | AGTACGCACTATCCCCGTATTTAGTTTGTCTTTCCTGTTTCACA | 49 | |
| GCTGGA[A/G]GAAGCCTGGGTATTTTGACACGGGATCATCTGT | ||||
| AAGGCCCCATCCTCCCT | ||||
| Gene name | rs1322045 | TGGAGGGGGCACTGGACTGGGCACTTCCCCAGCAAGGAGGCAGG | 50 | |
| AGGGGC[A/G]AGGGCCCCCAGGTGGTCCCCAGATCTCTTCCCT | ||||
| GACCTGGAGAGAAGGAA | ||||
| Gene name | rs1951432 | CTGGCGCGCAGGTCCCGGAGGGGGCGGCTGGCGCGCACTACACG | 51 | |
| CTTGGG[A/G]ACAAGGAAAACATCCGCCGGAGGCCCGGCCGGG | ||||
| CGGCGCTCCAGCCTCGG | ||||
| Gene name | GA025687 | GTCGTGGTGTCGCTACGGGCGCGAAACGGACACTGAACACAGTC | 52 | |
| TGACTG[A/T]ATGGAGGCAGGTGGGGAGGGATCCCCTGGGAGA | ||||
| ACTTGGCGGGCCGAGAG | ||||
| Gene name | rs10814275 | TGCATTGCCTTTGGTCCCAAACAAGCAAATCTGGGTCAATTAAT | 53 | |
| GAAAAA[A/G]AAAAGAAAAGAAAAGAAAATGTCTTACTTTGGG | ||||
| CCCTGTTGCACTCTCCC | ||||
| Gene name | rs10758320 | TTGGATAACAAATTAACCTCCATTTCCACTGGACAGAGAACTCA | 54 | |
| TTCTTC[T/C]GGTATGTTTCAGAAGGCTAATGGAGCAAGGATA | ||||
| ACCTTATATTACTAATG | ||||
| Gene name | rs4878628 | TGGCTAGTGTTTTTTGTATCCTGCATAAGAAATCTTCCCTTACA | 55 | |
| CCAGGT[T/C]ACAAAGATTTTTTTCCTACATTTTCTCCTATAT | ||||
| CTAAAAGTTTTATGATT | ||||
| Gene name | rs10758321 | AGACATCATTAAATTCATCATGGCATTCTTTCTTGCTGAGCCTG | 56 | |
| GACATA[A/G]CCTGGTAAGACTAGAACTAGATAATAGGAAAAG | ||||
| AAATGTAGACATTAAGT | ||||
| Gene name | rs10758322 | TGGGAGAGGCTGGCATCAAATTACTCCTCTGTTTTTCTCTCTTG | 57 | |
| GTGACC[T/C]AGCAGGTGTTTAGGACAATGACGACTACTCATG | ||||
| TGGAACCTTTGCAGTCA | ||||
| TABLE 9 | ||||||||
| Gene | SEQ | Gene | SEQ | |||||
| Gene | polymorphism | ID | polymorphism | ID | ||||
| name | Position | name | Sequence | NO: | Position | name | Sequence | NO: |
| CRE | 5′ | rs4722778 | AATCACCATTTTATGTGAAC | 58 | Intron | rs177584 | GGGTGACGTAAGGGGGTGCA | 100 |
| B5 | Flanking | AAATTGAAGTCTTTATAGCA | GAGATTCCCACTTGGGTTTA | |||||
| region | TTCTTAATTT[C/G]GTTTC | TGCTGGCCTC[A/G]TCTTT | ||||||
| TGAAAGACATTTAGATAATT | GACTGGCTCTGTCATGTTGC | |||||||
| GGGCAATTTAACAAAAGAGT | CCTTGTGGGGTCCTGTTTTC | |||||||
| ATGTTC | ATTAA | |||||||
| rs177479 | CAAGTTTCATCCACGTTGTA | 59 | rs177585 | TTTTGCACGGTAAATGCTTC | 101 | |||
| GCGTGTATCAAAACTTCAAT | GTAAACGTCAGCTATTCATT | |||||||
| TAATATTCTT[T/C]TATAT | AGTGAGGTGT[T/C]GGGGA | |||||||
| GGGTATGTTACATTTTGTTT | GTTGTCGGGGGAAGAGAGAG | |||||||
| ATCCATTCATCAGTTGGTAG | GAGAAAGAAGGAAGTGAGAG | |||||||
| ACATG | GGGAG | |||||||
| rs177480 | GCTGCTGTGGACATTTGCAT | 60 | rs216715 | AAAAAGAAAGAGCCAGCCTT | 102 | |||
| ACAAGTTTTTTTGTGTGGAA | TAAGGAAACGGGAAGTCAAA | |||||||
| ATATGTTTTC[A/G]ATTCT | GCTTGTGTAA[T/C]GAAGC | |||||||
| CTTGGGAATATACCTAGGAC | AAGACCAGACTTTTTAAATC | |||||||
| TGGAATGGGTCATTTGGAAA | TACCTCCCTTAACCTTTATA | |||||||
| CTACG | AACAT | |||||||
| rs11981754 | ATTCAAAAATAACAGGATTG | 61 | rs10951197 | ATGGTGCTACATAGGCTGGC | 103 | |||
| TGAAATATCCAACTAAAATC | TTAACATCTTTTTTTGAAAT | |||||||
| ATATTTGAAA[A/G]TGGTC | AAAAACCAAG[T/C]GTAAA | |||||||
| CAGGAATCCCCAAATAACTT | CATGAGTCAGAATGACAGGG | |||||||
| TTATGCATGTTATATGAAGA | CATATGCAGGACTCCAACAT | |||||||
| TAAAT | TTACT | |||||||
| rs177486 | CCTTCCTTTCAGCATGCAGA | 62 | rs160335 | TGAATTTGATGCTGTTCTCT | 104 | |||
| ATTGAACTTGGCTCTGAAGT | TGGTCTTTTTCACAACTGAA | |||||||
| AAAACAATAC[A/G]GGTTT | ACATTGGGCC[A/G]TTGGT | |||||||
| TTGAGTGATCCAGCAGCTGT | GGGACGTTCTGTGCCTTGAA | |||||||
| TCTACTTTGGTGAGAGTTTT | ACTTTTAATACGTGCAGCTC | |||||||
| CTTCT | CATCT | |||||||
| rs177498 | GTCCTCAATTACATCTTTGT | 63 | rs1008262 | GTCTTCTCCCCAAGAGGCCA | 105 | |||
| GAGAATCAAATGTGATAAGG | CCTTTTTGACCAGGTGACTC | |||||||
| CATAACACTC[T/C]TGGCA | TCCTCAGTGA[T/C]GATAT | |||||||
| TGGTGGCTTTAGATATTAAC | GGTGCAATTTTTATGAGATT | |||||||
| AACTCTTGCTATGTTGGTTG | TTGGGATGTGAAGCAGCTCT | |||||||
| TGCTT | GTAGA | |||||||
| rs2175738 | ATTAGTTTCTGGCTATTGCA | 64 | rs310353 | TGCTAACAGTGCCCTTGGGG | 106 | |||
| GCTAATTCTCGGGTAAAGAA | AATGTTTGGAGGGACTTGAT | |||||||
| TTTGAATGGC[A/G]TTCTA | TCCAGATCAG[A/G]AAAGA | |||||||
| GTATTGCATTTTACCTAGAC | TAAACAGTGATCTGGAGGGT | |||||||
| TACACTGTTACAGAATTGTG | CTGGTTTAGATGCAAGTCAT | |||||||
| TGTAG | ATTTC | |||||||
| Intron | rs17156579 | TATCACAGGGTTCTTTGTTG | 65 | rs310359 | CACCCTTTACATACCTGTGT | 107 | ||
| GCTATTTATTGACCCATCTT | CCCTGGATCTTCCTTTCTCC | |||||||
| CTCTCAGGCA[T/C]GTATA | ATGGTCCTCA[T/C]AGCCT | |||||||
| TTCTCTGGGCAAGTATAGAC | CTCTTCTTTTACACTTACCT | |||||||
| TCACAAGTGCCTGGAGTCCC | CTCCTTGAGCTCCCTGATGT | |||||||
| TCCTC | GCCTT | |||||||
| rs17156603 | ATCAGTACATCAAACAACTC | 66 | rs41273 | TGGTTCTGACAAGAAAAAGA | 108 | |||
| AATTAACAAATGCTTGCATC | AAGTATTCATATTTGGTGGA | |||||||
| TGCAATGTTC[A/G]TTATA | CGTGGTGGTA[A/G]GTAAA | |||||||
| ATACAGCATCATAGTTGCAG | CTACTAATTTGTAAACATTG | |||||||
| AATTAAAATGGCAAGATTAT | GAAATTTTTACTTTAAGTGA | |||||||
| AAAAC | GAGCA | |||||||
| rs17642145 | GGAAGTAGGACCACCATCGG | 67 | rs1637457 | AGCTGTTGAGCACACTCGCC | 109 | |||
| CCCATACAACTTAAGTCCAA | TGTGGTTGACAGGACTCTGG | |||||||
| TATATAGACT[T/C]TTAAC | CACAAGTGCC[A/G]TGGAG | |||||||
| CTATGTCAGTGTGAATAGTT | GATGATGTTAGAGAGGTGGA | |||||||
| GCCTGCTTGACCAGGGACTT | CACATGGGGTCAGAAGAGGA | |||||||
| TAATT | AGGAG | |||||||
| rs10029500 | TCCAGTCAGATGACTATTTG | 68 | rs17156919 | ATTCACCGCATACATTCACG | 110 | |||
| TTCAAATATTTATTCTACTA | CAAAGGGGAAAATTTACTGC | |||||||
| CATGACACAC[T/C]GTGCT | CTAAACAGAG[A/G]GACCT | |||||||
| GGACACTTCAGAGATAGCTG | AAATCCCCCAGGCTAAATAA | |||||||
| TGAGTTTTGCTTCCTGTGTG | ACCCAATGGAAACACAAGAA | |||||||
| GTAGC | CTGCA | |||||||
| rs10243659 | GTGGGATGCAGGACAAAGTG | 69 | rs41276 | TAAAAAGGTTTCTTCAAATG | 111 | |||
| TTTACTTTTGTCTTTCAGAG | AAAAATGGATGGCTGAGCTG | |||||||
| TCAAAATGGG[A/C]AAGGT | CTAATGGCCC[A/G]GTAAC | |||||||
| TAACACAAGGAGTAAACTAA | CTAAAAATTTAACTCTTCCC | |||||||
| GAAAATATATCCATATCCAT | TAATGCTCAGGGACCTCAGG | |||||||
| ATTCA | TAAGG | |||||||
| rs4722785 | AACTGGCTTCAGCCAATTAC | 70 | rs160375 | TTTTTGTCCTTTATTATTTT | 112 | |||
| TATACCTGTTTCCTCTGGCT | TTGAATTACTTTGCTTTATT | |||||||
| ATAGTGATTG[A/G]TTCAG | TTTCATGTGT[A/G]AAAAC | |||||||
| GGAGAGGCCCTTAATCTAGT | ACCATATGGTGGCCACAGTG | |||||||
| AGCTGTTGAGATGGAAAAAA | GGAAGCCAGGTCCTCTGCAC | |||||||
| AAACA | TAAGA | |||||||
| rs16874503 | GAGATAGTTCCTATTCAGGA | 71 | rs917275 | ATAGGAGGTTAGGTATGGTT | 113 | |||
| CACACACCCAGTGCTTGCAG | CTGACATTGCAATATTCTCT | |||||||
| ATCCATACTG[T/C]TAGAC | TCAAGTTAAC[A/G]GCAGG | |||||||
| TACGTGAAGGAGGAAGAAAG | CATTTGTTACATGCTCAGAG | |||||||
| ATGTTTGCAAAGGAGCCAAG | AATTTTATGATTTATAAAGA | |||||||
| GGGGA | ACTTT | |||||||
| rs11772815 | ATCCATACTGCTAGACTACG | 72 | rs41348 | TTCATTTACGTTATCAACTT | 114 | |||
| TGAAGGAGGAAGAAAGATGT | AATTAATTTATTTATAAAAT | |||||||
| TTGCAAAGGA[A/G]CCAAG | TTCCATGACC[A/G]TAGGA | |||||||
| GGGGAAAGCAGGTTGCCTGC | TGACCACGTAGAAGTGTGGA | |||||||
| ACCAAGATCAGACTGTCTCT | CTATGGATCACTAGCATCAA | |||||||
| TGTGT | AATCT | |||||||
| rs6958133 | GATGTTTGCAAAGGAGCCAA | 73 | rs886816 | CAGGAAAGCCATCTTTACAT | 115 | |||
| GGGGGAAAGCAGGTTGCCTG | CACCTCTATTTAAAGCACAG | |||||||
| CACCAAGATC[A/G]GACTG | GGTCCCTTTT[A/G]CCTAT | |||||||
| TCTCTTGTGTTCTTTGATAA | GTCACTGAAAAACAGCAGAA | |||||||
| CTCTGAGATTTTCCTTTCCT | GCCTGGTATCTAGTGGATTC | |||||||
| ATTCC | ACCCC | |||||||
| rs16874525 | CTTTCTTCCCATCTATTAAT | 74 | rs17157048 | ATGCAATCTGATTTATTTCC | 116 | |||
| GAGCATGAACTACATCCTGG | ATGGATTCTGAGCTAGGAAT | |||||||
| CCTTTAATCA[T/C]TGATA | CGCAATTGGG[A/C]ATCTC | |||||||
| TCATTTCATATATACTTTTT | CAGAACCAATGGGGATTTTT | |||||||
| CATTATCCTCATCTCTCCTT | GCTGTAGGACCATCGTTCTT | |||||||
| TGCTT | TTCTG | |||||||
| rs17715174 | CATTTTTCATAGAGTCTTTG | 75 | rs6462098 | TTTTCCAAAGCAGCTTAATG | 117 | |||
| GCATTGGGTTGGACAATGAT | TAGAACAATAGGGCCAAGAA | |||||||
| GGAAATTAGT[C/G]AGTTT | GGGGTTTTTT[T/C]GCTCT | |||||||
| TACTCAGACAAGGTCCCTTC | GAAAAATACCGAGTCCCCTG | |||||||
| CTTTGAGGAATTTATCCTCC | CCCAAGAGCTCCAGTGCCTC | |||||||
| ATAAT | CCTCC | |||||||
| rs6953524 | TGGTATTTCCAGGGAAGAAT | 76 | rs10951201 | CCCCAAATACCACATTTGTT | 118 | |||
| ACATTAGTAATGCAGGCTTG | TGCAAGTAGGAATAGGACTG | |||||||
| GGTAACCACT[T/C]GCAGC | TCTGAGGAAT[A/C]ATTTG | |||||||
| TCACCTCACTACTGAGCAAT | AGAAACTGAGCCAGTCACTC | |||||||
| GACGTGGAATTGGAGCTGGT | TCTTTGGCAACATGCAGGGC | |||||||
| ATCAC | CACCA | |||||||
| rs10239810 | ATCAGAGCCTGAGCCAATAA | 77 | rs13311248 | TTGTGTGCCAAGCTCAGTGC | 119 | |||
| TATGAGCTGTCTTCTTGGAT | TCTCAAATATTCTCCCTTCA | |||||||
| AGCTTGGGCT[A/G]GGCTC | GCCTAGAAGA[C/G]AGACT | |||||||
| CACAACAGAAGAAGCTGGGG | GGTACCTGCTGTAAGGGGTC | |||||||
| CAAATTGGCTCTGTTGCTGA | TGGCATGGAGAGAAAGCCGG | |||||||
| GACCT | CTTCC | |||||||
| rs17156649 | TTCTGGCAGTGTGAACTTCA | 78 | rs12540480 | TATTTTCTACAGCAGATCAC | 120 | |||
| ATGGCCCACATAATTTTTTT | TCATCTCTTAAATAGATTAT | |||||||
| GACCTAATGT[A/G]TAAAC | GCATTGATCG[T/C]CTTCA | |||||||
| ATTTTACCTCATGTGTAGAA | AAGGGCTAAGCACACTCAAA | |||||||
| ATAGGGACAATGGTACTACC | ATATTCTCTAAAGTCATTCT | |||||||
| TCGTG | CATGC | |||||||
| rs1811248 | ATCCTCATTTTAAAGGGAAG | 79 | rs10265166 | TCCCTAGAAAGCAAGTCAGA | 121 | |||
| GAAACCAATGAGAGTGAAAT | CAGGGACAAGTCTATTTTTT | |||||||
| TTAAGAAACA[T/G]ATCAG | AAGAGCCCAA[T/G]AAGAG | |||||||
| ATTATTGGGAAATGGAGTAT | GAAATTTCAAAATCTCTATT | |||||||
| TCTTCCCAGAGCTCCTCAAA | AGCCATTTAATTGTTTTACA | |||||||
| ATATC | CTATT | |||||||
| rs887623 | GAGTACCCCTTAACTCAGTG | 80 | rs7798774 | CATCATTATCTGCCAGCCTT | 122 | |||
| AGGTAGACACCCAAAAGCAA | CTCTAATGTCTCCCCCATGG | |||||||
| CCATCCTGCA[T/C]TTTTT | GCTAAAGAAG[T/C]CTTAT | |||||||
| TCCGTGAGCATTAATAAAGT | TTCCTTTACTTTTCCCATTA | |||||||
| CTATTGTTCATTGTAGAATG | AGTCTTCCCTTCCGGCTTTT | |||||||
| TTCTG | TAGTA | |||||||
| rs740988 | TCCCATCTTTCTCACCATTA | 81 | rs7799246 | TCAGCCTTGTTAGGCAATGC | 123 | |||
| ACATGTACACATTATGCCTA | CCCTTTCCTTGTTCATGTTT | |||||||
| ACACGAATCC[A/G]CCAAT | CCTTGGAGAA[T/C]AAGTG | |||||||
| CCCTTGCAGCCACTGGCATG | ATCCTCTCAGCACGCTATCA | |||||||
| CTCATTGGTCTCTGCCTCCA | CTTTATCATTAAGAATAGAA | |||||||
| GACCC | CTTGA | |||||||
| rs7794304 | TCCTTGCTTACTTCTTTCTC | 82 | rs6972081 | TTGGTTAATAAATGAATCAA | 124 | |||
| AATCACGCATAATGCCTCAA | GCTGACTGCATGACTAATTC | |||||||
| CTCTTAGAGC[T/C]GGCAT | AGATTAATGG[T/C]GCAGA | |||||||
| TTGTTGTATCAGTCCTAATA | AATCAGTCACTAAAGAAGCC | |||||||
| ACTCTTGAGGTATCTCTGAA | AAAAAAAGTTTGCTTTAATA | |||||||
| ATCAG | GTCTT | |||||||
| rs6952227 | TAAAGACTTGGAAAGTGTCA | 83 | rs12533079 | GCTTGACAGTAAGATTTGGT | 125 | |||
| CATTGTAGTACAGTGGGGTT | TCGGAACATGAGCTCATTCA | |||||||
| TTCTCCTGAT[A/G]GCTAC | CAAAAAGATA[T/G]GGGTA | |||||||
| AATTTACATGCCAGGAGCCC | ATAAGACGTCTTTTAAAAAT | |||||||
| TGTAAGCCCTCTAGCATTTT | ATGGGTCAGGCAGCTTTCTC | |||||||
| CTTGA | GTGTT | |||||||
| rs42695 | CATAATTTTATCAAAATTTT | 84 | rs7806547 | CTTCAAGAGTCTTTGAGATG | 126 | |||
| TTTCACATACGTTGGCATGG | CCTATAGGCTCATCTGTTCA | |||||||
| TCTTCAGACC[T/C]GTGGT | TTACAAGATG[A/G]TGAAA | |||||||
| AATAATCACACCTCTCTTAA | TGGAGAGCCTGAAAGTTAAG | |||||||
| CGGGTGGCGTGCTGATCAAA | AGTCTTTTCCCCCAGTCAAT | |||||||
| TAAGT | AACTT | |||||||
| rs1029897 | CTGTTGAGTGTTCAAGTCTG | 85 | rs6462100 | CAGATCTTCTGAAGACCTGA | 127 | |||
| ATTTGGCTTCACCAAGAATA | GAAAGGACAGCAGGGTGGAG | |||||||
| GAACAATGTT[T/C]CTAAA | AGACCCCTTC[A/G]CACCT | |||||||
| AAGTTTGTCATGAAGAGAAG | TCCAGACGAAAGCACTGGCC | |||||||
| CCCATTTAGAAATTCATCCT | TGAGGATAGGCTTGCCCAAG | |||||||
| CTAAC | GGCAA | |||||||
| rs4722793 | GGGAGGTGTATTAACTTTTG | 86 | rs6979352 | ACCCCTAGACAGGAAAACAT | 128 | |||
| CCTATGGAGCTAGTAACAGG | CCTTCGGGGGGAAAAATGAG | |||||||
| TAGAACCGGG[A/C]TTCTT | GACATGAAAT[T/C]GCTTG | |||||||
| TTTTTTCATCATTTTTTATT | CTGCGGTGCCTATCATTCTG | |||||||
| ATGTAAAATATATATAACAA | TTAAGGACAGTGAAAACACA | |||||||
| AATTT | GTCTG | |||||||
| rs10233653 | AAGTTCAGAGTAACTTCCCA | 87 | rs6950574 | TATTCAGAATCCAAACATAT | 129 | |||
| GATTTTAAATATTCTGTGTC | AGGGATCTCAAATAATCCTT | |||||||
| ATGTAAGAAC[A/G]AGGAG | TCCCTTCTAT[A/G]CACTA | |||||||
| GAATCGCTGATCAATTAGGT | CTAATTAGCTTGATCGATAT | |||||||
| TTAAAAGCTACTGAAATTCT | CATTAGGAAATTATTATTAT | |||||||
| CAAGA | AATCC | |||||||
| rs6955105 | CGGCTGTCAAATCTCTTGCT | 88 | rs4722835 | ACATTAAGACCGGAGGATAT | 130 | |||
| GTCTGCTGCCTTTCCTCTCA | CAACAAATTTGGTTGACTGA | |||||||
| GCATGTGAGC[A/G]TGGAG | GCCACATCCT[A/C]TACCT | |||||||
| CTGGGGGTCTGGTGGATCCT | ATCTGACTCAGTCTATCCAC | |||||||
| GTCAATCATATGTCTGTGGG | CTGTGAAGGAGACTTTAAGA | |||||||
| CAGCA | CCTAG | |||||||
| rs17156685 | TTTATCATATGTATCTCCAG | 89 | rs2066979 | TGGTGAATGAAAGGCAGTGC | 131 | |||
| CTTGCACCTCTCTCCTTGGC | AGAGACTGCCTCTCTTTTTG | |||||||
| AATGGCCTTC[A/G]CTGCA | AGGATGTTTG[T/C]TACAG | |||||||
| CCTTTGACATTTTCCAACTG | AGCCTTGGTGTCAGATAATC | |||||||
| CGCCTTTGACATTTTCCTCT | ATGTAACAAGCACTGGATTG | |||||||
| AGATG | GCAAG | |||||||
| rs17156694 | CTCAGACTTTCTTTGATGGA | 90 | rs10486591 | GGATTCATTTTCTGAAGAAT | 132 | |||
| GCCAGCCTCCTTGAAAGCAG | TAAGTCAACAGACATGGCTT | |||||||
| TTATTTTTAG[A/G]TGTTC | CACAATGCAC[A/G]TATTG | |||||||
| CAACAGCCATCTATCTTACA | GATTCCTTTTGGGGGTCAGA | |||||||
| AAAGGATTTTCTCTTCAGAT | GCAGACTCAGAGCTCTGAGA | |||||||
| AGGCT | GGCTT | |||||||
| rs17156699 | AGAGGAGCTCAGTCAATGGT | 91 | rs721993 | GAGAGCCTCAGCTTCCCAGT | 133 | |||
| GAGATCGAATCTTTGGACCT | TGCTTGCTGGACCCTAAAGC | |||||||
| CCTTTGGACC[A/G]CCGGA | TGTAAGAACT[T/C]TGTGA | |||||||
| ATGAAATCACACGTTCCCTA | AACTTGAATGTTTCTTTTTT | |||||||
| CAATAACAAGAGAAGCTGTT | TAACCAAGGTAAGGAATTTA | |||||||
| ATTTT | ATGCC | |||||||
| rs177572 | CTCACCTTATTTCCATGATG | 92 | rs2237351 | GGAGGTACCTTCATCCTTGA | 134 | |||
| CTTGGTTGTCAGTGAACGCA | GAAGAGAGACTTCAGTATCT | |||||||
| GATATTGGAG[T/C]TAAGG | GTGGAACAAG[T/C]GAAGC | |||||||
| CCAGTGTTTGTCCCAGGGCC | TAGAACTTGGCATCGGAGCA | |||||||
| CCAGATCCAACTGGAGTGAA | TAGTGCTGAGCAAAGAAGCC | |||||||
| TATTA | TCTAC | |||||||
| rs177573 | TTTCTATGGGTGCTATTAAG | 93 | rs3735566 | TCTCTTAAACTCCCTCCACT | 135 | |||
| CATATAAAATTTTTTTTCAA | CAACACAACTGATACCTTTC | |||||||
| AAGGACTGAG[T/C]TGAGT | ATTATCTCCT[A/G]TAGTG | |||||||
| TGGTATGCCACTGTGAACAG | TCTGTGGCATTGGTATTCTA | |||||||
| TAACTTCATCACTTGGAAGA | AAGGAGAAAACTAGAATCTA | |||||||
| TCCGA | ATGAG | |||||||
| rs177574 | ATTTCCTCATGGTAGCATTT | 94 | rs11975539 | TTGTTGTTTTTGTTGCCACC | 136 | |||
| GAACCAAGCCTTTAAGTAGA | ACAAGAGCAAAGGTATTTCC | |||||||
| ACAAGATTTT[A/G]CTAAA | TATTTTGTTT[A/G]AATTT | |||||||
| CATAGAAGGCAGAAAGGGCA | GTCACTAAGATCTAAAACAG | |||||||
| CTGCTGACTAGCTATTTGAA | TGGACACACAATGGGCACAC | |||||||
| GAAAA | AACAA | |||||||
| rs177576 | TCATTGGTGGATCTGGAGAG | 95 | rs6462107 | ATGCCTCCAGGCTTATGTTC | 137 | |||
| TAGCTGACCTGAAAACAGTC | TTAGTCTAATACTCAGCCCT | |||||||
| TTCATCTTTC[T/C]GCCAA | TAGCTCACAA[T/C]GGAAT | |||||||
| AATAATTTTAACACTTAAAA | CATCAATCCCAGCAACTAGA | |||||||
| AAAATTTTTTTGAGAAGGTA | TATTGGGACAGGGAACCTAG | |||||||
| CTAGA | AGAGT | |||||||
| rs13437706 | CTGAGACACAGTGGGCCTTG | 96 | rs2190306 | TTGATAACCTAGTTTAGTAT | 138 | |||
| GAAATGGCAGTTCCCATAGG | CCTATGAGTGCCTTAAATAC | |||||||
| GAGTCCTGCA[T/C]GAGCC | AGAGGATGCT[T/C]AATGA | |||||||
| ATGAAGGCGAGAAGCCAAGG | AAATTTATAGACTGCCCGCT | |||||||
| CTTTGCATGCTATGCTTTGG | CAGCAGCTCACTGGGATTG | |||||||
| GTGTG | AATAT | |||||||
| rs177580 | TGCAGATCTGATGACAGTAC | 97 | rs4719955 | ATCTGCACATGCCAGTGGTC | 139 | |||
| ATCCACACCCTGTCGCTTTC | TGAATAACAGAAGGAGTCCT | |||||||
| CCTGCCAAGA[T/C]GAACT | TCCAAGGCCA[T/C]CCTGA | |||||||
| GTAGCCGTCAGAGCCTCCAT | CCTGCAGCCATGTTGGTGTA | |||||||
| TCTGCTCCCCACACCCATCC | GGAACTGTCTCCAGGGAGCC | |||||||
| AGTGA | AAAGT | |||||||
| rs177581 | TGACAGTACATCCACACCCT | 98 | rs10228137 | CTAGAAAATATCCGTCTCTT | 140 | |||
| GTCGCTTTCCCTGCCAAGAC | GTTCTAGCAGCCATAGGTAA | |||||||
| GAACTGTAGC[T/C]GTCAG | ATGACAATGG[A/C]GACGC | |||||||
| AGCCTCCATTCTGCTCCCCA | TACTGAAAAATCACAACTCG | |||||||
| CACCCATCCAGTGACCATCC | TGTGTTCTAAAATGACCACA | |||||||
| ACTAA | AAGGG | |||||||
| rs1266 | TCTTCTGCACTCCAGCCTCT | |||||||
| CCCTCTACTTCCCTCCTTTT | ||||||||
| TGCTTCAGCC[A/C]GAGGC | ||||||||
| AGATGGCAGACATGGATACA | ||||||||
| CATTTATGGATTGGCTGATG | ||||||||
| TGTCT | ||||||||
| TABLE 10 | ||||
| Gene | ||||
| polymorphism | SEQ | |||
| Gene name | Position | name | Sequence | ID NO: |
| ATF2 | 5′ | rs268174 | ACGCGTGTATGTTTTACAATATACATCTCTCATAATATCAACTGAAGCAA[T/C] | 141 |
| Flanking | ATTTAATGTTTCAGTCTACCACAGATCATTTATTTTCTAGCAAATGTCTT | |||
| region | rs13030474 | ACATGTGAGTTGAAGTTACTCCATGAAGCCCCTAAGAATGTGCAGAAAAG[T/G] | 142 | |
| GATTGATTCAAATGGATCATTCTTTCTTTTCCATTACCTTTTTTTTTTCC | ||||
| rs268237 | TGGACTGACTTATATAAAAAATTAGAGAAAAATACAAATTAGTACACATT[T/C] | 143 | ||
| CAGGACAAAGTTGTGTGATGCACTAAGGGAAATCGCATTAGAAAAGAGAT | ||||
| rs1982235 | TGAGGAGGAAGCAAGAAAGAAGCCAAGATCCACAGTGGCTGCTTCCAAGT[T/G] | 144 | ||
| GCATATGGACTAGTTGCTTGTGGCAGGGAGAGACATGGGTTCCGAATCCC | ||||
| rs10497435 | AAATAGAGATAATTCACGTGTACTGTTCAACAAGCAATTATTCATATAGT[T/C] | 145 | ||
| TCTCAAGTACTCAATTCTAACCAAGAACATGGTGTCCTGTGGTGTCTACA | ||||
| rs268231 | GTAATTCTAACAAATGGCTAATGGAAGTGATATCAACACGTCAACATAAA[A/C] | 146 | ||
| GATTAAACATCTAGAATGCCCTGCTAAGAAGATGGCTGGGGACTGAACTC | ||||
| rs268230 | GAAAGAAGGGTCATTCACTACTTAACAGGAAACTAGGGTCCCCAGCAAAG[A/C] | 147 | ||
| GAAGATATTTATTTCAAGGAACCTGGAAAATGGTTCCAGAAGTATGGCTA | ||||
| rs268229 | ACAAAAAGAAAAACTGTAGATTCACCCCGGCAGAGAGGACTAAACAGATT[A/G] | 148 | ||
| ACTTTTGATATGAGTTGGCTGCAGGATAGTGGGCCTTTTTCTTCACGTTG | ||||
| rs268228 | CCCTGTGCCCTCCACTTACCTTCCCAGGAGGCGGCGGCGGCACGGGCTGC[A/G] | 149 | ||
| GCAGAGGTCGAAGGAGTGGGACTCAATGCGCAAGCGCGGTCCGGCTCTTA | ||||
| rs166531 | GGTGAGCTCCGGAAAGGCTGCTAGAGGGAAAGCAGGATGGGTCCTCCGAG[T/C] | 150 | ||
| CCAGCCCCAGGAGCCGGGTGTCTCCGTTTCCGTCACTTCCCAGCACTAGG | ||||
| rs268214 | TTCTGGAGGGGGCGGGACCAGAGGGCCCAAGGAGCGTTACTTCTGTAAAC[T/C] | 151 | ||
| CGGAGCTGTGGAAGACTGTGATTGGCTGTCGGCTGGAGGAGGGCGCGGGT | ||||
| Exon | rs10497434 | TTCTAGCTGGTGGGCCATGAGCTTTATTTACTCTGCTTCCAGGAATACCT[T/C] | 152 | |
| AGCTGTTATCAATAAGCAGTCCTTTCTCAAGTTTCCATCTAGTACCCTTA | ||||
| Intron | rs11888507 | CCCCTCTTAAAGAGCTTGATCTGCCAACATTGGAGAAAAGGGCAATCCTA[T/C] | 153 | |
| ATATCCATGATCCTGACATACCTGCCTCAGGTAAACTAGGGGAGATACTG | ||||
| rs13388308 | TTTCCCTCCTCCTATCCCACCATGGGCTGGATTCTTCATTTCACATCCTA[T/C] | 154 | ||
| AAAAACTCAGCATAATTTCCAGGTTTGAAATGGCAACTTTCTCTCTGTCT | ||||
| rs3755490 | AAATTGCATTTTTCATAATTTTGTTCATAAATGAAGTTTCAAGAATGTCA[T/C] | 155 | ||
| GCTCAGAAAAATTTGGTAATTCTTGTGGGGAAATGTGTAACTAGCCAAAG | ||||
| rs7578569 | ATAAATTTGGGAAATGTTGAATGTGTAGGCTTCATTTCACAGGACTTTTC[A/G] | 156 | ||
| TGACCTTAATGTTATGTCAATTAAGGATTCATAACTTTAAAAAATGCCCC | ||||
| rs7566401 | ATACTTTCTAAAGCTCAGTTGCACTATTGAAGAAAAAGCAGAATTTCTTG[A/C] | 157 | ||
| CAAAAGTTTCCTGGGTTTTTTTTCATCCTAACTCTAAAATTTTACAGAAT | ||||
| rs1153676 | GAAGGTAACTGTTAATAATCCAAACAAAAGATGATGATGGTTTGGGCTTA[A/C] | 158 | ||
| GTGGTGTCACTGAACACAGACATAGAGGATGAGATTCAGGTCTGATAAAA | ||||
| rs1205399 | GCACTCCAGCCTGAGTGACAAAGAGAAAGACTGTCCAAAAACAACAACAA[A/C] | 159 | ||
| AAAAAAAGAATTACAGTCAGGTGCAGTGACTCACGCCTGTAATCCCAACA | ||||
| rs2072538 | TTAGGTTTTCCCTGTCCCCAGTAAGCAGATCTAGTTCTCTTTTGCTGTTG[T/C] | 160 | ||
| AGGTTTGCCAGTTAATTATTGGATTGTACTGGACTCACATTCAGAGCATG | ||||
| rs212361 | ACAAGATACAGTTATGTAAATACCTATGCTTAGGTGGCAATCTAAAACTT[A/G] | 161 | ||
| TTTATATGTGTTTCTTTGATTGAAAACTTTTGCTTTTTAATGCCAATGCT | ||||
| rs212360 | GAAGCTTAATTTCTGCTACTCAGAGTTACATTTGTATATTTTTATGCCTA[T/C] | 162 | ||
| CAAGGATTGGAGGCTTCTTAGAAGTGTATACTGCTCCTTCTCTCCCCATG | ||||
| rs1153685 | CTTATTTCAGTTGCTTTTCATAATAGTACTTATTCTATCAGTTTGACGGA[A/G] | 163 | ||
| AAACAAAGGCTTAGGAAGATTCTTAGTAAAAGCTTCAAATGTAAGTATTA | ||||
| rs12693057 | ATTAGAAGCACAGTCTCCATTTTTAAAGTAGCAGCTCAGTTCACTCTGAC[A/G] | 164 | ||
| GTATTTCACTGACGTAGCCTAAGGCTATAGGTAATGGAACATTACTCACT | ||||
| rs212347 | TCTTATCAAAAAAGAAGGACATTACAAAAAGGAAAAGGCACAATTAACCT[T/C] | 165 | ||
| TAAAATGCTGAAAACAAAAGAATCTCATTCTTTGGGAAAACATTTAGCAG | ||||
| rs212349 | ACGGAATCTTTTAAATTAAAAAATATTGCCCATTCTGATGAAACTGCTTA[T/C] | 166 | ||
| AATGACTACAAGTAAAGATGGTGGCCATTAAGTTTTATCGTGAGCACCTG | ||||
| rs3845744 | CCAGTTTTAGCACTGAAAGTCCTGCTTCCTAAGAAGACCCCTCAGTCGTG[A/G] | 167 | ||
| GAAAACCATGACAGTTAGTCACCCCAACAGTTAAGTAATATAAAACCTGA | ||||
| rs2302663 | TTATCAGCAGCTGGGTGGAAAAAAGAAAAATTATTCATTTTCCTAAAATC[A/G] | 168 | ||
| GTAAGAATGCACCAGTATGCTGAGGCAATACACAGAGTAAAAAGTTAGAA | ||||
| 3′ | rs1153699 | GTGGGTTTGATTCTTGTCCTAGTCTAGCCTCAGTTTTGGGCAGGCACTGC[T/G] | 169 | |
| Flanking | TTGGGGTGGGGCTTTCTCAAATATCCTGCCCCTTTTCCAGTAGCAGGAAA | |||
| region | rs7583431 | ATCCTTTCTGTGTGTCTCCTCTTGTGGCTACACTTGACGGGCCATATTAT[A/C] | 170 | |
| AAAGAATACAAAACAATAGTACAGACAGGTAAATGTTTATGCCTAGAAAT | ||||
| rs1153702 | TGTTGTTCATATTTTAAAAAAATTCTTAGCCATTATCTCTTCAAATAACA[T/C] | 171 | ||
| GTTTGCCAAGTTCTCAATATGATATTGTTCCATAGATCTTGGATGCTGTG | ||||
| rs1153711 | TGTGTGTCTTGCAGCAGCTGGATGAAGGTTCTGTAAATGTATGCTACGTC[T/G] | 172 | ||
| GTTGAGTCCATGGTGTAGTTTAAGTCTGATAATTTTTGTTGATTTTTTTT | ||||
In Table 7 to Table 10 (SEQ ID NOS: 1 to 172), 101 nucleotides are shown, and a gene polymorphic site is shown at the 51st nucleotide. For example, one represented by “A/G” means a gene polymorphism associated with transitions between “A” and “G”, and “C/T” means a gene polymorphism associated with transitions between “C” and “T”.
In the present invention, by using SNP among the above-mentioned gene polymorphisms, a haplotype can be constructed. The SNP to become a target of a haplotype analysis may be any as long as its gene polymorphism frequency is 0.5% or higher, preferably, those with a gene polymorphism frequency of 1%, more preferably those with a gene polymorphism frequency of 5% or higher can be selected. Further, SNP to become a target of a haplotype analysis may be a full or partial sequence thereof.
The haplotype analysis can be carried out using various computer programs, and for example, Haploview (available from the following website: Broad Institute) (the same shall apply hereafter); Barrett J C, Fry B, Mailer J, Daly M J. Haploview: analysis and visualization of LD and haplotype maps. Bioinformatics. 2005 Jan. 15 [PubMed ID: 15297300] Whitehead Institute for Biomedical Research Cambridge, Mass. 02142, USA.) can be used.
As an example of the haplotype analysis, among cyclic AMP responsive element binding protein gene polymorphisms in Japanese healthy subjects found as in the above-mentioned 2, with regard to the 17 sites of SNPs which are CREB1 subtype gene polymorphisms, the 40 sites of SNPs which are CREB3 subtype gene polymorphisms, the 64 sites of SNPs which are CREB5 subtype gene polymorphisms, and the 31 sites of SNPs which are ATF2 subtype gene polymorphisms, a haplotype was estimated for each linkage disequilibrium block (haplotype block), using Haploview. The estimated haplotypes are shown in Tables 11 to 14. It is to be noted that the “Tag” shown in the tables indicates a Tag SNP that is a typical gene polymorphism in the linkage disequilibrium block.
| TABLE 11 |
| Gene name CREB1 |
| Linkage disequilibrium block No. | |
| 1 | |
| Gene polymorphism name () |
| 1 | 2 | 3 | 12 | 13 | 17 | ||||||||||||
| Haplotype No. | Tag | Tag | Tag | 4 | 5 | 6 | 8 | 9 | 10 | 11 | Tag | Tag | 14 | 15 | 16 | Tag | |
| H1 | C | C | C | A | G | G | G | T | C | C | C | C | C | C | A | A | T |
| H2 | C | C | A | G | A | T | A | C | T | A | T | C | C | T | G | G | T |
| H3 | C | T | C | A | G | G | A | T | T | C | C | C | C | C | A | A | T |
| H4 | T | C | A | G | A | T | A | C | T | A | T | C | A | T | G | G | C |
| H5 | C | C | A | G | A | T | A | C | T | A | T | A | C | C | A | A | T |
| H6 | T | C | A | G | A | T | A | C | T | A | T | C | C | T | G | G | T |
| H7 | T | C | A | G | A | T | A | C | T | A | T | C | A | T | G | G | T |
| . . . | Haplotypes which are estimated to occur at a frequency of less than 1% |
| () 1~17: (in this order)rs16839837, rs2360969, rs10932200, rs2253206, rs2551640, rs11904814, rs16839883, rs6740584, rs3770704, rs2254137, rs2551645, rs2551946, rs4234080, rs2952768, rs2709386, rs7591784 and rs7594560 |
| TABLE 12 |
| Gene name CREB3 |
| Linkage disequilibrium block No. | |
| 1 | |
| Gene polymorphism name () |
| 1 | 2 | 3 | 9 | 11 | ||||||||||||||||||||
| Haplotype No. | Tag | Tag | Tag | 4 | 5 | 6 | 7 | 8 | Tag | 10 | Tag | 12 | 13 | 14 | 15 | 16 | 17 | 18 | 19 | 20 | 21 | 22 | 23 | 24 |
| H1 | G | C | G | T | A | T | T | T | C | T | C | C | G | C | T | G | T | G | T | C | A | G | G | A |
| H2 | G | C | G | T | A | T | T | T | T | T | C | C | G | C | T | G | T | G | T | C | A | G | G | A |
| H3 | T | T | A | T | A | T | C | T | C | T | T | C | G | A | G | A | C | A | C | C | G | T | G | C |
| H4 | T | T | A | T | A | T | C | T | C | T | C | C | G | A | G | A | C | A | C | C | G | T | G | C |
| H5 | T | C | G | C | C | C | C | C | C | T | C | C | A | A | G | G | C | A | T | C | A | T | A | C |
| H6 | T | T | G | T | A | T | C | T | C | C | C | T | G | A | T | G | C | G | T | C | A | G | G | C |
| H7 | T | C | A | T | A | T | C | T | C | T | T | C | G | A | G | A | C | A | C | C | G | T | G | C |
| . . . | Haplotypes which are estimated to occur at a frequency of less than 1% |
| Linkage disequilibrium block No. | |
| 2 | |
| Gene polymorphism name () |
| 25 | 26 | 29 | 36 | 38 | 39 | |||||||||||
| Haplotype No. | Tag | Tag | 27 | 28 | Tag | 30 | 31 | 32 | 33 | 34 | 35 | Tag | 37 | Tag | Tag | 40 |
| H8 | C | C | G | G | G | C | G | G | G | A | T | A | C | C | G | C |
| H9 | C | T | A | T | G | T | A | G | A | G | A | A | T | C | A | T |
| H10 | T | C | G | G | C | T | G | A | A | G | A | A | T | C | G | C |
| H11 | C | T | A | G | G | T | A | G | A | G | A | A | T | C | G | T |
| H12 | C | C | G | G | C | T | G | A | A | G | A | A | T | C | G | C |
| H13 | C | T | A | T | G | T | A | G | A | G | A | G | T | C | A | T |
| H14 | C | C | G | G | G | C | G | G | G | A | T | A | C | T | G | C |
| . . . | Haplotypes which are estimated to occur at a frequency of less than 1% |
| () 1~40: (in this order)rs1243872, rs2145925, rs2025126, rs1885373, rs1885374, GA007473, rs2295794, rs4879926, GA007477, rs867194, rs11541908, rs741917, rs7862485, rs2756894, rs2249250, rs2295795, rs877365, rs2737273, rs2295797, rs2295798, rs1534847, rs7873822, rs2737274, rs10972567, rs3763630, rs10814274, rs3750434, rs1570246, GA025684, rs1570248, rs1570249, rs34478611, rs1322045, rs1951432, GA025687, rs10814275, rs10758320, rs4878628, rs10758321 and rs10758322 |
| TABLE 13 |
| Gene name CREB5 |
| Linkage disequilibrium block No. |
| 1 | 5 | 6 | 9 | 10 |
| Gene polymorphism name () |
| 1 | 2 | 5 | 6 | 7 | 8 | 9 | 11 | 13 | 14 | 15 | 16 | 17 | 18 | |||||||||
| Haplotype (H) No. | Tag | Tag | 3 | 4 | Tag | Tag | H No. | Tag | Tag | Tag | 10 | Tag | 12 | H No. | Tag | Tag | H No. | Tag | Tag | H No. | Tag | Tag |
| H1 | C | T | A | A | G | C | H6 | C | C | G | C | A | G | H11 | T | G | H14 | T | A | H17 | G | T |
| H2 | G | C | G | A | G | T | H7 | C | A | A | C | G | G | H12 | C | C | H15 | C | A | H18 | G | G |
| H3 | G | C | G | A | A | T | H8 | C | C | G | C | G | G | H13 | C | G | H16 | C | G | H19 | A | G |
| H4 | C | C | G | A | G | T | H9 | T | A | A | C | G | A | . . . | . . . | . . . | ||||||
| H5 | G | C | G | A | G | C | H10 | C | C | A | C | G | G |
| . . . | Haplotypes which are estimated to occur at a frequency of less than 1% |
| Linkage disequilibrium block No. |
| 11 | 12 | 13 | 15 | 16 |
| Gene polymorphism name () |
| 19 | 20 | 21 | 22 | 23 | 24 | 25 | 26 | 27 | 28 | 29 | 30 | 31 | |||||||
| Haplotype (H) No. | Tag | Tag | H No. | Tag | Tag | Tag | H No. | Tag | Tag | H No. | Tag | Tag | Tag | H No. | Tag | Tag | Tag | 32 | 33 |
| H20 | T | A | H24 | G | C | C | H28 | A | A | H31 | G | T | C | H35 | C | C | C | G | C |
| H21 | T | G | H25 | G | C | T | H29 | G | A | H32 | A | C | T | H36 | T | C | A | G | C |
| H22 | C | G | H26 | A | C | T | H30 | G | G | H33 | A | T | T | H37 | C | C | A | G | C |
| H23 | C | A | H27 | G | T | T | . . . | H34 | A | T | C | H38 | T | T | C | A | T |
| . . . | Haplotypes which are estimated to occur at a frequency of less than 1% |
| Linkage disequilibrium block No. |
| 25 | 26 | 27 | 32 |
| Gene polymorphism name () |
| 34 | 35 | 36 | 37 | 38 | 39 | 40 | 42 | 43 | 44 | 45 | 47 | 50 | ||||||||
| Haplotype (H) No. | Tag | Tag | H No. | Tag | Tag | Tag | Tag | H No. | Tag | 41 | H No. | Tag | Tag | Tag | Tag | 46 | Tag | 48 | 49 | Tag |
| H39 | T | A | H42 | G | A | G | G | H47 | A | A | H49 | A | T | C | G | T | G | T | T | T |
| H40 | C | G | H43 | G | A | A | A | H48 | G | G | H50 | A | T | C | G | T | G | T | T | C |
| H41 | T | G | H44 | A | G | G | A | . . . | H51 | A | T | A | C | C | G | T | C | C | ||
| . . . | H45 | G | A | G | A | H52 | C | T | A | C | T | T | C | T | C | |||||
| H46 | G | G | G | A | H53 | C | T | A | C | T | G | C | T | C | ||||||
| . . . | H54 | A | C | C | G | T | G | T | T | T | ||||||||||
| H55 | A | T | A | G | T | G | T | T | C |
| Haplotypes which are estimated to occur at a frequency of less than 1% | |
| Linkage disequilibrium block No. |
| 33 | 35 | 40 |
| Gene polymorphism name () |
| 51 | 52 | 53 | 54 | 57 | 58 | 59 | ||||||||||
| Haplotype (H) No. | Tag | Tag | Tag | Tag | 55 | 56 | H No | Tag | Tag | H No. | Tag | 60 | 61 | 62 | 63 | 64 |
| H56 | T | G | G | C | A | A | H61 | C | T | H64 | G | G | C | T | T | C |
| H57 | T | A | A | T | G | C | H62 | T | C | H65 | A | A | T | C | C | A |
| H58 | G | A | A | C | G | C | H63 | T | T | . . . | ||||||
| H59 | T | A | G | C | A | A | . . . | |||||||||
| H60 | T | A | A | C | G | C |
| . . . | Haplotypes which are estimated to occur at a frequency of less than 1% |
| () 1~64: (in this order)rs4722778, rs177479, rs177480, rs11981754, rs177486, rs177498, rs10229500, rs10243659, rs4722785, rs16874503, rs11772815, rs6958133, rs16874525, rs17715174, rs6953524, rs10239810, rs17156649, rs1811248, rs887623, rs740988, rs6952227, rs42695, rs1029897, rs10233653, rs6955105, rs17156699, rs177572, rs177573, rs177580, rs177581, rs12666636, rs177584, rs177585, rs1008262, rs310353, rs41273, rs1637457, rs17156919, rs41276, rs160375, rs917275, rs17157048, rs6462098, rs10951201, rs13311248, rs12540480, rs10265166, rs7798774, rs7799246, rs6972081, rs12533079, rs7806547, rs6462100, rs6979352, rs6950574, rs4722835, rs721993, rs2237351, rs3735566, rs11975539, rs6462107, rs2190306, rs4719955 and rs10228137 |
| TABLE 14 |
| Gene name ATF2 |
| Linkage disequilibrium block No. |
| 1 | 2 |
| Gene polymorphism name () |
| 1 | 2 | 3 | 4 | 5 | ||||||||||||
| Haplotype No. | Tag | Tag | Tag | Tag | Tag | 6 | 7 | 8 | 9 | 10 | 11 | 12 | 13 | 14 | 15 | 16 |
| H1 | T | C | A | A | G | C | C | A | G | C | G | T | C | A | A | A |
| H2 | G | C | A | G | G | T | T | G | A | T | A | C | A | C | C | G |
| H3 | T | T | C | G | A | T | T | G | A | T | A | C | A | C | C | G |
| H4 | T | T | A | G | A | T | T | G | A | T | A | C | A | C | C | G |
| G | G | T | T | G | A | T | A | C | A | C | C | G |
| . . . | Haplotypes which are estimated to occur at a frequency of less than 1% |
| Linkage disequilibrium block No. | |
| 2 | |
| Gene polymorphism name () |
| 21 | 28 | ||||||||||||||
| Haplotype No. | 17 | 18 | 19 | 20 | Tag | 22 | 23 | 24 | 25 | 26 | 27 | Tag | 29 | 30 | 31 |
| H5 | C | T | T | C | C | C | G | A | C | A | C | T | T | G | T |
| H6 | T | C | C | T | T | T | A | G | A | C | T | G | C | G | C |
| H7 | T | C | C | T | T | T | A | G | A | C | T | T | C | G | C |
| H8 | T | C | C | T | T | T | A | G | A | C | T | G | C | G | C |
| H9 | T | C | C | T | C | C | G | A | C | A | C | T | T | G | T |
| . . . | Haplotypes which are estimated to occur at a frequency of less than 1% |
| () 1~31: (in this order)rs1153711, rs1153702, rs7583431, rs2302663, rs3845744, s212349, rs212347, rs12693057, rs1153685, rs212360, rs212361, rs2072538, rs1205399, rs1153676, rs7566401, rs7578569, rs3755490, rs13388308, rs11888507, rs10497434, rs268214, rs166531, rs268228, rs268229, rs268230, rs268231, rs10497435, rs1982235, rs268237, rs13030474 and rs268174 |
Further, from the genotype information of cyclic AMP responsive element binding protein (CREB) genes of the respective individuals in a population, a haplotype frequency in the population is calculated, and a linkage disequilibrium analysis can be carried out based on the thus obtained haplotype frequency. The D′ value and r2 value, which indicate measures of linkage disequilibrium, can be calculated based on the following definition.
It is assumed that there are SNP A and SNP B, and the respective alleles are represented by A and a, and B and b. The four haplotypes formed by SNP A and SNP B are represented by AB, Ab, aB and ab, and the respective haplotype frequencies are represented by PAB, PAb, PaB and Pab.
D=PAB×Pab−PAb×PaB (In the case of D>0)
D′=(PAB×Pab−PAb×PaB)/Minimum(((PAB+PaB)×(PaB+Pab)),((PAB+PAb)×(PAb+Pab))) (In the case of D<0)
D′=(PAB×Pab−PAb×PaB)/Minimum(((PAB+PaB)×(PAB+PAb)),((PaB+Pab)×(PAb+Pab)))
r2=(PAB×Pab−PAb×PaB)2/[(PAB+PAb)(PAB+PaB)(PaB+Pab)(PAb+Pab)]
[However, Minimum (((PAB+PaB)×(PaB+Pab)), ((PAB+PAb)×(PAb+Pab))) means that a smaller value among (PAB+PaB)×(PaB+Pab) and (PAB+PAb)×(PAb+Pab) is adopted.]
Further, a haplotype block can be estimated from the results of the linkage disequilibrium analysis. As for the haplotype block, a linkage block can be estimated from the results of the haplotype analysis by using, for example, Haploview.
When a specific SNP in the estimated haplotype blocks is examined, the information of SNPs indirectly linked to each other in the same block can be obtained. That is, when a gene polymorphism of the cyclic AMP responsive element binding protein gene (specifically, a CREB1 subtype gene, a CREB3 subtype gene, a CREB5 subtype gene, or an ATF2 subtype gene) is examined, it is not necessary to analyze all the SNPs, and it is only necessary to perform typing for several specific SNPs, for example, representative SNPs such as a Tag SNP.
4. Correlation of Cyclic AMP Responsive Element Binding Protein Gene Polymorphism with Drug Sensitivity and Disease Vulnerability
It is considered that when a gene polymorphism occurs in the cyclic AMP responsive element binding protein gene, the function or expression level of the cyclic AMP responsive element binding protein might change. Therefore, there is a correlation between a cyclic AMP responsive element binding protein gene polymorphism and various phenotypes associated with the cyclic AMP responsive element binding protein in some cases.
Here, as the phenotype, a phenotype associated with sensitivity to drugs (drug sensitivity) and a phenotype associated with occurrence of a disease (disease vulnerability) can be exemplified. As the drug sensitivity, an efficacy of drugs, a side effect of drugs, duration of efficacy of drugs and the like can be exemplified. As the disease vulnerability, pain sensitivity, vulnerability to substance dependence (in particular, vulnerability to drug dependence) and the like can be exemplified.
In the present invention, the type of the aforementioned drug is not particularly limited, and preferred examples of the drug include opioid receptor function modulators and cyclic AMP responsive element binding protein function modulators. Examples of such modulators include various drugs acting directly or indirectly on the opioid receptor or the cyclic AMP responsive element binding protein. Specific examples of various drugs acting directly or indirectly on the opioid receptor include a stimulant such as methamphetamine, a dopamine receptor agonist, a dopamine receptor antagonist, a m-, κ-, or δ-opioid receptor agonist, a m-, κ-, or δ-opioid receptor antagonist, and the like. Specific examples of various drugs acting directly or indirectly on the cyclic AMP responsive element binding protein include phosphorylated enzyme, a coactivator, a PDE4 inhibitor, dephosphorylated enzyme, an agonist for each subtypes of the cyclic AMP responsive element binding protein, an antagonist for each subtypes of the cyclic AMP responsive element binding protein, and the like.
Examples of the opioid receptor function modulator include morphine, DAMGO, codeine, methadone, carfentanil, fentanyl, heroin, cocaine, naloxone, naltrexone, nalorphine, levallorphan, pentazocine, pethidine, buprenorphine, oxycodone, hydrocodone, levorphanol, etorphine, dihydroetorphine, hydromorphone, oxymorphone, tramadol, diclofenac, indomethacin, flurbiprofen axetil, marcain, ethanol, methanol, diethyl ether, propanol, butanol, flupirtine, laughing gas, F3 (1-chloro-1,2,2-trifluorocyclobutane), halothane, estradiol, dithiothreitol, thioridazine, pimozide, fluoxetine, paroxetine, desipramine, imipramine, clomipramine, tetramide, isoflurane, ginsenoside, ifenprodil, bupivacaine, tertiapine, clozapine, haloperidol, SCH23390, cocaine, and the like. In particular, morphine, pentazocine, pethidine, buprenorphine, diclofenac, indomethacin, flurbiprofen axetil and marcain are preferred, and morphine, fentanyl and pentazocine are more preferred.
Preferred examples of the cyclic AMP responsive element binding protein function modulator include phosphodiesterase 4 (PDE4), calcineurin, protein kinase A, protein kinase C, p90 ribosome S6 kinase 1 (RSK1), calmodulin kinase, glycogen synthase kinase 3β, and CREB-regulated transcription coactivator 1 (CRTC1).
The correlation between a cyclic AMP responsive element binding protein gene polymorphism and a phenotype can be examined as described in the following (1) to (4), for example.
(1) A gene polymorphism in a linkage disequilibrium block estimated as a result of a linkage disequilibrium analysis and a haplotype analysis in healthy subjects is selected. For example, a Tag SNP which is a typical gene polymorphism is selected as a cyclic AMP responsive element binding protein gene polymorphism for analyzing a correlation with a phenotype.
(2) Then, a gene polymorphism frequency of the gene polymorphism in test subjects (patients) is analyzed. In the case where a correlation between a gene polymorphism and disease vulnerability is examined, a comparison is made in terms of gene polymorphisms between the test subjects and the healthy subjects. It is effective to use a statistical technique such as a chi-square test in the comparison.
Here, the test subjects are classified into groups depending on the difference in phenotypes, and a comparison may be made in terms of gene polymorphism frequencies or genotypes between healthy subjects and test subjects in each group. In the case where the phenotype associated with the occurrence of a disease is a stimulant-induced psychotic-like symptom, it can be classified, for example, according to a period of time from the start of the use of a stimulant to the occurrence of delusion or hallucination, a period of duration of delusion or hallucination after termination of the use thereof, the presence or absence of the relapse, and the presence or absence of multiple drug abuse.
(3) If there is a gene polymorphism significantly linked to drug sensitivity in the test subjects, the gene polymorphism can be used for evaluating the genetic predisposition to drug sensitivity. Further, if there is a gene polymorphism with a significant difference in the gene polymorphism frequency between the healthy subjects and the test subjects, the gene polymorphism can be used for evaluating the genetic predisposition to disease vulnerability.
However, it is suggested that a tendency to gene polymorphism would be affected by the race, birthplace or the like, therefore, it is preferred that in a group showing a similar gene polymorphism to that of a population used for finding an associated gene polymorphism (such as SNP), the above-mentioned evaluation using the gene polymorphism is carried out.
Specific examples of the correlation between a cyclic AMP responsive element binding protein gene polymorphism and a phenotype will be shown in the following (1) to (4).
(1) In the correlation with the measurement results of the required total administration amount of analgesic in 24 hours after surgery, in the case of patients who had a minor allele (C) of the CREB1 subtype gene polymorphism (rs10932200) and underwent the surgery, the required administration amount (logarithmic transformation) of analgesic after the surgery was statistically significantly high in correlation with the number of alleles which they had. Thus, by analyzing the CREB1 subtype gene polymorphism (rs10932200), the sensitivity to analgesic can be more easily predicted.
(2) In the correlation with the measurement results of pain perception latency due to finger immersion in ice water before surgery, the presence or absence of a minor allele (C) of the CREB1 subtype gene polymorphism (rs10932200) and pain perception latency (logarithmic transformation) showed a significant correlation. Thus, by analyzing the CREB1 subtype gene polymorphism (rs10932200), the sensitivity to pain can be more easily predicted.
(3) In the correlation with the measurement results of the scale of the intensity of pain (VAS: on visual analogue scale) 24 hours after surgery, in the case of patients who had a minor allele (C) of the CREB1 subtype gene polymorphism (rs10932200) and underwent the surgery, the value of VAS (logarithmic transformation) was statistically significantly high in correlation with the number of alleles which they had. Thus, by analyzing the CREB1 subtype gene polymorphism (rs10932200), the sensitivity to pain or analgesic after the surgery can be more easily predicted.
(4) In the correlation with the measurement results of a difference in threshold of pain perception latency due to finger immersion in ice water before surgery, in the case of patients who had a minor allele (C) of the ATF2 subtype gene polymorphism (rs7583431) and underwent the surgery, a difference in threshold of pain perception latency (logarithmic transformation) due to finger immersion in ice water was statistically significantly short in correlation with the number of alleles which they had. Thus, by analyzing the ATF2 subtype gene polymorphism (rs7583431), the sensitivity to analgesic before the surgery can be more easily predicted.
As in the above-mentioned 4, the correlation between a cyclic AMP responsive element binding protein gene polymorphism and a phenotype analyzed can be used as an index in a method of predicting sensitivity to various drugs associated with the opioid receptor and the cyclic AMP responsive element binding protein and also to pain, a method of selecting a method of treating or preventing a disease associated with the opioid receptor and the cyclic AMP responsive element binding protein, a method of determining an appropriate administration amount of therapeutic drugs, a method of predicting side effects, or the like.
Further, by using the gene polymorphism or the method of the present invention, it is possible to evaluate drug sensitivity and disease vulnerability in different races. The subjects are not particularly limited, and examples thereof include Japanese, Europeans, Americans and the like. In the present invention, however, they are preferably Japanese or those having a similar gene polymorphism tendency to that of Japanese.
A genome sample of a test subject can be extracted from the blood, saliva, skin or the like, however, the origin is not limited to these as long as a genome sample can be collected therefrom. The extraction and purification methods of genomic DNA are publicly well known. For example, genomic DNA is purified from a specimen such as the blood, saliva, skin or the like collected from a human using the phenol method or the like. At this time, a commercially available genomic DNA extraction kit such as GFX Genomic Blood DNA Purification Kit (manufactured by GE Healthcare Bio-Sciences KK) or a device may be used. In the case where SNP to be detected is present in an exon, mRNA or total RNA may be extracted instead of genomic DNA.
In the detection of a cyclic AMP responsive element binding protein gene polymorphism in a genome sample, the above-mentioned oligonucleotide of the present invention can be used as a probe or a primer. Hereinafter, an example of the gene polymorphism detection method will be described.
In order to amplify a test sample by PCR, it is preferred that a high fidelity DNA polymerase, for example, KOD Dash polymerase (manufactured by TOYOBO) is used. A primer to be used is designed such that a target SNP in the test sample can be amplified and synthesis is carried out. It is preferred that a gene polymorphism or a strand complementary thereto is contained at a given position between the forward and reverse primers. After completion of the amplification reaction, detection of the amplified products is carried out, and the presence or absence of a gene polymorphism is determined by a sequence method or the like.
The gene polymorphism of the present invention can also be detected by a sequencing method based on the dideoxy method. As a sequencer to be used for the sequencing, a commercially available ABI series (Applied Biosystems (Life Technologies)) can be used.
A DNA microarray is a microarray in which oligonucleotide probes have been immobilized on a support, and includes a DNA chip, a Gene chip, a microchip, a bead array and the like. First, a polynucleotide of a test sample is isolated and amplified by PCR, and then labeled with a fluorescent reporter group. Then, a labeled DNA/mRNA, or total RNA is incubated along with an array.
Then, this array is inserted in a scanner, and a hybridization pattern is detected. The data of the hybridization is collected as emitted light from the fluorescent reporter group bound to the probe array (i.e., incorporated in a target sequence). A probe which is completely identical with the target sequence generates a stronger signal than those having a region which is not identical with the target sequence. Because the sequence and the position of each probe on the array are known, the sequence of the target polynucleotide reacted with the probe array can be determined based on the complementarity.
The TaqMan PCR method is a method utilizing an allele specific oligonucleotide (also referred to as TaqMan probe) labeled with fluorescence and PCR with Taq DNA polymerase. The allele specific oligonucleotide is an oligonucleotide containing a gene polymorphic site. The allele specific oligonucleotide to be used in the TaqMan PCR method can be designed based on the above-mentioned gene polymorphism information.
The invader method is a method of detecting a gene polymorphism by subjecting an allele specific oligonucleotide and a template to hybridization. A kit for carrying out the invader method is commercially available (for example, NanoInvader® Array (manufactured by BML, Inc.)), and it is possible to easily detect a gene polymorphism by this method.
The present invention provides a kit for evaluating drug sensitivity and disease vulnerability. The kit for detecting a gene polymorphism of the present invention includes one or more components necessary for carrying out the present invention.
For example, the kit of the present invention preferably includes a component for storing or supplying an enzyme and/or a reaction component necessary for detecting a gene polymorphism. Such a component is not limited, and examples thereof include the oligonucleotide of the present invention, an enzyme buffer solution, dNTP, a reagent for control (such as a tissue sample or a target oligonucleotide for a positive or negative control), a reagent for labeling and/or detection, a solid phase support, a written instruction manual and the like. Further, the kit of the present invention may be a partial kit including only a part of the necessary components. In this case, a user can prepare the other components.
The kit of the present invention can be provided as a microarray in which the above-mentioned oligonucleotide has been immobilized on a support. The microarray is one in which the oligonucleotide of the present invention has been immobilized on a support, and includes a DNA chip, a Gene chip, a microchip, a bead array and the like.
The kit of the present invention preferably includes an oligonucleotide which contains a cyclic AMP responsive element binding protein gene polymorphism found in the present invention and is capable of being specifically hybridized to a DNA fragment containing the gene polymorphism.
In the case where a gene polymorphism is determined using the kit of the present invention, for example, the blood is collected before drugs are applied to patients or the like (for example, before surgery, at the time of occurrence of cancer pain or the like), and DNA containing a cyclic AMP responsive element binding protein 1 gene is isolated. Then, this gene is reacted with an oligonucleotide in the kit, and thereby a genotype is determined.
From the determined genotype and gene polymorphism, a dosage regimen such as the type or administration amount of the drugs can be designed. As a result, an effect of the drugs suitable for an individual can be obtained, which is useful in the personalized medicine. For example, in the case of using morphine, it becomes possible to obtain an analgesic effect suitable for an individual, and also to suppress the side effects to the minimum.
Hereinafter, the present invention will be described in more detail with reference to Examples. However, the present invention is not limited to these.
Genomic DNA was extracted from the blood of humans (127 Japanese healthy subjects) by a standard method, and gene polymorphisms were identified in four subtypes (CREB1, CREB3, CREB5, and ATF2) of a human cyclic AMP responsive element binding protein.
With regard to the CREB1 subtype gene, an entire exon region, 5′ and 3′ flanking regions, and an intron region were analyzed. In the case of the CREB1 subtype gene, 7 gene polymorphisms in an intron region were identified in the Japanese samples. Further, 4 and 6 gene polymorphisms were found in the 5′ and 3′ flanking regions, respectively (see Table 15). As a result of linkage disequilibrium analysis, 1 linkage disequilibrium block was found in a region ranging from the 5′ flanking region to the 3′ flanking region (see FIG. 1 and FIG. 2). It was found that rs16839837, rs2360969, rs10932200, rs2551946, rs4234080 and rs7594560 were suitable as Tag SNPs representing this linkage disequilibrium block.
Further, in the same manner as above, with regard to the CREB3 subtype gene, an entire exon region, 5′ and 3′ flanking regions, and an intron region were analyzed. In the case of the CREB3 subtype gene, 1 gene polymorphism in an intron region, and 25 and 14 gene polymorphisms in the 5′ and 3′ flanking regions, respectively, were identified in the Japanese samples (see Table 15). As a result of linkage disequilibrium analysis, 1 linkage disequilibrium block was found in the 5′ flanking region, and 1 linkage disequilibrium block was found in a region ranging from the 5′ flanking region to the 3′ flanking region (see FIG. 3 and FIG. 4). It was found that rs1243872, rs2145925, rs2025126, GA007477, rs11541908, rs3763630, rs10814274, rsGA025684, rs10814275, rs4878628 and rs10758321 were suitable as Tag SNPs representing this linkage disequilibrium block.
Further, in the same manner as above, with regard to the CREB5 subtype gene, an entire exon region, 5′ and 3′ flanking regions, and an intron region were analyzed. In the case of the CREB5 subtype gene, 2 gene polymorphisms in a noncoding region of exon, 241 gene polymorphisms in an intron region, and 9 and 5 gene polymorphisms in the 5′ and 3′ flanking regions, respectively, were identified in the Japanese samples (see Table 16). As a result of linkage disequilibrium analysis performed on some of the aforementioned gene polymorphisms, 1 linkage disequilibrium block was found in the 5′ flanking region, 15 linkage disequilibrium blocks were found in the intron region, and 1 linkage disequilibrium block was found in a region ranging from the noncoding region of exon to the 3′ flanking region (see FIG. 5 and FIG. 6). It was found that rs4722778, rs177479, rs177486, rs177498, rs10229500, rs10243659, rs4722785, rs11772815, rs16874525, rs17715174, rs6953524, rs10239810, rs17156649, rs1811248, rs887623, rs740988, rs6952227, rs42695, rs1029897, rs10233653, rs6955105, rs17156699, rs177572, rs177573, rs177580, rs177581, rs12666636, rs1008262, rs310353, rs41273, rs1637457, rs17156919, rs41276, rs160375, rs17157048, rs6462098, rs10951201, rs13311248, rs10265166, rs6972081, rs12533079, rs7806547, rs6462100, rs6979352, rs721993, rs2237351 and rs3735566 were suitable as Tag SNPs representing this linkage disequilibrium block.
Further, in the same manner as above, with regard to the ATF2 subtype gene, an entire exon region, 5′ and 3′ flanking regions, and an intron region were analyzed. In the case of the ATF2 subtype gene, 1 gene polymorphism in a noncoding region of exon 1, 16 gene polymorphisms in an intron region, and 11 and 6 gene polymorphisms in the 5′ and 3′ flanking regions, respectively, were identified in the Japanese samples (see Table 15). As a result of linkage disequilibrium analysis, 1 linkage disequilibrium block was found in a region ranging from the 5′ flanking region to the intron region, and 1 linkage disequilibrium block was found in the 3′ flanking region (see FIG. 7 and FIG. 8). It was found that rs1153711, rs1153702, rs7583431, rs2302663, rs3845744, rs268214 and rs1982235 were suitable as Tag SNPs representing this linkage disequilibrium block.
| TABLE 15 | |||||
| CREB1 gene polymorphism | CREB3 gene polymorphism | ATF2 gene polymorphism |
| Gene | Major | Minor | Gene | Major | Minor | Gene | Major | Minor | |||
| polymorphism | allele:minor | allele | polymorphism | allele:minor | allele | polymorphism | allele:minor | allele | |||
| Position | name | allele | frequency | Position | name | allele | frequency | Position | name | allele | frequency |
| 5′ | rs16839837 | C:T | 0.232 | 5′ | rs1243872 | G:T | 0.449 | 5′ | rs268174 | C:T | 0.201 |
| Flanking | rs2360969 | C:T | 0.126 | Flanking | rs2145925 | C:T | 0.39 | Flanking | rs13030474 | G:T | 0.008 |
| region | rs10932200 | A:C | 0.315 | region | rs2025126 | G:A | 0.366 | region | rs268237 | C:T | 0.189 |
| rs2253206 | G:A | 0.315 | rs1885373 | T:C | 0.055 | rs1982235 | T:G | 0.398 | |||
| Intron | rs2551640 | A:G | 0.323 | rs1885374 | A:C | 0.051 | rs10497435 | T:C | 0.189 | ||
| rs11904814 | T:G | 0.319 | GA007473 | T:C | 0.051 | rs268231 | C:A | 0.197 | |||
| rs16839883 | A:G | 0.181 | rs2295794 | T:C | 0.453 | rs268230 | A:C | 0.197 | |||
| rs6740584 | C:T | 0.307 | rs4879926 | T:C | 0.051 | rs268229 | G:A | 0.197 | |||
| rs3770704 | T:C | 0.181 | GA007477 | C:T | 0.358 | rs268228 | A:G | 0.205 | |||
| rs2254137 | A:C | 0.323 | rs867194 | T:C | 0.028 | rs166531 | T:C | 0.189 | |||
| rs2551645 | T:C | 0.319 | rs11541908 | C:T | 0.283 | rs268214 | T:C | 0.189 | |||
| 3′ | rs2551946 | C:A | 0.02 | rs741917 | C:T | 0.028 | Exon | rs10497434 | T:C | 0.154 | |
| Flanking | rs4234080 | C:A | 0.193 | rs7862485 | G:A | 0.051 | Intron | rs11888507 | C:T | 0.154 | |
| region | rs2952768 | T:C | 0.331 | rs2756894 | C:A | 0.445 | rs13388308 | C:T | 0.154 | ||
| rs2709386 | G:A | 0.331 | rs2249250 | T:G | 0.425 | rs3755490 | T:C | 0.146 | |||
| rs7591784 | G:A | 0.331 | rs2295795 | G:A | 0.374 | rs7578569 | G:A | 0.154 | |||
| rs7594560 | T:C | 0.181 | rs877365 | T:C | 0.445 | rs7566401 | C:A | 0.154 | |||
| rs2737273 | G:A | 0.413 | rs1153676 | C:A | 0.154 | ||||||
| rs2295797 | T:C | 0.374 | rs1205399 | A:C | 0.169 | ||||||
| rs2295798 | C:T | 0.008 | rs2072538 | C:T | 0.146 | ||||||
| rs1534847 | A:G | 0.37 | rs212361 | A:G | 0.154 | ||||||
| rs7873822 | G:T | 0.417 | rs212360 | T:C | 0.154 | ||||||
| rs2737274 | G:A | 0.051 | rs1153685 | A:G | 0.154 | ||||||
| rs10972567 | A:C | 0.445 | rs12693057 | G:A | 0.154 | ||||||
| rs3763630 | C:T | 0.276 | rs212347 | T:C | 0.154 | ||||||
| Intron | rs10814274 | C:T | 0.409 | rs212349 | T:C | 0.154 | |||||
| 3′ | rs3750434 | G:A | 0.402 | rs3845744 | A:G | 0.291 | |||||
| Flanking | rs1570246 | G:T | 0.385 | rs2302663 | G:A | 0.146 | |||||
| region | GA025684 | G:C | 0.323 | 3′ | rs35507277 | T:G | 0.008 | ||||
| rs1570248 | T:C | 0.268 | Flanking | rs1153699 | G:T | 0.472 | |||||
| rs1570249 | G:A | 0.409 | region | rs1153700 | C:G | 0.425 | |||||
| rs34478611 | G:A | 0.323 | rs7583431 | A:C | 0.366 | ||||||
| rs1322045 | A:G | 0.268 | rs1153702 | T:C | 0.476 | ||||||
| rs1951432 | G:A | 0.26 | rs1153711 | T:G | 0.209 | ||||||
| GA025687 | A:T | 0.264 | |||||||||
| rs10814275 | A:G | 0.067 | |||||||||
| rs10758320 | T:C | 0.264 | |||||||||
| rs4878628 | C:T | 0.134 | |||||||||
| rs10758321 | G:A | 0.394 | |||||||||
| rs10758322 | C:T | 0.402 | |||||||||
| TABLE 16 |
| CREB5 gene polymorphism |
| Gene | Major | |||
| polymorphism | allele:minor | Minor allele | ||
| Position | name | allele | frequency | |
| 5′ Flanking | rs4722778 | C:G | 0.256 | |
| region | rs177479 | T:C | 0.252 | |
| rs177480 | A:G | 0.242 | ||
| rs11981754 | A:G | 0.008 | ||
| rs177486 | G:A | 0.161 | ||
| rs177498 | C:T | 0.248 | ||
| rs849322 | A:G | 0.437 | ||
| rs177505 | T:G | 0.201 | ||
| rs2175738 | G:A | 0.161 | ||
| Intron | rs4719932 | A:C | 0.016 | |
| rs10258745 | C:T | 0.031 | ||
| rs1013900 | G:T | 0.021 | ||
| rs6955393 | G:A | 0.035 | ||
| rs6953880 | A:G | 0.02 | ||
| rs17156573 | T:C | 0.035 | ||
| rs6960209 | C:T | 0.02 | ||
| rs17156577 | T:C | 0.039 | ||
| rs7811922 | A:C | 0.035 | ||
| rs6973453 | T:C | 0.201 | ||
| rs17156579 | C:T | 0.055 | ||
| rs1073298 | T:C | 0.201 | ||
| rs6961801 | C:T | 0.319 | ||
| rs6977728 | C:A | 0.106 | ||
| rs6978238 | C:T | 0.102 | ||
| rs13230543 | C:A | 0.248 | ||
| rs12673465 | A:G | 0.343 | ||
| rs10251129 | T:C | 0.327 | ||
| rs2391656 | T:C | 0.333 | ||
| rs6971345 | A:G | 0.327 | ||
| rs17156603 | A:G | 0.398 | ||
| rs7806362 | C:A | 0.173 | ||
| rs17642145 | T:C | 0.008 | ||
| rs10229500 | C:T | 0.138 | ||
| rs10243659 | C:A | 0.476 | ||
| rs4722785 | G:A | 0.488 | ||
| rs16874503 | C:T | 0.004 | ||
| rs11772815 | G:A | 0.331 | ||
| rs6958133 | G:A | 0.13 | ||
| rs16874525 | C:T | 0.461 | ||
| rs17715174 | G:C | 0.354 | ||
| rs10242868 | T:G | 0.205 | ||
| rs12700884 | G:A | 0.476 | ||
| rs17156635 | G:A | 0.189 | ||
| rs10239606 | C:T | 0.374 | ||
| rs16874528 | G:A | 0.008 | ||
| rs7799687 | C:A | 0.189 | ||
| rs714218 | G:A | 0.327 | ||
| rs1860759 | A:G | 0.327 | ||
| rs997908 | G:A | 0.476 | ||
| rs12112050 | C:T | 0.484 | ||
| rs2191827 | A:G | 0.484 | ||
| rs4498447 | T:C | 0.327 | ||
| rs10254657 | G:A | 0.449 | ||
| rs6953524 | C:T | 0.492 | ||
| rs10239810 | A:G | 0.307 | ||
| rs17156649 | G:A | 0.079 | ||
| rs1811248 | T:G | 0.13 | ||
| rs887623 | T:C | 0.252 | ||
| rs740988 | A:G | 0.276 | ||
| rs7794304 | T:C | 0.457 | ||
| rs42694 | A:G | 0.035 | ||
| rs6952227 | G:A | 0.291 | ||
| rs42695 | C:T | 0.244 | ||
| rs1029897 | T:C | 0.409 | ||
| rs42699 | A:C | 0.024 | ||
| rs4722793 | C:A | 0.405 | ||
| rs735101 | T:C | 0.409 | ||
| rs10233653 | G:A | 0.421 | ||
| rs6955105 | G:A | 0.465 | ||
| rs2286841 | C:A | 0.228 | ||
| rs979915 | C:T | 0.012 | ||
| rs7794347 | C:T | 0.248 | ||
| rs16874562 | G:T | 0.283 | ||
| rs17156685 | A:G | 0.087 | ||
| rs174024 | C:T | 0.268 | ||
| rs6949786 | G:A | 0.26 | ||
| rs7793437 | A:G | 0.016 | ||
| rs3757677 | T:C | 0.016 | ||
| rs6462085 | T:G | 0.016 | ||
| rs17717216 | T:C | 0.016 | ||
| rs17156694 | G:A | 0.441 | ||
| rs17156699 | A:G | 0.268 | ||
| rs177572 | T:C | 0.331 | ||
| rs177573 | T:C | 0.417 | ||
| rs6977204 | A:G | 0.48 | ||
| rs177574 | A:G | 0.047 | ||
| rs177576 | T:C | 0.327 | ||
| rs177578 | G:A | 0.012 | ||
| rs13437706 | C:T | 0.374 | ||
| rs177580 | C:T | 0.382 | ||
| rs177581 | C:T | 0.169 | ||
| rs12666636 | C:A | 0.224 | ||
| rs177584 | G:A | 0.169 | ||
| rs177585 | C:T | 0.169 | ||
| rs177588 | G:A | 0.098 | ||
| rs6462088 | G:A | 0.437 | ||
| rs7796539 | C:T | 0.004 | ||
| rs1859020 | A:G | 0.378 | ||
| rs1011384 | A:G | 0.236 | ||
| rs6462090 | G:T | 0.004 | ||
| rs12671247 | T:C | 0.154 | ||
| rs217508 | T:C | 0.398 | ||
| rs4719936 | G:T | 0.004 | ||
| rs217509 | G:T | 0.197 | ||
| rs217510 | T:C | 0.193 | ||
| rs17718257 | G:A | 0.004 | ||
| rs149591 | C:A | 0.051 | ||
| rs1910553 | C:A | 0.22 | ||
| rs217517 | G:A | 0.193 | ||
| rs217519 | G:A | 0.173 | ||
| rs2391668 | T:G | 0.382 | ||
| rs4722804 | G:T | 0.189 | ||
| rs618776 | A:G | 0.378 | ||
| rs217503 | C:T | 0.382 | ||
| rs217513 | C:T | 0.236 | ||
| rs65264 | C:T | 0.394 | ||
| rs441355 | G:T | 0.189 | ||
| rs2391670 | C:T | 0.362 | ||
| rs2391671 | A:G | 0.362 | ||
| rs216708 | A:G | 0.425 | ||
| rs11980665 | C:T | 0.173 | ||
| rs11980669 | C:T | 0.173 | ||
| rs11984308 | T:C | 0.173 | ||
| rs160346 | G:A | 0.37 | ||
| rs150607 | A:G | 0.276 | ||
| rs177594 | G:A | 0.106 | ||
| rs6969064 | A:G | 0.169 | ||
| rs150610 | A:G | 0.094 | ||
| rs216715 | T:C | 0.287 | ||
| rs10951197 | T:C | 0.39 | ||
| rs12539927 | A:G | 0.185 | ||
| rs216720 | A:G | 0.051 | ||
| rs17156823 | G:A | 0.252 | ||
| rs2078980 | G:A | 0.492 | ||
| rs216730 | T:G | 0.236 | ||
| rs13228899 | G:T | 0.201 | ||
| rs160335 | G:A | 0.496 | ||
| rs10951200 | G:A | 0.047 | ||
| rs10486588 | G:A | 0.461 | ||
| rs216735 | G:A | 0.287 | ||
| rs216737 | C:T | 0.031 | ||
| rs216743 | G:A | 0.055 | ||
| rs216744 | A:G | 0.055 | ||
| rs216747 | C:T | 0.031 | ||
| rs1976489 | A:G | 0.496 | ||
| rs150613 | C:T | 0.169 | ||
| rs17156878 | G:A | 0.232 | ||
| rs767834 | C:G | 0.437 | ||
| rs4722820 | G:A | 0.177 | ||
| rs160337 | C:A | 0.047 | ||
| rs160338 | G:A | 0.075 | ||
| rs1008262 | T:C | 0.323 | ||
| rs310353 | G:A | 0.299 | ||
| rs310359 | T:C | 0.217 | ||
| rs310361 | C:T | 0.169 | ||
| rs13233942 | A:G | 0.339 | ||
| rs310338 | T:C | 0.323 | ||
| rs41273 | G:A | 0.169 | ||
| rs1637457 | A:G | 0.22 | ||
| rs17156919 | G:A | 0.299 | ||
| rs41276 | A:G | 0.417 | ||
| rs160375 | A:G | 0.067 | ||
| rs917275 | A:G | 0.067 | ||
| rs160342 | A:G | 0.264 | ||
| rs160343 | T:C | 0.083 | ||
| rs41295 | C:T | 0.094 | ||
| rs160357 | A:G | 0.492 | ||
| rs41298 | G:A | 0.236 | ||
| rs41305 | G:A | 0.402 | ||
| rs41307 | C:T | 0.425 | ||
| rs10228740 | A:G | 0.126 | ||
| rs3888613 | G:A | 0.205 | ||
| rs41320 | C:T | 0.323 | ||
| rs41321 | A:G | 0.402 | ||
| rs41322 | A:G | 0.335 | ||
| rs7780656 | G:T | 0.063 | ||
| rs41327 | A:G | 0.343 | ||
| rs42322 | T:C | 0.331 | ||
| rs41333 | A:G | 0.331 | ||
| rs9655280 | A:G | 0.063 | ||
| rs9655281 | G:A | 0.063 | ||
| rs4719945 | A:G | 0.307 | ||
| rs6945988 | A:G | 0.413 | ||
| rs10258405 | T:G | 0.185 | ||
| rs10243376 | G:A | 0.185 | ||
| rs41334 | T:C | 0.429 | ||
| rs10245004 | C:T | 0.189 | ||
| rs41339 | G:T | 0.317 | ||
| rs982947 | C:T | 0.181 | ||
| rs982950 | A:G | 0.181 | ||
| rs16874653 | A:G | 0.28 | ||
| rs41346 | G:T | 0.02 | ||
| rs41348 | A:G | 0.386 | ||
| rs9969149 | C:T | 0.339 | ||
| rs6968464 | G:A | 0.02 | ||
| rs886816 | G:A | 0.181 | ||
| rs757980 | A:G | 0.035 | ||
| rs41351 | G:A | 0.083 | ||
| rs9691873 | A:C | 0.098 | ||
| rs17157048 | A:C | 0.087 | ||
| rs6462098 | T:C | 0.122 | ||
| rs10951201 | C:A | 0.154 | ||
| rs13311248 | G:C | 0.146 | ||
| rs12540480 | T:C | 0.063 | ||
| rs10265166 | G:T | 0.043 | ||
| rs7798774 | T:C | 0.087 | ||
| rs7799246 | T:C | 0.059 | ||
| rs6972081 | T:C | 0.287 | ||
| rs7777929 | T:C | 0.037 | ||
| rs12533079 | T:G | 0.079 | ||
| rs7806547 | G:A | 0.157 | ||
| rs6462100 | G:A | 0.134 | ||
| rs6979352 | C:T | 0.012 | ||
| rs6950574 | A:G | 0.13 | ||
| rs4722835 | A:C | 0.13 | ||
| rs9648352 | A:G | 0.028 | ||
| rs879593 | A:C | 0.138 | ||
| rs879591 | G:T | 0.15 | ||
| rs2299110 | C:T | 0.228 | ||
| rs2237349 | C:T | 0.272 | ||
| rs2066979 | T:C | 0.276 | ||
| rs10486589 | A:G | 0.039 | ||
| rs10486591 | G:A | 0.272 | ||
| rs6462103 | C:T | 0.118 | ||
| rs721993 | C:T | 0.154 | ||
| rs2237351 | T:C | 0.091 | ||
| rs740315 | G:A | 0.004 | ||
| rs2237353 | A:C | 0.238 | ||
| rs2073537 | T:C | 0.217 | ||
| rs4722844 | G:T | 0.181 | ||
| rs17730621 | C:T | 0.327 | ||
| rs2282907 | G:A | 0.24 | ||
| rs10238623 | G:A | 0.193 | ||
| rs2299116 | C:A | 0.091 | ||
| rs2299117 | T:C | 0.154 | ||
| rs2237355 | A:G | 0.366 | ||
| rs2237360 | T:G | 0.268 | ||
| rs2237361 | T:C | 0.217 | ||
| rs2237362 | T:C | 0.106 | ||
| rs7791555 | G:T | 0.272 | ||
| rs2237364 | A:G | 0.26 | ||
| rs2282909 | T:G | 0.366 | ||
| rs2282910 | C:T | 0.366 | ||
| rs2282911 | T:C | 0.366 | ||
| rs1544470 | A:G | 0.362 | ||
| rs1964240 | A:C | 0.293 | ||
| rs17669844 | T:C | 0.008 | ||
| rs886750 | A:G | 0.354 | ||
| rs12531253 | G:A | 0.272 | ||
| rs10951205 | A:G | 0.374 | ||
| Exon | rs2190305 | A:G | 0.374 | |
| rs3735566 | G:A | 0.039 | ||
| 3′ Flanking | rs11975539 | G:A | 0.039 | |
| region | rs6462107 | C:T | 0.039 | |
| rs2190306 | T:C | 0.043 | ||
| rs4719955 | T:C | 0.047 | ||
| rs10228137 | C:A | 0.051 | ||
In Table 15 and Table 16, there is not found any polymorphism causing amino acid substitution, namely, a polymorphism in which the type of amino acid after translation is changed depending on the gene polymorphism allele.
Moreover, in Table 15 and Table 16, “minor allele frequency” means the ratio of a minor allele. It is to be noted that the number of healthy subjects used as test subjects was 127.
As some examples of haplotype analysis, with regard to the 17 sites of SNPs which are CREB1 subtype gene polymorphisms, the 40 sites of SNPs which are CREB3 subtype gene polymorphisms, the 83 sites of SNPs which are CREB5 subtype gene polymorphisms, and the 23 sites of SNPs which are ATF2 subtype gene polymorphisms, as shown in Table 15 and Table 16, among the cyclic AMP responsive element binding protein gene polymorphisms in Japanese healthy subjects, a haplotype was estimated for each linkage disequilibrium block (haplotype block), using Haploview. The estimated haplotypes are shown in Tables 17, 18, 19 and 20. It is to be noted that the “Tag” used in each table means a Tag SNP that is a representative gene polymorphism in the linkage disequilibrium block.
| TABLE 17 |
| Gene name CREB1 |
| Linkage disequilibrium block No. | |
| 1 | |
| Gene polymorphism name () |
| 1 | 2 | 3 | 12 | 13 | 17 | |||||||||||||
| Haplotype No. | Frequency (%) | Tag | Tag | Tag | 4 | 5 | 6 | 7 | 8 | 9 | 10 | 11 | Tag | Tag | 14 | 15 | 16 | Tag |
| H1 | 16.9 | C | C | C | A | G | G | G | T | C | C | C | C | C | C | A | A | T |
| H2 | 42.5 | C | C | A | G | A | T | A | C | T | A | T | C | C | T | G | G | T |
| H3 | 12.2 | C | T | C | A | G | G | A | T | T | C | C | C | C | C | A | A | T |
| H4 | 17.7 | T | C | A | G | A | T | A | C | T | A | T | C | A | T | G | G | C |
| H5 | 1.6 | C | C | A | G | A | T | A | C | T | A | T | A | C | C | A | A | T |
| H6 | 3.5 | T | C | A | G | A | T | A | C | T | A | T | C | C | T | G | G | T |
| H7 | 1.2 | T | C | A | G | A | T | A | C | T | A | T | C | A | T | G | G | T |
| . . . | Haplotypes which are estimated to occur at a frequency of less than 1% |
| 100.0% | |
| () 1~17: (in this order)rs16839837, rs2360969, rs10932200, rs2253206, rs2551640, rs11904814, rs16839883, rs6740584, rs3770704, rs2254137, rs2551645, rs2551946, rs4234080, rs2952768, rs2709386, rs7591784 and rs7594560 |
| TABLE 18 |
| Gene name CREB3 |
| Linkage disequilibrium block No. | ||
| 1 | ||
| Hap- | Gene polymorphism name () |
| lotype | Frequen- | 1 | 2 | 3 | 9 | 11 | |||||||||||||||||||
| No. | cy (%) | Tag | Tag | Tag | 4 | 5 | 6 | 7 | 8 | Tag | 10 | Tag | 12 | 13 | 14 | 15 | 16 | 17 | 18 | 19 | 20 | 21 | 22 | 23 | 24 |
| H1 | 18.9 | G | C | G | T | A | T | T | T | C | T | C | C | G | C | T | G | T | G | T | C | A | G | G | A |
| H2 | 35.4 | G | C | G | T | A | T | T | T | T | T | C | C | G | C | T | G | T | G | T | C | A | G | G | A |
| H3 | 25.6 | T | T | A | T | A | T | C | T | C | T | T | C | G | A | G | A | C | A | C | C | G | T | G | C |
| H4 | 8.3 | T | T | A | T | A | T | C | T | C | T | C | C | G | A | G | A | C | A | C | C | G | T | G | C |
| H5 | 4.3 | T | C | G | C | C | C | C | C | C | T | C | C | A | A | G | G | C | A | T | C | A | T | A | C |
| H6 | 2.8 | T | T | G | T | A | T | C | T | C | C | C | T | G | A | T | G | C | G | T | C | A | G | G | C |
| H7 | 1.2 | T | C | A | T | A | T | C | T | C | T | T | C | G | A | G | A | C | A | C | C | G | T | G | C |
| . . . | Haplotypes which are estimated to occur at a frequency of less than 1% |
| 100.0% | |
| Linkage disequilibrium block No. | ||
| 2 | ||
| Hap- | Gene polymorphism name () |
| lotype | Frequen- | 25 | 26 | 29 | 36 | 38 | 39 | ||||||||||
| No. | cy (%) | Tag | Tag | 27 | 28 | Tag | 30 | 31 | 32 | 33 | 34 | 35 | Tag | 37 | Tag | Tag | 40 |
| H8 | 12.6 | C | C | G | G | G | C | G | G | G | A | T | A | C | C | G | C |
| H9 | 29.8 | C | T | A | T | G | T | A | G | A | G | A | A | T | C | A | T |
| H10 | 25.9 | T | C | G | G | C | T | G | A | A | G | A | A | T | C | G | C |
| H11 | 2.0 | C | T | A | G | G | T | A | G | A | G | A | A | T | C | G | T |
| H12 | 6.4 | C | C | G | G | C | T | G | A | A | G | A | A | T | C | G | C |
| H13 | 6.7 | C | T | A | T | G | T | A | G | A | G | A | G | T | C | A | T |
| H14 | 12.2 | C | C | G | G | G | C | G | G | G | A | T | A | C | T | G | C |
| . . . | Haplotypes which are estimated to occur at a frequency of less than 1% |
| 100.0% | |
| () 1~40: (in this order)rs1243872, rs2145925, rs2025126, rs1885373, rs1885374, GA007473, rs2295794, rs4879926, GA007477, rs867194, rs11541908, rs741917, rs7862485, rs2756894, rs2249250, rs2295795, rs877365, rs2737273, rs2295797, rs2295798, rs1534847, rs7873822, rs2737274, rs10972567, rs3763630, rs10814274, rs3750434, rs1570246, GA025684, rs1570248, rs1570249, rs34478611, rs1322045, rs1951432, GA025687, rs10814275, rs10758320, rs4878628, rs10758321 and rs10758322 |
| TABLE 19 |
| Gene name CREB5 |
| Linkage disequilibrium block No. |
| 1 | 5 | 6 | 9 | 10 |
| Hap- | Gene polymorphism name () |
| lotype | Frequen- | 1 | 2 | 5 | 6 | H | Frequen- | 7 | 8 | 9 | 11 | H | Frequen- | 13 | 14 | H | Frequen- | 15 | 16 | H | Frequen- | 17 | 18 | ||||
| (H) No. | cy (%) | Tag | Tag | 3 | 4 | Tag | Tag | No. | cy (%) | Tag | Tag | Tag | 10 | Tag | 12 | No. | cy (%) | Tag | Tag | No. | cy (%) | Tag | Tag | No. | cy (%) | Tag | Tag |
| H1 | 73.2 | C | T | A | A | G | C | H6 | 33.1 | C | C | G | C | A | G | H11 | 46.1 | T | G | H14 | 49.2 | T | A | H17 | 87.0 | G | T |
| H2 | 6.7 | G | C | G | A | G | T | H7 | 33.8 | C | A | A | C | G | G | H12 | 35.4 | C | C | H15 | 20.1 | C | A | H18 | 5.1 | G | G |
| H3 | 16.1 | G | C | G | A | A | T | H8 | 16.5 | C | C | G | C | G | G | H13 | 18.5 | C | G | H16 | 30.7 | C | G | H19 | 7.9 | A | G |
| H4 | 1.2 | C | C | G | A | G | T | H9 | 12.6 | T | A | A | C | G | A | . . . | . . . | . . . | |||||||||
| H5 | 1.2 | G | C | G | A | G | C | H10 | 2.0 | C | C | A | C | G | G |
| . . . | Haplotypes which are estimated to occur at a frequency of less than 1% |
| 100.0% | 100.0% | 100.0% | 100.0% | 100.0% | |||||||||||||||||||||
| Linkage disequilibrium block No. |
| 11 | 12 | 13 | 15 | 16 |
| Hap- | Gene polymorphism name () |
| lotype | Frequen- | 19 | 20 | H | Frequen- | 21 | 22 | 23 | H | Frequen- | 24 | 25 | H | Frequen- | 26 | 27 | 28 | H | Frequen- | 29 | 30 | 31 | ||
| (H) No. | cy (%) | Tag | Tag | No. | cy (%) | Tag | Tag | Tag | No. | cy (%) | Tag | Tag | No. | cy (%) | Tag | Tag | Tag | No. | cy (%) | Tag | Tag | Tag | 32 | 33 |
| H20 | 71.2 | T | A | H24 | 40.1 | G | C | C | H28 | 42.1 | A | A | H31 | 26.8 | G | T | C | H35 | 60.6 | C | C | C | G | C |
| H21 | 3.6 | T | G | H25 | 6.4 | G | C | T | H29 | 4.3 | G | A | H32 | 33.1 | A | C | T | H36 | 21.3 | T | C | A | G | C |
| H22 | 24.0 | C | G | H26 | 28.7 | A | C | T | H30 | 53.5 | G | G | H33 | 25.2 | A | T | T | H37 | 1.2 | C | C | A | G | C |
| H23 | 1.2 | C | A | H27 | 24.0 | G | T | T | . . . | H34 | 15.0 | A | T | C | H38 | 16.9 | T | T | C | A | T |
| . . . | Haplotypes which are estimated to occur at a frequency of less than 1% |
| 100.0% | 100.0% | 100.0% | 100.0% | 100.0% | |||||||||||||||
| Linkage disequilibrium block No. |
| 25 | 26 | 27 | 32 |
| Hap- | Gene polymorphism name () |
| lotype | Frequen- | 34 | 35 | H | Frequen- | 36 | 37 | 38 | 39 | H | Frequen- | 40 | H | Frequen- | 42 | 43 | 44 | 45 | 47 | 50 | ||||
| (H) No. | cy (%) | Tag | Tag | No. | cy (%) | Tag | Tag | Tag | Tag | No. | cy (%) | Tag | 41 | No. | cy (%) | Tag | Tag | Tag | Tag | 46 | Tag | 48 | 49 | Tag |
| H39 | 29.9 | T | A | H42 | 41.7 | G | A | G | G | H47 | 93.3 | A | A | H49 | 58.7 | A | T | C | G | T | G | T | T | T |
| H40 | 32.3 | C | G | H43 | 29.9 | G | A | A | A | H48 | 6.7 | G | G | H50 | 13.0 | A | T | C | G | T | G | T | T | C |
| H41 | 37.8 | T | G | H44 | 16.9 | A | G | G | A | . . . | H51 | 5.4 | A | T | A | C | C | G | T | C | C | |||
| . . . | H45 | 6.3 | G | A | G | A | H52 | 4.3 | C | T | A | C | T | T | C | T | C | |||||||
| H46 | 5.1 | G | G | G | A | H53 | 4.3 | C | T | A | C | T | G | C | T | C | ||||||||
| . . . | H54 | 12.2 | A | C | C | G | T | G | T | T | T | |||||||||||||
| H55 | 1.2 | A | T | A | G | T | G | T | T | C |
| Haplotypes which are estimated to occur at a frequency of less than 1% |
| 100.0% | 100.0% | 100.0% | 100.0% | ||||||||||||
| Linkage disequilibrium block No. |
| 33 | 35 | 40 |
| Hap- | Gene polymorphism name () |
| lotype | Frequen- | 51 | 52 | 53 | 54 | H | Frequen- | 57 | 58 | H | Frequen- | 59 | |||||||
| (H) No. | cy (%) | Tag | Tag | Tag | Tag | 55 | 56 | No. | cy (%) | Tag | Tag | No. | cy (%) | Tag | 60 | 61 | 62 | 63 | 64 |
| H56 | 83.4 | T | G | G | C | A | A | H61 | 84.6 | C | T | H64 | 94.5 | G | G | C | T | T | C |
| H57 | 1.2 | T | A | A | T | G | C | H62 | 9.1 | T | C | H65 | 3.9 | A | A | T | C | C | A |
| H58 | 7.5 | G | A | A | C | G | C | H63 | 6.3 | T | T | . . . | |||||||
| H59 | 2.8 | T | A | G | C | A | A | . . . | |||||||||||
| H60 | 4.3 | T | A | A | C | G | C |
| . . . | Haplotypes which are estimated to occur at a frequency of less than 1% |
| 100.0% | 100.0% | 100.0% | |||||||||||
| () 1~64: (in this order)rs4722778, rs177479, rs177480, rs11981754, rs177486, rs177498, rs10229500, rs10243659, rs4722785, rs16874503, rs11772815, rs6958133, rs16874525, rs17715174, rs6953524, rs10239810, rs17156649, rs1811248, rs887623, rs740988, rs6952227, rs42695, rs1029897, rs10233653, rs6955105, rs17156699, rs177572, rs177573, rs177580, rs177581, rs12666636, rs177584, rs177585, rs1008262, rs310353, rs41273, rs1637457, rs17156919, rs41276, rs160375, rs917275, rs17157048, rs6462098, rs10951201, rs13311248, rs12540480, rs10265166, rs7798774, rs7799246, rs6972081, rs12533079, rs7806547, rs6462100, rs6979352, rs6950574, rs4722835, rs721993, rs2237351, rs3735566, rs11975539, rs6462107, rs2190306, rs4719955 and rs10228137 |
| TABLE 20 |
| Gene name ATF2 |
| Linkage disequilibrium block No. |
| 1 | 2 |
| Gene polymorphism name () |
| 1 | 2 | 3 | 4 | 5 | |||||||||||||
| Haplotype No. | Frequency (%) | Tag | Tag | Tag | Tag | Tag | 6 | 7 | 8 | 9 | 10 | 11 | 12 | 13 | 14 | 15 | 16 |
| H1 | 26.3 | T | C | A | A | G | C | C | A | G | C | G | T | C | A | A | A |
| H2 | 20.9 | G | C | A | G | G | T | T | G | A | T | A | C | A | C | C | G |
| H3 | 36.2 | T | T | C | G | A | T | T | G | A | T | A | C | A | C | C | G |
| H4 | 16.2 | T | T | A | G | A | T | T | G | A | T | A | C | A | C | C | G |
| G | G | T | T | G | A | T | A | C | A | C | C | G |
| . . . | Haplotypes which are estimated to occur at a frequency of less than 1% |
| 100.0% | |
| Linkage disequilibrium block No. | ||
| 2 | ||
| Gene polymorphism name () |
| 21 | 28 | |||||||||||||||
| Haplotype No. | Frequency (%) | 17 | 18 | 19 | 20 | Tag | 22 | 23 | 24 | 25 | 26 | 27 | Tag | 29 | 30 | 31 |
| H5 | 14.6 | C | T | T | C | C | C | G | A | C | A | C | T | T | G | T |
| H6 | 8.8 | T | C | C | T | T | T | A | G | A | C | T | G | C | G | C |
| H7 | 40.3 | T | C | C | T | T | T | A | G | A | C | T | T | C | G | C |
| H8 | 28.3 | T | C | C | T | T | T | A | G | A | C | T | G | C | G | C |
| H9 | 4.3 | T | C | C | T | C | C | G | A | C | A | C | T | T | G | T |
| . . . | Haplotypes which are estimated to occur at a frequency of less than 1% |
| 100.0% | |
| () 1~31: (in this order)rs1153711, rs1153702, rs7583431, rs2302663, rs3845744, s212349, rs212347, rs12693057, rs1153685, rs212360, rs212361, rs2072538, rs1205399, rs1153676, rs7566401, rs7578569, rs3755490, rs13388308, rs11888507, rs10497434, rs268214, rs166531, rs268228, rs268229, rs268230, rs268231, rs10497435, rs1982235, rs268237, rs13030474 and rs268174 |
As shown in Table 17, at least 7 haplotypes were estimated as the haplotype of CREB1 subtype gene polymorphism in the Japanese healthy subjects, and among these, there were 6 haplotypes observed at a high frequency of 3% or higher (haplotype Nos. H1 to H6). Incidentally, specific description regarding haplotypes which are estimated to occur at a frequency of less than 1% was omitted from Table 17.
In addition, as shown in Table 18, at least 14 haplotypes were estimated as the haplotype of CREB3 subtype gene polymorphism in the Japanese healthy subjects, and among these, there were 11 haplotypes observed at a high frequency of 3% or higher (haplotype Nos. H1 to H5, H8 to H10, and H12 to H14). Incidentally, specific description regarding haplotypes which are estimated to occur at a frequency of less than 1% was omitted from Table 18.
Moreover, as shown in Table 19, at least 65 haplotypes were estimated as the haplotype of CREB5 subtype gene polymorphism in the Japanese healthy subjects, and among these, there were 57 haplotypes observed at a high frequency of 3% or higher (haplotype Nos. H1 to H3, H6 to H9, H11 to H22, H24 to H36, H38 to H54, H56, H58, and H60 to H65). Incidentally, specific description regarding haplotypes which are estimated to occur at a frequency of less than 1% was omitted from Table 19.
Furthermore, as shown in Table 20, at least 9 haplotypes were estimated as the haplotype of ATF2 subtype gene polymorphism in the Japanese healthy subjects, and among these, there were 9 haplotypes observed at a high frequency of 3% or higher (haplotype Nos. H1 to H9). Incidentally, specific description regarding haplotypes which are estimated to occur at a frequency of less than 1% was omitted from Table 20.
As well as an analysis of the haplotype frequencies in the haplotype analysis shown in Tables 17, 18, 19 and 20, a linkage disequilibrium analysis was carried out. The results are shown in FIG. 1 to FIG. 8. The linkage disequilibrium among the CREB1 subtype gene polymorphisms in the Japanese healthy subjects is shown in FIG. 1 and FIG. 2. In addition, the linkage disequilibrium among the CREB3 subtype gene polymorphisms in the Japanese healthy subjects is shown in FIG. 3 and FIG. 4. Moreover, the linkage disequilibrium among the CREB5 subtype gene polymorphisms in the Japanese healthy subjects is shown in FIG. 5 and FIG. 6. Furthermore, the linkage disequilibrium among the ATF2 subtype gene polymorphisms in the Japanese healthy subjects is shown in FIG. 7 and FIG. 8.
A linkage disequilibrium block was estimated from the results of the linkage disequilibrium analysis (FIG. 1 to FIG. 8) using Haploview.
In FIG. 1, a D′ value, which is an index of a linkage disequilibrium between SNP and SNP, is calculated, and the resulting value (two places of decimals) is written in the square at the intersection of squares continued from each SNP to the lower left direction or the lower right direction. Further, an r2 value, which is a more stringent index of the linkage disequilibrium, is calculated in the same manner, and the resulting value is written in the same square as defined above in FIG. 2. It is to be noted that the square in which no numbers are written indicates that the D′ or r2 value is 1. Also, the same shall apply to FIGS. 3 and 4, FIGS. 5 and 6, and FIGS. 7 and 8.
When focusing attention on the D′ values in FIG. 1, a complete linkage disequilibrium (D′=1) was observed in many combinations of gene polymorphisms. Further, when focusing attention on the r2 values in FIG. 2, it was found that several gene polymorphisms showed a strong linkage disequilibrium (r2=1). It was found that suitable Tag SNPs representing these linkage disequilibrium blocks are rs16839837, rs2360969, rs10932200, rs2551946, rs4234080 and rs7594560.
In addition, when focusing attention on the D′ values in FIG. 3, a complete linkage disequilibrium (D′=1) was observed in many combinations of gene polymorphisms. Further, when focusing attention on the r2 values in FIG. 4, it was found that several gene polymorphisms showed a strong linkage disequilibrium (r2=1). It was found that suitable Tag SNPs representing these linkage disequilibrium blocks are rs1243872, rs2145925, rs2025126, GA007477, rs11541908, rs3763630, rs10814274, rsGA025684, rs10814275, rs4878628 and rs10758321.
When focusing attention on the D′ values in FIG. 5, a complete linkage disequilibrium (D′=1) was observed in many combinations of gene polymorphisms. Further, when focusing attention on the r2 values in FIG. 6, it was found that several gene polymorphisms showed a strong linkage disequilibrium (r2=1). It was found that suitable Tag SNPs representing these linkage disequilibrium blocks are rs4722778, rs177479, rs177486, rs177498, rs10229500, rs10243659, rs4722785, rs11772815, rs16874525, rs17715174, rs6953524, rs10239810, rs17156649, rs1811248, rs887623, rs740988, rs6952227, rs42695, rs1029897, rs10233653, rs6955105, rs17156699, rs177572, rs177573, rs177580, rs177581, rs12666636, rs1008262, rs310353, rs41273, rs1637457, rs17156919, rs41276, rs160375, rs17157048, rs6462098, rs10951201, rs13311248, rs10265166, rs6972081, rs12533079, rs7806547, rs6462100, rs6979352, rs721993, rs2237351 and rs3735566.
In addition, when focusing attention on the D′ values in FIG. 7, a complete linkage disequilibrium (D′=1) was observed in many combinations of gene polymorphisms. Further, when focusing attention on the r2 values in FIG. 8, it was found that several gene polymorphisms showed a strong linkage disequilibrium (r2=1). It was found that suitable Tag SNPs representing these linkage disequilibrium blocks are rs1153711, rs1153702, rs7583431, rs2302663, rs3845744, rs268214 and rs1982235.
Further, a linkage disequilibrium block was estimated from the results of the linkage disequilibrium analysis (FIG. 1 to FIG. 8) using Haploview. As a result, with regard to SNP in the CREB1 subtype gene shown in FIG. 1 and FIG. 2, one linkage disequilibrium block was confirmed in a region ranging from the 5′ flanking region to the 3′ flanking region. In a similar manner, with regard to SNP in the CREB3 subtype gene shown in FIG. 3 and FIG. 4, one linkage disequilibrium block was confirmed in the 5′ flanking region, and one linkage disequilibrium block was confirmed in a region ranging from the 5′ flanking region to the 3′ flanking region. In a similar manner, with regard to SNP in the CREB5 subtype gene shown in FIG. 5 and FIG. 6, one linkage disequilibrium block was confirmed in the 5′ flanking region, 15 linkage disequilibrium blocks were confirmed in the intron region, and one linkage disequilibrium block was confirmed in a region ranging from the noncoding region of exon to the 3′ flanking region. In a similar manner, with regard to SNP in the ATF2 subtype gene shown in FIG. 7 and FIG. 8, one linkage disequilibrium block was confirmed in a region ranging from the 5′ flanking region to the intron region, and one linkage disequilibrium block was confirmed in the 3′ flanking region.
<Correlation Between CREB1 Subtype Gene Polymorphism (rs10932200) and Required Administration Amount of Analgesic>
A correlation between a cyclic AMP responsive element binding protein gene polymorphism and the required administration amount of analgesic was examined. Genomic DNA was extracted from the blood of 247 patients undergoing surgery (orthognathic surgery), and one gene polymorphism (rs10932200) in the CREB1 subtype gene was determined. Then, a correlation between these results of determination of the gene polymorphism and the required administration amount of analgesic after the surgery was analyzed.
Incidentally, as the analgesic, fentanyl, which is mainly administered intravenously through a PCA (patient-controlled analgesia) pump, was used.
As a result, as shown in the following Table 21 and FIG. 9, in the case of patients who had a minor allele (C) of the CREB1 subtype gene polymorphism (rs10932200) and underwent the surgery, the required administration amount (logarithmic transformation) of analgesic after the surgery was statistically significantly high in correlation with the number of alleles which they had. Accordingly, by analyzing the CREB1 subtype gene polymorphism (rs10932200), the sensitivity to analgesic can be predicted.
Using the median (2.222 (μg/kg)) of the required administration amounts of fentanyl in 24 hours after the surgery as a reference, a patient group with a value smaller than the reference and a patient group with a value larger than the reference were defined as a “high analgesic sensitivity group” and a “low analgesic sensitivity group,” respectively, and the groups were then stratified in terms of the rs10932200 polymorphism of the CREB1 gene. As a result, in terms of this polymorphism, 54% and 46% of patients were determined to belong to the high analgesic sensitivity group and the low analgesic sensitivity group, respectively, in the A/A patient group. In contrast, in the C/C patient group, 23% and 77% of patients were determined to belong to the high analgesic sensitivity group and the low analgesic sensitivity group, respectively.
| TABLE 21 |
| Effect of CREB1 rs10932200 polymorphism on required amount |
| of analgesic administered in 24 hours after surgery in |
| patients treated with analgesic in surgery (orthognathic surgery) |
| (descriptive statistics by gender) |
| Number of test | ||||
| CREB1 | Average | subjects | ||
| rs10932200 | Gender | | Standard deviation | (subjects) |
| A/A | F | 2.47 | 2.06 | 77 |
| M | 2.42 | 2.57 | 36 | |
| Total | 2.46 | 2.23 | 113 | |
| A/C | F | 3.23 | 2.65 | 75 |
| M | 2.05 | 1.97 | 33 | |
| Total | 2.87 | 2.51 | 108 | |
| C/C | F | 4.37 | 3.32 | 13 |
| M | 4.94 | 2.70 | 13 | |
| Total | 4.65 | 2.98 | 26 | |
| Total | F | 2.96 | 2.50 | 165 |
| M | 2.67 | 2.54 | 82 | |
| Total | 2.87 | 2.51 | 247 | |
| Required administration amount (μg/kg) of analgesic in 24 hours after surgery |
<Correlation Between CREB1 Subtype Gene Polymorphism (rs10932200) and Pain Sensitivity>
A correlation between a cyclic AMP responsive element binding protein gene polymorphism and pain sensitivity was examined. Genomic DNA was extracted from the blood of 247 patients undergoing surgery (orthognathic surgery), and one gene polymorphism (rs10932200) in the CREB1 subtype gene was determined. Then, a correlation between these results of determination of the gene polymorphism and the measurement of pain perception latency due to finger immersion in ice water before the surgery was analyzed.
As a result, as shown in the following Table 22 and FIG. 10, in the case of patients who had a minor allele (C) of the CREB1 subtype gene polymorphism (rs10932200) and underwent the surgery, the measurement result (logarithmic transformation) of pain perception latency was statistically significantly low in correlation with the number of alleles which they had. Accordingly, by analyzing the CREB1 subtype gene polymorphism (rs10932200), the sensitivity to pain can be predicted.
Using the median (15 sec) of the measurement results of pain perception latency due to finger immersion in ice water before the surgery as a reference, a patient group with a value smaller than the reference and a patient group with a value larger than the reference were defined as a “high pain sensitivity group” and a “low pain sensitivity group,” respectively, and the groups were then stratified in terms of the rs10932200 polymorphism of the CREB1 gene. As a result, in terms of this polymorphism, 45% and 55% of patients were determined to belong to the high pain sensitivity group and the low pain sensitivity group, respectively, in the A/A patient group. In contrast, in the A/C or C/C patient group, 55% and 45% of patients were determined to belong to the high pain sensitivity group and the low pain sensitivity group, respectively.
| TABLE 22 |
| Effect of CREB1 rs10932200 polymorphism on |
| measurement results of pain sensitivity before surgery in |
| patients treated with analgesic in surgery (orthognathic surgery) |
| (descriptive statistics by gender) |
| Number of test | ||||
| CREB1 | Average | subjects | ||
| rs10932200 | Gender | | Standard deviation | (subjects) |
| A/A | F | 20.95 | 18.21 | 76 |
| M | 27.96 | 32.07 | 36 | |
| Total | 23.20 | 23.65 | 112 | |
| A/C | F | 17.83 | 15.13 | 75 |
| M | 21.91 | 17.12 | 33 | |
| Total | 19.07 | 15.80 | 108 | |
| C/C | F | 12.07 | 8.03 | 14 |
| M | 17.73 | 9.86 | 13 | |
| Total | 14.80 | 9.24 | 27 | |
| Total | F | 18.78 | 16.33 | 165 |
| M | 23.90 | 24.28 | 82 | |
| Total | 20.48 | 19.43 | 247 | |
| Measurement (sec) of pain perception latency due to finger immersion in ice water before surgery |
<Correlation Between CREB1 Subtype Gene Polymorphism (rs10932200) and Pain Sensitivity>
A correlation between a cyclic AMP responsive element binding protein gene polymorphism and pain sensitivity was examined. Genomic DNA was extracted from the blood of 247 patients undergoing surgery (orthognathic surgery), and one gene polymorphism (rs10932200) in the CREB1 subtype gene was determined. Then, a correlation between these results of determination of the gene polymorphism and the measurement of the scale of the intensity of pain (VAS: on visual analogue scale) 24 hours after the surgery was analyzed.
As a result, as shown in the following Table 23 and FIG. 11, in correlation with the measurement result (logarithmic transformation) of the scale of the intensity of pain (VAS) 24 hours after the surgery, patients who had a minor allele (T) of the CREB1 subtype gene polymorphism (rs10932200) and underwent the surgery had a value of VAS (logarithmic transformation) that was statistically significantly high in correlation with the number of alleles which they had. Accordingly, by analyzing the CREB1 subtype gene polymorphism (rs10932200), the sensitivity to pain or analgesic after the surgery can be more easily predicted.
Using the median (24 mm) of the VAS values 24 hours after the surgery as a reference, a patient group with a value smaller than the reference and a patient group with a value larger than the reference were defined as a “low pain sensitivity group” and a “high pain sensitivity group,” respectively, and the groups were then stratified in terms of the rs10932200 polymorphism of the CREB1 gene. As a result, in terms of this polymorphism, 54% and 46% of patients were determined to belong to the low pain sensitivity group and the high pain sensitivity group, respectively, in the A/A patient group. In contrast, in the A/C or C/C patient group, 47% and 53% of patients were determined to belong to the low pain sensitivity group and the high pain sensitivity group, respectively.
| TABLE 23 |
| Effect of CREB1 rs10932200 polymorphism on measurement results |
| of VAS (intensity of pain on visual analogue scale) after surgery |
| in patients administered with analgesic in surgery (orthognathic surgery) |
| (descriptive statistics by gender) |
| Number of test | ||||
| Standard | subjects | |||
| CREB1 rs10932200 | Gender | Average | deviation | (subjects) |
| A/A | F | 24.17 | 19.35 | 77 |
| M | 21.94 | 18.59 | 36 | |
| Total | 23.46 | 19.06 | 113 | |
| A/C | F | 28.51 | 24.49 | 75 |
| M | 26.33 | 20.06 | 33 | |
| Total | 27.84 | 23.15 | 108 | |
| C/C | F | 37.31 | 17.78 | 13 |
| M | 34.31 | 21.78 | 13 | |
| Total | 35.81 | 19.54 | 26 | |
| Total | F | 27.18 | 21.92 | 165 |
| M | 25.67 | 19.92 | 82 | |
| Total | 26.68 | 21.25 | 247 | |
| Measurement (mm) of scale of intensity of pain by VAS after surgery |
<Correlation Between ATF2 Subtype Gene Polymorphism (rs7583431) and Analgesic Effect of Fentanyl>
A correlation between a cyclic AMP responsive element binding protein gene polymorphism and pain sensitivity was examined. Genomic DNA was extracted from the blood of 247 patients undergoing surgery (orthognathic surgery), and one gene polymorphism (rs7583431) in the ATF2 subtype gene was determined. Then, a correlation between these results of determination of the gene polymorphism and the analgesic effect of fentanyl that was evaluated based on the measurement of a difference in threshold of pain perception latency due to finger immersion in ice water after administration of an analgesic before the surgery was analyzed.
As a result, as shown in the following Table 24 and FIG. 12, in correlation with the measurement result (logarithmic transformation) of a difference in threshold of pain perception latency due to finger immersion in ice water before the surgery, patients who had a minor allele (C) of the ATF2 subtype gene polymorphism (rs7583431) and underwent the surgery had a difference in threshold of pain perception latency (logarithmic transformation) due to finger immersion in ice water before the surgery that was statistically significantly low in correlation with the number of alleles which they had. Accordingly, by analyzing the ATF2 subtype gene polymorphism (rs7583431), the sensitivity to analgesic before surgery can be more easily predicted.
Using the median (13 sec) of the measurement results of a difference in threshold of pain perception due to finger immersion in ice water before the surgery as a reference, a patient group with a value smaller than the reference and a patient group with a value larger than the reference were defined as a “low analgesic sensitivity group” and a “high analgesic sensitivity group,” respectively, and the groups were then stratified in terms of the rs7583431 polymorphism of the ATF2 gene. As a result, in terms of this polymorphism, 40% and 60% of patients were determined to belong to the low analgesic sensitivity group and the high analgesic sensitivity group, respectively, in the A/A patient group. In contrast, in the C/C patient group, 71% and 29% of patients were determined to belong to the low analgesic sensitivity group and the high analgesic sensitivity group, respectively.
| TABLE 24 |
| Effect of ATF2 rs7583431 polymorphism on measurement results of |
| difference in threshold of pain sensitivity before surgery in patients |
| treated with analgesic in surgery (orthognathic surgery) |
| (descriptive statistics by gender) |
| Number of test | ||||
| ATF2 | subjects | |||
| rs7583431 | Gender | Average | Standard deviation | (subjects) |
| A/A | F | 26.69 | 32.69 | 64 |
| M | 34.78 | 36.28 | 32 | |
| Total | 29.39 | 33.96 | 96 | |
| A/C | F | 26.97 | 36.11 | 76 |
| M | 28.73 | 42.97 | 44 | |
| Total | 27.62 | 38.60 | 120 | |
| C/C | F | 14.24 | 25.36 | 25 |
| M | 12.00 | 19.07 | 6 | |
| Total | 13.81 | 24.00 | 31 | |
| Total | F | 24.93 | 33.49 | 165 |
| M | 29.87 | 39.24 | 82 | |
| Total | 26.57 | 35.50 | 247 | |
| Measurement (sec) of difference in threshold of pain perception latency due to finger immersion in ice water before surgery |
In the same manner as Examples 2 to 5 above, a correlation between each gene polymorphism of the cyclic AMP responsive element binding protein gene, and each of the required administration amount of analgesic, pain sensitivity, and the analgesic effect of fentanyl was examined. Genomic DNA was extracted from the blood of 355 patients undergoing surgery (orthognathic surgery), and gene polymorphisms in the CREB1, CREB3, CREB5 and ATF2 subtype genes (Tag SNPs in linkage disequilibrium blocks and individual SNPs outside of the linkage disequilibrium blocks) were determined. Then, a correlation between these results of determination of the gene polymorphisms, and each of the required administration amount of analgesic in 24 hours after the surgery, pain sensitivity before the surgery, pain sensitivity (VAS) 24 hours after the surgery and before the surgery, and the analgesic effect of fentanyl, was analyzed.
Incidentally, as the analgesic, fentanyl, which is mainly administered intravenously through a PCA (patient-controlled analgesia) pump, was used.
As a result, the gene polymorphisms of the CREB1, CREB3, CREB5 and ATF2 subtype genes showed a statistically significant correlation with any phenotype of the required administration amount of analgesic in 24 hours after the surgery, pain sensitivity before the surgery, pain sensitivity (VAS) 24 hours after the surgery and before the surgery, and the analgesic effect of fentanyl. Accordingly, by analyzing these gene polymorphisms, the sensitivity to analgesic, pain sensitivity, and the analgesic effect of fentanyl can be predicted.
The results of the present example, as well as the results of Examples 2 to 5, are collectively shown in the following Table 25.
| TABLE 25 |
| Tag SNPs in linkage disequilibrium (LD) blocks and SNPs outside of LD blocks found to have significant association with phenotypes |
| Gene | Chromosome | Minor allele | Statistics |
| region | No. | LD block No. | Tag SNP | Position | frequency | Phenotype | N | BETA | SE | R2 | P |
| CREB1 | 2 | 1 | rs16839837 | 208079256 | 0.232 | Required amount of fentanyl | 247 | −0.1347 | 0.06718 | 0.01613 | 0.04613 |
| administered in 24 hours after | |||||||||||
| surgery | |||||||||||
| CREB1 | 2 | 1 | rs2360969 | 208081241 | 0.126 | Required amount of fentanyl | 353 | 0.1453 | 0.07182 | 0.01153 | 0.04377 |
| administered in 24 hours after | |||||||||||
| surgery | |||||||||||
| CREB1 | 2 | 1 | rs10932200 | 208095930 | 0.315 | Required amount of fentanyl | 247 | 0.2211 | 0.0597 | 0.05301 | 0.000263 |
| administered in 24 hours after | |||||||||||
| surgery | |||||||||||
| CREB1 | 2 | 1 | rs10932200 | 208095930 | 0.315 | VAS 24 hours after surgery | 247 | 0.3084 | 0.1305 | 0.02228 | 0.01891 |
| CREB1 | 2 | 1 | rs10932200 | 208095930 | 0.315 | pain perception latency before | 247 | −0.14 | 0.06043 | 0.02145 | 0.02129 |
| surgery | |||||||||||
| CREB1 | 2 | 1 | rs4234080 | 208197346 | 0.193 | Required amount of fentanyl | 247 | −0.2078 | 0.07133 | 0.03348 | 0.003906 |
| administered in 24 hours after | |||||||||||
| surgery | |||||||||||
| CREB3 | 9 | 1 | rs2145925 | 35679373 | 0.39 | Required amount of fentanyl | 246 | −0.1258 | 0.05884 | 0.01838 | 0.03358 |
| administered in 24 hours after | |||||||||||
| surgery | |||||||||||
| CREB3 | 9 | 1 | rs2025126 | 35686625 | 0.366 | Required amount of fentanyl | 247 | −0.1281 | 0.06011 | 0.01821 | 0.03402 |
| administered in 24 hours after | |||||||||||
| surgery | |||||||||||
| CREB3 | 9 | 2 | rs4878628 | 35756561 | 0.134 | VAS 24 hours after surgery | 253 | −0.4888 | 0.1739 | 0.0305 | 0.005343 |
| CREB5 | 7 | 1 | rs4722778 | 28278588 | 0.256 | Required amount of fentanyl | 126 | −0.2062 | 0.09913 | 0.03371 | 0.03961 |
| administered in 24 hours after | |||||||||||
| surgery | |||||||||||
| CREB5 | 7 | — | rs2175738 | 28304605 | 0.161 | Required amount of fentanyl | 126 | −0.3309 | 0.1141 | 0.06356 | 0.0044 |
| administered in 24 hours after | |||||||||||
| surgery | |||||||||||
| CREB5 | 7 | — | rs2175738 | 28304605 | 0.161 | VAS 24 hours after surgery | 126 | −0.5459 | 0.2322 | 0.04267 | 0.0203 |
| CREB5 | 7 | — | rs17156579 | 28327642 | 0.055 | Required amount of fentanyl | 253 | −0.306 | 0.1293 | 0.02184 | 0.01868 |
| administered in 24 hours after | |||||||||||
| surgery | |||||||||||
| CREB5 | 7 | — | rs17156603 | 28348671 | 0.398 | pain perception latency before | 253 | −0.1105 | 0.05533 | 0.01564 | 0.04692 |
| surgery | |||||||||||
| CREB5 | 7 | — | rs17642145 | 28355789 | 0.008 | pain perception latency before | 247 | −0.7505 | 0.319 | 0.02209 | 0.01943 |
| surgery | |||||||||||
| CREB5 | 7 | 5 | rs4722785 | 28356666 | 0.488 | Required amount of fentanyl | 253 | −0.1142 | 0.05564 | 0.01651 | 0.04114 |
| administered in 24 hours after | |||||||||||
| surgery | |||||||||||
| CREB5 | 7 | 6 | rs16874525 | 28357707 | 0.461 | VAS 24 hours after surgery | 252 | 0.2455 | 0.121 | 0.01621 | 0.04345 |
| CREB5 | 7 | 10 | rs17156649 | 28386945 | 0.079 | Analgesic effect of fentanyl | 247 | −0.6983 | 0.2917 | 0.02285 | 0.01743 |
| before surgery | |||||||||||
| CREB5 | 7 | — | rs7794304 | 28394916 | 0.457 | pain perception latency before | 354 | −0.1154 | 0.05005 | 0.01487 | 0.02175 |
| surgery | |||||||||||
| CREB5 | 7 | 12 | rs1029897 | 28400928 | 0.409 | pain perception latency before | 353 | −0.09985 | 0.04979 | 0.01133 | 0.04568 |
| surgery | |||||||||||
| CREB5 | 7 | — | rs4722793 | 28404054 | 0.405 | pain perception latency before | 252 | −0.1225 | 0.05698 | 0.01817 | 0.03246 |
| surgery | |||||||||||
| CREB5 | 7 | 13 | rs10233653 | 28406845 | 0.421 | pain perception latency before | 354 | −0.119 | 0.05004 | 0.0158 | 0.01796 |
| surgery | |||||||||||
| CREB5 | 7 | 13 | rs6955105 | 28409814 | 0.465 | pain perception latency before | 354 | −0.1222 | 0.0481 | 0.01802 | 0.01147 |
| surgery | |||||||||||
| CREB5 | 7 | — | rs17156685 | 28431959 | 0.087 | pain perception latency before | 247 | −0.2359 | 0.1053 | 0.02007 | 0.02598 |
| surgery | |||||||||||
| CREB5 | 7 | — | rs17156694 | 28451480 | 0.441 | pain perception latency before | 253 | −0.1379 | 0.05492 | 0.02449 | 0.0127 |
| surgery | |||||||||||
| CREB5 | 7 | 15 | rs177572 | 28460820 | 0.331 | pain perception latency before | 253 | 0.1454 | 0.06446 | 0.01988 | 0.02492 |
| surgery | |||||||||||
| CREB5 | 7 | — | rs177574 | 28461566 | 0.047 | Analgesic effect of fentanyl | 247 | 0.7803 | 0.3685 | 0.01798 | 0.03521 |
| before surgery | |||||||||||
| CREB5 | 7 | — | rs177576 | 28463632 | 0.327 | Analgesic effect of fentanyl | 247 | 0.4179 | 0.1582 | 0.02771 | 0.008764 |
| before surgery | |||||||||||
| CREB5 | 7 | — | rs13437706 | 28465016 | 0.374 | Analgesic effect of fentanyl | 253 | 0.3854 | 0.1501 | 0.02559 | 0.01083 |
| before surgery | |||||||||||
| CREB5 | 7 | 16 | rs177580 | 28465195 | 0.382 | Analgesic effect of fentanyl | 253 | −0.3177 | 0.1503 | 0.01749 | 0.03554 |
| before surgery | |||||||||||
| CREB5 | 7 | 16 | rs12666636 | 28465748 | 0.224 | VAS 24 hours after surgery | 354 | −0.2569 | 0.1182 | 0.01325 | 0.03036 |
| CREB5 | 7 | — | rs216715 | 28539407 | 0.287 | VAS 24 hours after surgery | 354 | −0.2213 | 0.1069 | 0.01202 | 0.03923 |
| CREB5 | 7 | — | rs10951197 | 28540048 | 0.39 | VAS 24 hours after surgery | 253 | −0.248 | 0.1181 | 0.01726 | 0.03676 |
| CREB5 | 7 | — | rs160335 | 28554342 | 0.496 | VAS 24 hours after surgery | 247 | 0.2437 | 0.122 | 0.01602 | 0.04693 |
| CREB5 | 7 | 25 | rs310353 | 28603649 | 0.299 | VAS 24 hours after surgery | 247 | −0.2846 | 0.1258 | 0.02047 | 0.02451 |
| CREB5 | 7 | — | rs310359 | 28606311 | 0.217 | Required amount of fentanyl | 126 | 0.2233 | 0.1071 | 0.0339 | 0.03904 |
| administered in 24 hours after | |||||||||||
| surgery | |||||||||||
| CREB5 | 7 | 26 | rs1637457 | 28615963 | 0.22 | pain perception latency before | 253 | −0.1327 | 0.06564 | 0.01603 | 0.04422 |
| surgery | |||||||||||
| CREB5 | 7 | — | rs41348 | 28683373 | 0.386 | pain perception latency before | 354 | −0.1254 | 0.04985 | 0.01765 | 0.01235 |
| surgery | |||||||||||
| CREB5 | 7 | — | rs886816 | 28689932 | 0.181 | Required amount of fentanyl | 354 | 0.1596 | 0.06074 | 0.01924 | 0.008961 |
| administered in 24 hours after | |||||||||||
| surgery | |||||||||||
| CREB5 | 7 | 32 | rs17157048 | 28703823 | 0.087 | Required amount of fentanyl | 354 | −0.2175 | 0.09867 | 0.01361 | 0.02816 |
| administered in 24 hours after | |||||||||||
| surgery | |||||||||||
| CREB5 | 7 | 32 | rs10951201 | 28711867 | 0.154 | Required amount of fentanyl | 354 | −0.2078 | 0.07776 | 0.01988 | 0.007896 |
| administered in 24 hours after | |||||||||||
| surgery | |||||||||||
| CREB5 | 7 | 32 | rs10265166 | 28713821 | 0.043 | Analgesic effect of fentanyl | 253 | 0.9373 | 0.4605 | 0.01624 | 0.04285 |
| before surgery | |||||||||||
| CREB5 | 7 | 32 | rs6972081 | 28715571 | 0.287 | pain perception latency before | 354 | −0.1289 | 0.05762 | 0.01402 | 0.02588 |
| surgery | |||||||||||
| CREB5 | 7 | 33 | rs6462100 | 28720620 | 0.134 | Required amount of fentanyl | 354 | −0.2022 | 0.08 | 0.01782 | 0.01194 |
| administered in 24 hours after | |||||||||||
| surgery | |||||||||||
| CREB5 | 7 | — | rs2066979 | 28730634 | 0.276 | pain perception latency before | 250 | −0.1395 | 0.06557 | 0.01792 | 0.0344 |
| surgery | |||||||||||
| CREB5 | 7 | — | rs10486591 | 28733403 | 0.272 | pain perception latency before | 354 | −0.1231 | 0.05973 | 0.01192 | 0.04007 |
| surgery | |||||||||||
| CREB5 | 7 | 35 | rs721993 | 28745985 | 0.154 | Required amount of fentanyl | 354 | −0.1698 | 0.07741 | 0.01348 | 0.02898 |
| administered in 24 hours after | |||||||||||
| surgery | |||||||||||
| CREB5 | 7 | 40 | rs3735566 | 28831314 | 0.039 | Required amount of fentanyl | 247 | −0.2901 | 0.1445 | 0.01618 | 0.04582 |
| administered in 24 hours after | |||||||||||
| surgery | |||||||||||
| ATF2 | 2 | 1 | rs1153702 | 175629003 | 0.476 | Analgesic effect of fentanyl | 354 | 0.2496 | 0.1214 | 0.01188 | 0.04044 |
| before surgery | |||||||||||
| ATF2 | 2 | 1 | rs7583431 | 175630628 | 0.366 | Analgesic effect of fentanyl | 247 | −0.5442 | 0.1582 | 0.04606 | 0.000685 |
| before surgery | |||||||||||
| ATF2 | 2 | — | rs1153699 | 175631032 | 0.472 | Analgesic effect of fentanyl | 247 | 0.3865 | 0.1524 | 0.02558 | 0.01184 |
| before surgery | |||||||||||
| ATF2 | 2 | — | rs1153699 | 175631032 | 0.472 | pain perception latency before | 247 | 0.1173 | 0.0577 | 0.01659 | 0.04312 |
| surgery | |||||||||||
| ATF2 | 2 | 2 | rs268214 | 175741461 | 0.189 | Analgesic effect of fentanyl | 247 | 0.4065 | 0.1863 | 0.01907 | 0.03004 |
| before surgery | |||||||||||
<Correlation Between CREB1 Subtype Gene Polymorphism (rs2952768) and Required Administration Amount of Analgesic>
A correlation between a cyclic AMP responsive element binding protein gene polymorphism and the required administration amount of analgesic was examined. Genomic DNA was extracted from the blood of 354 patients undergoing surgery (orthognathic surgery), and one gene polymorphism (rs2952768) in the CREB1 subtype gene was determined. Then, a correlation between these results of determination of the gene polymorphism and the required administration amount of analgesic after the surgery was analyzed.
Incidentally, as the analgesic, fentanyl, which is mainly administered intravenously through a PCA (patient-controlled analgesia) pump, was used.
As a result, as shown in the following Table 26 and FIG. 13, in the case of patients who had a minor allele (C) of the CREB1 subtype gene polymorphism (rs2952768) and underwent the surgery, the required administration amount (logarithmic transformation) of analgesic after the surgery was statistically significantly high in correlation with the number of alleles which they had. Accordingly, by analyzing the CREB1 subtype gene polymorphism (rs2952768), the sensitivity to analgesic can be predicted.
Using the median (2.268 (μg/kg)) of the required administration amount of fentanyl in 24 hours after the surgery as a reference, a patient group with a value smaller than the reference and a patient group with a value larger than the reference were defined as a “high analgesic sensitivity group” and a “low analgesic sensitivity group,” respectively, and the groups were then stratified in terms of the rs2952768 polymorphism of the CREB1 gene. As a result, in terms of this polymorphism, 53% and 47% of patients were determined to belong to the high analgesic sensitivity group and the low analgesic sensitivity group, respectively, in the T/T or T/C patient group. In contrast, in the C/C patient group, 22% and 78% of patients were determined to belong to the high analgesic sensitivity group and the low analgesic sensitivity group, respectively.
| TABLE 26 |
| Effect of CREB1 rs2952768 polymorphism on required amount |
| of analgesic administered in 24 hours after surgery in patients |
| treated with analgesic in surgery (orthognathic surgery) |
| (descriptive statistics by gender) |
| Number of test | ||||
| CREB1 | subjects | |||
| rs2952768 | Gender | Average | Standard deviation | (subjects) |
| T/T | F | 2.78 | 2.43 | 101 |
| M | 2.38 | 2.46 | 58 | |
| Total | 2.64 | 2.44 | 159 | |
| T/C | F | 2.99 | 2.42 | 108 |
| M | 2.38 | 2.50 | 52 | |
| Total | 2.79 | 2.46 | 160 | |
| C/C | F | 4.80 | 3.05 | 20 |
| M | 5.08 | 2.55 | 15 | |
| Total | 4.92 | 2.81 | 35 | |
| Total | F | 3.05 | 2.53 | 229 |
| M | 2.71 | 2.62 | 125 | |
| Total | 2.93 | 2.57 | 354 | |
| Required amount (μg/kg) of analgesic administered in 24 hours after surgery |
<Correlation Between CREB1 Subtype Gene Polymorphism (rs2952768) and Required Administration Amount of Analgesic>
A correlation between a cyclic AMP responsive element binding protein gene polymorphism and the required administration amount of analgesic was examined. Genomic DNA was extracted from the blood or the oral mucosa of 112 patients undergoing surgery (abdominal surgery), and one gene polymorphism (rs2952768) in the CREB1 subtype gene was determined. Then, a correlation between these results of determination of the gene polymorphism and the required administration amount of analgesic after the surgery was analyzed.
Incidentally, as the analgesic, analgesics such as pentazocine and pethidine, which are mainly administered intravenously, buprenorphine, diclofenac and indomethacin, which are mainly administered as a suppository, flurbiprofen axetil, which is injected by intravenous infusion, as well as epidural morphine and marcain were used.
Incidentally, the total amount of each analgesic in terms of fentanyl means the total amount of analgesic (mg) in the case where the amount of each administered analgesic is converted to a value corresponding to the potency equivalent to fentanyl. The conversion of the amount of each analgesic to a value corresponding to the potency of fentanyl was carried out by setting a potency equivalent to 0.3 mg of fentanyl at 90 mg of pentazocine, 360 mg in the case of pethidine (Opystan), 1 mg in the case of buprenorphine (Lepetan), 300 mg in the case of diclofenac (Voltaren), 300 mg in the case of flurbiprofen axetil (Ropion), and 6 mg in the case of epidural morphine.
As a result, as shown in the following Table 27 and FIG. 14, in the case of patients who did not have a major allele (T) of the CREB1 subtype gene polymorphism (rs2952768) and underwent the surgery, the required administration amount (logarithmic transformation) of analgesic after the surgery was statistically significantly higher compared with patients having the aforementioned allele (T). Accordingly, by analyzing the CREB1 subtype gene polymorphism (rs2952768), the sensitivity to each analgesic can be predicted.
Using the median (2.453 (μg/kg)) of the required total administration amount of each analgesic in terms of fentanyl in 24 hours after the surgery as a reference, a patient group with a value smaller than the reference and a patient group with a value larger than the reference were defined as a “high analgesic sensitivity group” and a “low analgesic sensitivity group,” respectively, and the groups were then stratified in terms of the rs2952768 polymorphism of the CREB1 gene. As a result, in terms of this polymorphism, 52% and 48% of patients were determined to belong to the high analgesic sensitivity group and the low analgesic sensitivity group, respectively, in the T/T or T/C patient group. In contrast, in the C/C patient group, 33% and 67% of patients were determined to belong to the high analgesic sensitivity group and the low analgesic sensitivity group, respectively.
| TABLE 27 |
| Effect of CREB1 rs2952768 polymorphism on required amount |
| of analgesic administered in 24 hours after surgery in patients |
| treated with analgesic in surgery (abdominal surgery) |
| (descriptive statistics by gender) |
| Number of test | ||||
| CREB1 | subjects | |||
| rs2952768 | Gender | Average | Standard deviation | (subjects) |
| T/T | F | 0.93 | 1.35 | 18 |
| M | 0.43 | 0.63 | 26 | |
| Total | 0.63 | 1.01 | 44 | |
| T/C | F | 0.67 | 1.32 | 28 |
| M | 0.78 | 1.01 | 28 | |
| Total | 0.72 | 1.17 | 56 | |
| C/C | F | 1.12 | 1.34 | 6 |
| M | 1.78 | 1.61 | 6 | |
| Total | 1.45 | 1.45 | 12 | |
| Total | F | 0.81 | 1.32 | 52 |
| M | 0.73 | 1.00 | 60 | |
| Total | 0.77 | 1.15 | 112 | |
| Required total amount (μg/kg) of analgesic administered in terms of fentanyl in 24 hours after surgery |
<Correlation Between CREB1 Subtype Gene Polymorphism (rs2952768) and Severity of Drug Dependence in Methamphetamine-Dependent Patients>
A correlation between a cyclic AMP responsive element binding protein gene polymorphism and vulnerability to drug dependence associated with the severity of drug dependence was examined. Genomic DNA was extracted from the blood of 194 methamphetamine-dependent patients, and one gene polymorphism (rs2952768) in the CREB1 subtype gene was determined. The patients were classified based on the presence or absence of the abuse of many drugs, and a comparison was made among them. The results are shown in the following Table 28. Here, the methamphetamine-dependent patients were classified into two groups, namely, a patient group involving the abuse of drugs other than stimulants (two or more types) and a patient group involving the abuse of a single drug (only one type).
As a result, as is clear from the following Table 28, a significant difference in genotype frequency was observed in terms of the gene polymorphism (rs2952768), and in methamphetamine-dependent patients having a major allele (T), the number of patients who abused many drugs was statistically significantly higher compared with patient who did not have the aforementioned allele T.
From the above results, it was demonstrated that drug sensitivity associated with the severity of stimulant dependence can be easily predicted by determining genotype frequency in the cyclic AMP responsive element binding protein gene polymorphism.
| TABLE 28 |
| Comparison of genotype and allele frequencies in rs2952768 polymorphism in methamphetamine-dependent patients |
| classified based on presence or absence of abuse of many drugs |
| Gene polymorphism name: CREB1 rs2952768 |
| (Number of samples) | Genotype frequency (%) | Allele frequency | |
| Sample name | Abuse of many drugs | T/T T/C C/C | T C |
| Methamphetamine- dependent patients | No (53) Yes (141) | 19 22 12 ( 35.8 % ) ( 41.5 % ) ( 22.6 % ) 58 67 16 ) ( P = 0.137 ; genotype ) ( P = 0.503 ; dominant model ) * ( P = 0.046 ; recessive model ) ( 41.1 % ) ( 47.5 % ) ( 11.3 % ) | 0.556 0.444 0.644 0.356 ) ( P = 0.133 ; allele ) |
| Each model indicates hereditary mode regarding minor allele (C); | |||
| *. P < 0.05. |
<Correlation Between CREB1 Subtype Gene Polymorphism (rs2952768) and Severity of Drug Dependence in Alcohol-Dependent Patients>
A correlation between a cyclic AMP responsive element binding protein gene polymorphism and vulnerability to drug dependence associated with the severity of drug dependence was examined. Genomic DNA was extracted from the blood of 436 alcohol-dependent patients, and one gene polymorphism (rs2952768) in the CREB1 subtype gene was determined. The patients were classified based on the presence or absence of drug abuse, and a comparison was made among them. The results are shown in the following Table 29. Here, the alcohol-dependent patients were classified into two groups, namely, a patient group with drug abuse (one or more types) and a patient group without drug abuse (only alcohol ingestion).
As a result, as is clear from the following Table 29, a significant difference in genotype and allele frequencies was observed in terms of the gene polymorphism (rs2952768), and it was demonstrated that the frequency of major allele (T) was statistically significantly higher in the patient group with drug abuse than in the patient group without drug abuse.
From the above results, it was demonstrated that vulnerability to drug dependence associated with the severity of drug dependence can be easily predicted by determining genotype and allele frequencies in the cyclic AMP responsive element binding protein gene polymorphism.
| TABLE 29 |
| Comparison of genotype and allele frequencies in rs2952768 polymorphism in alcohol-dependent patients |
| classified based on presence or absence of drug abuse |
| Gene polymorphism name: CREB1 rs2952768 |
| (Number of samples) | Genotype frequency (%) | Allele frequency | |
| Sample name | Drug abuse | T/T T/C C/C | T C |
| Alcohol- dependent patients | No (391) Yes (45) | 172 166 53 ( 44.0 % ) ( 42.5 % ) ( 13.6 % ) 25 18 2 ) ( P = 0.142 ; genotype ) ( P = 0.140 ; dominant model ) † ( P = 0.097 ; recessive model ) ( 55.6 % ) ( 40.0 % ) ( 4.4 % ) | 0.652 0.348 0.756 0.244 ) * ( P = 0.049 ; allele ) |
| Each model indicates hereditary mode regarding minor allele (C); | |||
| *. P < 0.05. | |||
| †. 0.05 ≦ P < 0.1. |
<Correlation Between CREB1 Subtype Gene Polymorphism (rs2952768) and Severity of Drug Dependence in Eating Disorder Patients>
A correlation between a cyclic AMP responsive element binding protein gene polymorphism and vulnerability to drug dependence associated with the severity of drug dependence was examined. Genomic DNA was extracted from the blood of 221 patients with eating disorder, and one gene polymorphism (rs2952768) in the CREB1 subtype gene was determined. The patients were classified based on the presence or absence of drug dependence, and a comparison was made among them. The results are shown in the following Table 30. Here, the eating disorder patients were classified into two groups, namely, a patient group with a complication of drug dependence and a patient group without a complication of drug dependence.
As a result, as is clear from the following Table 30, a significant difference in genotype and allele frequencies was observed in terms of the gene polymorphism (rs2952768), and it was demonstrated that the frequency of major allele (T) was statistically significantly higher in the patient group with a complication of drug dependence than in the patient group without a complication of drug dependence.
From the above results, it was demonstrated that vulnerability to drug dependence associated with the severity of drug dependence can be easily predicted by determining genotype and allele frequencies in the cyclic AMP responsive element binding protein gene polymorphism.
| TABLE 30 |
| Comparison of genotype and allele frequencies in rs2952768 polymorphism in patients with eating disorder |
| classified based on presence or absence of complication of drug dependence |
| Gene polymorphism name: CREB1 rs2952768 |
| (Number of samples) | Genotype frequency (%) | Allele frequency | |
| Sample name | Complication of drug | T/T T/C C/C | T C |
| Eating disorder patients | No (200) Yes (21) | 85 93 22 ( 42.5 % ) ( 46.5 % ) ( 11.0 % ) 14 6 1 ) ( P = 0.103 ; genotype ) * ( P = 0.034 ; dominant model ) ( P = 0.705 ; recessive model ) ( 66.7 % ) ( 28.6 % ) ( 4.8 % ) | 0.658 0.343 0.810 0.190 ) * ( P = 0.046 ; allele ) |
| Each model indicates hereditary mode regarding minor allele (C); | |||
| *. P < 0.05. |
<Correlation Between CREB1 Subtype Gene Polymorphism (rs2952768) and Severity of Substance Dependence in Eating Disorder Patients>
A correlation between a cyclic AMP responsive element binding protein gene polymorphism and vulnerability to substance (alcohol) dependence associated with the severity of substance (alcohol) dependence was examined. Genomic DNA was extracted from the blood of 221 patients with eating disorder, and one gene polymorphism (rs2952768) in the CREB1 subtype gene was determined. The patients were classified based on the presence or absence of alcohol dependence, and a comparison was made among them. The results are shown in the following Table 31. Here, the eating disorder patients were classified into two groups, namely, a patient group with a complication of alcohol dependence and a patient group without a complication of alcohol dependence.
As a result, as is clear from the following Table 31, a significant difference in genotype and allele frequencies was observed in terms of the gene polymorphism (rs2952768), and it was demonstrated that the frequency of major allele (T) was statistically significantly higher in the patient group with a complication of alcohol dependence than in the patient group without a complication of alcohol dependence.
From the above results, it was demonstrated that vulnerability to substance (alcohol) dependence associated with the severity of substance (alcohol) dependence can be easily predicted by determining genotype and allele frequencies in the cyclic AMP responsive element binding protein gene polymorphism.
| TABLE 31 |
| Comparison of genotype and allele frequencies in rs2952768 polymorphism in patients with eating disorder |
| classified based on presence or absence of complication of alcohol dependence |
| Gene polymorphism name: CREB1 rs2952768 |
| (Number of samples) | Genotype frequency (%) | Allele frequency | |
| Sample name | Complication of alcohol | T/T T/C C/C | T C |
| Eating disorder patients | No (151) Yes (70) | 61 72 18 ( 40.4 % ) ( 47.7 % ) ( 11.9 % ) 38 27 5 ) ( P = 0.136 ; genotype ) † ( P = 0.053 ; dominant model ) ( P = 0.279 ; recessive model ) ( 54.3 % ) ( 38.6 % ) ( 7.1 % ) | 0.642 0.358 0.736 0.264 ) † ( P = 0.052 ; allele ) |
| Each model indicates hereditary mode regarding minor allele (C); | |||
| †. 0.05 ≦ P < 0.1. |
<Correlation Between CREB1 Subtype Gene Polymorphism (rs2952768) and Reward Dependence>
A correlation between a cyclic AMP responsive element binding protein gene polymorphism and dependence-prone personality associated with reward dependence was examined. Genomic DNA was extracted from the oral mucosa of 495 healthy subjects, and one gene polymorphism (rs2952768) in the CREB1 subtype gene was determined. Then, a correlation between these results of determination of the gene polymorphism and dependence-prone personality was analyzed.
It is to be noted that, as a test of dependence-prone personality, a reward dependence (RD) score (average) in the Temperament and Character Inventory (TCI) was used.
As a result, as is shown in the following Table 32 and FIG. 15, healthy subjects having a minor allele (C) in the CREB1 subtype gene polymorphism (rs2952768) had an RD score (logarithmic transformation) that was statistically significantly low in correlation with the number of alleles which they had. Accordingly, by analyzing the CREB1 subtype gene polymorphism (rs2952768), dependence-prone personality can be predicted.
Using the median (0.667) of the RD score as a reference, a patient group with a value smaller than the reference and a patient group with a value larger than the reference were defined as a “low reward dependence group” and a “high reward dependence group,” respectively, and the groups were then stratified in terms of the rs2952768 polymorphism of the CREB1 gene. As a result, in terms of this polymorphism, 43% and 57% of healthy subjects were determined to belong to the low reward dependence group and the high reward dependence group, respectively, in the T/T patient group. In contrast, in the C/C patient group, 58% and 42% of healthy subjects were determined to belong to the low reward dependence group and the high reward dependence group, respectively.
From the above results, it was demonstrated that dependence-prone personality associated with reward dependence can be easily predicted by determining genotype and allele frequencies in the cyclic AMP responsive element binding protein gene polymorphism.
| TABLE 32 |
| Effect of CREB1 rs2952768 polymorphism on |
| reward dependence (RD) score (average) |
| (descriptive statistics by gender) |
| Number of test | ||||
| CREB1 | Average | subjects | ||
| rs2952768 | Gender | | Standard deviation | (subjects) |
| T/T | F | 0.72 | 0.18 | 98 |
| M | 0.66 | 0.18 | 122 | |
| Unknown | 0.60 | 0.09 | 2 | |
| Total | 0.68 | 0.18 | 222 | |
| T/C | F | 0.70 | 0.18 | 103 |
| M | 0.62 | 0.20 | 98 | |
| Unknown | 0.78 | 0.08 | 3 | |
| Total | 0.66 | 0.19 | 204 | |
| C/C | F | 0.68 | 0.22 | 37 |
| M | 0.58 | 0.18 | 32 | |
| Total | 0.63 | 0.21 | 69 | |
| F | 0.70 | 0.19 | 238 | |
| M | 0.63 | 0.19 | 252 | |
| Unknown | 0.71 | 0.12 | 5 | |
| Total | 0.67 | 0.19 | 495 | |
| Average in dimension of average score in each subscale |
<Correlation Between CREB1 Subtype Gene Polymorphism (rs2952768) and Expression Level of CREB1 Gene>
A correlation between a cyclic AMP responsive element binding protein gene polymorphism and a gene expression level was examined. Genomic DNA was extracted from the blood of 100 postmortem brain tissue donors at the Stanley Foundation Brain Bank, and one gene polymorphism (rs2952768) in the CREB1 subtype gene was determined. Then, a correlation between these results of determination of the gene polymorphism and a gene expression level was analyzed.
Incidentally, as the gene expression level, the value of the relative mRNA expression level of CREB1, which was standardized with the value of the mRNA expression level of a β-actin gene (ACTB), was used.
As a result, as shown in the following Table 33 and FIG. 16, in the case of subjects who did not have a major allele (T) of the CREB1 subtype gene polymorphism (rs2952768), the mRNA expression level (logarithmic transformation) of CREB1 was statistically significantly higher compared with subjects having the aforementioned allele (T). Accordingly, by analyzing the CREB1 subtype gene polymorphism (rs2952768), the gene expression level can be predicted.
Using the median (0.0145) of the relative mRNA expression level as a reference, a subject group with a value smaller than the reference and a subject group with a value larger than the reference were defined as a “low gene expression group” and a “high gene expression group,” respectively, and the groups were then stratified in terms of the rs2952768 polymorphism of the CREB1 gene. As a result, in terms of this polymorphism, 52% and 48% of subjects were determined to belong to the low gene expression group and the high gene expression group, respectively, in the T/T or T/C subject group. In contrast, in the C/C subject group, 30% and 70% of subjects were determined to belong to the low gene expression group and the high gene expression group, respectively.
From the above results, it was demonstrated that the tendency of the expression level of a CREB1 gene (whether the gene tends to be expressed at a high level or at a low level) can be easily predicted by determining genotype and allele frequencies in the cyclic AMP responsive element binding protein gene polymorphism.
| TABLE 33 |
| Effect of CREB1 rs2952768 polymorphism on gene expression level |
| in postmortem brain tissue donors at Stanley Foundation Brain Bank |
| (descriptive statistics) |
| Number of test | |||
| subjects | |||
| CREB1 rs2952768 | Average | Standard deviation | (subjects) |
| T/T | 0.015345 | 0.006618 | 48 |
| T/C | 0.015667 | 0.005267 | 42 |
| C/C | 0.023360 | 0.023537 | 10 |
| Total | 0.016282 | 0.009396 | 100 |
| Relative mRNA expression level value of CREB1 standardized with mRNA expression level value of β-actin gene (ACTB) |
According to the present invention, it becomes possible to provide: a gene polymorphism of a cyclic AMP responsive element binding protein gene or a haplotype constituted by the gene polymorphism, which can evaluate an individual difference in terms of drug sensitivity and disease vulnerability; a method for evaluating drug sensitivity and disease vulnerability using the gene polymorphism or the haplotype; and the like. According to this evaluation method, it becomes possible to readily know or predict a proper prescribed amount, a proper prescribed schedule associated with a narcotic drug such as morphine, and the like, and hence the method is extremely useful for personalized pain therapy, drug dependence therapy and the like.
1. A method for evaluating drug sensitivity, comprising associating a gene polymorphism of a cyclic AMP responsive element binding protein gene or a haplotype constituted by the gene polymorphism with an individual drug sensitivity.
2. The method according to claim 1, wherein a tendency in the presence or absence of an individual drug sensitivity is evaluated based on the results from the analysis of the gene polymorphism or the haplotype.
3. The method according to claim 1, comprising the following steps:
(1) a step of performing linkage disequilibrium analysis and haplotype analysis on a healthy subject and selecting gene polymorphisms in a linkage disequilibrium block;
(2) a step of analyzing the association between the genotypes of the gene polymorphisms and drug sensitivity in a test subject; and
(3) a step of using the gene polymorphism that has been significantly associated with drug sensitivity in the test subject for evaluation of the drug sensitivity.
4. A method for evaluating disease vulnerability, comprising associating a gene polymorphism of a cyclic AMP responsive element binding protein gene or a haplotype constituted by the gene polymorphism with an individual disease vulnerability.
5. The method according to claim 4, wherein a tendency in the presence or absence of an individual disease vulnerability is evaluated based on the results from the analysis of the gene polymorphism or the haplotype.
6. The method according to claim 4, comprising the following steps:
(1) a step of performing linkage disequilibrium analysis and haplotype analysis on a healthy subject and selecting gene polymorphisms in a linkage disequilibrium block;
(2) a step of comparing the frequency of gene polymorphisms in a test subject with the frequency of gene polymorphisms in the healthy subject; and
(3) a step of using the gene polymorphism that has a significant difference in the gene polymorphism frequency between the test subject and the healthy subject for evaluation of the disease vulnerability.
7. The method according to claim 4, wherein the disease vulnerability is pain sensitivity or vulnerability to substance dependence.
8. The method according to claim 1 or 4, wherein the gene polymorphism is at least one selected from the group consisting of a single nucleotide polymorphism, an insertion polymorphism, a deletion polymorphism, and a nucleotide repeat polymorphism.
9. The method according to claim 1 or 4, wherein the gene polymorphism is at least one selected from among: rs16839837, rs2360969, rs10932200, rs2253206, rs2551640, rs11904814, rs16839883, rs6740584, rs3770704, rs2254137, rs2551645, rs2551946, rs4234080, rs2952768, rs2709386, rs7591784, and rs7594560 of a CREB1 subtype gene; rs1243872, rs2145925, rs2025126, rs1885373, rs1885374, GA007473, rs2295794, rs4879926, GA007477, rs867194, rs11541908, rs741917, rs7862485, rs2756894, rs2249250, rs2295795, rs877365, rs2737273, rs2295797, rs2295798, rs1534847, rs7873822, rs2737274, rs10972567, rs3763630, rs10814274, rs3750434, rs1570246, GA025684, rs1570248, rs1570249, rs34478611, rs1322045, rs1951432, GA025687, rs10814275, rs10758320, rs4878628, rs10758321, and rs10758322 of a CREB3 subtype gene; rs4722778, rs177479, rs177480, rs11981754, rs177486, rs177498, rs2175738, rs17156579, rs17156603, rs17642145, rs10229500, rs10243659, rs4722785, rs16874503, rs11772815, rs6958133, rs16874525, rs17715174, rs6953524, rs10239810, rs17156649, rs1811248, rs887623, rs740988, rs7794304, rs6952227, rs42695, rs1029897, rs4722793, rs10233653, rs6955105, rs17156685, rs17156694, rs17156699, rs177572, rs177573, rs177574, rs177576, rs13437706, rs177580, rs177581, rs12666636, rs177584, rs177585, rs216715, rs10951197, rs160335, rs1008262, rs310353, rs310359, rs41273, rs1637457, rs17156919, rs41276, rs160375, rs917275, rs41348, rs886816, rs17157048, rs6462098, rs10951201, rs13311248, rs12540480, rs10265166, rs7798774, rs7799246, rs6972081, rs12533079, rs7806547, rs6462100, rs6979352, rs6950574, rs4722835, rs2066979, rs10486591, rs721993, rs2237351, rs3735566, rs11975539, rs6462107, rs2190306, rs4719955, and rs10228137 of a CREB5 subtype gene; and rs1153711, rs1153702, rs7583431, rs1153699, rs2302663, rs3845744, rs212349, rs212347, rs12693057, rs1153685, rs212360, rs212361, rs2072538, rs1205399, rs1153676, rs7566401, rs7578569, rs3755490, rs13388308, rs11888507, rs10497434, rs268214, rs166531, rs268228, rs268229, rs268230, rs268231, rs10497435, rs1982235, rs268237, rs13030474, and rs268174 of an ATF2 subtype gene.
10. The method according to claim 1 or 4, wherein the haplotype is at least one selected from the following table.
| TABLE 1 |
| Gene name CREB1 |
| Linkage disequilibrium block No. | |
| 1 | |
| Gene polymorphism name () |
| 1 | 2 | 3 | 12 | 13 | 17 | ||||||||||||
| Haplotype No. | Tag | Tag | Tag | 4 | 5 | 6 | 7 | 8 | 9 | 10 | 11 | Tag | Tag | 14 | 15 | 16 | Tag |
| H1 | C | C | C | A | G | G | G | T | C | C | C | C | C | C | A | A | T |
| H2 | C | C | A | G | A | T | A | C | T | A | T | C | C | T | G | G | T |
| H3 | C | T | C | A | G | G | A | T | T | C | C | C | C | C | A | A | T |
| H4 | T | C | A | G | A | T | A | C | T | A | T | C | A | T | G | G | C |
| H5 | C | C | A | G | A | T | A | C | T | A | T | A | C | C | A | A | T |
| H6 | T | C | A | G | A | T | A | C | T | A | T | C | C | T | G | G | T |
| H7 | T | C | A | G | A | T | A | C | T | A | T | C | A | T | G | G | T |
| . . . | Haplotypes which are estimated to occur at a frequency of less than 1% |
| () 1~17: (in this order)rs16839837, rs2360969, rs10932200, rs2253206, rs2551640, rs11904814, rs16839883, rs6740584, rs3770704, rs2254137, rs2551645, rs2551946, rs4234080, rs2952768, rs2709386, rs7591784 and rs7594560 |
| TABLE 2 |
| Gene name CREB3 |
| Linkage disequilibrium block No. | |
| 1 | |
| Gene polymorphism name () |
| 1 | 2 | 3 | 9 | 11 | ||||||||||||||||||||
| Haplotype No. | Tag | Tag | Tag | 4 | 5 | 6 | 7 | 8 | Tag | 10 | Tag | 12 | 13 | 14 | 15 | 16 | 17 | 18 | 19 | 20 | 21 | 22 | 23 | 24 |
| H1 | G | C | G | T | A | T | T | T | C | T | C | C | G | C | T | G | T | G | T | C | A | G | G | A |
| H2 | G | C | G | T | A | T | T | T | T | T | C | C | G | C | T | G | T | G | T | C | A | G | G | A |
| H3 | T | T | A | T | A | T | C | T | C | T | T | C | G | A | G | A | C | A | C | C | G | T | G | C |
| H4 | T | T | A | T | A | T | C | T | C | T | C | C | G | A | G | A | C | A | C | C | G | T | G | C |
| H5 | T | C | G | C | C | C | C | C | C | T | C | C | A | A | G | G | C | A | T | C | A | T | A | C |
| H6 | T | T | G | T | A | T | C | T | C | C | C | T | G | A | T | G | C | G | T | C | A | G | G | C |
| H7 | T | C | A | T | A | T | C | T | C | T | T | C | G | A | G | A | C | A | G | C | G | T | G | C |
| . . . | Haplotypes which are estimated to occur at a frequency of less than 1% |
| Linkage disequilibrium block No. | |
| 2 | |
| Gene polymorphism name () |
| 25 | 26 | 29 | 36 | 38 | 39 | |||||||||||
| Haplotype No. | Tag | Tag | 27 | 28 | Tag | 30 | 31 | 32 | 33 | 34 | 35 | Tag | 37 | Tag | Tag | 40 |
| H8 | C | C | G | G | G | C | G | G | G | A | T | A | C | C | G | C |
| H9 | C | T | A | T | G | T | A | G | A | G | A | A | T | C | A | T |
| H10 | T | C | G | G | C | T | G | A | A | G | A | A | T | C | G | C |
| H11 | C | T | A | G | G | T | A | G | A | G | A | A | T | C | G | T |
| H12 | C | C | G | G | C | T | G | A | A | G | A | A | T | C | G | C |
| H13 | C | T | A | T | G | T | A | G | A | G | A | G | T | C | A | T |
| H14 | C | C | G | G | G | C | G | G | G | A | T | A | C | T | G | C |
| . . . | Haplotypes which are estimated to occur at a frequency of less than 1% |
| () 1~40: (in this order)rs1243872, rs2145925, rs2025126, rs1885373, rs1885374, GA007473, rs2295794, rs4879926, GA007477, rs867194, rs11541908, rs741917, rs7862485, rs2756894, rs2249250, rs2295795, rs877365, rs2737273, rs2295797, rs2295798, rs1534847, rs7873822, rs2737274, rs10972567, rs3763630, rs10814274, rs3750434, rs1570246, GA025684, rs1570248, rs1570249, rs34478611, rs1322045, rs1951432, GA025687, rs10814275, rs10758320, rs4878628, rs10758321 and rs10758322 |
| TABLE 3 |
| Gene name crEB5 |
| Linkage disequilibrium block No. |
| 1 | 5 | 6 | 9 | 10 |
| Gene polymorphism name () |
| 1 | 2 | 5 | 6 | 7 | 8 | 9 | 11 | 13 | 14 | 15 | 16 | 17 | 18 | |||||||||
| Haplotype (H) No. | Tag | Tag | 3 | 4 | Tag | Tag | H No. | Tag | Tag | Tag | 10 | Tag | 12 | H No. | Tag | Tag | H No. | Tag | Tag | H No. | Tag | Tag |
| H1 | C | T | A | A | G | C | H6 | C | C | G | C | A | G | H11 | T | G | H14 | T | A | H17 | G | T |
| H2 | G | C | G | A | G | T | H7 | C | A | A | C | G | G | H12 | C | C | H15 | C | A | H18 | G | G |
| H3 | G | C | G | A | A | T | H8 | C | C | G | C | G | G | H13 | C | G | H16 | C | G | H19 | A | G |
| H4 | C | C | G | A | G | T | H9 | T | A | A | C | G | A | . . . | . . . | . . . | ||||||
| H5 | G | C | G | A | G | C | H10 | C | C | A | C | G | G |
| . . . | Haplotypes which are estimated to occur at a frequency of less than 1% |
| Linkage disequilibrium block No. |
| 11 | 12 | 13 | 15 | 16 |
| Gene polymorphism name () |
| 19 | 20 | 21 | 22 | 23 | 24 | 25 | 26 | 27 | 28 | 29 | 30 | 31 | |||||||
| Haplotype (H) No. | Tag | Tag | H No. | Tag | Tag | Tag | H No. | Tag | Tag | H No. | Tag | Tag | Tag | H No. | Tag | Tag | Tag | 32 | 33 |
| H20 | T | A | H24 | G | C | C | H28 | A | A | H31 | G | T | C | H35 | C | C | C | G | C |
| H21 | T | G | H25 | G | C | T | H29 | G | A | H32 | A | C | T | H36 | T | C | A | G | C |
| H22 | C | G | H26 | A | C | T | H30 | G | G | H33 | A | T | T | H37 | C | C | A | G | C |
| H23 | C | A | H27 | G | T | T | . . . | H34 | A | T | C | H38 | T | T | C | A | T |
| . . . | Haplotypes which are estimated to occur at a frequency of less than 1% |
| Linkage disequilibrium block No. |
| 25 | 26 | 27 | 32 |
| Gene polymorphism name () |
| 34 | 35 | 36 | 37 | 38 | 39 | 40 | 42 | 43 | 44 | 45 | 47 | 50 | ||||||||
| Haplotype (H) No. | Tag | Tag | H No. | Tag | Tag | Tag | Tag | H No. | Tag | 41 | H No. | Tag | Tag | Tag | Tag | 46 | Tag | 48 | 49 | Tag |
| H39 | T | A | H42 | G | A | G | G | H47 | A | A | H49 | A | T | C | G | T | G | T | T | T |
| H40 | C | G | H43 | G | A | A | A | H48 | G | G | H50 | A | T | C | G | T | G | T | T | C |
| H41 | T | G | H44 | A | G | G | A | . . . | H51 | A | T | A | C | C | G | T | C | C | ||
| . . . | H45 | G | A | G | A | H52 | C | T | A | C | T | T | C | T | C | |||||
| H46 | G | G | G | A | H53 | C | T | A | C | T | G | C | T | C | ||||||
| . . . | H54 | A | C | C | G | T | G | T | T | T | ||||||||||
| H55 | A | T | A | G | T | G | T | T | C |
| Haplotypes which are estimated to occur at a frequency of less than 1% | |
| Linkage disequilibrium block No. |
| 33 | 35 | 40 |
| Gene polymorphism name () |
| 51 | 52 | 53 | 54 | 57 | 58 | 59 | ||||||||||
| Haplotype (H) No. | Tag | Tag | Tag | Tag | 55 | 56 | H No. | Tag | Tag | H No. | Tag | 60 | 61 | 62 | 63 | 64 |
| H56 | T | G | G | C | A | A | H61 | C | T | H64 | G | G | C | T | T | C |
| H57 | T | A | A | T | G | C | H62 | T | C | H65 | A | A | T | C | C | A |
| H58 | G | A | A | C | G | C | H63 | T | T | . . . | ||||||
| H59 | T | A | G | C | A | A | . . . | |||||||||
| H60 | T | A | A | C | G | C |
| . . . | Haplotypes which are estimated to occur at a frequency of less than 1% |
| () 1~64: (in this order)rs4722778, rs177479, rs177480, rs11981754, rs177486, rs177498, rs10229500, rs10243659, rs4722785, rs16874503, rs11772815, rs6958133, rs16874525, rs17715174, rs6953524, rs10239810, rs17156649, rs1811248, rs887623, rs740988, rs6952227, rs42695, rs1029897, rs10233653, rs6955105, rs17156699, rs177572, rs177573, rs177580, rs177581, rs12666636, rs177584, rs177585, rs1008262, rs310353, rs41273, rs1637457, rs17156919, rs41276, rs160375, rs917275, rs17157048, rs6462098, rs10951201, rs13311248, rs12540480, rs10265166, rs7798774, rs7799246, rs6972081, rs12533079, rs7806547, rs6462100, rs6979352, rs6950574, rs4722835, rs721993, rs2237351, rs3735566, rs11975539, rs6462107, rs2190306, rs4719955 and rs10228137 |
| TABLE 4 |
| Gene name ATF2 |
| Linkage disequilibrium block No. |
| 1 | 2 |
| Gene polymorphism name () |
| 1 | 2 | 3 | 4 | 5 | ||||||||||||
| Haplotype No. | Tag | Tag | Tag | Tag | Tag | 6 | 7 | 8 | 9 | 10 | 11 | 12 | 13 | 14 | 15 | 16 |
| H1 | T | C | A | A | G | C | C | A | G | C | G | T | C | A | A | A |
| H2 | G | C | A | G | G | T | T | G | A | T | A | C | A | C | C | G |
| H3 | T | T | C | G | A | T | T | G | A | T | A | C | A | C | C | G |
| H4 | T | T | A | G | A | T | T | G | A | T | A | C | A | C | C | G |
| G | G | T | T | G | A | T | A | C | A | C | C | G |
| . . . | Haplotypes which are estimated to occur at a frequency of less than 1% |
| Linkage disequilibrium block No. | |
| 2 | |
| Gene polymorphism name () |
| 21 | 28 | ||||||||||||||
| Haplotype No. | 17 | 18 | 19 | 20 | Tag | 22 | 23 | 24 | 25 | 26 | 27 | Tag | 29 | 30 | 31 |
| H5 | C | T | T | C | C | C | G | A | C | A | C | T | T | G | T |
| H6 | T | C | C | T | T | T | A | G | A | C | T | G | C | G | C |
| H7 | T | C | C | T | T | T | A | G | A | C | T | T | C | G | C |
| H8 | T | C | C | T | T | T | A | G | A | C | T | G | C | G | C |
| H9 | T | C | C | T | C | C | G | A | C | A | C | T | T | G | T |
| . . . | Haplotypes which are estimated to occur at a frequency of less than 1% |
| () 1~31: (in this order)rs1153711, rs1153702, rs7583431, rs2302663, rs3845744, s212349, rs212347, rs12693057, rs1153685, rs212360, rs212361, rs2072538, rs1205399, rs1153676, rs7566401, rs7578569, rs3755490, rs13388308, rs11888507, rs10497434, rs268214, rs166531, rs268228, rs268229, rs268230, rs268231, rs10497435, rs1982235, rs268237, rs13030474 and rs268174 |
11. A method for determining the type, amount, and/or frequency of administration of a drug to be administered to an individual, comprising using the result from the evaluation by the method according to claim 1 or 4 as an index.
12. A method for predicting a side effect of a drug to be administered to an individual, comprising using the result from the evaluation by the method according to claim 1 or 4 as an index.
13. The method according to claim 1 or 7, wherein the drug is an opioid receptor function modulator and/or a cyclic AMP responsive element binding protein function modulator.
14. The method according to claim 13, wherein the opioid receptor function modulator is at least one selected from the group consisting of methamphetamine, methylenedioxymethamphetamine, amphetamine, dextroamphetamine, dopamine, morphine, DAMGO, codeine, methadone, carfentanil, fentanyl, heroin, cocaine, naloxone, naltrexone, nalorphine, levallorphan, pentazocine, pethidine, buprenorphine, oxycodone, hydrocodone, levorphanol, etorphine, dihydroetorphine, hydromorphone, oxymorphone, tramadol, diclofenac, indomethacin, flurbiprofen axetil, marcaine, ethanol, methanol, diethyl ether, propanol, butanol, flupirtine, laughing gas, F3 (1-chloro-1,2,2-trifluorocyclobutane), halothane, estradiol, dithiothreitol, thioridazine, pimozide, fluoxetine, paroxetine, desipramine, imipramine, clomipramine, tetramide, isoflurane, ginsenoside, ifenprodil, bupivacaine, tertiapin, clozapine, haloperidol, SCH23390, and cocaine; and the cyclic AMP responsive element binding protein function modulator is at least one selected from the group consisting of phosphodiesterase 4 (PDE4), calcineurin, protein kinase A, protein kinase C, p90 ribosome S6 kinase 1 (RSK1), calmodulin kinase, glycogen synthase kinase 3β, and CREB-regulated transcription coactivator 1 (CRTC1).
15. The method according to claim 1 or 4, comprising using an oligonucleotide consisting of a nucleotide sequence of at least 10 nucleotides comprising the 51st nucleotide of the nucleotide sequence represented by any one of SEQ ID NOS: 1 to 172, or a complementary nucleotide sequence thereto, which can specifically hybridize to a DNA fragment comprising a gene polymorphism of a cyclic AMP responsive element binding protein gene.
16. The method according to claim 15, wherein the oligonucleotide spans a length of 10 to 150 nucleotides.
17. The method according to claim 15, wherein the oligonucleotide is selected from the group consisting of the nucleotide sequence represented by any one of SEQ ID NOS: 1 to 172 and a complementary nucleotide sequence thereto.
18. A gene polymorphism marker for evaluating a tendency in the presence or absence of an individual drug sensitivity, comprising a gene polymorphism of a cyclic AMP responsive element binding protein gene or a haplotype constituted by the gene polymorphism.
19. A gene polymorphism marker for evaluating a tendency in the presence or absence of an individual disease vulnerability, comprising a gene polymorphism of a cyclic AMP responsive element binding protein gene or a haplotype constituted by the gene polymorphism.