US20180313841A1
2018-11-01
15/936,601
2018-03-27
Newly identified proteins as markers for the detection of ovary tumors, or as therapeutic targets for treatment thereof; affinity ligands capable of selectively interacting with the newly identified markers, methods for tumor diagnosis and therapy using the same.
Get notified when new applications in this technology area are published.
G01N33/57449 » CPC main
Investigating or analysing materials by specific methods not covered by groups -; Biological material, e.g. blood, urine ; Haemocytometers; Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing; Immunoassay; Biospecific binding assay; Materials therefor for cancer; Specifically defined cancers of ovaries
G01N2500/02 » CPC further
Screening for compounds of potential therapeutic value Screening involving studying the effect of compounds C on the interaction between interacting molecules A and B (e.g. A = enzyme and B = substrate for A, or A = receptor and B = ligand for the receptor)
C12N2310/14 » CPC further
Structure or type of the nucleic acid; Type of nucleic acid interfering N.A.
C07K16/3069 » CPC further
Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants from tumour cells Reproductive system, e.g. ovaria, uterus, testes, prostate
G01N33/574 IPC
Investigating or analysing materials by specific methods not covered by groups -; Biological material, e.g. blood, urine ; Haemocytometers; Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing; Immunoassay; Biospecific binding assay; Materials therefor for cancer
C07K16/30 IPC
Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants from tumour cells
C12N15/113 » CPC further
Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor; Recombinant DNA-technology; DNA or RNA fragments; Modified forms thereof Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides
The present invention relates to newly identified proteins as markers for the detection of ovary tumors, or as targets for their treatment. Also provided are affinity ligands capable of selectively interacting with the newly identified markers, as well as methods for tumor diagnosis and therapy using such ligands.
Tumor Markers (or Biomarkers)
Tumor markers are substances that can be produced by tumor cells or by other cells of the body in response to cancer. In particular, a protein biomarker is either a single protein or a panel of different proteins that could be used to unambiguously distinguish a disease state. Ideally, a biomarker would have both a high specificity and sensitivity, being represented in a significant percentage of the cases of given disease and not in healthy state.
Biomarkers can be identified in different biological samples, like tissue biopsies or preferably biological fluids (saliva, urine, blood-derivatives and other body fluids), whose collection does not necessitate invasive treatments. Tumor marker levels may be categorized in three major classes on the basis of their clinical use. Diagnostic markers can be used in the detection and diagnosis of cancer. Prognostics markers are indicative of specific outcomes of the disease and can be used to define predictive models that allow the clinicians to predict the likely prognosis of the disease at time of diagnosis. Moreover, prognosis markers are helpful to monitor the patient response to a drug therapy and facilitate a more personalized patient management. A decrease or return to a normal level may indicate that the cancer is responding to therapy, whereas an increase may indicate that the cancer is not responding. After treatment has ended, tumor marker levels may be used to check for recurrence of the tumor. Finally, therapeutic markers can be used to develop tumor-specific drugs or affinity ligand (i.e. antibodies) for a prophylactic intervention.
Currently, although an abnormal tumor marker level may suggest cancer, this alone is usually not enough to accurately diagnose cancer and their measurement in body fluids is frequently combined with other tests, such as a biopsy and radioscopic examination. Frequently, tumor marker levels are not altered in all of people with a certain cancer disease, especially if the cancer is at early stage. Some tumor marker levels can also be altered in patients with noncancerous conditions. Most biomarkers commonly used in clinical practice do not reach a sufficiently high level of specificity and sensitivity to unambiguously distinguish a tumor from a normal state.
To date the number of markers that are expressed abnormally is limited to certain types/subtypes of cancer, some of which are also found in other diseases. (http://www.cancer.gov/cancertopics/factsheet).
For example, prostate-specific antigen (PSA) levels are often used to screen men for prostate cancer, but this is controversial since elevated PSA levels can be caused by both prostate cancer or benign conditions, and most men with elevated PSA levels turn out not to have prostate cancer.
Another tumor marker, Cancer Antigen 125, (CA 125), is sometimes used to screen women who have an increased risk for ovarian cancer. Scientists are studying whether measurement of CA 125, along with other tests and exams, is useful to find ovarian cancer before symptoms develop. So far, CA 125 measurement is not sensitive or specific enough to be used to screen all women for ovarian cancer. Mostly, CA 125 is used to monitor response to treatment and check for recurrence in women with ovarian cancer. Finally, human epidermal growth factor receptor (HER2) is a marker protein overproduced in about 20% of breast cancers, whose expression is typically associated with a more aggressive and recurrent tumors of this class.
Routine Screening Test for Tumor Diagnosis
Screening tests are a way of detecting cancer early, before there are any symptoms. For a screening test to be helpful, it should have high sensitivity and specificity. Sensitivity refers to the test's ability to identify people who have the disease. Specificity refers to the test's ability to identify people who do not have the disease. Different molecular biology approaches such as analysis of DNA sequencing, small nucleotide polymorphyms, in situ hybridization and whole transcriptional profile analysis have done remarkable progresses to discriminate a tumor state from a normal state and are accelerating the knowledge process in the tumor field. However so far different reasons are delaying their use in the common clinical practice, including the higher analysis complexity and their expensiveness. Other diagnosis tools whose application is increasing in clinics include in situ hybridization and gene sequencing.
Currently, Immuno-HistoChemistry (IHC), a technique that allows the detection of proteins expressed in tissues and cells using specific antibodies, is the most commonly used method for the clinical diagnosis of tumor samples. This technique enables the analysis of cell morphology and the classification of tissue samples on the basis of their immunoreactivity. However, at present, IHC can be used in clinical practice to detect cancerous cells of tumor types for which protein markers and specific antibodies are available. In this context, the identification of a large panel of markers for the most frequent cancer classes would have a great impact in the clinical diagnosis of the disease.
Anti-Cancer Therapies
In the last decades, an overwhelming number of studies remarkably contributed to the comprehension of the molecular mechanisms leading to cancer. However, this scientific progress in the molecular oncology field has not been paralleled by a comparable progress in cancer diagnosis and therapy. Surgery and/or radiotherapy are the still the main modality of local treatment of cancer in the majority of patients. However, these treatments are effective only at initial phases of the disease and in particular for solid tumors of epithelial origin, as is the case of colon, lung, breast, prostate and others, while they are not effective for distant recurrence of the disease. In some tumor classes, chemotherapy treatments have been developed, which generally relies on drugs, hormones and antibodies, targeting specific biological processes used by cancers to grow and spread. However, so far many cancer therapies had limited efficacy due to severity of side effects and overall toxicity. Indeed, a major effort in cancer therapy is the development of treatments able to target specifically tumor cells causing limited damages to surrounding normal cells thereby decreasing adverse side effects. Recent developments in cancer therapy in this direction are encouraging, indicating that in some cases a cancer specific therapy is feasible. In particular, the development and commercialization of humanized monoclonal antibodies that recognize specifically tumor-associated markers and promote the elimination of cancer is one of the most promising solution that appears to be an extremely favorable market opportunity for pharmaceutical companies. However, at present the number of therapeutic antibodies available on the market or under clinical studies is very limited and restricted to specific cancer classes. So far licensed monoclonal antibodies currently used in clinics for the therapy of specific tumor classes, show only a partial efficacy and are frequently associated with chemotherapies to increase their therapeutic effect. Administration of Trastuzumab (Herceptin), a commercial monoclonal antibody targeting HER2, a protein overproduced in about 20% of breast cancers, in conjunction with Taxol adjuvant chemotherapy induces tumor remission in about 42% of the cases. Bevacizumab (Avastin) and Cetuximab (Erbitux) are two monoclonal antibodies recently licensed for use in humans, targeting the endothelial and epithelial growth factors respectively that, combined with adjuvant chemotherapy, proved to be effective against different tumor diseases. Bevacizumab proved to be effective in prolonging the life of patients with metastatic colorectal, breast and lung cancers. Cetuximab demostrated efficacy in patients with tumor types refractory to standard chemotherapeutic treatments (Adams G. P. and Weiner L. M. (2005) Monoclonal antibody therapy cancer. Nat Biotechnol. 23:1147-57).
In summary, available screening tests for tumor diagnosis are uncomfortable or invasive and this sometimes limits their applications. Moreover tumor markers available today have a limited utility in clinics due to either their incapability to detect all tumor subtypes of the defined cancers types and/or to distinguish unambiguously tumor vs. normal tissues. Similarly, licensed monoclonal antibodies combined with standard chemotherapies are not effective against the majority of cases. Therefore, there is a great demand for new tools to advance the diagnosis and treatment of cancer.
Experimental Approaches Commonly Used to Identify Tumor Markers
Most popular approaches used to discover new tumor markers are based on genome-wide transcription profile or total protein content analyses of tumor. These studies usually lead to the identification of groups of mRNAs and proteins, which are differentially expressed in tumors. Validation experiments then follow to eventually single out, among the hundreds of RNAs/proteins identified, the very few that have the potential to become useful markers. Although often successful, these approaches have several limitations and often, do not provide firm indications on the association of protein markers with tumor. A first limitation is that, since frequently mRNA levels not always correlate with corresponding protein abundance (approx. 50% correlation), studies based on transcription profile do not provide solid information regarding the expression of protein markers in tumor (1, 2, 3, 4).
A second limitation is that neither transcription profiles nor analysis of total protein content discriminate post-translation modifications, which often occur during oncogenesis. These modifications, including phosphorylations, acetylations, and glycosylations, or protein cleavages influence significantly protein stability, localization, interactions, and functions (5).
As a consequence, large scale studies generally result in long lists of differentially expressed genes that would require complex experimental paths in order to validate the potential markers. However, large scale genomic/proteomic studies reporting novel tumor markers frequently lack of confirmation data on the reported potential novel markers and thus do not provide solid demonstration on the association of the described protein markers with tumor.
The approach that we used to identify the protein markers included in the present invention is based on an innovative immuno-proteomic technology. In essence, a library of recombinant human proteins has been produced from E. coli and is being used to generate polyclonal antibodies against each of the recombinant proteins.
The screening of the antibodies library on Tissue microarrays (TMAs) carrying clinical samples from different patients affected by the tumor under investigation lead to the identification of specific tumor marker proteins. Therefore, by screening TMAs with the antibody library, the tumor markers are visualized by immuno-histochemistry, the classical technology applied in all clinical pathology laboratories. Since TMAs also include healthy tissues, the specificity of the antibodies for the tumors can be immediately appreciated and information on the relative level of expression and cellular localization of the markers can be obtained. In our approach the markers are subjected to a validation process consisting in a molecular and cellular characterization.
Altogether, the detection the marker proteins disclosed in the present invention selectively in tumor samples and the subsequent validation experiments lead to an unambiguous confirmation of the marker identity and confirm its association with defined tumor classes. Moreover this process provides an indication of the possible use of the proteins as tools for diagnostic or therapeutic intervention. For instance, markers showing a surface cellular localization could be both diagnostic and therapeutic markers against which both chemical and antibody therapies can be developed. Differently, markers showing a cytoplasmic expression could be more likely considered for the development of tumor diagnostic tests and chemotherapy/small molecules treatments.
The present invention provides new means for the detection and treatment of tumors, in particular ovary tumor, based on the identification of protein markers specific for these tumor type, namely:
The invention also provides a method for the diagnosis of these cancer types, comprising a step of detecting the above-identified markers in a biological sample, e.g. in a tissue sample of a subject suspected of having or at risk of developing malignancies or susceptible to cancer recurrences.
In addition, the tumor markers identify novel targets for affinity ligands, which can be used for therapeutic applications. Also provided are affinity ligands, particularly antibodies, capable of selectively interacting with the newly identified protein markers.
The present invention is based on the surprising finding of antibodies that are able to specifically stain tumor tissues from patients, while negative or very poor staining is observed in normal tissues from the same patients. These antibodies have been found to specifically bind to proteins for which no previous association with tumor has been reported. Hence, in a first aspect, the invention provides an ovarian tumor marker, which is selected from the group consisting of:
i) KLRG2, SEQ ID NO:85, SEQ ID NO:86 or a different isoform having sequence identity of at least 80%, preferably at least 90%, more preferably at least 95% to SEQ ID NO:85, SEQ ID NO:86 or a nucleic acid molecule containing a sequence coding for a KLRG2 protein, said encoding sequence being preferably selected from SEQ ID NO: 87 and SEQ ID NO:88;
ii) SLC39A10 in one of its variant isoforms SEQ ID NO:1, SEQ ID NO:2 or a different isoform having sequence identity of at least 80%, preferably at least 90%, more preferably at least 95% to SEQ ID NO:1 or SEQ ID NO:2; or a nucleic acid molecule containing a sequence coding for a SLC39A10 protein, said encoding sequence being preferably selected from SEQ ID NO: 3 and SEQ ID NO: 4;
iii) GPR107, in one of its variant isoforms SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, or a different isoform having sequence identity of at least 80%, preferably at least 90%, more preferably at least 95% to any of SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, or a nucleic acid molecule containing a sequence coding for a GPR107 protein, said encoding sequence being preferably selected from SEQ ID NO:8, SEQ ID NO:9 and SEQ ID NO:10;
iv) DPY19L3, in one of its variant isoforms SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, or a different isoform having sequence identity of at least 80%, preferably at least 90%, more preferably at least 95% to SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13 or SEQ ID NO:14, or a nucleic acid molecule containing a sequence coding for a DPY19L3 protein, said encoding sequence being preferably selected from SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17 and SEQ ID NO:18;
v) FLJ42986, SEQ ID NO:19 or a different isoform having sequence identity of at least 80%, preferably at least 90%, more preferably at least 95% to SEQ ID NO:19, or a nucleic acid molecule containing a sequence coding for a FLJ42986 protein, said encoding sequence being preferably SEQ ID NO:20;
vi) COL20A1, in one of its variant isoforms SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, or a different isoform having sequence identity of at least 80%, preferably at least 90%, more preferably at least 95% to any of SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, or a nucleic acid molecule containing a sequence coding for a COL20A1 protein, said encoding sequence being preferably selected from SEQ ID NO:24, SEQ ID NO:25 and SEQ ID NO:26;
vii) GLT25D2, in one of its variant isoforms SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, or a different isoform having sequence identity of at least 80%, preferably at least 90%, more preferably at least 95% to any of SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, or a nucleic acid molecule containing a sequence coding for a GLT25D2 protein, said encoding sequence being preferably selected from SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33 and SEQ ID NO:34;
viii) SYTL3, in one of its variant isoforms SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, or a different isoform having sequence identity of at least 80%, preferably at least 90%, more preferably at least 95% to any of SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, or a nucleic acid molecule containing a sequence coding for a SYTL3 protein, said encoding sequence being preferably selected from SEQ ID NO:38, SEQ ID NO:39 and SEQ ID NO:40;
ix) DENND1B; in one of its variant isoforms SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44, or a different isoform having sequence identity of at least 80%, preferably at least 90%, more preferably at least 95% to any of SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44, or a nucleic acid molecule containing a sequence coding for a DENND1B protein, said encoding sequence being preferably selected from SEQ ID NO:45, SEQ ID NO:46, SEQ ID NO:47 and SEQ ID NO:48;
x) FLJ3710, SEQ ID NO:49 or a different isoform having sequence identity of at least 80%, preferably at least 90%, more preferably at least 95% to SEQ ID NO:49, or a nucleic acid molecule containing a sequence coding for a FLJ3710 protein, said encoding sequence being preferably SEQ ID NO:50;
xi) Chromosome 6 orf 98 (C6orf98) SEQ ID NO:51 or a different isoform having sequence identity of at least 80%, preferably at least 90%, more preferably at least 95% to SEQ ID NO:51, or a nucleic acid molecule containing a sequence coding for a C6orf98 protein, said encoding sequence being preferably SEQ ID NO:52;
xii) Family with sequence similarity 69, member B (Fam69B) SEQ ID NO:53, SEQ ID NO:54 or a different isoform having sequence identity of at least 80%, preferably at least 90%, more preferably at least 95% to SEQ ID NO:53 or SEQ ID NO:54, or a nucleic acid molecule containing a sequence coding for a Fam69B protein, said encoding sequence being preferably selected from SEQ ID NO:55 and SEQ ID NO:56;
xiii) EMI domain-containing protein 1 Precursor (EMID1) in one of its variant isoforms SEQ ID NO:57, SEQ ID NO:58, SEQ ID NO:59, SEQ ID NO:60, SEQ ID NO:61, SEQ ID NO:62, SEQ ID NO:63, SEQ ID NO:64, SEQ ID NO:65, SEQ ID NO:66, SEQ ID NO:67, SEQ ID NO:68, SEQ ID NO:69, SEQ ID NO:70, or a different isoform having sequence identity of at least 80%, preferably at least 90%, more preferably at least 95% to SEQ ID NO:57, SEQ ID NO:58, SEQ ID NO:59, SEQ ID NO:60, SEQ ID NO:61, SEQ ID NO:62, SEQ ID NO:63, SEQ ID NO:64, SEQ ID NO:65, SEQ ID NO:66, SEQ ID NO:67, SEQ ID NO:68, SEQ ID NO:69 OR SEQ ID NO:70, or a nucleic acid molecule containing a sequence coding for a EMID protein, said encoding sequence being preferably selected from SEQ ID NO:71, SEQ ID NO:72, SEQ ID NO:73, SEQ ID NO:74, SEQ ID NO:75, SEQ ID NO:76, SEQ ID NO:77, SEQ ID NO:78, SEQ ID NO:79, SEQ ID NO:80, SEQ ID NO:81, SEQ ID NO:82, SEQ ID NO:83 and SEQ ID NO:84;
xiv) ERMP1, SEQ ID NO:89, SEQ ID NO:90 and SEQ ID NO:91, or a different isoform having sequence identity of at least 80%, preferably at least 90%, more preferably at least 95% to SEQ ID NO:89, SEQ ID NO:90 or SEQ ID NO:91, or a nucleic acid molecule containing a sequence coding for a ERMP1 protein, said encoding sequence being preferably selected from SEQ ID NO:92, SEQ ID NO:93 and SEQ ID NO:94;
xv) VMO1, SEQ ID NO:95, SEQ ID NO:96, SEQ ID NO:97, SEQ ID NO: 98 or a different isoform having sequence identity of at least 80%, preferably at least 90%, more preferably at least 95% to SEQ ID NO:95, SEQ ID NO:96, SEQ ID NO:97, SEQ ID NO: 98 or a nucleic acid molecule containing a sequence coding for a VMO1 protein, said encoding sequence being preferably selected from SEQ ID NO:99, SEQ ID NO:100 SEQ ID NO:101 and SEQ ID NO: 102.
As used herein, โPercent (%) amino acid sequence identityโ with respect to the marker protein sequences identified herein indicates the percentage of amino acid residues in a full-length protein variant or isoform according to the invention, or in a portion thereof, that are identical with the amino acid residues in the specific marker sequence, after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent sequence identity, and not considering any conservative substitutions as part of the sequence identity. Alignment for purposes of determining percent amino acid sequence identity can be achieved in various ways that are within the skill in the art, for instance, using publicly available computer software such as BLAST, BLAST-2, ALIGN or Megalign (DNASTAR) software. Those skilled in the art can determine appropriate parameters for measuring alignment, including any algorithms needed to achieve maximal alignment over the full length of the sequences being compared. Identity between nucleotide sequences is preferably determined by the Smith-Waterman homology search algorithm as implemented in the MPSRCH program (Oxford Molecular), using an affine gap search with parameters gap open penalty=12 and gap extension penalty=1.
SLC39A10 mRNA has been shown to be moderately upregulated in breast cancer tissues as compared to normal samples (approximately 1.5 fold). In the same sudy, loss of SLC39A10 transcription in breast cell lines has been reported to reduce cell migratory activity (6). However, published studies on the expression of SLC39A10 in breast tumor cells are limited to the analysis of SLC39A10 transcript whilst, to the best of our knowledge, no data have been reported documenting the presence of SLC39A10 protein in these tumor cells.
SLC39A10 is also mentioned in a patent application reporting long lists of differentially transcribed genes in tumor cells by using genome-scale transcription profile analysis (e.g. in Publication Number: US20070237770A1). Again, no data are given documenting the expression of SLC39A10 in tumor at protein level. The lack of correlation between mRNA and protein expression, besides being a general fact, has been specifically demonstrated for LIV-1, another member of the zinc transporter family, suggesting that a similar phenomenon could be extended to other proteins of this class (7). Finally, no evidence exists on the association of SLC39A10 protein with other tumors, such as ovary tumor classes.
In the present invention we disclose SLC39A10 as a protein without previous known association with ovarian tumor classes and preferably used as a marker ovary tumors and in general for cancers of these types. As described below, an antibody generated towards the SLC39A10 protein shows a selective immunoreactivity in histological preparation of ovary cancer tissues which indicates the presence of SLC39A10 in these cancer samples and makes SLC39A10 protein and its antibody highly interesting tools for specifically distinguishing these cancer types from a normal state.
Moreover, this antibody also detected its target protein on the surface of ovary tumor cell lines and in cells transfected with a SLC39A10 encoding construct, indicating that the protein is exposed to the external environment and easily accessible to affinity ligands such as antibodies.
G protein-coupled receptor 107 (GPR107, synonyms: Protein GPR107 Precursor, Lung seven transmembrane receptor 1, Gene ID: ENSG00000148358; Transcript IDs: ENST00000347136, ENST00000372410, ENST00000372406; Protein IDs:ENSP00000336988, ENSP00000361487, ENSP00000361483) is a partially characterized protein. GPR107 has been mentioned in patent applications on pancreatic tumor (e.g. US20050260639A1) and in different patent application based on whole genome transcription profile analysis of cancer, but no supporting data are provided on the expression of GPR107 protein in tumor samples. Based on the above, in the present invention we disclose GPR107 as a protein without previous known association with the tumor class under investigation and preferably used as a marker for ovary tumor, and in general for cancers of this type. As described below, an antibody generated towards GPR107 protein shows a selective immunoreactivity in histological preparation of ovary cancer tissues, which indicates the presence of this protein in these cancer samples.
The protein was detected on the surface of tumor cell lines by anti-GPR107 antibodies, indicating that it is accessible to the binding of specific antibodies.
Protein dpy-19 homolog 3 (DPY19L3; synonym: Dpy-19-like protein 3; Gene ID: ENSG00000178904; Transcript IDs: ENST00000319326, ENST00000392250, ENST00000342179, ENST00000392248; Protein IDs: ENSP00000315672, ENSP00000376081. ENSP00000344937, ENSP00000376079) Dpy 19L3 transcript has been reported as differentially expressed in multiple myeloma (Publication Number: US20080280779A1). However not data are available at level of protein expression. In the present invention we disclose Dpy 19L3 protein as associated with tumor and preferably used as a marker for ovary tumor, and in general for these cancer types. As described below, an antibody generated towards DPY19L3 protein shows a selective immunoreactivity in histological preparation of ovary cancer tissues, which indicates the presence of this protein in these cancer samples.
Moreover the protein is detected on a panel of ovary tumor cell lines reinforcing the evidence. Finally the protein was detected on the surface of tumor cell lines by the specific antibody, suggesting that it can be exploited as target for affinity ligands with therapeutic activity.
Uncharacterized protein FLJ42986 (FLJ42986, Gene ID: ENSG00000196460; Transcript ID: ENST00000376826; Protein ID: ENSP00000366022) is a hypothetical protein without previous known association with ovarian tumor classes and is preferably used as a marker for ovary tumor and in general for these cancer types. As described below, an antibody generated towards FLJ42986 protein shows a selective immunoreactivity in histological preparation of ovary cancer tissues, which indicates the presence of this protein in these cancer samples.
Collagen, type XX, alpha 1 (COL20A1); Synonyms: Collagen alpha-1(XX) chain Precursor; Gene ID: ENSG00000101203; Protein IDs: ENSP00000323077; ENSP00000346302; ENSP00000351767; Transcript IDs: ENST00000326996; ENST00000354338; ENST00000358894) belongs to the family of collagenous domain, Fibronectin type III domain, heparin binding domain, von Willebrand type A domain proteins. COL20A1 is a protein without previous known association with tumor and is preferably used as a marker for ovary tumor and in general for these cancer types. As described below, an antibody generated towards COL20A1 protein shows a selective immunoreactivity in histological preparation of ovary tissues, which indicates the presence of this protein in these cancer samples.
Glycosyltransferase 25 domain containing 2 (GLT25D2; synonyms: Glycosyltransferase 25 family member 2 Precursor) Gene ID: ENSG00000198756; Trasnscript IDs: ENST00000367522, ENST00000361927, ENST00000367520, ENST00000367521; Protein IDs: ENSP00000356492, ENSP00000354960, ENSP00000356490, ENSP00000356491), is a protein without previous known association with ovarian tumor and is preferably used as a marker for ovary tumor and in general for these cancer types. As described below, an antibody generated towards GLT25D2 protein shows a selective immunoreactivity in histological preparation of ovarian cancer, which indicates the presence of this protein in these cancer samples.
Synaptotagmin-like 3 (SYTL3; synonyms: SLP3, SLP3-B, Synaptotagmin-like protein 3, Exophilin-6; Gene ID: ENSG00000164674; Transcript ID: ENST00000360448, ENST00000297239, ENST00000367081; Protein ID: ENSP00000353631, ENSP00000297239, ENSP00000356048) belongs the family of proteins containing C2 domain, calcium-dependent phospholipid binding, neurexin binding, phospholipid binding, protein binding, rab3A effector domain, Slp homology domain. SYTL3 is a protein without previous known association with ovarian tumor and is preferably used as a marker for ovary tumor and in general for these cancer types. As described below, an antibody generated towards SYTL3 protein shows a selective immunoreactivity in histological preparation of ovary cancer tissues, which indicates the presence of this protein in these cancer samples.
DENN/MADD domain containing 1B (DENND1B; synonyms: DENN domain-containing protein 1B, Protein FAM31B, C1orf218; Gene ID: ENSG00000162701. Transcript IDs: ENST00000294738, ENST00000367396, ENST00000400967, ENST00000235453; Protein IDs: ENSP00000294738, ENSP00000356366, ENSP00000383751, ENSP00000235453) is a poorly characterized protein without previous known association with ovarian tumors and is preferably used as a marker for ovary tumor and in general for these cancer types. As described below, an antibody generated towards DENND1B protein shows a selective immunoreactivity in histological preparation of ovary cancer tissues, which indicates the presence of this protein in these cancer samples.
Putative uncharacterized protein FLJ37107 (FLJ37107; synonyms: LOC284581; Gene ID: ENSG00000177990, Transcript ID: gi|58218993|ref|NM_001010882.1, Protein ID: gi|58218994|ref|NP_001010882.1| hypothetical protein LOC284581 [Homo sapiens], gi|74729692|sp|Q8N9I1.1|YA028_HUMAN) is an uncharacterized protein without previous known association with tumor and is preferably used as a marker for ovary tumor and in general for these cancer types. As described below, an antibody generated towards FLJ3710 protein shows a selective immunoreactivity in histological preparation of ovary cancer tissues, which indicates the presence of this protein in these cancer samples.
Chromosome 6 open reading frame 98 (C6orf98; synonym: dJ45H2.2; Gene ID: EG:387079, da ENSG00000222029 has 1 transcript: ENST00000409023, associated peptide: ENSP00000386324 and 1 exon: ENSE00001576965) is an uncharacterized protein. Analysis of human genome databases (E.g. Ensembl) erroneously assigns C6orf98 as SYNE1. Although SYNE nucleic acid sequences overlap with C6ORF98 transcript, the encoded proteins show no match. In fact C6orf98 maps on an SYNE1 untranslated region (intron) and its product derives from a different reading frame than those annotated for SYNE1 isoforms in public databases. C6orf98 is a protein without C6orf98 is a protein without previous known association with tumor and is preferably used as a marker for ovary tumor and in general for these cancer types. As described below, an antibody generated towards C6orf98 protein shows a selective immunoreactivity in histological preparation of ovary cancer tissues, which indicates the presence of this protein in these cancer samples.
Family with sequence similarity 69, member B (Fam69B; synonym: C9orf136; Gene ID: ENSG00000165716; Transcript IDs: ENST00000371692, ENST00000371691; Protein IDs: ENSP00000360757, ENSP00000360756) is a hypothetical protein without previous known association with tumor. This protein has been recently associated with Type 2 diabetes mellitus disease (8) and included in patent application on diabetes (Patent publication number: WO2008065544A2). In the present invention we disclose FAM69B as associated with tumor and preferably used as a marker for ovarian tumor and in general for these cancer types. As described below, an antibody generated towards Fam69B protein shows a selective immunoreactivity in histological preparation of ovary cancer tissues, which indicates the presence of this protein in these cancer samples.
EMI domain-containing protein 1 Precursor (EMID1; synonyms: Emilin and multimerin domain-containing protein 1, Protein Emu1; Gene ID: >OTTHUMG00000030824
| Transcript IDs: | Protein IDs: | |
| OTTHUMT00000075712 | OTTHUMP00000028901, | |
| ENST00000429226 | ENSP00000403816, | |
| ENST00000430127 | ENSP00000399760, | |
| ENST00000435427 | ENSP00000402621, | |
| ENST00000404820 | ENSP00000384452, | |
| ENST00000334018 | ENSP00000335481, | |
| ENST00000429415 | ENSP00000409801, | |
| ENST00000448676 | ENSP00000413034, | |
| ENST00000404755 | ENSP00000385414, | |
| ENST00000435194 | ENSP00000417004, | |
| ENST00000426629 | ENSP00000403484, | |
| ENST00000457925 | ENSP00000405422, | |
| ENST00000433143 | ENSP00000408339, | |
| ENST00000455501 | ENSP00000413947), | |
is a poorly characterized protein. EMID1 gene is mentioned in a patent application on follicular thyroid carcinoma (Publication number US2006035244 (A1). However, no data are available on the presence of this protein in the tumor class under investigation. Therefore, we disclose EMID1 as a protein without previous known association with ovary tumors and preferably used as a marker for ovary tumor and in general for these cancer types. As described below, an antibody generated towards EMID1 protein shows a selective immunoreactivity in histological preparation of ovary cancer tissues, which indicates the presence of this protein in these cancer samples. In particular this antibody stains also tumor secretion products indicating that EMID1 protein is specifically released by tumor cells.
Killer cell lectin-like receptor subfamily G member 2 (C-type lectin domain family 15 member B) (KLRG2, synonyms: CLEC15B, FLJ44186; GENE ID: ENSG00000188883; Transcript IDs: ENST00000340940, ENST00000393039; Protein IDs: ENSP00000339356, ENSP00000376759) is a poorly characterized protein. A KLRG2 sequence is included in a patent application on the use of an agent with tumor-inhibiting action of a panel of targets associated with different tumors, whose expression is mainly shown at RNA level (Publication number WO2005030250). However no data are provided documenting the presence of KLRG2 protein in the tumors. Moreover, no experimental evidence is given on the specificity of the proposed anti-tumor agent for KLRG2. Based on these considerations, in the present invention we disclose KLRG2 as a protein without previous known association with tumor class under investigation and preferably used as a marker for ovary tumor, and in general for cancers of this type. As described below, an antibody generated towards KLRG2 protein shows a selective immunoreactivity in histological preparation of ovary cancer tissues, which indicates the presence of this protein in this cancer type. In particular, the immunoistochemistry staining accumulates in the plasma membrane of tumor cells. Moreover, localization analysis of tumor cell lines showed that the protein is exposed on the cell surface and accessible to the binding of specific antibodies. Finally, silencing of KLRG2 significantly reduced the invasiveness and proliferation properties of tumor cells lines. Overall, KLRG2 is a likely target for the development of anti-cancer therapies being accessible to the action of affinity ligands and being involved in cellular processes relevant for tumor development.
Endoplasmic reticulum metallopeptidase 1 (ERMP1, synonyms: FLJ23309, FXNA, KIAA1815; GENE ID: ENSG00000099219; Transcript IDs: ENST00000214893, ENST00000339450, ENST00000381506; Protein IDs: ENSP00000214893, ENSP00000340427, ENSP00000370917) is a transmembrane metallopeptidase, so far described as localized to the endoplasmic reticulum. ERMP1 transcript has been found differentially expressed in the rat ovary at the time of folliculogenesis. A lower level of ERMP1 transcript in the rat ovary resulted in substantial loss of primordial, primary and secondary follicles, and structural disorganization of the ovary, suggesting that is required for normal ovarian histogenesis (9). ERMP1 has been also included in a patent application (Publication Number: US 2003064439) on novel nucleic acid sequences encoding melanoma associated antigen molecules. However in these publications, no solid data documented the relation of ERMP1 protein with tumor. Based on available information, ERMP1 protein has never been previously associated with tumor. In the present invention, differently with published scientific data, we disclose ERMP1 as a protein associated with tumor, preferably used as a marker for ovarian tumor, and in general for cancers of this type. As described below, an antibody generated towards ERMP1 protein shows a selective immunoreactivity in histological preparation of ovary cancer tissues, which indicates the presence of this protein in this cancer type. In particular our immunoistochemistry analysis of ovarian tissues indicates that the protein shows plasma membrane localization. Moreover, localization analysis of ovary tumor cell lines showed that the protein is exposed on the cell surface and accessible to the binding of specific antibodies. Finally, silencing of ERMP1 significantly reduced the invasiveness and proliferation properties of tumor cells lines. Based on the above evidences, ERMP1 is a likely target for the development of anti-cancer therapies being exposed to the action of affinity ligand and being involved in cellular processes relevant for tumor development.
Vitelline membrane outer layer protein 1 homolog Precursor (VMO1, synonyms: ERGA6350, PRO21055; GeneID: ENSG00000182853; Transcript ID: ENST00000328739, ENST00000354194, ENST00000416307, ENST00000441199; Protein IDs: ENSP00000328397, ENSP00000346133, ENSP00000390450, ENSP00000408166) is a marginally characterized protein. Evidences on the expression of VMO1 human protein are essentially based on studies in which the protein was detected in sputum from smoking human female and urine (10, 11).
In the present invention we disclose VMO1 as a protein without previous known association with tumor classes under investigation and preferably used as a marker for ovarian tumor, and in general for cancers of this type. As described below, an antibody generated towards VMO1 protein shows a selective immunoreactivity in histological preparation of ovarian cancer tissues, which indicates the presence of this protein in this cancer type. Immunoreactivity accumulates at the plasma membrane of tumor cells, providing a first indication that this protein is accessible to the action of affinity ligands (such as antibodies) with anti-cancer activities.
A further aspect of this invention is a method of screening a tissue sample for malignancy, which comprises determining the presence in said sample of at least one of the above-mentioned tumor markers. This method includes detecting either the marker protein, e.g. by means of labeled monoclonal or polyclonal antibodies that specifically bind to the target protein, or the respective mRNA, e.g. by means of polymerase chain reaction techniques such as RT-PCR. The methods for detecting proteins in a tissue sample are known to one skilled in the art and include immunoradiometric, immunoenzymatic or immunohistochemical techniques, such as radioimmunoassays, immunofluorescent assays or enzyme-linked immunoassays. Other known protein analysis techniques, such as polyacrylamide gel electrophoresis (PAGE), Western blot or Dot blot are suitable as well. Preferably, the detection of the protein marker is carried out with the immune-histochemistry technology, particularly by means of High Through-Put methods that allow the analyses of the antibody immune-reactivity simultaneously on different tissue samples immobilized on a microscope slide. Briefly, each Tissue Micro Array (TMA) slide includes tissue samples suspected of malignancy taken from different patients, and an equal number of normal tissue samples from the same patients as controls. The direct comparison of samples by qualitative or quantitative measurement, e.g. by enzimatic or colorimetric reactions, allows the identification of tumors.
In one embodiment, the invention provides a method of screening a sample of ovary tissue for malignancy, which comprises determining the presence in said sample of the SLC39A10, GPR107, DPY19L3, FLJ42986, COL20A1, GLT25D2, SYTL3, DENND1B, FLJ3710, C6orf98, FAM69B, EMID1, KLRG2, ERMP1, VMO1 protein tumor marker, variants or isoforms thereof as described above.
A further aspect of the invention is a method in vitro for determining the presence of an ovary tumor in a subject, which comprises the steps of:
(1) providing a sample of the tissue suspected of containing tumor cells;
(2) determining the presence of a tumor marker as above defined, or a combination thereof in said tissue sample by detecting the expression of the marker protein or the presence of the respective mRNA transcript;
wherein the detection of one or more tumor markers in the tissue sample is indicative of the presence of tumor in said subject.
The methods and techniques for carrying out the assay are known to one skilled in the art and are preferably based on immunoreactions for detecting proteins and on PCR methods for the detection of mRNAs. The same methods for detecting proteins or mRNAs from a tissue sample as disclosed above can be applied.
A further aspect of this invention is the use of the tumor markers herein provided as targets for the identification of candidate antitumor agents. Accordingly, the invention provides a method for screening a test compound which comprises contacting the cells expressing a tumor-associated protein selected from: Solute carrier family 39 (zinc transporter), member 10 (SLC39A10); G protein-coupled receptor 107 (GPR107); DPY19-like 3 (DPY19L3); Uncharacterized protein FLJ42986 (FLJ42986); Collagen, type XX, alpha 1 (COL20A1); Glycosyltransferase 25 domain containing 2 (GLT25D2); Synaptotagmin-like 3 (SYTL3); DENN/MADD domain containing 1B (DENND1B); Putative uncharacterized protein (FLJ3710); Chromosome 6 open reading frame 98 (C6orf98); Family with sequence similarity 69, member B (Fam69B); EMI domain-containing protein 1 Precursor (EMID1); Killer cell lectin-like receptor subfamily G member 2 (KLRG2); Endoplasmic reticulum metallopeptidase 1 (ERMP1); Vitelline membrane outer layer protein 1 homolog precursor (VMO1);
with the test compound, and determining the binding of said compound to said tumor-associated protein. In addition, the ability of the test compound to modulate the activity of each target molecule can be assayed.
A further aspect of the invention is an antibody or a fragment thereof, which is able to specifically recognize and bind to one of the tumor-associated proteins described above. The term โantibodyโ as used herein refers to all types of immunoglobulins, including IgG, IgM, IgA, IgD and IgE. Such antibodies may include polyclonal, monoclonal, chimeric, single chain, antibodies or fragments such as Fab or scFv. The antibodies may be of various origin, including human, mouse, rat, rabbit and horse, or chimeric antibodies. The production of antibodies is well known in the art. For the production of antibodies in experimental animals, various hosts including goats, rabbits, rats, mice, and others, may be immunized by injection with polypeptides of the present invention or any fragment or oligopeptide or derivative thereof which has immunogenic properties or forms a suitable epitope. Monoclonal antibodies may be produced following the procedures described in Kohler and Milstein, Nature 265:495 (1975) or other techniques known in the art.
The antibodies to the tumor markers of the invention can be used to detect the presence of the marker in histologic preparations or to distinguish tumor cells from normal cells. To that purpose, the antibodies may be labeled with radiocative, fluorescent or enzyme labels.
In addition, the antibodies can be used for treating proliferative diseases by modulating, e.g. inhibiting or abolishing the activity of a target protein according to the invention. Therefore, in a further aspect the invention provides the use of antibodies to a tumor-associated protein selected from: Solute carrier family 39 (zinc transporter), member 10 (SLC39A10); G protein-coupled receptor 107 (GPR107); DPY19-like 3 (DPY19L3); Uncharacterized protein FLJ42986 (FLJ42986); Collagen type XX, alpha 1 (COL20A1); glycosyltransferase 25 domain containing 2 (GLT25D2); Synaptotagmin-like 3 (SYTL3); DENN/MADD domain containing 1B (DENND1B); Putative uncharacterized protein (FLJ3710); Chromosome 6 open reading frame 98 (C6orf98); Family with sequence similarity 69, member B (Fam69B); EMI domain-containing protein 1 Precursor (EMID1); Killer cell lectin-like receptor subfamily G member 2 (KLRG2); Endoplasmic reticulum metallopeptidase 1 (ERMP1); Vitelline membrane outer layer protein 1 homolog Precursor (VMO1);
for the preparation of a therapeutic agent for the treatment of proliferative diseases. For use in therapy, the antibodies can be formulated with suitable carriers and excipients, optionally with the addition of adjuvants to enhance their effetcs.
A further aspect of the invention relates to a diagnostic kit containing suitable means for detection, in particular the polypeptides or polynucleotides, antibodies or fragments or derivatives thereof described above, reagents, buffers, solutions and materials needed for setting up and carrying out the immunoassays, nucleic acid hybridization or PCR assays described above. Parts of the kit of the invention can be packaged individually in vials or bottles or in combination in containers or multicontainer units.
FIG. 1. Analysis of purified SLC39A10 recombinant protein
Left panel: Comassie staining of purified His-tag SLC39A10 fusion protein separated by SDS-PAGE; Right panel: WB on the recombinant SLC39A10 protein stained with anti-SLC39A10 antibody. Arrow marks the protein band of the expected size. The low molecular weight bands correspond to partially degraded forms of SLC39A10 protein. Molecular weight markers are reported on the left.
FIG. 2. Staining of ovary tumor TMA with anti-SLC39A10 antibodies
In the case of the ovarian sample, both tumor and normal cells are represented on the same image. The antibody stains specifically tumor cells (in dark gray); negative or poor staining is visible in normal cells.
FIG. 3. Confocal microscopy analysis of expression and localization of SLC39A10 in transfected cells
HeLa cells transfected with the empty pcDNA3 vector (upper panels) or with the plasmid construct encoding the SLC39A10 gene (lower panels) stained with secondary antibodies (left panels) and with anti-SLC39A10 antibodies (right panels). Arrowheads mark surface specific localization.
FIG. 4. Expression and localization of SLC39A10 in ovary tumor cell lines
Flow cytometry analysis of SLC39A10 cell-surface localization in OVCAR-5 (left panel) and OVCAR-8 (right panel) tumor cells stained with a negative control antibody (filled curve or with anti-SLC39A10 antibody (empty curve). X axis, Fluorescence scale; Y axis, Cells (expressed as % relatively to major peaks).
FIG. 5. Analysis of purified GPR107 recombinant protein
Left panel: Comassie staining of purified His-tag GPR107 fusion protein separated by SDS-PAGE; Right panel: WB on the recombinant GPR107 protein stained with anti-GPR107 antibody. Arrow marks the protein band of the expected size. The high molecular weight band is consistent with a protein dimer of GPR107. Molecular weight markers are reported on the left.
FIG. 6. Staining of ovary tumor TMA with anti-GPR107 antibodies
In the case of the ovarian sample, both tumor and normal cells are represented on the same image. The antibody stains specifically tumor cells (in dark gray); negative or poor staining is visible in normal cells.
FIG. 7. Expression and localization of GPR107 in ovary tumor cells
Flow cytometry analysis of GPR107 cell surface localization in OVCAR-8 cells stained with a control antibody (filled curve or with anti-GPR107 antibody (empty curve). X axis, Fluorescence scale; Y axis, Cells (expressed as percentage, relatively to major peaks).
FIG. 8. Analysis of purified DPY19L3 recombinant protein
Left panel: Comassie staining of purified His-tag DPY19L3 fusion protein separated by SDS-PAGE; Right panel: WB on the recombinant DPY19L3 protein stained with anti-DPY19L3 antibody. Arrow marks the protein band of the expected size. Molecular weight markers are reported on the left.
FIG. 9. Staining of ovary tumor TMA with anti-DPY19L3 antibodies
In the case of the ovarian sample, both tumor and normal cells are represented on the same image. The antibody stains specifically tumor cells (in dark gray); negative or poor staining is visible in normal cells.
FIG. 10. Expression and localization of DPY19L3 in ovary tumor cell lines
Left panel: Western blot analysis of DPY19L3 expression in total protein extracts separated by SDS-PAGE from the ovary-derived tumor cells OVCAR-3 (lane 1), OVCAR-4 (lane 2), OVCAR-5 (lane 3), OVCAR-8 (lane 4). Arrow marks the protein band of the expected size. Molecular weight markers are reported on the left.
Right panel: Flow cytometry analysis of DPY19L3 cell surface localization in OVCAR-5 cells stained with a negative control antibody (filled curve or with anti-DPY19L3 antibody (empty curve). X axis, Fluorescence scale; Y axis, Cells (expressed as percentage, relatively to major peaks).
FIG. 11. Analysis of purified FLJ42986 recombinant protein
Left panel: Comassie staining of purified His-tag FLJ42986 fusion protein separated by SDS-PAGE; Right panel: WB on the recombinant FLJ42986 protein stained with anti-FLJ42986 antibody. Arrow marks the protein band of the expected size. Molecular weight markers are reported on the left.
FIG. 12. Staining of ovary tumor TMA with anti-FLJ42986 antibodies
In the case of the ovarian sample, both tumor and normal cells are represented on the same image. The antibody stains specifically tumor cells (in dark gray); negative or poor staining is visible in normal cells.
FIG. 13. Analysis of purified COL20A1 recombinant protein
Left panel: Comassie staining of purified His-tag COL20A1 fusion protein separated by SDS-PAGE; Right panel: WB on the recombinant COL20A1 protein stained with anti-COL20A1 antibody. Arrow marks the protein band of the expected size. The high molecular weight band is consistent with the formation of protein dimer. Molecular weight markers are reported on the left.
FIG. 14. Staining of ovary tumor TMA with anti-COL20A1 antibodies
In the case of the ovarian sample, both tumor and normal cells are represented on the same image. The antibody stains specifically tumor cells (in dark gray); negative or poor staining is visible in normal cells.
FIG. 15. Analysis of purified GLT25D2 recombinant protein
Left panel: Comassie staining of purified His-tag GLT25D2 fusion protein separated by SDS-PAGE; Right panel: WB on the recombinant GLT25D2 protein stained with anti-GLT25D2 antibody. Arrow marks the protein band of the expected size. Molecular weight markers are reported on the left.
FIG. 16. Staining of ovary tumor TMA with anti-GLT25D2 antibodies
In the case of the ovarian sample, both tumor and normal cells are represented on the same image. The antibody stains specifically tumor cells (in dark gray); negative or poor staining is visible in normal cells.
FIG. 17. Analysis of purified SYTL3 recombinant protein Left panel: Comassie staining of purified His-tag SYTL3 fusion protein espressed; Right panel: WB on the recombinant SYTL3 protein stained with anti-SYTL3 antibody. Arrow marks the protein band of the expected size. Molecular weight markers are reported on the left.
FIG. 18. Staining of ovary tumor TMA with anti-SYTL3 antibodies
In the case of the ovarian sample, both tumor and normal cells are represented on the same image. The antibody stains specifically tumor cells (in dark gray); negative or poor staining is visible in normal cells.
FIG. 19. Analysis of purified DENND1B recombinant protein
Left panel: Comassie staining of purified His-tag DENND1B fusion protein separated by SDS-PAGE; Right panel: WB on the recombinant DENND1B protein stained with anti-DENND1B antibody. Arrow marks the protein band of the expected size. The low molecular weight band corresponds to partially degraded forms of the protein. Molecular weight markers are reported on the left.
FIG. 20. Staining of ovary tumor TMA with anti DENND1B antibodies
In the case of the ovarian sample, both tumor and normal cells are represented on the same image. The antibody stains specifically tumor cells (in dark gray); negative or poor staining is visible in normal cells.
FIG. 21. Analysis of purified FLJ37107 recombinant protein
Left panel: Comassie staining of purified His-tag FLJ37107 fusion protein separated by SDS-PAGE; Right panel: WB on the recombinant protein stained with anti-FLJ37107 antibody. Arrow marks the protein band of the expected size. Molecular weight markers are reported on the left.
FIG. 22. Staining of ovary tumor TMA with anti-FLJ37107 antibodies
In the case of the ovarian sample, both tumor and normal cells are represented on the same image. The antibody stains specifically tumor cells (in dark gray); negative or poor staining is visible in normal cells.
FIG. 23. Analysis of purified C6orf98 recombinant protein
Left panel: Comassie staining of purified His-tag C6orf98 fusion protein separated by SDS-PAGE; Right panel: WB on the recombinant C6orf98 protein stained with anti-C6orf98 antibody. Arrow marks the protein band of the expected size. Molecular weight markers are reported on the left.
FIG. 24. Staining of ovary tumor TMA with anti-C6orf98 antibodies
In the case of the ovarian sample, both tumor and normal cells are represented on the same image. The antibody stains specifically tumor cells (in dark gray); negative or poor staining is visible in normal cells.
FIG. 25. Analysis of purified Fam69B recombinant protein
Left panel: Comassie staining of purified His-tag Fam69B fusion protein separated by SDS-PAGE; Right panel: WB on the recombinant Fam69B protein stained with anti-Fam69B antibody. Arrow marks the protein band of the expected size. Molecular weight markers are reported on the left.
FIG. 26. Staining of ovary tumor TMA with anti-Fam69B antibodies
In the case of the ovarian sample, both tumor and normal cells are represented on the same image. The antibody stains specifically tumor cells (in dark gray); negative or poor staining is visible in normal cells.
FIG. 27. Analysis of purified EMID1 recombinant protein
Left panel: Comassie staining of purified His-tag EMID1 fusion protein separated by SDS-PAGE; Right panel: WB on the recombinant EMID1 protein stained with anti-EMID1 antibody. Arrow marks the protein band of the expected size. Molecular weight markers are reported on the left.
FIG. 28. Staining of ovary tumor TMA with anti-EMID1 antibodies
In the case of the ovarian sample, both tumor and normal cells are represented on the same image. The antibody stains specifically tumor cells (in dark gray); negative or poor staining is visible in normal cells.
FIG. 29. Analysis of purified KLRG2 recombinant protein
Left panel: Comassie staining of purified His-tag KLRG2 fusion protein separated by SDS-PAGE; Right panel: WB on the recombinant protein stained with anti-KLRG2 antibody. Arrow marks the protein band of the expected size. Molecular weight markers are reported on the left.
FIG. 30. Staining of ovary tumor TMA with anti-KLRG2 antibodies
In the case of the ovarian sample, both tumor and normal cells are represented on the same image. The antibody stains specifically tumor cells (in dark gray) and the stain clearly delineates the plasma membrane; negative or poor staining is visible in normal cells.
FIG. 31. Expression and localization of KLRG2 in tumor cell lines
Panel A. KLRG2 expression in transfected HeLa cells. Western blot analysis of KLRG2 expression in total protein extracts separated by SDS-PAGE from HeLa cells (corresponding to 2ร105 cells) transfected with the empty pcDNA3 vector (lane 1), with the plasmid construct encoding the isoform 2 of the KLRG2 gene (lane 2); or with the plasmid construct encoding the isoform1 of the KLRG2 gene (lane 3);
Panel B. KLRG2 expression in ovary-derived tumor cell lines. Western blot analysis of KLRG2 expression in total protein extracts separated by SDS-PAGE from OVCAR-5 (lane 1) and from OVCAR-8 tumor cells (corresponding to 2ร105 cells) (lane 2);
Panel C. Surface exposure of KLRG2 in tumor cell lines. Flow cytometry analysis of KLRG2 cell surface localization in OVCAR-8 cells stained with a negative control antibody (filled curve or with anti-KLRG2 antibody (empty curve). X axis, Fluorescence scale; Y axis, Cells (expressed as percentage relatively to major peaks).
FIG. 32. KLRG2 confer malignant cell phenotypes
The proliferation and the migration/invasive phenotypes of MCF7 cell line were assessed after transfection with KLRG2-siRNA and a scrambled siRNA control using the MTT and the Boyden in vitro invasion assay, respectively.
Panel A. Cell migration/invasiveness measured by the Boyden migration assay. The graph represents the reduced migration/invasiveness of MCF7 treated with the KLRG2 specific siRNA. Small boxes below the columns show the visual counting of the migrated cells.
Panel B. Cell proliferation determined by the MTT incorporation assay. The graph represents the reduced proliferation of the MCF7 tumor cells upon treatment with KLRG2-siRNA, as determined by spectrophotometric reading.
FIG. 33. Analysis of purified ERMP1 recombinant protein
Left panel: Comassie staining of purified His-tag ERMP1 fusion protein separated by SDS-PAGE; Right panel: WB on the recombinant protein stained with anti-ERMP1 antibody. Arrow marks the protein band of the expected size. Molecular weight markers are reported on the left.
FIG. 34. Staining of ovary tumor TMA with anti-ERMP1 antibodies
In the case of the ovarian sample, both tumor and normal cells are represented on the same image. The antibody stains specifically tumor cells (in dark gray) and the stain clearly delineates the plasma membrane; negative or poor staining is visible in normal cells.
FIG. 35. Expression and localization of ERMP1 in tumor cell lines
Panel A. ERMP1 expression in transfected HEK-293T cells. Western blot analysis of ERMP1 expression in total protein extracts separated by SDS-PAGE from HEK-293T cells (corresponding to 2ร105 cells) transfected with the empty pcDNA3 vector (lane 1) or with the plasmid construct encoding the ERMP1 gene (lane 2).
Panel B. Western blot analysis of ERMP1 expression in total protein extracts separated by SDS-PAGE from OVCAR-4 tumor cells (corresponding to 2ร105 cells) (lane 1). Arrow marks the ERMP1 band. Molecular weight markers are reported on the left.
Panel C. Flow cytometry analysis of ERMP1 cell surface localization in OVCAR-8 tumor cells stained with a negative control antibody (filled curve or with anti-ERMP1 antibody (empty curve). X axis, Fluorescence scale; Y axis, Cells (expressed as % relatively to major peaks).
FIG. 36. ERMP1 confers malignant cell phenotypes
The proliferation and the invasive properties of the MCF7 cell line were assessed after transfection with ERMP1-siRNA and a scramble siRNA control using the MTT and the Boyden in vitro invasion assay, respectively.
Panel A. Cell migration/invasiveness measured by the Boyden migration assay. The graph represents the reduced migration/invasiveness of MCF7 treated with the ERMP1-specific siRNA. Small boxes below the columns show the visual counting of the migrated cells.
Panel B. Cell proliferation determined by the MTT incorporation assay. The graph represents the reduced proliferation of the MCF7 tumor cells upon treatment with ERMP1-siRNA, as determined by spectrophotometric reading.
FIG. 37. Analysis of purified VMO1 recombinant protein
Left panel: Comassie staining of purified His-tag VMO1 fusion protein separated by SDS-PAGE; Right panel: WB on the purified VMO1 protein stained with a specific antibody. Arrow marks the protein band of the expected size. Molecular weight markers are reported on the left
FIG. 38. Staining of ovary tumor TMA with anti-VMO1 antibodies
In the case of the ovarian sample, both tumor and normal cells are represented on the same image. The antibody stains specifically tumor cells (in dark gray); negative or poor staining is visible in normal cells.
The following examples further illustrate the invention.
Methods
The entire coding region or suitable fragments of the genes encoding the target proteins were designed for cloning and expression using bioinformatic tools with the human genome sequence as template (Lindskog M et al (2005). Where present, the leader sequence for secretion was replaced with the ATG codon to drive the expression of the recombinant proteins in the cytoplasm of E. coli. For cloning, genes were PCR-amplified from templates derived from Mammalian Gene Collection (http://mgc.nci.nih.gov/) clones or from cDNAs mixtures generated from pools of total RNA derived from Human testis, Human placenta, Human bone marrow, Human fetal brain, using specific primers. Clonings were designed so as to fuse a 10 histidine tag sequence at the 5โฒ end, annealed to in house developed vectors, derivatives of vector pSP73 (Promega) adapted for the T4 ligation independent cloning method (Nucleic Acids Res. 1990 Oct. 25; 18(20): 6069-6074) and used to transform E. coli NovaBlue cells recipient strain. E. coli tranformants were plated onto selective LB plates containing 100 ฮผg/ml ampicillin (LB Amp) and positive E. coli clones were identified by restriction enzyme analysis of purified plasmid followed by DNA sequence analysis. For expression, plasmids were used to transform BL21-(DE3) E. coli cells and BL21-(DE3) E. coli cells harbouring the plasmid were inoculated in ZYP-5052 growth medium (Studier, 2005) and grown at 37ยฐ C. for 24 hours. Afterwards, bacteria were collected by centrifugation, lysed into B-Per Reagent containing 1 mM MgCl2, 100 units DNAse I (Sigma), and 1 mg/ml lysozime (Sigma). After 30 min at room temperature under gentle shaking, the lysate was clarified by centrifugation at 30.000 g for 40 min at 4ยฐ C. All proteins were purified from the inclusion bodies by resuspending the pellet coming from lysate centrifugation in 40 mM TRIS-HCl, 1 mM TCEP {Tris(2-carboxyethyl)-phosphine hydrochloride, Pierce} and 6M guanidine hydrochloride, pH 8 and performing an IMAC in denaturing conditions. Briefly, the resuspended material was clarified by centrifugation at 30.000 g for 30 min and the supernatant was loaded on 0.5 ml columns of Ni-activated Chelating Sepharose Fast Flow (Pharmacia). The column was washed with 50 mM TRIS-HCl buffer, 1 mM TCEP, 6M urea, 60 mM imidazole, 0.5M NaCl, pH 8. Recombinant proteins were eluted with the same buffer containing 500 mM imidazole. Proteins were analysed by SDS-Page and their concentration was determined by Bradford assay using the BIORAD reagent (BIORAD) with a bovine serum albumin standard according to the manufacturer's recommendations.
To generate antisera, the purified proteins were used to immunize CD1 mice (6 week-old females, Charles River laboratories, 5 mice per group) intraperitoneally, with 3 protein doses of 20 micrograms each, at 2 week-interval. Freund's complete adjuvant was used for the first immunization, while Freund's incomplete adjuvant was used for the two booster doses. Two weeks after the last immunization animals were bled and sera collected from each animal was pooled.
Results
Gene fragments of the expected size were obtained by PCR from specific clones of the Mammalian Gene Collection or, alternatively, from cDNA generated from pools of total RNA derived from Human testis, Human placenta, Human bone marrow, Human fetal brain, using primers specific for each gene.
In particular, for the SLC39A10 gene, a DNA fragment corresponding to nucleotides 154-1287 of the transcript ENST00000359634 and encoding a protein of 378 residues, corresponding to the amino acid region from 26 to 403 of ENSP00000352656 sequence was obtained.
For the GPR107 gene, a fragment corresponding to nucleotides 291 to 968 of the transcript ENST00000347136 and encoding a protein of 226 residues, corresponding to the amino acid region from 39 to 264 of ENSP00000336988 sequence was obtained.
For the DPY19L3 gene, a fragment corresponding to nucleotides 158 to 463 of the transcript ENST00000392250 and encoding a protein of 102 residues, corresponding to the amino acid region from 1 to 102 of ENSP00000376081 sequence was obtained.
For the FLJ42986 gene, a fragment corresponding to nucleotides 1287 to 1717 of the transcript ENST00000376826 and encoding protein of 144 residues, corresponding to the amino acid region from 30 to 173 of ENSP00000366022 sequence was obtained.
For the COL20A1 gene, a fragment corresponding to nucleotides 577 to 1095 of the transcript ENST00000354338 and encoding a protein of 173 residues, corresponding to the amino acid region from 193 to 365 of ENSP00000346302 sequence was obtained.
For the GLT25D2 gene, a fragment corresponding to nucleotides 454 to 831 of the transcript ENST00000361927 and encoding a protein of 126 residues, corresponding to the amino acid region from 25 to 153 of ENSP00000354960 sequence was obtained.
For the SYTL3 gene, a fragment corresponding to nucleotides 267 to 569 of the transcript ENST00000360448 and encoding a protein of 101 residues, corresponding to the amino acid region from 50 to 150 of ENSP00000353631 sequence was obtained.
For the DENND1B gene, a fragment corresponding to nucleotides 563 to 1468 of the transcript ENST00000235453 and encoding a protein of 302 residues, corresponding to the amino acid region from 95 to 396 of ENSP00000235453 sequence was obtained.
For the FLJ37107 gene, a fragment corresponding to nucleotides 661-972 of the transcript gi|58218993|ref|NM_001010882.1 and encoding a protein of 104 residues, corresponding to the amino acid region from 1 to 104 of gi|58218994|ref|NP_001010882.1 sequence was obtained.
For the C6orf98 gene, a fragment corresponding to nucleotides 67 to 396 of the transcript ENST00000409023 and encoding a protein of 110 residues, corresponding to the amino acid region from 22 to 132 of ENSP00000386324 sequence was obtained.
For the Fam69B gene, a fragment corresponding to nucleotides 233 to 688 of the transcript ENST00000371692 and encoding a protein of 152 residues, corresponding to the amino acid region from 49 to 200 of ENSP00000360757 sequence was obtained.
For the EMID1 gene, a fragment corresponding to nucleotides 203 to 670 of the transcript OTTHUMT00000075712 and encoding a protein of 156 residues, corresponding to the amino acid region from 33 to 188 of OTTHUMP00000028901 sequence was obtained.
For the KLRG2 gene, a fragment corresponding to nucleotides 70 to 849 of the transcript ENST00000340940 and encoding a protein of 260 residues, corresponding to the amino acid region from 1 to 260 of ENSP00000339356 sequence was obtained.
For the ERMP1 gene, a fragment corresponding to nucleotides 55 to 666 of the transcript ENST00000339450 and encoding a protein of 204 residues, corresponding to the amino acid region from 1 to 204 of ENSP00000340427 sequence was obtained.
For the VMO1 gene, a fragment corresponding to nucleotides 157 to 690 of the transcript ENST00000328739 and encoding a protein of 178 residues corresponding to the amino acid region from 25-202 of ENSP00000328397 sequence was obtained.
A clone encoding the correct amino acid sequence was identified for each gene/gene fragment and, upon expression in E. coli, a protein of the correct size was produced and subsequently purified using affinity chromatography (FIGS. 1; 5; 8; 11; 13; 15; 17; 19; 21; 23; 25, 27, 29, 33, 37, left panels). As shown in the figures, in some case SDS-PAGE analysis of affinity-purified recombinant proteins revealed the presence of extra bands, of either higher and/or lower masses. Mass spectrometry analysis confirmed that they corresponded to either aggregates or degradation products of the protein under analysis.
Antibodies generated by immunization specifically recognized their target proteins in Western blot (WB) (FIGS. 1; 5; 8; 11; 13; 15; 17; 19; 21; 23; 25, 27, 29, 33, 37, right panels).
Methods
The analysis of the antibodies' capability to recognize their target proteins in tumor samples was carried out by Tissue Micro Array (TMA), a miniaturized immuno-histochemistry technology suitable for HTP analysis that allows to analyse the antibody immuno-reactivity simultaneously on different tissue samples immobilized on a microscope slide.
Since the TMAs include both tumor and healthy tissues, the specificity of the antibodies for the tumors can be immediately appreciated. The use of this technology, differently from approaches based on transcription profile, has the important advantage of giving a first hand evaluation on the potential of the markers in clinics. Conversely, since mRNA levels not always correlate with protein levels (approx. 50% correlation), studies based on transcription profile do not provide solid information regarding the expression of protein markers.
A tissue microarray was prepared containing formalin-fixed paraffin-embedded cores of human tissues from patients affected by ovary cancer and analyzed using the specific antibody sample. In total, the TMA design consisted in 20 ovary tissue samples from 5 well pedigreed patients, each including both tumor and normal epithelium (equal to four tumor samples from each patient) to identify promising target molecules differentially expressed in cancer and normal cells. The direct comparison between tumor and normal epithelium of each patient allowed the identification of antibodies that stain specifically tumor cells and provided indication of target expression in ovary tumor. To confirm the association of each protein with ovary tumors a tissue microarray was prepared containing 100 formalin-fixed paraffin-embedded cores of human ovary tissues from 50 patients (equal to two tissue samples from each patient).
All formalin fixed, paraffin embedded tissues used as donor blocks for TMA production were selected from the archives at the IEO (Istituto Europeo Oncologico, Milan). Corresponding whole tissue sections were examined to confirm diagnosis and tumour classification, and to select representative areas in donor blocks. Normal tissues were defined as microscopically normal (non-neoplastic) and were generally selected from specimens collected from the vicinity of surgically removed tumors. The TMA production was performed essentially as previously described (Kononen J et al (1998) Nature Med. 4:844-847; Kallioniemi O P et a/(2001) Hum. MoI. Genet. 10:657-662). Briefly, a hole was made in the recipient TMA block. A cylindrical core tissue sample (1 mm in diameter) from the donor block was acquired and deposited in the recipient TMA block. This was repeated in an automated tissue arrayer โGalileo TMA CK 3500โ BioRep (Milan) until a complete TMA design was produced. TMA recipient blocks were baked at 42<0>C for 2 h prior to sectioning. The TMA blocks were sectioned with 2-3 mm thicknes using a waterfall microtome (Leica), and placed onto poli-L-lysinated glass slides for immunohistochemical analysis. Automated immunohistochemistry was performed as previously described (Kampf C. et al (2004) Clin. Proteomics 1:285-300). In brief, the glass slides were incubated for 30โฒ min in 60ยฐ C., de-paraffinized in xylene (2ร15 min) using the Bio-Clear solution (Midway. Scientific, Melbourne, Australia), and re-hydrated in graded alcohols. For antigen retrieval, slides were immersed 0.01 M Na-citrate buffer, pH 6.0 at 99ยฐ C. for 30 min Slides were placed in the Autostainerยฎ (DakoCytomation) and endogenous peroxidase was initially blocked with 3% H2O2, for 5 min. Slides were then blocked in Dako Cytomation Wash Buffer containing 5% Bovine serum albumin (BSA) and subsequently incubated with mouse antibodies for 30โฒ (dilution 1:200 in Dako Realโข dilution buffer). After washing with DakoCytomation wash buffer, slides were incubated with the goat anti-mouse peroxidase conjugated Envisionยฎ for 30 min each at room temperature (DakoCytomation). Finally, diaminobenzidine (DakoCytomation) was used as chromogen and Harris hematoxylin (Sigma-Aldrich) was used for counterstaining. The slides were mounted with Pertexยฎ (Histolab).
The staining results have been evaluated by a trained pathologist at the light microscope, and scored according to both the percentage of immunostained cells and the intensity of staining. The individual values and the combined score (from 0 to 300) were recorded in a custom-tailored database. Digital images of the immunocytochemical findings have been taken at a Leica DM LB light microscope, equipped with a Leica DFC289 color camera.
Results
The results from tissue profiling showed that the antibodies specific for the recombinant proteins (see Example 1) are strongly immunoreactive on ovary cancer tissues from patients with varying frequencies, indicating the presence of the target proteins in tumors tissues, while no or poor reactivity was detected in normal tissues.
Based on this finding, the detection of target proteins in tissue samples can be associated with the specific tumor/s. In some cases the antibody staining accumulated at the plasma membrane of tumor cells, providing a first indication of the cell localization of target proteins. The capability of target-specific antibodies to stain different tumor tissues is summarized in Table I. Representative examples of microscopic enlargements of tissue samples stained by each antibody are reported in FIGS. 2; 6; 9; 12; 14; 16; 18, 20; 22; 24; 26, 28, 30, 34, 38.
Table I reports the percentage of positive ovarian tumor samples after staining with the target-specific antibodies
| TABLE I | ||
| Percentage of ovary tumor samples | ||
| Gene | showing positive IHC staining | |
| SLC39A10 | 80 | |
| GPR107 | 40 | |
| DPY19L3 | 93 | |
| FLJ42986 | 80 | |
| COL20A1 | 20 | |
| GLT25D2 | 20 | |
| SYTL3 | 60 | |
| DENND1B | 20 | |
| FLJ3710 | 80 | |
| C6orf98 | 100โ | |
| Fam69B | 73 | |
| EMID1 | โ20* | |
| KLRG2 | โ29** | |
| ERMP1 | โ69** | |
| VMO1 | โ20** | |
| *The antibody specifically stains secretion products of ovary tumor cells indicating that the corresponding protein is released by tumor cells. | ||
| **The antibody stains the plasma membrane of tumor cells |
Methods
The specificity of the antibodies for each target proteins was assessed by western blot and/or confocal microscopy analysis of eukaryotic cells transiently transfected with a plasmid construct containing the complete sequence of the gene encoding the target proteins. Examples of this type of confocal microscopy experiments are represented for SLC39A10 (corresponding to Transcript ID ENST00000359634), KLRG2 (two cloned sequences corresponding to Transcripts ENST00000340940 and ENST00000393039, corresponding to two transcript variants), ERMP1 (cloned sequence corresponding to Transcripts ENST00000339450).
For cloning, cDNA were generated from pools of total RNA derived from Human testis, Human placenta, Human bone marrow, Human fetal brain, in reverse transcription reactions and the entire coding regions were PCR-amplified with specific primers pairs. PCR products were cloned into plasmid pcDNA3 (Invitrogen). HeLa and Hek-293T cells were grown in DMEM-10% FCS supplemented with 1 mM Glutamine were transiently transfected with preparation of the resulting plasmid and with the empty vector as negative control using the Lipofectamine-2000 transfection reagent (Invitrogen). After 48 hours, cells were collected and analysed by Western blot or confocal microscopy. For Western blot, cells were lysed with PBS buffer containing 1% Triton X100 and total cell extracts (corresponding to 1ร106 cells) were separated on pre-cast SDS-PAGE gradient gels (NuPage 4-12% Bis-Tris gel, Invitrogen) under reducing conditions, followed by electro-transfer to nitrocellulose membranes (Invitrogen) according to the manufacturer's recommendations. The membranes were blocked in blocking buffer composed of 1รPBS-0.1% Tween 20 (PBST) added with 10% dry milk, for 1 h at room temperature, incubated with the antibody diluted 1:2500 in blocking buffer containing 1% dry milk and washed in PBST-1%. The secondary HRP-conjugated antibody (goat anti-mouse immunoglobulin/HRP, Perkin Elmer) was diluted 1:5000 in blocking buffer and chemiluminescence detection was carried out using a Chemidoc-IT UVP CCD camera (UVP) and the Western Lightningโข cheminulescence Reagent Plus (Perkin Elmer), according to the manufacturer's protocol.
For confocal microscopy analysis, the cells were plated on glass cover slips and after 48 h were washed with PBS and fixed with 3% p-formaldheyde solution in PBS for 20 min at RT. For surface staining, cells were incubated overnight at 4ยฐ C. with polyclonal antibodies (1:200). The cells were then stained with Alexafluor 488-labeled goat anti-mouse antibodies (Molecular Probes). DAPI (Molecular Probes) was used to visualize nuclei; Live/Deadยฎ red fixable (Molecular Probes) was used to visualize membrane. The cells were mounted with glycerol plastine and observed under a laser-scanning confocal microscope (LeicaSP5).
Results
The selected coding sequences for SLC39A10, KLRG2 and ERMP1 were cloned in a eukaryotic expression vector and the derived plasmids were used for transient transfection of HeLa or HEK293T cell lines. Expression of target proteins KLRG2 and ERMP1 was detected in total protein extracts from HeLa and HEK-293T cells, respectively, by Western blot using the protein-specific antibodies. Overall the data confirmed that the marker-specific antibodies recognized specifically their target proteins while no or marginal staining was visible in cell transfected with the empty pcDNA3. In the case of KLRG2, specific protein bands of expected size were detected in cells transfected with either of the two plasmids encoding the two annotated KLRG2 variants (FIG. 31A). As for cells transfected with ERMP1-encoding plasmid, a band of molecular mass higher than expected (theoretical mass of approximately 100 KDa) was specifically detected by the anti-ERMP1 antibody in transfected cells indicating that the protein forms stable aggregates (FIG. 35A). Expression of protein SLC3910 was carried by confocal microscopy of transfected HeLa cells. The anti-SLC39A10 antibody specifically detected its target protein expressed by transfected cells. In particular, the antibody mainly stained the surface of transfected cells (FIG. 3).
Expression of marker genes was assessed by WB and/or flow cytometry analysis of tumor cell lines. Cells were cultured in under ATCC recommended conditions, and sub-confluent cell monolayers were detached with PBS-0.5 mM EDTA for subsequent analysis. For Western blot analysis, cells were lysed by several freeze-thaw passages in PBS-1% Triton. Total protein extracts were loaded on SDS-PAGE (2ร105 cells/lane), and subjected to WB with specific antibodies as described above. For flow cytometry analysis, cells (2ร104 per well) were pelletted in 96 U-bottom microplates by centrifugation at 200รg for 5 min at 4ยฐ C. and incubated for 1 hour at 4ยฐ C. with the appropriate dilutions of the marker-specific antibodies. Cells were washed twice in PBS-5% FCS and incubated for 20 min with the appropriate dilution of R-Phycoerythrin (PE)-conjugated secondary antibodies (Jackson Immuno Research, PA, USA) at 4ยฐ C. After washing, cells were analysed by a FACS Canto II flow cytometer (Becton Dickinson). Data were analyzed with FlowJo 8.3.3 program.
Results
Western blot analysis of tumor cells lines is represented for KLRG2, ERMP1 and DPY19L3. Concerning KLRG2, two major protein bands were detected in the ovary tumor cell lines OVCAR-5 and OVCAR-8, that could be ascribed to the annotated protein variants (FIG. 31B). As regards ERMP1 a band of high molecular mass was detected in the OVCAR-4 cell line (FIG. 35B) showing an electrophoretic pattern similar to that reported in transfected cells (see previous example). This further confirms the existence of stable aggregates for this protein As for DPY19L3, a band of expected size was detected by the antibody on a panel of tumor cells lines (FIG. 10, left panel). Expression and localization analysis was also performed by surface staining and flow cytometry analysis of tumor cell lines. Results, represented for SLC39A10, KLRG2, DPY10L3 and ERMP1, show that these proteins were detected on the surface of ovary tumor cell lines by the marker-specific antibodies (FIGS. 4, 31C, 35C and FIG. 10 right panel).
To verify that the proteins included in the present invention can be exploited as targets for therapeutic applications, the effect of marker depletion was evaluated in vitro in cellular studies generally used to define the role of newly discovered proteins in tumor development. Marker-specific knock-down and control tumor cell lines were assayed for their proliferation and the migration/invasive phenotypes using the MTT assays and the Boyden in vitro invasion assay, respectively.
Method
Expression of marker genes were silenced in tumor cell lines by the siRNA technology and the influence of the reduction of marker expression on cell parameters relevant for tumor development was assessed in in vitro assays. The expression of marker genes was knocked down in a panel of epithelial tumor cell lines previously shown to express the tumor markers using a panel of marker-specific siRNAs (whose target sequence is reported in Table II) using the HiPerfect transfection reagent (QIAGEN) following the manufacturer's protocol. As control, cells treated with irrelevant siRNA (scrambled siRNA) were analysed in parallel. At different time points (ranging from 24 to 72 hours) post transfection, the reduction of gene transcription was assessed by quantitative RT-PCR (Q-RT-PCR) on total RNA, by evaluating the relative marker transcript level, using the beta-actin, GAPDH or MAPK genes as internal normalization control. Afterwards, cell proliferation and migration/invasiveness assays were carried out to assess the effect of the reduced marker expression. Cell proliferation was determined using the MTT assay, a colorimetric assay based on the cellular conversion of a tetrazolium salt into a purple colored formazan product. Absorbance of the colored solution can be quantified using a spectrophotometer to provide an estimate of the number of attached living cells. Approximately 5ร103 cells/100 ฮผl were seeded in 96-well plates in DMEM with 10% FCS to allow cell attachment. After overnight incubation with DMEM without FCS, the cells were treated with 2.5% FBS for 72 hours. Four hours before harvest 15 ฮผL of the MTT dye solution (Promega) were added to each well. After 4-hour incubation at 37ยฐ C., the formazan precipitates were solubilized by the addition of 100 ฮผL of solubilization solution (Promega) for 1 h at 37ยฐ C. Absorbance at 570 nm was determined on a multiwell plate reader (SpectraMax, Molecular Devices).
Cell migration/invasiveness was tested using the Boyden in vitro invasion assay, as compared to control cell lines treated with a scramble siRNA. This assay is based on a chamber of two medium-filled compartments separated by a microporous membrane. Cells are placed in the upper compartment and are allowed to migrate through the pores of the membrane into the lower compartment, in which chemotactic agents are present. After an appropriate incubation time, the membrane between the two compartments is fixed and stained, and the number of cells that have migrated to the lower side of the membrane is determined. For this assay, a transwell system, equipped with 8-ฮผm pore polyvinylpirrolidone-free polycarbonate filters, was used. The upper sides of the porous polycarbonate filters were coated with 50 ฮผg/cm2 of reconstituted Matrigel basement membrane and placed into six-well culture dishes containing complete growth medium. Cells (1ร104 cells/well) were loaded into the upper compartment in serum-free growth medium. After 16 h of incubation at 37ยฐ C., non-invading cells were removed mechanically using cotton swabs, and the microporous membrane was stained with Diff-Quick solution. Chemotaxis was evaluated by counting the cells migrated to the lower surface of the polycarbonate filters (six randomly chosen fields, meanยฑSD).
Results
Examples of this analysis are reported for ERMP1 and KLRG2 in MCF7 tumor cell line. Gene silencing experiments with marker-specific siRNA reduced the marker transcripts (approximately 30-40 fold reduction), as determined by Q-RT_PCR. Table II below reports the sequences targeted by the siRNA molecules. The reduction of the expression of either of the two genes expression significantly impairs the proliferation and the invasive phenotype of the MCF7 tumor cell line (FIGS. 32 and 36). This indicates that the proteins are involved in tumor development and are therefore likely targets for the development of anti-cancer therapies.
| TABLEโII |
| Sequencesโofโtheโmarker-specificโsiRNA |
| NCBIโgene | siRNAโTargetโSequence | |
| KLRG2 | CGAGGACAATCTGGATATCAA | |
| CTGGAGCCCTCGAGCAAGAAA | ||
| ERMP1 | CCCGTGGTTCATCTGATATAA | |
| AAGGACTTTGCTCGGCGTTTA | ||
| TACGTGGATGTTTGTAACGTA | ||
| CTCGTATTGGCTCAATCATAA | ||
1.-11. (canceled)
12. A method of treating a proliferative disease in a subject, the method comprising administering to the subject an antibody or a fragment thereof that specifically recognizes and binds to a KLRG2 protein.
13. The method of claim 12, wherein the proliferative disease is an ovarian cancer.
14. The method of claim 12, wherein the KLRG2 protein has an amino acid sequence that has at least 80% identity to SEQ ID NO: 85 or SEQ ID NO: 86.
15. The method of claim 12, wherein the KLRG2 protein has an amino acid sequence that has at least 90% identity to SEQ ID NO: 85 or SEQ ID NO: 86.
16. The method of claim 12, wherein the KLRG2 protein has an amino acid sequence that has at least 95% identity to SEQ ID NO: 85 or SEQ ID NO: 86.
17. The method of claim 12, wherein the KLRG2 protein has an amino acid sequence selected from SEQ ID NO: 85 or SEQ ID NO: 86.
18. The method of claim 12, wherein the antibody or fragment thereof modulates KLRG2 activity.
19. The method of claim 12, wherein the antibody or fragment thereof inhibits or abolishes KLRG2 activity.
20. The method of claim 12, wherein the antibody is a monoclonal antibody.
21. The method of claim 12, wherein the antibody is a polyclonal antibody.
22. The method of claim 12, wherein the antibody is labelled with a radioactive, fluorescent or enzyme label.
23. The method of claim 12 further comprising detecting the expression of KLRG2 protein in a tissue sample of the subject.
24. The method of claim 23, wherein the tissue sample is an ovarian tissue sample.
25. The method of claim 23, wherein the KLRG2 protein is detected by an immunoradiometric, immunoenzymatic or immunohistochemical assay.
26. The method of claim 12 further comprising detecting the expression of KLRG2 mRNA in a tissue sample of the subject.
27. The method of claim 26, wherein the tissue sample is an ovarian tissue sample.
28. The method of claim 26, wherein the KLRG2 mRNA is detected by polymerase chain reaction (PCR).
29. The method of claim 12, wherein the subject is a human.
30. A method of treating a proliferative disease in a subject, the method comprising administering to the subject a siRNA molecule that specifically silences KLRG2.
31. The method of claim 30, wherein the proliferative disease is an ovarian cancer.
32. The method of claim 30, wherein the siRNA molecule has a sequence complementary to SEQ ID NO: 87 or SEQ ID NO: 88.
33. The method of claim 29, wherein the subject is a human.