Patent application title:

ADAPTORS FOR NUCLEIC ACID CONSTRUCTS IN TRANSMEMBRANE SEQUENCING

Publication number:

US20200002761A1

Publication date:
Application number:

16/568,781

Filed date:

2019-09-12

Abstract:

The invention relates to adaptors for sequencing nucleic acids. The adaptors may be used to generate single stranded constructs of nucleic acid for sequencing purposes. Such constructs may contain both strands from a double stranded deoxyribonucleic acid (DNA) or ribonucleic acid (RNA) template. The invention also relates to the constructs generated using the adaptors, methods of making the adaptors and constructs, as well as methods of sequencing double stranded nucleic acids.

Inventors:

Assignee:

Interested in similar patents?

Get notified when new applications in this technology area are published.

Classification:

C12Q1/6869 »  CPC main

Measuring or testing processes involving enzymes, nucleic acids or microorganisms ; Compositions therefor; Processes of preparing such compositions involving nucleic acids Methods for sequencing

Description

FIELD OF THE INVENTION

The invention relates to adaptors for sequencing nucleic acids. The adaptors may be used to generate single stranded constructs of nucleic acid for sequencing purposes. Such constructs may contain both strands from a double stranded deoxyribonucleic acid (DNA) or ribonucleic acid (RNA) template. The invention also relates to the constructs generated using the adaptors, methods of making the adaptors and constructs, as well as methods of sequencing double stranded nucleic acids.

BACKGROUND OF THE INVENTION

Stochastic detection is an approach to sensing that relies on the observation of individual binding events between analyte molecules and a receptor. Stochastic sensors can be created by placing a single pore of nanometer dimensions in an insulating membrane and measuring voltage-driven ionic transport through the pore in the presence of analyte molecules. The frequency of occurrence of fluctuations in the current reveals the concentration of an analyte that binds within the pore. The identity of an analyte is revealed through its distinctive current signature, notably the duration and extent of current block (Braha, O., Walker, B., Cheley, S., Kasianowicz, J. J., Song, L., Gouaux, J. E., and Bayley, H. (1997) Chem. Biol. 4, 497-505; and Bayley, H., and Cremer, P. S. (2001) Nature 413, 226-230).

Engineered versions of the bacterial pore forming toxin α-hemolysin (α-HL) have been used for stochastic sensing of many classes of molecules (Bayley, H., and Cremer, P. S. (2001) Nature 413, 226-230; Shin, S., H., Luchian, T., Cheley, S., Braha, O., and Bayley, H. (2002) Angew. Chem. Int. Ed. 41, 3707-3709; and Guan, X., Gu, L.-Q., Cheley, S., Braha, O., and Bayley, H. (2005) Chem Bio Chem 6, 1875-1881). In the course of these studies, it was found that attempts to engineer α-HL to bind small organic analytes directly can prove taxing, with rare examples of success (Guan, X., Gu, L.-Q., Cheley, S., Braha, O., and Bayley, H. (2005) Chem Bio Chem 6, 1875-1881). Fortunately, a different strategy was discovered, which utilised non-covalently attached molecular adaptors, notably cyclodextrins (Gu, L.-Q., Braha, O., Conlan, S., Cheley, S., and Bayley, H. (1999) Nature 398, 686-690), but also cyclic peptides (Sanchez-Quesada, J., Ghadiri, M. R., Bayley, H., and Braha, O. (2000) J. Am. Chem. Soc. 122, 11758-11766) and cucurbiturils (Braha, O., Webb, J., Gu, L.-Q., Kim, K., and Bayley, H. (2005) Chem Phys Chem 6, 889-892). Cyclodextrins become transiently lodged in the α-HL pore and produce a substantial but incomplete channel block. Organic analytes, which bind within the hydrophobic interiors of cyclodextrins, augment this block allowing analyte detection (Gu, L.-Q., Braha, O., Conlan, S., Cheley, S., and Bayley, H. (1999) Nature 398, 686-690).

There is currently a need for rapid and cheap DNA or RNA sequencing technologies across a wide range of applications. Existing technologies are slow and expensive mainly because they rely on amplification techniques to produce large volumes of nucleic acid and require a high quantity of specialist fluorescent chemicals for signal detection. Stochastic sensing has the potential to provide rapid and cheap DNA sequencing by reducing the quantity of nucleotide and reagents required.

SUMMARY OF THE INVENTION

The inventor(s) have surprisingly demonstrated that artificial, identifiable adaptors may be used to generate single stranded nucleic acid constructs that contain both strands of a double stranded nucleic acid template. The two strands of the template are covalently linked and delineated (divided) by an adaptor. The adaptor not only allows the transition point from one strand to the other strand to be identified, but also allows the construct to be purified before it is sequenced. The adaptor may further allow the construct to be differentiated from similar constructs in which the strands have a different source. Hence, the adaptors allow multiplex sequence analysis of templates originating from separate individual sources.

The adaptors are particularly useful for sequencing double stranded DNA (dsDNA) and double stranded RNA (dsRNA). The adaptors may be used to generate single stranded constructs containing both the sense and antisense strands of the dsDNA or dsRNA.

The adaptors are generally used in pairs. Both types of adaptor in the pair not only comprise a region of double stranded nucleic acid that forms one half of a palindromic cleavage site, but also are differentially selectable from one another. Each pair comprises two types of adaptor; Type I and Type II. Type I adaptors comprise a hairpin loop, which allows covalent linkage of the two strands in a double stranded nucleic acid template. Type II adaptors may comprise a hairpin loop, but do not have to. This combination of features allows the generation and purification of single stranded constructs in which both strands of a double stranded nucleic acid template are covalently linked via a Type I adaptor. Unwanted constructs formed by ligation of adaptors with each other may be eliminated from the reaction mixture using the palindromic cleavage site. Similarly, constructs containing one or other of the two types of adaptor may be isolated from the reaction mixture using the adaptor's differential selectability.

Accordingly, the invention provides an adaptor for sequencing nucleic acids, which comprises a region of double stranded nucleic acid, wherein at least one end of the region forms one half of a palindromic cleavage site and wherein the adaptor is differentially selectable from another adaptor. In some embodiments, the region is formed by hybridization between two separated regions of a single stranded nucleic acid and the adaptor comprises a hairpin loop.

The invention also provides:

    • a pair of adaptors comprising an adaptor of the invention formed by hybridization between two separated regions of a single stranded nucleic acid and comprising a hairpin loop (Type I) and an adaptor of the invention (Type II), wherein each type of adaptor in the pair is differentially selectable from the other type and wherein a complete palindromic cleavage site is formed if any combination of the two types of adaptor are ligated to one another;
    • a kit comprising at least two populations of adaptors of the invention, wherein every adaptor in each population comprises a nucleic acid sequence that is specific for the population;
    • a nucleic acid construct for use as a sequencing template comprising a double stranded nucleic acid ligated to at least one adaptor of the invention;
    • a single stranded nucleic acid construct for use as a sequencing template comprising two strands of nucleic acid covalently linked via an adaptor of the invention formed by hybridization between two separated regions of a single stranded nucleic acid and comprising a hairpin loop;
    • a circular nucleic acid construct for use as a sequencing template comprising two strands of nucleic acid covalently linked at each end via an adaptor of the invention formed by hybridization between two separated regions of a single stranded nucleic acid and comprising a hairpin loop; a method for preparing an adaptor of the invention, comprising:

(a) providing two nucleic acids that are (i) capable of hybridizing to one another to form one half of a palindromic cleavage site and (ii) differentially selectable from those of another adaptor; and

(b) contacting the nucleic acids under conditions which allow them to hybridise and thereby preparing an adaptor;

    • a method for preparing an adaptor of the invention formed by hybridization between two separated regions of a single stranded nucleic acid and comprising a hairpin loop, comprising:

(a) providing a single stranded nucleic acid comprising (i) two regions that are capable of hybridizing to one another, (ii) a loop-forming region that is differentially selectable from that of another adaptor and (iii) two ends which together form one half of a palindromic cleavage site; and

(b) exposing the nucleic acid to conditions which allow the two regions to hybridise and form a hairpin loop and thereby preparing an adaptor;

    • a method for preparing a nucleic acid construct of the invention, comprising:

(a) contacting at least one adaptor of the invention with two strands of nucleic acid under conditions which allow ligation between the adaptor(s) and the strands; and

(b) allowing the adaptor to ligate to the two strands and thereby preparing a nucleic acid construct;

    • a method for preparing a single stranded nucleic acid construct of the invention, comprising:

(a) contacting an adaptor of the invention formed by hybridization between two separated regions of a single stranded nucleic acid and comprising a hairpin loop with two strands of nucleic acid under conditions which allow ligation between the adaptor and the strands;

(b) allowing the adaptor to covalently link the two strands; and

(c) denaturing the covalently linked construct and thereby preparing a single stranded nucleic acid construct;

    • a method for preparing a circular nucleic acid construct of the invention, comprising:

(a) contacting at least two adaptors of the invention which comprise a hairpin loop with two strands of nucleic acid under conditions which allow ligation between the adaptors and strands; and

(b) allowing an adaptor to covalently link the two strands at each end and thereby preparing a circular nucleic acid construct;

    • a method for preparing a sequence construct, comprising:

(a) providing double stranded nucleic acid;

(b) contacting the double stranded nucleic acid with a pair of adaptors of the invention in which the Type I adaptors are not capable of being cleaved or nicked and the Type II adaptors are capable of being cleaved or nicked under conditions which allow the adaptors to ligate to the nucleic acid;

(c) contacting the ligated products with a surface that specifically binds the Type II adaptors and removing any unbound products;

(d) contacting the surface with an enzyme that recognises the complete palindromic cleavage site and removing any unbound products;

(e) cleaving the Type II adaptors;

(f) contacting the soluble products produced in step (e) with a surface that specifically binds the Type I adaptors and removing any unbound products; and

(g) releasing from the surface the products remaining following step (f) and thereby producing a sequencing construct;

a method of sequencing double stranded nucleic acid, comprising:

(a) carrying out a method of the invention;

(b) denaturing the construct, if necessary, to form a single stranded construct; and

(c) sequencing the single stranded construct and thereby sequencing the double stranded nucleic acid; and

    • a kit for sequencing double stranded nucleic acid comprising a pair of adaptors of the invention and means for cleaving the palindromic cleavage sites.

DESCRIPTION OF THE FIGURES

FIG. 1 shows one embodiment of a Type I adaptor. The single stranded DNA strand has self complementarity such that it will hybridise to itself, leaving a large hairpin loop of single stranded DNA, which is used to selectively bind the ā€˜Type I adaptor’ ligation products during the purification. The terminus of the self hybridised adaptor encodes one half of the primary Restriction Endonuclease (arrowed, 1ry), utilised to cleave any ligation products created by adaptor:adaptor ligations, whether Type I:Type I, Type I:Type II or Type II:Type II.

FIG. 2 shows one embodiment of a Type II adaptor. In this Figure and all subsequent Figures, the Type II adaptor comprises a hairpin loop. The single stranded DNA is punctuated by a Biotin-dT base (starburst) which when the strand self-hybridises, is presented in the single stranded ā€˜bubble’ region. This biotin is a selectable characteristic of only those ligation products which include a Type II adaptor. The double stranded element of this adaptor includes a recognition sequence of the secondary Restriction Endonuclease, and (in common with the Type I adaptor) is terminated with one half of the primary Restriction Endonuclease recognition sequence, to enable elimination of adaptor:adaptor ligation products, as previously.

FIG. 3 shows two types of hairpin adaptor (black; Type I and dark grey; Type II) are combined with blunt ended template dsDNA (light grey). Box A shows the ideal situation where one Type I and one Type II adaptor are ligated onto either end of an intervening template DNA sequence. Box B depicts that if there is no intervening template, an undesirable ligation product is generated. The presence of a primary RE restriction recognition site (solid line box) within the ligated product is useful for the selective destruction of the undesirable ligation product. An alternative secondary RE restriction site (dotted box) within the Type II adaptor is used to liberate the sequencing template (see below). ā€˜B’ indicates the presence of a biotin moiety included upon the single stranded element of the Type II adaptor.

FIG. 4 shows the generation of closed circular ā€˜DNA Dumbells’ commences with conventional random fragmentation of high molecular weight template DNA. Only a proportion of the fragments generated will carry extendable 3′OH underhang on both strands, which can be end repaired by DNA polymerase. A still smaller number of the repaired fragments will additionally have 5′ PO4 ends on both strands. Although small in number, any such blunt ended fragments will be receptive to the ligation of artificial hairpin loop adaptors, which form the requisite closed circular templates for exonuclease sequencing on both strands.

FIG. 5 shows the post-ligation of the Type I and Type II adaptors. The desired product for sequencing can be purified using the indicated procedure: Black lines represent ā€˜Type I’ adaptors; Dark Grey lines represent biotinylated ā€˜Type II’ adaptors; Light Grey lines indicate template DNA. Crosshatched arrows indicate an operation without transfer to a fresh plate. Empty arrows indicate transfer of the contents of the previous well to a fresh plate. (1) Post ligation, the products are pipetted into an immobilised streptavidin plate. Only those ligation products harbouring a biotinylated Type II adaptor will bind. (2) Washing the plate will remove all Type I/Type I ligation products, etc. (3) Incubation with the ā€˜adaptor ligated to adaptor’ primary restriction endonuclease will cleave the ā€˜adaptor/adaptor’ products. (4) Wash away all of the restriction debris from the primary RE digestion. (5) Incubation with the ā€˜Type II adaptor’ encoded secondary restriction endonuclease will cleave the bound Type II adaptor products. (6) Transfer the secondary RE digestion products to a fresh plate, onto which ssDNA complementary to the Type I single stranded hairpin ā€˜bubble’ has been immobilised. Allow hybridisation of those RE fragments from 5 to the immobilised ssDNA. (7) Wash away any unbound material, leaving the only species retained as the desired ā€˜Type I adaptor ligated to template DNA’. (8) Using conditions which defeat the hybridisation of the ligation product to the immobilised DNA (heat, NaOH or any other means known in the art), transfer the desired product to a fresh tube/plate for subsequent denaturation and sequencing.

FIG. 6 shows the treatment of the captured dumbbell structure (FIG. 1, A) with the enzyme encoded in the hybridised region of the Type II adaptor releases a covalently closed structure as depicted here (left). Treatment of this structure with a denaturant yields a single stranded structure (right) susceptible to exonuclease I digestion, which if processive, will liberate nucleotides from the DNA to be interrogated, the linking artificial sequence nucleotides and then the reverse complement nucleotides, which can be compared with the base calls already made. Combination of the calls generates a consensus call of greater quality.

FIG. 7 shows an example of the single stranded product that is recovered from the plate is digested by exonuclease to liberate 5′ monophosphate nucleosides that elicit a change in the current flow through an adaptor modified α-HL protein pore. The order in which the ā€˜bases’ are released and identified is sequential.

DESCRIPTION OF THE SEQUENCE LISTING

SEQ ID NO: 1 shows the polynucleotide sequence encoding one subunit of wild type α-hemolysin (α-HL).

SEQ ID NO: 2 shows the amino acid sequence of one subunit of wild type α-HL. Amino acids 2 to 6, 73 to 75, 207 to 209, 214 to 216 and 219 to 222 form α-helices. Amino acids 22 to 30, 35 to 44, 52 to 62, 67 to 71, 76 to 91, 98 to 103, 112 to 123, 137 to 148, 154 to 159, 165 to 172, 229 to 235, 243 to 261, 266 to 271, 285 to 286 and 291 to 293 form β-strands. All the other non-terminal amino acids, namely 7 to 21, 31 to 34, 45 to 51, 63 to 66, 72, 92 to 97, 104 to 111, 124 to 136, 149 to 153, 160 to 164, 173 to 206, 210 to 213, 217, 218, 223 to 228, 236 to 242, 262 to 265, 272 to 274 and 287 to 290 form loop regions. Amino acids 1 and 294 are terminal amino acids.

SEQ ID NO: 3 shows the polynucleotide sequence encoding one subunit of α-HL M113R/N139Q (HL-RQ).

SEQ ID NO: 4 shows the amino acid sequence of one subunit of α-HL M113R/N139Q (HL-RQ). The same amino acids that form α-helices, β-strands and loop regions in wild type α-HL form the corresponding regions in this subunit.

SEQ ID NO: 5 shows the codon optimised polynucleotide sequence derived from the sbcB gene from E. coli. It encodes the exonuclease I enzyme (EcoExol) from E. coli.

SEQ ID NO: 6 shows the amino acid sequence of exonuclease I enzyme (EcoExol) from E. coli. This enzyme performs processive digestion of 5′ monophosphate nucleosides from single stranded DNA (ssDNA) in a 3′- 5′ direction. Amino acids 60 to 68, 70 to 78, 80 to 93, 107 to 119, 124 to 128, 137 to 148, 165 to 172, 182 to 211, 213 to 221, 234 to 241, 268 to 286, 313 to 324, 326 to 352, 362 to 370, 373 to 391, 401 to 454 and 457 to 475 form α-helices. Amino acids 10 to 18, 28 to 26, 47 to 50, 97 to 101, 133 to 136, 229 to 232, 243 to 251, 258 to 263, 298 to 302 and 308 to 311 form β-strands. All the other non-terminal amino acids, 19 to 27, 37 to 46, 51 to 59, 69, 79, 94 to 96102 to 106, 120 to 123, 129 to 132, 149 to 164, 173 to 181, 212, 222 to 228 233, 242, 252 to 257, 264 to 267, 287 to 297, 303 to 307, 312, 325, 353 to 361, 371, 372, 392 to 400, 455 and 456, form loops Amino acids 1 to 9 are terminal amino acids. The overall fold of the enzyme is such that three regions combine to form a molecule with the appearance of the letter C, although residues 355-358, disordered in the crystal structure, effectively convert this C into an O-like shape. The amino terminus (1-206) forms the exonuclease domain and has homology to the DnaQ superfamily, the following residues (202-354) form an SH3-like domain and the carboxyl domain (359-475) extends the exonuclease domain to form the C-like shape of the molecule. Four acidic residues of EcoExol are conserved with the active site residues of the DnaQ superfamily (corresponding to D15, E17, D108 and D186). It is suggested a single metal ion is bound by residues D15 and 108. Hydrolysis of DNA is likely catalyzed by attack of the scissile phosphate with an activated water molecule, with H181 being the catalytic residue and aligning the nucleotide substrate.

SEQ ID NO: 7 shows the codon optimised polynucleotide sequence derived from the recJ gene from T. thermophilus. It encodes the RecJ enzyme from T. thermophilus (TthRecJ-cd).

SEQ ID NO: 8 shows the amino acid sequence of the RecJ enzyme from T thermophilus (TthRecJ-cd). This enzyme performs processive digestion of 5′ monophosphate nucleosides from ssDNA in a 5′-3′ direction. Enzyme initiation on a strand requires at least 4 nucleotides. Amino acids 19 to 33, 44 to 61, 80 to 89, 103 to 111, 136 to 140, 148 to 163, 169 to 183, 189 to 202, 207 to 217, 223 to 240, 242 to 252, 254 to 287, 302 to 318, 338 to 350 and 365 to 382 form α-helices. Amino acids 36 to 40, 64 to 68, 93 to 96, 116 to 120, 133 to 135, 294 to 297, 321 to 325, 328 to 332, 352 to 355 and 359 to 363 form β-strands. All the other non-terminal amino acids, 34, 35, 41 to 43, 62, 63, 69 to 79, 90 to 92, 97 to 102, 112 to 115, 121 to 132, 141 to 147, 164 to 168, 184 to 188203 to 206, 218 to 222, 241, 253, 288 to 293, 298 to 301, 319, 320, 326, 327, 333 to 337, 351 to 358 and 364, form loops. Amino acids 1 to 18 and 383 to 425 are terminal amino acids. The crystal structure has only been resolved for the core domain of RecJ from Thermus thermophilus (residues 40-463). To ensure initiation of translation and in vivo expression of the RecJ core domain a methionine residue was added at its amino terminus, this is absent from the crystal structure information. The resolved structure shows two domains, an amino (2-253) and a carboxyl (288-463) region, connected by a long α-helix (254-287). The catalytic residues (D46, D98, 11122, and D183) co-ordinate a single divalent metal ion for nucleophilic attack on the phosphodiester bond. D46 and H120 proposed to be the catalytic pair; however, mutation of any of these conserved residues in the E. coli. RecJ was shown to abolish activity.

SEQ ID NO: 9 shows the sequence of the I-SceI homing endonuclease recognition site.

SEQ ID NO: 10 shows the nucleic sequence from which preferred nucleic acid linkers can be generated.

SEQ ID NO: 11 shows a preferred nucleic acid linker. MAL is maleimide. This linker is used in combination with SEQ ID NO: 14.

SEQ ID NO: 12 shows a preferred nucleic acid linker. MAL is maleimide. This linker is used in combination with SEQ ID NO: 15.

SEQ ID NO: 13 shows a preferred nucleic acid linker. MAL is maleimide. This linker is used in combination with SEQ ID NO: 16.

SEQ ID NO: 14 shows a preferred 15 mer nucleic acid linker. MAL is maleimide. This linker is complementary to and used in combination with SEQ ID NO: 11.

SEQ ID NO: 15 shows a preferred 15 mer nucleic acid linker. MAL is maleimide. This linker is complementary to and used in combination with SEQ ID NO: 12.

SEQ ID NO: 16 shows a preferred 15 mer nucleic acid linker. MAL is maleimide. This linker is complementary to and used in combination with SEQ ID NO: 13.

DETAILED DESCRIPTION OF THE INVENTION

It is to be understood that different applications of the disclosed products and methods may be tailored to the specific needs in the art. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments of the invention only, and is not intended to be limiting.

In addition as used in this specification and the appended claims, the singular forms ā€œaā€, ā€œanā€, and ā€œtheā€ include plural referents unless the content clearly dictates otherwise. Thus, for example, reference to ā€œa constructā€ includes ā€œconstructsā€, reference to ā€œa transmembrane poreā€ includes two or more such pores, reference to ā€œa molecular adaptorā€ includes two or more such adaptors, and the like.

All publications, patents and patent applications cited herein, whether supra or infra, are hereby incorporated by reference in their entirety.

Adaptor

The invention provides adaptors for sequencing nucleic acids. The adaptors comprise a region of double stranded nucleic acid. At least one end of the region forms one half of a palindromic cleavage site. The adaptors are differentially selectable from other adaptors. In some embodiments, the region is formed by hybridization between two separated regions of a single stranded nucleic acid and the adaptors comprise a hairpin loop. Adaptors of the invention are typically used as part of a pair of adaptors.

The adaptors of the invention have several advantages. The adaptors facilitate construction, purification and final release of a desired single stranded sequencing construct, which comprises both strands of a double stranded nucleic acid template. This ensures that, when the construct is sequenced, each position in the double stranded nucleic acid is not merely observed once, but is in fact interrogated twice. This gives greater certainty that each position in the nucleic acid has been observed and that the aggregate call for both bases at each position is of a greater quality score than would be possible with a single observation. In other words, the key advantage of the adaptors of the invention is that they allow each ā€˜base pair’ position of a double stranded template to be effectively interrogated twice as part of the same ā€˜read event’. This ensures that the quality of the sequence generated is consequently very much higher, with a reduced potential for misidentified base calls, or completely missed bases.

This is particularly helpful for the sequencing of dsDNA or dsRNA. The adaptors of the invention allow the production of constructs containing both the sense and antisense strands of dsDNA and dsRNA. Each ā€˜base pair’ position of the dsDNA or dsRNA can effectively be interrogated twice; once on the sense strand and once on the antisense strand.

This ability to interrogate each position twice is particularly important when sequencing nucleic acids using stochastic sensing. Such sequencing normally depends on the capture of every base in turn by the transmembrane pore and a sufficiently high sampling rate to enable accurate determination of the degree to which the current flowing through the pore is reduced. Being able to effectively interrogate every base twice reduces the need to capture every base at a sufficiently high rate.

In addition, the adaptors of the invention allow the nucleic acid to be provided in a form suitable for stochastic sensing. Only single stranded nucleic acids can be threaded through transmembrane pores. In addition, many nucleic acid handling enzymes, which are an integral part of the sequencing methods described herein, are capable of only handling single stranded nucleic acids.

The ability to interrogate each position twice is also helpful for differentiating between methylcytosine and thymine using stochastic sensing. These two bases result in very similar current traces when they pass through and interact with a transmembrane pore. It can therefore be difficult to differentiate between the two. However, interrogation of each position in a nucleic acid twice will allow such differentiation because the complementary base for methylcytosine is guanine, whereas the complementary base for thymine is adenine. Methylcytosine has of course been linked with various diseases, including cancer.

Being artificial sequences, the adaptors of the invention have a great degree of flexibility in their actual sequence and therefore functionality can be built into the sequences used. For instance, an adaptor-specific sequence can be built into each adaptor. This allows a construct containing a particular adaptor to be differentiated from one containing a different adaptor. This is particularly helpful for multiplex sequence analysis of templates originating from separate individual sources.

The adaptors are for sequencing nucleic acids. The adaptors are preferably for sequencing a double stranded nucleic acid by generating a single stranded nucleic acid construct that contains both strands of the double stranded nucleic acid template. The adaptors are more preferably for sequencing dsDNA or dsRNA by generating a single stranded nucleic acid construct that contains both the sense and antisense strands of the dsDNA or dsRNA.

Region of Double Stranded Nucleic Acid

The adaptors comprise a region of double stranded nucleic acid. The presence of this region means that the adaptors of the invention are capable of ligating to other double stranded nucleic acids, such as dsDNA or dsRNA. The adaptors of the invention are also capable of ligating to themselves or other types of adaptors. As described in more detail below, such ligation will result in the formation of a complete palindromic cleavable site. Suitable conditions that allow the ligation of the adaptors of the invention to double stranded nucleic acids or themselves are discussed below.

The region of double stranded nucleic acid may comprise any type of nucleic acid._A nucleic acid is a macromolecule comprising two or more nucleotides. The nucleic acid handled may comprise any combination of any nucleotides. The nucleotides can be naturally occurring or artificial. A nucleotide typically contains a nucleobase, a sugar and at least one phosphate group. The nucleobase is typically heterocyclic. Nucleobases include, but are not limited to, purines and pyrimidines and more specifically adenine, guanine, thymine, uracil and cytosine. The sugar is typically a pentose sugar. Nucleotide sugars include, but are not limited to, ribose and deoxyribose. The nucleotide is typically a ribonucleotide or deoxyribonucleotide. The nucleotide typically contains a monophosphate, diphosphate or triphosphate. Phosphates may be attached on the 5′ or 3′ side of a nucleotide.

Nucleotides include, but are not limited to, adenosine monophosphate (AMP), adenosine diphosphate (ADP), adenosine triphosphate (ATP), guanosine monophosphate

(GMP), guanosine diphosphate (GDP), guanosine triphosphate (GTP), thymidine monophosphate (TMP), thymidine diphosphate (TDP), thymidine triphosphate (TTP), uridine monophosphate (UMP), uridine diphosphate (UDP), uridine triphosphate (UTP), cytidine monophosphate (CMP), cytidine diphosphate (CDP), cytidine triphosphate (CTP), cyclic adenosine monophosphate (cAMP), cyclic guanosine monophosphate (cGMP), deoxyadenosine monophosphate (dAMP), deoxyadenosine diphosphate (dADP), deoxyadenosine triphosphate (dATP), deoxyguanosine monophosphate (dGMP), deoxyguanosine diphosphate (dGDP), deoxyguanosine triphosphate (dGTP), deoxythymidine monophosphate (dTMP), deoxythymidine diphosphate (dTDP), deoxythymidine triphosphate (dTTP), deoxyuridine monophosphate (dUMP), deoxyuridine diphosphate (dUDP), deoxyuridine triphosphate (dUTP), deoxycytidine monophosphate (dCMP), deoxycytidine diphosphate (dCDP) and deoxycytidine triphosphate (dCTP). The nucleotides are preferably selected from AMP, TMP, GMP, CMP, UMP, dAMP, dTMP, dGMP or dCMP.

The nucleic acid can be deoxyribonucleic acid (DNA) or ribonucleic acid (RNA). The nucleic acid may include two strands of any synthetic nucleic acid known in the art, such as peptide nucleic acid (PNA), glycerol nucleic acid (GNA), threose nucleic acid (TNA), locked nucleic acid (LNA) or other synthetic polymers with nucleotide side chains. When sequencing a double stranded nucleic acid template, the nucleic acid in the adaptor is chosen such that the adaptors are capable of ligating to the double stranded nucleic acid being sequenced.

The region of double stranded nucleic acid may be any length as long as the palindromic cleavage site is functional when two adaptors ligate together. The region will typically be 40 or fewer base pairs, such as 30 or fewer base pairs, 20 or fewer base pairs or 10 or fewer base pairs, in length. The region is preferably 5 to 20 base pairs in length and more preferably 6 to 10 base pairs in length.

The region may be formed by hybridization of two separate strands of single stranded nucleic acid. The two separate strands may be the same type of nucleic acid or different types of nucleic acid as long as they hybridise. The two separate strands can be any of the types of nucleic acid described above. Suitable conditions that allow hybridization of nucleic acids are discussed in more detail below.

The region of double stranded nucleic acid is preferably formed by hybridization of two separated regions of a single stranded nucleic acid such that the adaptor comprises a hairpin loop. In the context of the invention, Type I adaptors comprise a hairpin loop. This allows Type I adaptors to covalently link two strands of a double nucleic acid template. Type II adaptors may or may not comprise a hairpin loop. It is preferred that the Type II adaptors comprise a hairpin loop. The formation of hairpin loops is known in the art. The hairpin loop is typically formed from single stranded nucleic acid. The hairpin loop may be the same type of nucleic acid as that making up the region of double stranded nucleic acid. Alternatively, the hairpin loop may be a different type of nucleic acid from that making up the region of double stranded nucleic acid. The hairpin loop can be any of the types of nucleic acid described above. As discussed in more detail below, the hairpin loop may be involved in the differential selectability of the adaptors of the invention. For instance, the hairpin loop may comprise a selectable binding moiety.

The hairpin loop may be any length. The hairpin loop is typically 50 or fewer bases, such as 40 or fewer bases, 30 or fewer bases, 20 or fewer bases or 10 or fewer bases, in length. The hairpin loop is preferably from about 1 to 50, from 2 to 40 or from 6 to 30 bases in length. Longer lengths of the hairpin loop, such as from 15 to 50 bases, are preferred if the loop is involved in the differential selectability of the adaptor. Similarly, shorter lengths of the hairpin loop, such as from 1 to 5 bases, are preferred if the loop is not involved in the differential selectability of the adaptor.

In adaptors without a hairpin loop, the region of double stranded nucleic acid will have two free ends. One or both of these ends may ligate to a double stranded nucleic acid template. At least one end forms one half of a palindromic cleavage site. Both ends preferably form one half of the same palindromic cleavage site. One or both ends may also be involved in the differential selectability of the adaptors of the invention. Preferably, one end of the adaptor may ligate to a double stranded nucleic acid template and forms one half of a palindromic cleavage site and the other end is involved in the differential selectability of the adaptor.

In adaptors with a hairpin loop, the region of double stranded nucleic acid will have only one free end. The other end is closed by the hairpin loop. The free end not only forms one half of a palindromic cleavage site, but also may ligate to a double stranded nucleic acid template.

The free end(s) of the region of double stranded nucleic acid may be in any form. The end(s) can be sticky. In other words, the end(s) do not have to form a base pair. The sticky end(s) may have a 5′ or 3′ overhang. It is preferred that the end(s) are blunt. In other words, it is preferred that the end(s) form a base pair. It is particularly preferred that the end(s) of the region forming one half of a palindromic cleavage site are blunt.

In adaptors without a hairpin loop, it is preferred that the end that ligates to a double stranded nucleic acid template and forms one half of a palindromic cleavage site is blunt and the other end that is involved in the differential selectability of the adaptor is sticky.

One Half of a Palindromic Cleavage Site

A palindromic cleavage site is a palindromic consensus sequence in a nucleic acid that may be cleaved in some manner. Several such sequences are known in the art and may be used in the invention. Preferred palindromic cleavage sites are shown below.

One half of a palindromic cleavage site is exactly one half of a palindromic consensus sequence. In other words, it is the amount of a palindromic cleavage site that when recombined with itself forms a complete palindromic cleavage site. As discussed above, the ends forming the one half of the palindromic cleavage site may be sticky or blunt. For instance, for a palindromic cleavage site having the following sequence:

5′ .ā€ƒ.ā€ƒ.ā€ƒAAAATTTTā€ƒ.ā€ƒ.ā€ƒ.ā€ƒ3′
3′ .ā€ƒ.ā€ƒ.ā€ƒTTTTAAAAā€ƒ.ā€ƒ.ā€ƒ.ā€ƒ5′

one half of the palindromic cleavage site can be

5′ .ā€ƒ.ā€ƒ.ā€ƒAAAAā€ƒ.ā€ƒ.ā€ƒ.ā€ƒ3′
3′ .ā€ƒ.ā€ƒ.ā€ƒTTTTā€ƒ.ā€ƒ.ā€ƒ.ā€ƒ5′
or
5′ .ā€ƒ.ā€ƒ.ā€ƒAAAATā€ƒ.ā€ƒ.ā€ƒ.ā€ƒ3′
3′ .ā€ƒ.ā€ƒ.ā€ƒTTTā€ƒ.ā€ƒ.ā€ƒ.ā€ƒ5′
or
5′ .ā€ƒ.ā€ƒ.ā€ƒAAAā€ƒ.ā€ƒ.ā€ƒ.ā€ƒ3′
3′ .ā€ƒ.ā€ƒ.ā€ƒTTTTAā€ƒ.ā€ƒ.ā€ƒ.ā€ƒ5′

In the examples above, the first one half of the palindromic cleavage site has blunt ends, while the second two one halves of the palindromic cleavage site have sticky ends.

As discussed above, the adaptors of the invention are typically used in pairs with one type of adaptor in the pair being differentially selectable from the other type of adaptor in the pair. Since both types adaptors in the pair comprise one half a palindromic cleavage site, a complete palindromic cleavage site is formed when one type of adaptor ligates with an adaptor of the same type or of a different type. For instance, a complete palindromic cleavage site will be formed if Type I ligates to Type I (Type I:Type I), Type II ligates to Type II (Type II:Type II) or Type I ligates to Type II (Type I:Type II). The formation of a complete palindromic cleavage site allows the ligated adaptors to be cleaved. This is discussed in more detail below.

The complete palindromic cleavage site may be any length. For instance, palindromic cleavage sites are typically from 8 to 50 base pairs, such as at least 10 base pairs, at least 12 base pairs, at least 14 base pairs, at least 16 base pairs, at least 20 base pairs, at least 30 base pairs or at least 40 base pairs, in length. For sequencing purposes, the longer the palindromic cleavage site the better because the less likely the sequence will appear randomly in an organism's genome. In a completely random genome sequence (which of course is never found in nature), a palindromic cleavage site of x base pairs in length would be found once every 4x base pairs.

Preferred palindromic cleavage sites include restriction endonuclease recognition sites. Restriction endonuclease recognition sites are sites that are cleaved by restriction endonuclease enzymes. Suitable restriction endonuclease enzymes for use in the invention include, but are not limited to, those in Enzyme Classification (EC) groups 3.1.21.4 and 3.1.21.5.

The restriction endonuclease recognition site may be a naturally occurring site that is cleaved by a naturally occurring restriction endonuclease enzyme. Alternatively, the restriction endonuclease recognition site and/or the restriction endonuclease may be non-naturally occurring. Engineering a restriction endonuclease recognition site and/or a restriction endonuclease for use in the invention offers various advantages. For instance, engineering an endonuclease to cleave a long and/or rare site means that the endonuclease is less likely to ā€œaccidentallyā€ cleave one or more sites with the double stranded nucleic acid template being interrogated.

Preferred restriction endonuclease recognition sites include, but are not limited to, the following:

Sbflā€ƒ5′ .ā€ƒ.ā€ƒ.ā€ƒCCTGCAGGā€ƒ.ā€ƒ.ā€ƒ.ā€ƒ3′
3′ .ā€ƒ.ā€ƒ.ā€ƒGGACGTCCā€ƒ.ā€ƒ.ā€ƒ.ā€ƒ5′
and
AsiSIā€ƒ5′ .ā€ƒ.ā€ƒ.ā€ƒGCGATCGCā€ƒ.ā€ƒ.ā€ƒ.ā€ƒ3′
3′ .ā€ƒ.ā€ƒ.ā€ƒCGCTAGCGā€ƒ.ā€ƒ.ā€ƒ.ā€ƒ5′

Preferred halves of these sites therefore include, but are not limited to, the following:

Sbflā€ƒ5′ .ā€ƒ.ā€ƒ.ā€ƒCCTGā€ƒ.ā€ƒ.ā€ƒ.ā€ƒ3′
3′ .ā€ƒ.ā€ƒ.ā€ƒGGACā€ƒ.ā€ƒ.ā€ƒ.ā€ƒ5′
Sbflā€ƒ5′ .ā€ƒ.ā€ƒ.ā€ƒCCTā€ƒ.ā€ƒ.ā€ƒ.ā€ƒ3′
3′ .ā€ƒ.ā€ƒ.ā€ƒGGACGā€ƒ.ā€ƒ.ā€ƒ.ā€ƒ5′
Sbflā€ƒ5′ .ā€ƒ.ā€ƒ.ā€ƒAGGā€ƒ.ā€ƒ.ā€ƒ.ā€ƒ3′
3′ .ā€ƒ.ā€ƒ.ā€ƒCGTCCā€ƒ.ā€ƒ.ā€ƒ.ā€ƒ5′
AsiSIā€ƒ5′ .ā€ƒ.ā€ƒ.ā€ƒGCGAā€ƒ.ā€ƒ.ā€ƒ.ā€ƒ3′
3′ .ā€ƒ.ā€ƒ.ā€ƒCGCTā€ƒ.ā€ƒ.ā€ƒ.ā€ƒ5′
AsiSIā€ƒ5′ .ā€ƒ.ā€ƒ.ā€ƒCGCā€ƒ.ā€ƒ.ā€ƒ.ā€ƒ3′
3′ .ā€ƒ.ā€ƒ.ā€ƒTAGCGā€ƒ.ā€ƒ.ā€ƒ.ā€ƒ5′
and
AsiSIā€ƒ5′ .ā€ƒ.ā€ƒ.ā€ƒGCGā€ƒ.ā€ƒ.ā€ƒ.ā€ƒ3′
3′ .ā€ƒ.ā€ƒ.ā€ƒCGCTAā€ƒ.ā€ƒ.ā€ƒ.ā€ƒ5′

Differential Selectability

Adaptors of the invention are differentially selectable from other adaptors. Adaptors of the invention are differentially selectable from different types of adaptor of the invention. Type I adaptors are differentially selectable from Type II adaptors. Differential selectability means that one type of adaptor can be delineated or distinguished from another type of the adaptor on the basis of at least one property. Any property may be used to differentially select different types of adaptors.

Generally, different types of adaptors are differentially selectable because they can be separated from each other. When used in pairs, each type of adaptor in the pair can be separated from the other type. For instance, Type I adaptors can be separated from Type II adaptors and vice versa. This facilitates the method of the invention discussed in more detail below. Any means of separation can be used.

Differential selection preferably involves differential or selective binding to a surface. For instance, two types of adaptors of the invention can of course be differentially selected if only one binds to surface A and only the other binds to surface B. Adaptors of the invention are therefore differentially selectable if they specifically bind to a surface. Adaptors specifically bind to a surface if they bind to the surface to a much greater degree than adaptors of a different type. In preferred embodiments, the adaptors bind to a surface to which no other types of adaptor bind. Suitable surfaces are discussed in more detail below.

It is most preferred that the adaptors can be separated from other adaptors by differential binding. For instance, it is possible to separate two types of adaptor (for example Types A and B) from each other if the first type of adaptor (Type A) specifically binds to one surface (surface A) and the second type of adaptor (Type B) binds to another surface (surface B). A mixture of two types of adaptor will contain unligated adaptors of both types, as well as ligated constructs of Type A:Type A, Type B:Type B and Type A:Type B. Contacting the mixture with surface A will result in the binding of Type A adaptors and any constructs comprising a Type A adaptor. Similarly, contacting the mixture with surface B will result in the binding of Type B adaptors and any constructs comprising a Type B adaptor. Ligated constructs can of course be cleaved using the palindromic cleavage site.

The adaptors preferably comprise a selectable binding moiety. A selectable binding moiety is a moiety that can be selected on the basis of its binding properties. Hence, a selectable binding moiety is preferably a moiety that specifically binds to a surface. A selectable binding moiety specifically binds to a surface if it binds to the surface to a much greater degree than any other moiety used in the invention. In preferred embodiments, the moiety binds to a surface to which no other moiety used in the invention binds. If present, the hairpin loop preferably comprises the selective binding moiety.

Suitable selective binding moieties are known in the art. Preferred selective binding moieties include, but are not limited to, biotin, a nucleic acid sequence, antibodies, antibody fragments, such as Fab and ScSv, antigens, nucleic acid binding proteins, poly histidine tails and GST tags. The most preferred selective binding moieties are biotin and a selectable nucleic acid sequence. Biotin specifically binds to a surface coated with avidins. Selectable nucleic acid sequences specifically bind (i.e. hybridise) to a surface coated with homologous sequences. This is discussed in more detail below. Alternatively, selectable nucleic acid sequences specifically bind to a surface coated with nucleic acid binding proteins. In the most preferred embodiment, one type of adaptor in a pair of adaptors comprises biotin and the other type of adaptor comprises a selectable nucleic acid sequence.

Identification Sequences

In preferred embodiments, the adaptors comprise a nucleic acid sequence that allows identification of the adaptor. The nucleic acid sequence may be present in the region of double stranded nucleic acid or, if present, the hairpin loop.

The nucleic acid sequence is typically 12 or fewer bases, such as 10 or fewer bases, 8 or fewer bases or 6 or fewer bases, in length. It comprises a recognizable sequence that can be identified when a construct comprising the adaptor is sequenced in accordance with the invention. In adaptors that comprising a hairpin loop, the sequence will be identified as the adaptor part that links the two strands of nucleic acid to be interrogated is sequenced. In adaptors that lack a hairpin loop and are capable of being cleaved or nicked, the sequence is typically present between the end that ligates to the double stranded nucleic acid template and the point at which adaptor can be cleaved or nicked. In such embodiments, the sequence remains ligated to the double stranded nucleic acid template even once the adaptor is cleaved or nicked.

In preferred embodiments, the nucleic acid sequence identifies the source of the two strands to which it is ligated. In such embodiments, the adaptor allows multiplex sequence analysis of templates originating from separate individual sources. Each template is assigned a different adaptor, each of which comprises a nucleic acid sequence that allows identification of the source of the template.

Adaptors that are Capable of Being Cleaved or Nicked

In some embodiments, the adaptor is itself capable of being cleaved or nicked. In other words, the adaptor may be cleaved or nicked without having to ligate to another adaptor. The region of double stranded nucleic acid may be capable of being cleaved or nicked and/or, if present, the hairpin loop may be capable of being cleaved or nicked. In adaptors with a hairpin loop, it is preferred that the end of the adaptor that forms one half of a palindromic cleavage site (i.e. the end of the adaptor that ligates to the double stranded sequence template) can be separated from the selectable binding moiety. In adaptors without a hairpin loop, it is preferred that one or both ends of the adaptor can be separated from the selectable binding moiety.

Adaptors that are capable of being cleaved or nicked preferably contain one or more, such as two, three or more, cleavage or nick sites. Any cleavage or nick site may be used in accordance with the invention. Such sites include, but are not limited to, chemical cleavage or nick sites, RNA/DNA composite sites, non-natural bases (e.g. uracil) and restriction endonuclease recognition sites and homing endonuclease recognition sites.

Adaptors that are capable of being cleaved or nicked more preferably comprise one or more restriction or homing endonuclease recognition sites. It is preferred that the restriction or homing endonuclease recognition site(s) are not the palindromic cleavage site formed if the adaptor ligates to another adaptor of the invention. Suitable restriction or homing endonuclease recognition sites are known in the art. Preferred homing endonuclease recognition sites include, but are not limited to, the following:

I-SceIā€ƒ
(SEQā€ƒIDā€ƒNO:ā€ƒ9)
5′ .ā€ƒ.ā€ƒ.ā€ƒTAGGGATAACAGGGTAATā€ƒ.ā€ƒ.ā€ƒ.ā€ƒ3′
3′ .ā€ƒ.ā€ƒ.ā€ƒATCCCTATTGTCCCATTAā€ƒ.ā€ƒ.ā€ƒ.ā€ƒ5′

Pairs of Adaptors

The invention also provides pairs of adaptors of the invention. One type of adaptor in the pair is formed by hybridization between two separated regions of a single stranded nucleic acid and comprises a hairpin loop (Type I). The other type of adaptor in the pair may or may not have a hairpin loop (Type II). The Type II adaptor is preferably also formed by hybridization between two separated regions of a single stranded nucleic acid and comprises a hairpin loop. Each type of adaptor in the pair is differentially selectable from the other type. A complete palindromic cleavage site is formed if any combination of the two types of adaptor are ligated to one another. The adaptors may be any of those discussed above.

It is preferred that the Type adaptor I can be separated from the Type II adaptor and vice versa. Any method of separation described above can be used. It is more preferred that the Type I adaptor can be separated from the Type II adaptor by differential binding. It is even more preferred that the Type I adaptor comprises a different selectable binding moiety from the Type II adaptor. Preferably, the Type I adaptor comprises a selectable nucleic acid and the Type II adaptor comprises biotin. All of these embodiments facilitate the method of the invention discussed in more detail below.

It is also preferred that the Type I adaptor is not itself capable of being cleaved or nicked and that the Type II is itself capable of being cleaved or nicked. The Type II adaptor may be cleaved or nicked in any of the ways discussed above.

It is further preferred that the Type I adaptor comprises a nucleic acid sequence that allows identification of the adaptor.

The most preferred pair of adaptors of the invention is summarised in Table 1 below.

Type I Type II
Hairpin present Hairpin present
Selectable nucleic acid Biotin
Not itself capable of being cleaved or Itself capable of being cleaved or
nicked nicked
Nucleic acid sequence that allows Nucleic acid sequence that allows
identification of the adaptor identification of the adaptor

Kits

The invention also provides kits comprising at least two populations of adaptors of the invention formed by hybridization between two separated regions of a single stranded nucleic acid and comprising a hairpin loop (Type I). Every adaptor in each population comprises a nucleic acid sequence that is specific for the population. In other words, each adaptor in a population comprises a sequence that allows the adaptor to be identified as being part of that population and not part of one of the other populations. The two or more populations allow multiplex sequence analysis of double stranded nucleic acid templates originating from two or more separate individual sources, such as from two or more organisms. Suitable organisms are discussed below. Each template is assigned a different population, each of which comprises a nucleic acid sequence that allows identification of the source of the template. The identifying nucleic acid sequence will be different in each population. The sequence is typically located at the same position in the adaptors of each of the two or more populations. This allows efficient differentiation between the populations. Nucleic acid sequences that allow identification of adaptors are discussed in more detail above. Any of the embodiments discussed above are applicable to the kits of the invention.

The kits may comprise any number of populations, such as 5, 10, 20, 50, 100 or more populations.

The kits preferably further comprise two or more populations of Type II adaptors such that every Type I adaptor forms a pair with a Type II adaptor. Pairs of adaptors are discussed in more detail above. Any of the embodiments discussed above are applicable to the kits of the invention.

The present invention also provides kits for sequencing double stranded nucleic acid comprising a pair of adaptors of the invention and means for cleaving the palindromic cleavage site. The means is typically an enzyme as discussed above.

The kits of the invention may additionally comprise one or more other reagents or instruments which enable any of the embodiments mentioned above to be carried out. Such reagents or instruments include one or more of the following: suitable buffer(s) (aqueous solutions), means to obtain a sample from a subject (such as a vessel or an instrument comprising a needle), means to amplify, express and/or sequence polynucleotide sequences, a membrane as defined above, a surface as defined above or voltage or patch clamp apparatus. Reagents may be present in the kit in a dry state such that a fluid sample resuspends the reagents. The kit may also, optionally, comprise instructions to enable the kit to be used in the method of the invention or details regarding which patients the method may be used for. The kit may, optionally, comprise nucleotides.

Nucleic Acid Constructs

The present invention also provides nucleic acid constructs for use as sequence templates. The constructs are useful for sequencing double stranded nucleic acids. The constructs generally comprise two strands of nucleic acid ligated to at least one adaptor of the invention. It is typically the sequence of the two strands of nucleic acid that needs to be determined.

In one embodiment, the invention provides nucleic acid constructs for use as a sequencing template comprising a double stranded nucleic acid ligated to at least one adaptor of the invention. The construct may comprise two adaptors, one ligated to each end of the double stranded nucleic acid. The construct may comprise any of the adaptors discussed above.

In another embodiment, the invention provides single stranded nucleic acid constructs for use as a sequencing template comprising two strands of nucleic acid covalently linked via an adaptor of the invention formed by hybridization between two separated regions of a single stranded nucleic acid and comprising a hairpin loop (Type I). The two strands are typically derived from a double stranded nucleic acid, such as dsDNA or dsRNA. The construct may comprise any of the Type I adaptors discussed above. Such constructs have several advantages as described above. In some instances, it may be necessary to denature the construct to yield a single stranded structure. Suitable conditions for denaturing nucleic acids are discussed in more detail below.

In a further embodiment, the invention provides circular nucleic acid constructs comprising two strands of nucleic acid covalently linked at each end via an adaptor of the invention formed by hybridization between two separated regions of a single stranded nucleic acid and comprising a hairpin loop (Type I). The two strands are typically derived from a double stranded nucleic acid, such as dsDNA or dsRNA. The construct may comprise any of the Type I adaptors discussed above.

In all these embodiments, the two strands are preferably the sense and antisense strands of dsDNA or dsRNA.

Methods for Preparing Adaptors of the Invention

The invention also provides methods for preparing adaptors of the invention. The methods involve providing two nucleic acids that are (i) capable of hybridizing to one another to form one half of a palindromic cleavage site and (ii) differentially selectable from those of another adaptor. These features are all discussed in detail above with reference to the adaptors of the invention. The nucleic acids are contacted under conditions which allow them to hybridise and prepare an adaptor of the invention. Such conditions are discussed in detail below.

The invention also provides methods for preparing Type I adaptors. The methods involve providing a single stranded nucleic acid comprising (i) two regions that are capable of hybridizing to one another, (ii) a loop-forming region that is differentially selectable from that of another adaptor and (iii) two ends which together form one half of a palindromic cleavage site. These features are all discussed in detail above with reference to the adaptors of the invention. The nucleic acid is exposed to conditions which allow the two regions to hybridise and form a hairpin loop and thereby prepare a Type I adaptor.

The nucleic acids or regions that are capable of hybridizing to one another preferably share at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99% homology based on sequence identity. The nucleic acids or regions are more preferably complementary (i.e. share 100% homology based on sequence identity).

Standard methods in the art may be used to determine homology. For example the UWGCG Package provides the BESTFIT program which can be used to calculate homology, for example used on its default settings (Devereux et al (1984) Nucleic Acids Research 12, p 38′7-395). The PILEUP and BLAST algorithms can be used to calculate homology or line up sequences (such as identifying equivalent residues or corresponding sequences (typically on their default settings)), for example as described in Altschul S. F. (1993) J Mol Evol 36:290-300; Altschul, S.F et al (1990) J Mol Biol 215:403-10.

Software for performing BLAST analyses is publicly available through the National Center for Biotechnology Information (http://www.ncbi.nlm.nih.gov/). This algorithm involves first identifying high scoring sequence pair (HSPs) by identifying short words of length W in the query sequence that either match or satisfy some positive-valued threshold score T when aligned with a word of the same length in a database sequence. T is referred to as the neighbourhood word score threshold (Altschul et al, supra). These initial neighbourhood word hits act as seeds for initiating searches to find HSP's containing them.

The word hits are extended in both directions along each sequence for as far as the cumulative alignment score can be increased. Extensions for the word hits in each direction are halted when: the cumulative alignment score falls off by the quantity X from its maximum achieved value; the cumulative score goes to zero or below, due to the accumulation of one or more negative-scoring residue alignments; or the end of either sequence is reached. The BLAST algorithm parameters W, T and X determine the sensitivity and speed of the alignment. The BLAST program uses as defaults a word length (W) of 11, the BLOSUM62 scoring matrix (see Henikoff and Henikoff (1992) Proc. Natl. Acad. Sci. USA 89: 10915-10919) alignments (B) of 50, expectation (E) of 10, M=5, N=4, and a comparison of both strands.

The BLAST algorithm performs a statistical analysis of the similarity between two sequences; see e.g., Karlin and Altschul (1993) Proc. Natl. Acad. Sci. USA 90: 5873-5787. One measure of similarity provided by the BLAST algorithm is the smallest sum probability (P(N)), which provides an indication of the probability by which a match between two amino acid sequences would occur by chance. For example, a sequence is considered similar to another sequence if the smallest sum probability in comparison of the first sequence to the second sequence is less than about 1, preferably less than about 0.1, more preferably less than about 0.01, and most preferably less than about 0.001.

Conditions that permit the hybridization are well-known in the art (for example, Sambrook et al., 2001, Molecular Cloning: a laboratory manual, 3rd edition, Cold Spring Harbour Laboratory Press; and Current Protocols in Molecular Biology, Chapter 2, Ausubel et al., Eds., Greene Publishing and Wiley-Interscience, New York (1995)). Hybridization can be carried out under low stringency conditions, for example in the presence of a buffered solution of 30 to 35% formamide, 1 M NaCl and 1% SDS (sodium dodecyl sulfate) at 37° C. followed by a wash in from 1X (0.1650 M Na+) to 2X (0.33 M Na+) SSC (standard sodium citrate) at 50° C. Hybridization can be carried out under moderate stringency conditions, for example in the presence of a buffer solution of 40 to 45% formamide, 1 M NaCl, and 1% SDS at 37° C., followed by a wash in from 0.5X (0.0825 M Na+) to 1X (0.1650 M Na+) SSC at 55° C. Hybridization can be carried out under high stringency conditions, for example in the presence of a buffered solution of 50% formamide, 1 M NaCl, 1% SDS at 37° C., followed by a wash in 0.1X (0.0165 M Na+) SSC at 60° C.

Methods for Preparing Constructs of the Invention

The invention also provides various methods for preparing the constructs of the invention. The constructs of the invention are discussed above. Any of the constructs of the invention can be made using these methods.

In one embodiment, the invention provides methods for preparing nucleic acid constructs of the invention. The methods involve contacting at least one adaptor of the invention with two strands of nucleic acid under conditions which allow ligation between the adaptor(s) and the strands. Any of the adaptors discussed above may be used. The two strands are typically derived from a double stranded nucleic acid, such as dsDNA or dsRNA. Conditions suitable for ligating nucleic acids are known in the art. Such conditions include, but are not limited to, 50 mM Tris-HCl, 10 mM MgCl2, 1 mM ATP, 10 mM Dithiothreitol, pH 7.5 and 25° C. The adaptor(s) are then allowed to ligate to the two strands and thereby prepare a nucleic acid construct.

In another embodiment, the invention provides methods for preparing single stranded nucleic acid constructs of the invention. The methods involve contacting a Type I adaptor with two strands of nucleic acid under conditions which allow ligation between the adaptor and the strands. Any of the Type I adaptors discussed above may be used. The two strands are typically derived from a double stranded nucleic acid, such as dsDNA or dsRNA. Conditions suitable for ligating nucleic acids are discussed above. The adaptor is allowed to covalently link the two strands at each end. The covalently linked constructs are then denatured to prepare single stranded nucleic acid constructs. Suitable conditions for denaturing nucleic acids include, but are not limited to, pH, temperature and ionic strength.

In yet another embodiment, the invention provides method for preparing circular nucleic acid constructs of the invention. The methods involve contacting at least two Type I adaptors with two strands of nucleic acid under conditions which allow ligation between the adaptors and strands. The at least two Type I adaptors may be the same or different. Any of the Type I adaptors discussed above may be used. The two strands are typically derived from a double stranded nucleic acid, such as dsDNA or dsRNA. Conditions suitable for ligating nucleic acids are discussed above. An adaptor is then allowed to covalently link the two strands at each end and thereby prepare circular nucleic acid constructs.

In yet another embodiment, the invention provides methods for preparing sequence constructs. The methods prepare single stranded nucleic acid constructs comprising the two strands of a double stranded nucleic acid covalently linked via a Type I adaptor. The methods involve providing double stranded nucleic acid. The providing preferably involves randomly fragmenting template nucleic acid. The ends of the double stranded nucleic acid may be repaired to form blunt ends. Any of the nucleic acids disclosed above can be used. The methods are typically carried out using a double stranded nucleic acid whose sequence is unknown. Alternatively, the methods may be carried out using a double stranded nucleic acid whose sequence is known or can be predicted.

The methods may be carried out in vitro on double stranded nucleic acid obtained from or extracted from any organism or microorganism. The organism or microorganism is typically prokaryotic, eukaryotic or an archeeon and typically belongs to one the five kingdoms: plantae, animalia, fungi, monera and protista. The methods may be carried out in vitro on double stranded nucleic acid obtained from or extracted from any virus. Typically, the double stranded nucleic acid is human in origin, but alternatively it may be from another mammal animal such as from commercially farmed animals such as horses, cattle, sheep or pigs or may alternatively be pets such as cats or dogs.

The double stranded nucleic acid is typically processed prior to undergoing the methods, for example by centrifugation or by passage through a membrane that filters out unwanted molecules or cells, such as red blood cells. The double stranded nucleic acid may be used immediately upon being taken. The double stranded nucleic acid may also be typically stored prior to undergoing the methods, preferably below āˆ’70° C.

The double stranded nucleic acid is preferably dsDNA or dsRNA.

The double stranded nucleic acid is contacted with a pair of Type I and Type II adaptors of the invention under conditions which allow the adaptors to ligate to the nucleic acid. The Type II adaptor is itself capable of being cleaved or nicked as discussed above. Conditions suitable for ligating nucleic acids are discussed above. Suitable pairs of Type I adaptors and Type II adaptors are also discussed above.

The ligated products are then contacted with a surface that specifically binds the Type II adaptors that are capable of being cleaved or nicked. Any constructs containing Type II adaptors will bind to the surface. Suitable surfaces include, but are not limited to, metal (gold in particular), agarose, dextran, polystyrene, glass, silica (bonded and unbonded) and cellulose. Preferably, the surface specifically binds a selectable binding moiety on the Type II adaptors. The surface is most preferably coated with avidins.

Any unbound products are then removed. This is typically done by washing the surface with a suitable buffer. Suitable buffers include, but are not limited to, Tris, HEPES and MOPS at suitable ionic concentrations. This step removes all constructs formed by the ligation of a Type I adaptor to a Type I adaptor (Type I:Type I).

The surface is then contacted with an enzyme that recognises the complete palindromic cleavage site. Suitable enzymes are discussed above. This step will cleave any remaining (i e bound) constructs formed from the ligation of an adaptor to an adaptor, i.e. Type I:Type II or Type II:Type II.

Again, any unbound products are removed, typically by washing. This step ensures that only Type II adaptors in isolation or constructs containing the double stranded nucleic acid and at least one Type II adaptor remain bound to the surface.

The Type H adaptors are then cleaved. Methods for doing this are discussed above. This step ensures the release of the constructs containing the double stranded nucleic acid and at least one Type II adaptor from the surface.

The soluble products are then contacted with a surface that specifically binds the Type I adaptors that are not capable of being cleaved or nicked. Any remaining constructs containing Type I adaptors bind to the surface. Each construct will contain the double stranded nucleic acid covalently linked at one end via a Type I adaptor. The surface preferably specifically binds a selectable binding moiety on the Type I adaptors. The surface is more preferably coated with nucleic acid sequences that are at least 80%, such as least 90%, at least 95% or at least 99%, homologous based on sequence identity to a selectable nucleic acid sequence in the Type I adaptors. The surface is most preferably coated with nucleic acid sequences that are complementary to a selectable nucleic acid sequence in the Type I adaptors. Again, unbound products are removed.

Finally, any remaining products are released from the surface. Those released products represent a sequencing construct of the invention in which a double stranded nucleic acid is covalently linked at one end via a Type I adaptor. The construct may also contain fragments of the Type II adaptor at the ends of the double stranded nucleic acid.

The resulting construct may need to be denatured to form a single stranded construct. Conditions suitable for denaturing double stranded nucleic acids are discussed above.

Methods of Sequencing Double Stranded Nucleic Acid

The invention also provides methods of sequencing double stranded nucleic acid. The methods involve carrying out one of the methods described above for preparing nucleic acid constructs. The construct contains two strands of nucleic acid, preferably DNA or RNA, covalently linked via a Type I adaptor. If necessary, the construct is denatured to form a single stranded construct. Conditions for doing this are described above.

The single stranded construct is then be sequenced. Sequencing the single stranded construct will provide the sequence of, in order, one strand, the Type I adaptor and the other strand. The strands will of course be in opposite orientations. In some embodiments, fragments of the Type II adaptors may also be present in the single stranded nucleic acid construct.

The methods of the invention are advantageous because each position in the double stranded nucleic acid is interrogated twice (i.e. once on each strand). The methods preferably involve sequencing double stranded nucleic acid containing or suspected of containing methylcytosine. If the Type I adaptor comprises a nucleic acid sequence that identifies the source of the double stranded nucleic acid, this will also be recognised using the methods of the invention.

The whole or only part of the construct may be sequenced using these methods. The construct can be any length. For example, the construct can be at least 10, at least 50, at least 100, at least 150, at least 200, at least 250, at least 300, at least 400 or at least 500 nucleotides in length. The methods are typically carried out in vitro.

By effectively doubling the interrogation of every base, the invention may improve the data quality of all existing second generation sequencing chemistries and next generation sequencing technologies in development. Any method of sequencing the single stranded nucleic acid construct may be used in accordance with the invention. Suitable methods are known in the art. Such methods include, but are not limited to, Sanger (or dideoxy) method, the Maxam-Gilbert (chemical cleavage) method, Life Technologies' SOLiD (which uses sequencing by ligation), Illumina Genome Analyser (which uses fluorescent reversible terminator chemistry on amplified templates), 454 Genome Sequencer FLX (which uses pyrosequencing chemistry on amplified templates), Helicos Heliscope (which uses true single molecule sequencing by fluorescent reversible terminator chemistry on unamplified (adapter modified) templates), Bionanomatrix (electronic discrimination of bases in etched channels), Danaher Motion ('polony' sequencing), LingVitae ('design polymer' sequencing), Pacific BioSciences' Single Molecule Sequencing by fluorescent nucleotide DNA polymerization and Visigen's (Sequencing by FRET interaction of donor and acceptor during a DNA polymerisation reaction).

There are also a number of ways that transmembrane pores can be used to sequence nucleic acid molecules. One way involves the use of an exonuclease enzyme, such as a deoxyribonuclease. In this approach, the exonuclease enzyme is used to sequentially detach the nucleotides from a target nucleic strand. The nucleotides are then detected and discriminated by the pore in order of their release, thus reading the sequence of the original strand.

Another way of sequencing nucleic acids involves the use of an enzyme that pushes or pulls the target nucleic acid strand through the pore in combination with an applied potential. In this approach, the ionic current fluctuates as a nucleotide in the target strand passes through the pore. The fluctuations in the current are indicative of the sequence of the strand.

A third way of sequencing a nucleic acid strand is to detect the byproducts of a polymerase in close proximity to a pore detector. In this approach, nucleoside phosphates (nucleotides) are labelled so that a phosphate labelled species is released upon the addition of a polymerase to the nucleotide strand and the phosphate labelled species is detected by the pore. The phosphate species contains a specific label for each nucleotide. As nucleotides are sequentially added to the nucleic acid strand, the bi-products of the base addition are detected. The order that the phosphate labelled species are detected can be used to determine the sequence of the nucleic acid strand.

Any of these three methods can be used to sequence in accordance with the invention.

In one preferred embodiment, the sequencing is carried out by methods comprising (i) contacting the construct with a transmembrane pore having an exonuclease and a molecular adaptor covalently attached thereto so that the exonuclease digests an individual nucleotide from one end of the construct; (ii) contacting the nucleotide with the pore so that the nucleotide interacts with the molecular adaptor; (iii) measuring the current passing through the pore during the interaction and thereby determining the identity of the nucleotide; and (iv) repeating steps (i) to (iii) at the same end of the construct and thereby determining the sequence of the target sequence. Hence, the methods involve stochastic sensing of a proportion of the nucleotides in the construct in a successive manner in order to sequence the construct. Individual nucleotides are described below.

In another preferred embodiment, the sequencing is carried out by methods comprising (i) contacting the construct with a transmembrane pore having a nucleic acid handling enzyme attached thereto so that the enzyme pushes or pulls the construct through the pore and a proportion of the nucleotides in the construct interacts with the pore and (ii) measuring the current passing through the pore during each interaction and thereby determining the sequence of the construct. Hence, the methods involve stochastic sensing of a proportion of the nucleotides in a construct as the nucleotides pass through the barrel or channel in a successive manner in order to sequence the construct.

Transmembrane Pores

A transmembrane pore is a pore that permits ions driven by an applied potential to flow from one side of a membrane to the other side of the membrane. The pore preferably permits nucleotides to flow from one side of a membrane to the other along the applied potential. The pore preferably allows a nucleic acid, such as DNA or RNA, to be pushed or pulled through the pore.

The pore is preferably a transmembrane protein pore. A transmembrane protein pore is a polypeptide or a collection of polypeptides that permits ions driven by an applied potential to flow from one side of a membrane to the other side of the membrane.

The pore may be isolated, substantially isolated, purified or substantially purified. A pore is isolated or purified if it is completely free of any other components, such as lipids or other pores. A pore is substantially isolated if it is mixed with carriers or diluents which will not interfere with its intended use. For instance, a pore is substantially isolated or substantially purified if it present in a form that comprises less than 10%, less than 5%, less than 2% or less than 1% of other components, such as lipids or other pores. The pore is typically present in a lipid bilayer.

The pore may be a monomer or an oligomer. The pore is preferably made up of several repeating subunits, such as 6, 7 or 8 subunits. The pore is more preferably a heptameric pore. The pore typically comprises a barrel or channel through which the ions may flow. The subunits of the pore typically surround a central axis and contribute strands to a transmembrane β barrel or channel or a transmembrane α-helix bundle or channel.

The barrel or channel of the pore typically comprises amino acids that facilitate interaction with nucleotides or nucleic acids. These amino acids are preferably located near a constriction of the barrel or channel. The pore typically comprises one or more positively charged amino acids, such as arginine, lysine or histidine. These amino acids typically facilitate the interaction between the pore and nucleotides or nucleic acids. The nucleotide detection can be facilitated with an adaptor. This is discussed in more detail below.

Pores for use in accordance with the invention can be β-barrel pores, α-helix bundle pores or solid state pores. β-barrel pores comprise a barrel or channel that is formed from β-strands. Suitable β-barrel pores include, but are not limited to, β-toxins, such as α-hemolysin, anthrax toxin and leukocidins, and outer membrane proteins/porins of bacteria, such as Mycobacterium smegmatis porin A (MspA), outer membrane porin F (OmpF), outer membrane porin G (OmpG), outer membrane phospholipase A and Neisseria autotransporter lipoprotein (NalP). α-helix bundle pores comprise a barrel or channel that is formed from α-helices. Suitable α-helix bundle pores include, but are not limited to, inner membrane proteins and a outer membrane proteins, such as WZA.

Suitable solid state pores include, but are not limited to, silicon nitride pores, silicon dioxide pores and graphene pores. Other suitable solid state pores and methods of producing them are discussed in U.S. Pat. No. 6,464,842, WO 03/003446, WO 2005/061373, U.S. Pat. Nos. 7,258,838, 7,466,069, 7,468,271 and 7,253,434.

The pore is preferably derived from α-hemolysin (α-HL). The wild type α-HL pore is formed of seven identical monomers or subunits (i.e. it is heptameric). The sequence of one wild type monomer or subunit of α-hemolysin is shown in SEQ ID NO: 2. The pore preferably comprises seven subunits of the sequence shown in SEQ ID NO: 2 or a variant thereof. Amino acids 1, 7 to 21, 31 to 34, 45 to 51, 63 to 66, 72, 92 to 97, 104 to 111, 124 to 136, 149 to 153, 160 to 164, 173 to 206, 210 to 213, 217, 218, 223 to 228, 236 to 242, 262 to 265, 272 to 274, 287 to 290 and 294 of SEQ ID NO: 2 form loop regions. Residues 113 and 147 of SEQ ID NO: 2 form part of a constriction of the barrel or channel of α-HL.

A variant of SEQ ID NO: 2 is a subunit that has an amino acid sequence which varies from that of SEQ ID NO: 2 and which retains its pore forming ability. The ability of a variant to form a pore can be assayed using any method known in the art. For instance, the variant may be inserted into a membrane along with other appropriate subunits and its ability to oligomerise to form a pore may be determined.

The variant may include modifications that facilitate covalent attachment to or interaction with the nucleic acid handling enzyme. The variant preferably comprises one or more reactive cysteine residues that facilitate attachment to the enzyme. For instance, the variant may include a cysteine at one or more of positions 8, 9, 17, 18, 19, 44, 45, 50, 51, 237, 239 and 287 and/or on the amino or carboxy terminus of SEQ ID NO: 2. Preferred variants comprise a substitution of the residue at position 8, 9,17, 237, 239 and 287 of SEQ ID NO: 2 with cysteine (K8C, T9C, N17C, K237C, S239C or E287C).

The variant may be modified to facilitate genetic fusion of the enzyme. For instance, one or more residues adjacent to the insertion site may be modified, such as deleted, to facilitate insertion of the enzyme and/or linkers. If the enzyme is inserted into loop 2 of SEQ ID NO: 2, one or more of residues D45, K46, N47, H48, N49 and K50 of SEQ ID NO: 2 may be deleted.

The variant may also include modifications that facilitate any interaction with nucleotides or facilitate orientation of a molecular adaptor as discussed below. The variant may also contain modifications that facilitate covalent attachment of a molecular adaptor.

In particular, the variant preferably has a glutamine at position 139 of SEQ ID NO: 2. The variant preferably has an arginine at position 113 of SEQ ID NO: 2. The variant preferably has a cysteine at position 119, 121 or 135 of SEQ ID NO: 2. SEQ ID NO: 4 shows the sequence of SEQ ID NO: 2 except that it has an arginine at position 113 (M113R) and a glutamine at position 139 (N139Q). SEQ ID NO: 4 or a variant thereof may be used to form a pore in accordance with the invention.

The variant may be a naturally occurring variant which is expressed naturally by an organism, for instance by a Staphylococcus bacterium, or expressed recombinantly by a bacterium such as Escherichia coli. Variants also include non-naturally occurring variants produced by recombinant technology. Over the entire length of the amino acid sequence of SEQ ID NO: 2 or 4, a variant will preferably be at least 50% homologous to that sequence based on amino acid identity. More preferably, the variant polypeptide may be at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90% and more preferably at least 95%, 97% or 99% homologous based on amino acid identity to the amino acid sequence of SEQ ID NO: 2 or 4 over the entire sequence. There may be at least 80%, for example at least 85%, 90% or 95%, amino acid identity over a stretch of 200 or more, for example 230, 250, 270 or 280 or more, contiguous amino acids (ā€œhard homologyā€).

Amino acid substitutions may be made to the amino acid sequence of SEQ ID NO: 2 or 4 in addition to those discussed above, for example up to 1, 2, 3, 4, 5, 10, 20 or 30 substitutions. Conservative substitutions may be made, for example, according to Table 2 below.

TABLE 2
Conservative substitutions
Amino acids in the same block in the second column and preferably in
the same line in the third column may be substituted for each other.
NON-AROMATIC Non-polar G A P
I L V
Polar - uncharged C S T M
N Q
Polar - charged D E
H K R
AROMATIC H F W Y

One or more amino acid residues of the amino acid sequence of SEQ ID NO: 2 may additionally be deleted from the polypeptides described above. Up to 1, 2, 3, 4, 5, 10, 20 or 30 residues may be deleted, or more.

Variants may fragments of SEQ ID NO: 2 or 4. Such fragments retain pore forming activity. Fragments may be at least 50, 100, 200 or 250 amino acids in length. A fragment preferably comprises the pore forming domain of SEQ ID NO: 2 or 4. Fragments typically include residues 119, 121, 135. 113 and 139 of SEQ ID NO: 2 or 4.

One or more amino acids may be alternatively or additionally added to the polypeptides described above. An extension may be provided at the amino terminus or carboxy terminus of the amino acid sequence of SEQ ID NO: 2 or 4 or a variant or fragment thereof. The extension may be quite short, for example from 1 to 10 amino acids in length. Alternatively, the extension may be longer, for example up to 50 or 100 amino acids. A carrier protein may be fused to a pore or variant. As discussed above, a variant of SEQ ID NO: 2 or 4 is a subunit that has an amino acid sequence which varies from that of SEQ ID NO: 2 or 4 and which retains its ability to form a pore. A variant typically contains the regions of SEQ ID NO: 2 or 4 that are responsible for pore formation. The pore forming ability of α-HL, which contains a β-barrel, is provided by β-strands in each subunit. A variant of SEQ ID NO: 2 or 4 typically comprises the regions in SEQ ID NO: 2 that form β-strands. The amino acids of SEQ ID NO: 2 or 4 that form β-strands are discussed above. One or more modifications can be made to the regions of SEQ ID NO: 2 or 4 that form β-strands as long as the resulting variant retains its ability to form a pore. Specific modifications that can be made to the β-strands regions of SEQ ID NO: 2 or 4 are discussed above.

A variant of SEQ ID NO: 2 or 4 preferably includes one or more modifications, such as substitutions, additions or deletions, within its α-helices and/or loop regions. Amino acids that form α-helices and loops are discussed above.

The variant may be modified for example by the addition of histidine or aspartic acid residues to assist its identification or purification or by the addition of a signal sequence to promote their secretion from a cell where the polypeptide does not naturally contain such a sequence.

The pore may be labelled with a revealing label. The revealing label may be any suitable label which allows the pore to be detected. Suitable labels include, but are not limited to, fluorescent molecules, radioisotopes, e.g. 125I, 35S, 14C, enzymes, antibodies, antigens, polynucleotides and ligands such as biotin.

The pore may be isolated from a pore producing organism, such as Staphylococcus aureus, or made synthetically or by recombinant means. For example, the pore may be synthesised by in vitro translation and transcription. The amino acid sequence of the pore may be modified to include non-naturally occurring amino acids or to increase the stability of the pore. When the pore is produced by synthetic means, such amino acids may be introduced during production. The pore may also be altered following either synthetic or recombinant production.

The pore may also be produced using D-amino acids. For instance, the pores may comprise a mixture of L-amino acids and D-amino acids. This is conventional in the art for producing such proteins or peptides.

The pore may also contain other non-specific chemical modifications as long as they do not interfere with its ability to form a pore. A number of non-specific side chain modifications are known in the art and may be made to the side chains of the pores. Such modifications include, for example, reductive alkylation of amino acids by reaction with an aldehyde followed by reduction with NaBH4, amidination with methylacetimidate or acylation with acetic anhydride. The modifications to the pore can be made after expression of each subunit or after the subunits have been used to form a pore.

The pore can be produced using standard methods known in the art. Polynucleotide sequences encoding a pore or pore subunit may be isolated and replicated using standard methods in the art. Polynucleotide sequences encoding a pore or pore subunit may be expressed in a bacterial host cell using standard techniques in the art. The pore may be produced in a cell by in situ expression of the polypeptide from a recombinant expression vector. The expression vector optionally carries an inducible promoter to control the expression of the polypeptide.

A pore may be produced in large scale following purification by any protein liquid chromatography system from pore producing organisms or after recombinant expression as described below. Typical protein liquid chromatography systems include FPLC, AKTA systems, the Bio-Cad system, the Bio-Rad BioLogic system and the Gilson HPLC system.

Nucleic Acid Handling Enzyme

A nucleic acid handling enzyme is a polypeptide that is capable of interacting with and modifiying at least one property of a nucleic acid. The enzyme may modify the nucleic acid by cleaving it to form individual nucleotides or shorter chains of nucleotides, such as di- or trinucleotides. The enzyme may modify the nucleic acid by orienting it or moving it to a specific position. Any of the nucleic acids discussed above may be handled by the enzyme.

The nucleic acid handled by the enzyme is preferably single stranded. The nucleic acid handled by the enzyme may be double stranded, such as dsDNA or dsRNA. Enzymes that handle single stranded nucleic acids may be used to sequence double stranded DNA as long as the double stranded DNA is chemically or thermally dissociated into a single strand before it is handled by the enzyme.

It is preferred that the tertiary structure of the nucleic acid handling enzyme is known. Knowledge of the three dimensional structure of the enzyme allows modifications to be made to the enzyme to facilitate its function in the methods of the invention.

The enzyme may be any size and have any structure. For instance, the enzyme may be an oligomer, such as a dimer or trimer. The enzyme is preferably a small, globular polypeptide formed from one monomer. Such enzymes are easy to handle and are less likely to interfere with the pore forming ability of the pore or pore subunit, particularly if fused to or inserted into the sequence of the pore or pore subunit.

The amino and carboxy terminii of the enzyme are preferably in close proximity. The amino and carboxy terminii of the enzyme are more preferably presented on same face of the enzyme. Such embodiments facilitate insertion of the enzyme into the sequence of the pore or pore subunit. For instance, if the amino and carboxy terminii of the enzyme are in close proximity, each can be attached by genetic fusion to adjacent amino acids in the sequence of the pore or pore subunit.

It is also preferred that the location and function of the active site of the enzyme is known. This prevents modifications being made to the active site that abolish the activity of the enzyme. It also allows the enzyme to be attached to the pore so that the enzyme handles the construct in such a way that a proportion of the nucleotides in the construct interacts with the pore. It is beneficial to position the active site of the enzyme as close as possible to the part of the pore that forms part of the opening of the barrel of channel of the pore, without the enzyme itself presenting a block to the flow of current. Knowledge of the way in which an enzyme may orient nucleic acids also allows an effective pore-enzyme construct to be designed.

In order that most of the nucleotides in the construct are correctly identified by stochastic sensing, the enzyme must handle the nucleic acid in a buffer background which is compatible with discrimination of the nucleotides. The enzyme preferably has at least residual activity in a salt concentration well above the normal physiological level, such as from 100 mM to 2000 mM. The enzyme is more preferably modified to increase its activity at high salt concentrations. The enzyme may also be modified to improve its processivity, stability and shelf life.

Suitable modifications can be determined from the characterisation of nucleic acid handling enzymes from extremphiles such as halophilic, moderately halophilic bacteria, thermophilic and moderately thermophilic organisms, as well as directed evolution approaches to altering the salt tolerance, stability and temperature dependence of mesophilic or thermophilic exonucleases.

The enzyme also preferably retains at least partial activity at temperatures from 10° C. to 60° C., such as at room temperature. This allows the construct to sequence nucleic acids at a variety of temperatures, including room temperature.

The nucleic acid handling enzyme is preferably a nucleolytic enzyme. The nucleic acid handling enzyme is more preferably member of any of the Enzyme Classification (EC) groups 3.1.11, 3.1.13, 3.1.14, 3.1.15, 3.1.16, 3.1.21, 3.1.22, 3.1.25, 3.1.26, 3.1.27, 3.1.30 and 3.1.31. The nucleic acid handling enzyme is more preferably any one of the following enzymes:

    • 3.1.11.- Exodeoxyribonucleases producing 5′-phosphomonoesters.
      • 3.1.11.1 Exodeoxyribonuclease I.
      • 3.1.11.2 Exodeoxyribonuclease III.
      • 3.1.11.3 Exodeoxyribonuclease (lambda-induced).
      • 3.1.11.4 Exodeoxyribonuclease (phage SP3-induced).
      • 3.1.11.5 Exodeoxyribonuclease V.
      • 3.1.11.6 Exodeoxyribonuclease VII.
    • 3.1.13.- Exoribonucleases producing 5′-phosphomonoesters.
      • 3.1.13.1 Exoribonuclease II.
      • 3.1.13.2 Exoribonuclease H.
      • 3.1.13.3 Oligonucleotidase.
      • 3.1.13.4 Poly(A)-specific ribonuclease.
      • 3.1.13.5 Ribonuclease D.
    • 3.1.14.- Exoribonucleases producing 3′-phosphomonoesters.
      • 3.1.14.1 Yeast ribonuclease.
    • 3.1.15.- Exonucleases active with either ribo- or deoxyribonucleic acid producing 5′ phosphomonoesters
      • 3.1.15.1 Venom exonuclease.
    • 3.1.16.- Exonucleases active with either ribo- or deoxyribonucleic acid producing 3′ phosphomonoesters
      • 3.1.16.1 Spleen exonuclease.
    • 3.1.21.- Endodeoxyribonucleases producing 5′-phosphomonoesters.
      • 3.1.21.1 Deoxyribonuclease I.
      • 3.1.21.2 Deoxyribonuclease IV (phage-T(4)-induced).
      • 3.1.21.3 Type I site-specific deoxyribonuclease.
      • 3.1.21.4 Type II site-specific deoxyribonuclease.
      • 3.1.21.5 Type III site-specific deoxyribonuclease.
      • 3.1.21.6 CC-preferring endodeoxyribonuclease.
      • 3.1.21.7 Deoxyribonuclease V.
    • 3.1.22.- Endodeoxyribonucleases producing other than 5′-phosphomonoesters.
      • 3.1.22.1 Deoxyribonuclease II.
      • 3.1.22.2 Aspergillus deoxyribonuclease K(1).
      • 3.1.22.3 Transferred entry: 3.1.21.7.
      • 3.1.22.4 Crossover junction endodeoxyribonuclease.
      • 3.1.22.5 Deoxyribonuclease X.
    • 3.1.25.- Site-specific endodeoxyribonucleases specific for altered bases.
      • 3.1.25.1 Deoxyribonuclease (pyrimidine dimer).
      • 3.1.25.2 Transferred entry: 4.2.99.18.
    • 3. 1.26.- Endoribonucleases producing 5′-phosphomonoesters.
      • 3.1.26.1 Physarum polycephalum ribonuclease.
      • 3.1.26.2 Ribonuclease alpha.
      • 3.1.26.3 Ribonuclease III.
      • 3.1.26.4 Ribonuclease H.
      • 3.1.26.5 Ribonuclease P.
      • 3.1.26.6 Ribonuclease IV.
      • 3.1.26.7 Ribonuclease P4.
      • 3.1.26.8 Ribonuclease M5.
      • 3.1.26.9 Ribonuclease (poly-(U)-specific).
      • 3.1.26.10 Ribonuclease IX.
      • 3.1.26.11 Ribonuclease Z.
    • 3.1.27.- Endoribonucleases producing other than 5′-phosphomonoesters.
      • 3.1.27.1 Ribonuclease T(2).
      • 3.1.27.2 Bacillus subtilis ribonuclease.
      • 3.1.27.3 Ribonuclease T(1).
      • 3.1.27.4 Ribonuclease U(2).
      • 3.1.27.5 Pancreatic ribonuclease.
      • 3.1.27.6 Enterobacter ribonuclease.
      • 3.1.27.7 Ribonuclease F.
      • 3.1.27.8 Ribonuclease V.
      • 3.1.27.9 tRNA-intron endonuclease.
      • 3.1.27.10 rRNA endonuclease.
    • 3.1.30.- Endoribonucleases active with either ribo- or deoxyribonucleic producing 5′ phosphomonoesters
      • 3.1.30.1 Aspergillus nuclease S(1).
      • 3.1.30.2 Serratia marcescens nuclease.
    • 3.1.31.- Endoribonucleases active with either ribo- or deoxyribonucleic producing 3′ phosphomonoesters 3.1.31.1 Micrococcal nuclease.

The enzyme is most preferably an exonuclease, such as a deoxyribonuclease, which cleave nucleic acids to form individual nucleotides. The advantages of exodeoxyribonucleases are that they are active on both single stranded and double stranded DNA and hydrolyse bases either in the 5′-3′ or 3′-5′ direction.

An individual nucleotide is a single nucleotide. An individual nucleotide is one which is not bound to another nucleotide or nucleic acid by any bond, such as a phosphodiester bond. A phosphodiester bond involves one of the phosphate groups of a nucleotide being bound to the sugar group of another nucleotide. An individual nucleotide is typically one which is not bound in any manner to another nucleic acid sequence of at least 5, at least 10, at least 20, at least 50, at least 100, at least 200, at least 500, at least 1000 or at least 5000 nucleotides.

Preferred enzymes for use in the method include exonuclease I from E. coli (SEQ ID NO: 6) and RecJ from T thermophilus (SEQ ID NO: 8) and variants thereof. The exonuclease enzyme preferably comprises any of the sequences shown in SEQ ID NOs: 6 and 8 or a variant thereof. A variant of SEQ ID NO: 6 or 8 is an enzyme that has an amino acid sequence which varies from that of SEQ ID NO: 6 or 8 and which retains nucleic acid handling ability. The ability of a variant to handle nucleic acids can be assayed using any method known in the art. For instance, the variant or a pore having the variant attached thereto can be tested for their ability to handle specific sequences of nucleic acids. The enzyme may include modifications that facilitate handling of the nucleic acid and/or facilitate its activity at high salt concentrations and/or room temperature. The enzyme may include modifications that facilitate covalent attachment to or its interaction with the pore or pore subunit. As discussed above, accessible cysteines may be removed from the enzyme to avoid non-specific reactions with a linker. Alternatively, one or more reactive cysteines may be introduced into the enzyme, for instance as part of a genetically-fused peptide linker, to facilitate attachment to the pore or pore subunit.

Variants may differ from SEQ ID NO: 6 or 8 to the same extent as variants of SEQ ID NO: 2 differ from SEQ ID NO: 2 or 4 as discussed above. A variant of SEQ ID NO: 6 or 8 retains its nucleic acid handling activity. A variant typically contains the regions of SEQ ID NO: 6 or 8 that are responsible for nucleic acid handling activity. The catalytic domains of SEQ ID NOs: 6 and 8 are discussed above. A variant of SEQ ID NO: 6 or 8 preferably comprises the relevant catalytic domain. A variant SEQ ID NO: 6 or 8 typically includes one or more modifications, such as substitutions, additions or deletions, outside the relevant catalytic domain.

Preferred variants of SEQ ID NO: 6 or 8 are described in a co-pending application being filed simultaneously with this application [J A Kemp & Co Ref: N.106566; Oxford Nanolabs Ref: ONL IP 007] which is incorporated herein by reference. All the teachings of that application may be applied equally to the present invention.

Preferred enzymes that are capable of pushing or pulling the construct through the pore include polymerases, exonucleases, helicases and topoisomerases, such as gyrases. The polymerase is preferably a member of any of the Enzyme Classification (EC) groups 2.7.7.6, 2.7.7.7, 2.7.7.19, 2.7.7.48 and 2.7.7.49. The polymerase is preferably a DNA-dependent DNA polymerase, an RNA-dependent DNA polymerase, a DNA-dependent RNA polymerase or an RNA-dependent RNA polymerase. The helicase is preferably a member of any of the Enzyme Classification (EC) groups 3.6.1.- and 2.7.7.-. The helicase is preferably an ATP-dependent DNA helicase (EC group 3.6.1.8), an ATP-dependent RNA helicase (EC group 3.6.1.8) or an ATP-independent RNA helicase. The topoisomerase is preferably a member of any of the Enzyme Classification (EC) groups 5.99.1.2 and 5.99.1.3.

The enzyme may be labelled with a revealing label. The revealing label may be any of those described above.

The enzyme may be isolated from an enzyme-producing organism, such as E. coli, T thermophilus or bacteriophage, or made synthetically or by recombinant means. For example, the enzyme may be synthesised by in vitro translation and transcription as described above and below. The enzyme may be produced in large scale following purification as described above.

Covalent Attachment of the Enzyme to the Pore

In order to effectively sequence the construct, it is important to ensure that a proportion of the nucleotides in the construct is identified in a successive manner. The fixed nature of the enzyme means that a proportion of the nucleotides in the construct affects the current flowing through the pore.

The enzyme attached to the pore handles a construct in such a way that a proportion of the nucleotide in the construct interacts with the pore, preferably the barrel or channel of the pore. Nucleotides are then distinguished on the basis of the different ways in which they affect the current flowing through the pore during the interaction.

The fixed nature of the enzyme means that a construct is handled by the pore in a specific manner. For instance, each nucleotide may be digested from one of the construct in a processive manner or the construct may be pushed or pulled through the pore. This ensures that a proportion of the nucleotides in the construct interacts with the pore and is identified. The lack of any interruption in the signal is important when sequencing nucleic acids. In addition, the fixed nature of the enzyme and the pore means they can be stored together, thereby allowing the production of a ready-to-use sensor.

In a preferred embodiment, an exonuclease enzyme, such as a deoxyribonuclease, is attached to the pore such that a proportion of the nucleotides is released from the construct and interacts with the barrel or channel of the pore. In another preferred embodiment, an enzyme that is capable of pushing or pulling the construct through the pore is attached to the pore such that the construct is pushed or pulled through the barrel or channel of the pore and a proportion of the nucleotides in the construct interacts with the barrel or channel. In this embodiment, the nucleotides may interact with the pore in blocks or groups of more than one, such as 2, 3 or 4. Suitable enzymes include, but are not limited to, polymerases, nucleases, helicases and topoisomerases, such as gyrases. In each embodiment, the enzyme is preferably attached to the pore at a site in close proximity to the opening of the barrel of channel of the pore. The enzyme is more preferably attached to the pore such that its active site is orientated towards the opening of the barrel of channel of the pore. This means that a proportion of the nucleotides of the construct is fed in the barrel or channel. The enzyme is preferably attached to the cis side of the pore.

The pore is attached to the enzyme. The pore may be attached to the enzyme at more than one, such as two or three, points. Attaching the pore to the enzyme at more than one point can be used to constrain the mobility of the enzyme. For instance, multiple attachments may be used to constrain the freedom of the enzyme to rotate or its ability to move away from the pore or pore subunit.

The pore may be in a monomeric form when it is attached to the enzyme (post expression modification). Alternatively, the pore may be an oligomeric pore when it is attached to an enzyme (post oligomerisation modification).

The pore or pore subunit can be attached to the enzyme using any method known in the art. The pore or pore subunit and enzyme may be produced separately and then attached together. The two components may be attached in any configuration. For instance, they may be attached via their terminal (i.e. amino or carboxy terminal) amino acids. Suitable configurations include, but are not limited to, the amino terminus of the enzyme being attached to the carboxy terminus of the pore or pore subunit and vice versa. Alternatively, the two components may be attached via amino acids within their sequences. For instance, the enzyme may be attached to one or more amino acids in a loop region of the pore or pore subunit. In a preferred embodiment, terminal amino acids of the enzyme are attached to one or more amino acids in the loop region of a pore or pore subunit. Terminal amino acids and loop regions are discussed above.

In one preferred embodiment, the pore or pore subunit is genetically fused to the enzyme. A pore or pore subunit is genetically fused to an enzyme if the whole construct is expressed from a single polynucleotide sequence. The coding sequences of the pore or pore subunit and enzyme may be combined in any way to form a single polynucleotide sequence encoding the construct.

The pore or pore subunit and enzyme may be genetically fused in any configuration. The pore or pore subunit and enzyme may be fused via their terminal amino acids. For instance, the amino terminus of the enzyme may be fused to the carboxy terminus of the pore or pore subunit and vice versa. The amino acid sequence of the enzyme is preferably added in frame into the amino acid sequence of the pore or pore subunit. In other words, the enzyme is preferably inserted within the sequence of the pore or pore subunit. In such embodiments, the pore or pore subunit and enzyme are typically attached at two points, i.e. via the amino and carboxy terminal amino acids of the enzyme. If the enzyme is inserted within the sequence of the pore or pore subunit, it is preferred that the amino and carboxy terminal amino acids of the enzyme are in close proximity and are each attached to adjacent amino acids in the sequence of the pore or pore subunit. In a preferred embodiment, the enzyme is inserted into a loop region of the pore or pore subunit. In an especially preferred embodiment, the enzyme is inserted between amino acids, 18 and 19, 44 and 45 or 50 and 51 of SEQ ID NO: 2.

In another preferred embodiment, the pore or pore subunit is chemically fused to the enzyme. A pore or pore subunit is chemically fused to an enzyme if the two parts are chemically attached, for instance via a linker molecule. Suitable methods include, but are not limited to, hex-his tag, Ni-NTA, biotin binding to streptavidin, antibody binding to an antigen, primary amine coupling, GST tags binding to glutathione, MBP tags binding to dextrin, Protein A binding to IgG, reaction between thiols, nucleic acid hybridization linkers and cysteine linkage. DNA hybridization linkers and cysteine linkage are discussed in more detail below. The pore or pore subunit is preferably covalently attached to the enzyme.

The pore must retain its pore forming ability. The pore forming ability of the pore is typically provided by its α-helices and β-strands. β-barrel pores comprise a barrel or channel that is formed from P-strands, whereas α-helix bundle pores comprise a barrel or channel that is formed from α-helices. The α-helices and β-strands are typically connected by loop regions. In order to avoid affecting the pore forming ability, the enzyme is preferably genetically fused to a loop region of the pore or pore subunit or inserted into a loop region of the pore or pore subunit. The loop regions of specific subunits are discussed in more detail above. In a preferred embodiment, enzyme is attached to one or more of amino acids 8, 9, 17, 18, 19, 44, 45, 50 and 51 of SEQ ID NO: 2.

Similarly, the construct retains the nucleic acid handling ability of the enzyme, which is also typically provided by its secondary structural elements (α-helices and p-strands) and tertiary structural elements. In order to avoid adversely affecting the nucleic acid handling ability of the enzyme, the enzyme is preferably genetically fused to the pore or pore subunit or inserted into the pore or pore subunit via residues or regions that does not affect its secondary or tertiary structure.

The pore or pore subunit may be attached directly to the enzyme. The pore or pore subunit is preferably attached to the enzyme using one or more, such as two or three, linkers. The one or more linkers may be designed to constrain the mobility of the enzyme. The linkers may be attached to one or more reactive cysteine residues, reactive lysine residues or non-natural amino acids in the pore, pore subunit subunit and/or enzyme. Suitable linkers are well-known in the art. Suitable linkers include, but are not limited to, chemical crosslinkers and peptide linkers. Preferred linkers are amino acid sequences (i.e. peptide linkers) or nucleic acid hybridization linkers. The length, flexibility and hydrophilicity of the peptide or nucleic acid hybridization linkers are typically designed such that it does not to disturb the functions of the pore or pore subunit and enzyme. Preferred flexible peptide linkers are stretches of 2 to 20, such as 4, 6, 8, 10 or 16, serine and/or glycine amino acids. More preferred flexible linkers include (SG)1, (SG)2, (SG)3, (SG)4, (SG)5 and (SG)8 wherein S is serine and G is glycine. Preferred rigid linkers are stretches of 2 to 30, such as 4, 6, 8, 16 or 24, proline amino acids. More preferred rigid linkers include (P)12 wherein P is proline.

The nucleic acid hybridization linkers can comprise any of the nucleic acids discussed above. For instance, they may comprise deoxyribonucleic acid (DNA), ribonucleic acid (RNA) or any synthetic nucleic acid known in the art, such as peptide nucleic acid (PNA), glycerol nucleic acid (GNA), threose nucleic acid (TNA), locked nucleic acid (LNA) or other synthetic polymers with nucleotide side chains. The linkers can also be modified such they react with one another once they have hybridised. Alternatively, agents may be used to crosslink the linkers once they have hybridised to one another.

Preferred nucleic acid hybridization linkers correspond to the first 15, 25 or 35 nucleotides from the 5′ end of SEQ ID NO: 10. The linker preferably also has TT at the 3′ end to provide extra flexibility. At the 3′ end, the linkers have a group, such as maleimide, that allows the linker to be attached to the nucleic acid binding protein or surface. Maleimide modified oliognucleotides can be obtained commercially, for instance from ATDBio. More preferred linkers are shown in SEQ ID NOs: 11, 12 and 13. Complementary linkers are shown in SEQ ID NOs: 14, 15 and 16. SEQ ID NO: 11, 12 or 13 may be attached to one of the nucleic acid binding protein and surface and the complementary linker (SEQ ID NO: 14, 15 or 16 respectively) is attached to the other of the nucleic acid binding protein and surface. The nucleic acid binding protein and surface can then be attached together by hybridizing the linkers.

Other preferred chemical crosslinkers are shown in the following Table 3.

TABLE 3
Some preferred linkers
Name Reacts with Structure
1,4-Bis[3-(2- pyridyldithio)propionamido] butane Thiols
1,11-bis- Maleimidotriethyleneglycol Thiols
3,3′-Dithiodipropionic acid di(N-hydroxysuccinimide ester) Primary amines
Ethylene glycol-bis(succinic acid N-hydroxysuccinimide ester) Primary amines
4,4′- Diisothiocyanatostilbene- 2,2′-disulfonic acid disodium salt Primary amines
Bis[2-(4- azidosalicylamido)ethyl] disulfide Photo- activated, non-specific
3-(2-Pyridyldithio)propionic acid N-hydroxysuccinimide ester Thiols, primary amines
4-Maleimidobutyric acid N- hydroxysuccinimide ester Thiols, primary amines
Iodoacetic acid N- hydroxysuccinimide ester Thiols, primary amines
S-Acetylthioglycolic acid N-hydroxysuccinimide ester Thiols, primary amines
Azide-PEG-maleimide Thiols, alkkyne
Alkyne-PEG-maleimide Thiols, azide

Linkers may be attached to the pore or pore subunit first and then the enzyme, the enzyme first and then the pore or pore subunit or the enzyme and pore or pore subunit at the same time. When the linker is attached to the pore or pore subunit, it may be a monomeric subunit, part of an oligomer of two or more monomers or part of complete oligomeric pore. It is preferred that the linker is reacted before any purification step to remove any unbound linker.

A preferred method of attaching the pore or pore subunit to the enzyme is via cysteine linkage. This can be mediated by a bi-functional chemical linker or by a polypeptide linker with a terminal presented cysteine residue. α-HL (SEQ ID NO: 2) lacks native cysteine residues so the introduction of a cysteine into the sequence of SEQ ID NO: 2 enables the controlled covalent attachment of the enzyme to the subunit. Cysteines can be introduced at various positions, such as position K8, T9 or N17 of SEQ ID NO: 2 or at the carboxy terminus of SEQ ID NO: 2. The length, reactivity, specificity, rigidity and solubility of any bi-functional linker may be designed to ensure that the enzyme is positioned correctly in relation to the subunit and the function of both the subunit and enzyme is retained. Suitable linkers include bismaleimide crosslinkers, such as 1,4-bis(maleimido)butane (BMB) or bis(maleimido)hexane. One draw back of bi-functional linkers is the requirement of the enzyme to contain no further surface accessible cysteine residues, as binding of the bi-functional linker to these cannot be controlled and may affect substrate binding or activity. If the enzyme does contain several accessible cysteine residues, modification of the enzyme may be required to remove them while ensuring the modifications do not affect the folding or activity of the enzyme. In a preferred embodiment, a reactive cysteine is presented on a peptide linker that is genetically attached to the enzyme. This means that additional modifications will not necessarily be needed to remove other accessible cysteine residues from the enzyme. The reactivity of cysteine residues may be enhanced by modification of the adjacent residues, for example on a peptide linker. For instance, the basic groups of flanking arginine, histidine or lysine residues will change the pKa of the cysteines thiol group to that of the more reactive Sāˆ’ group. The reactivity of cysteine residues may be protected by thiol protective groups such as dTNB. These may be reacted with one or more cysteine residues of the enzyme or pore or pore subunit, either as a monomer or part of an oligomer, before a linker is attached.

Cross-linkage of pores, pore subunits or enzymes to themselves may be prevented by keeping the concentration of linker in a vast excess of the pore, pore subunit and/or enzyme. Alternatively, a ā€œlock and keyā€ arrangement may be used in which two linkers are used. For instance, click chemistry, such as azide alkyne Huisgen cycloaddition, may be used to ensure that the pore or pore subunit only binds to the enzyme and not to itself and vice versa. In a preferred embodiment, the azide-PEG-maleimide and alkyne-PEG-maleimide linkers shown in Table 3 above are used. One is attached to the pore or pore subunit and the other is attached to the enzyme. This ensures that binding only occurs between the pore or pore subunit and the enzyme.

Only one end of each linker may react together to form a longer linker and the other ends of the linker each react with a different part of the construct (i.e. subunit or monomer). The site of covalent attachment is selected such that the enzyme handles a construct in such a way that a proportion of the nucleotides in the construct interacts with the pore. Nucleotides are then distinguished on the basis of the different ways in which they affect the current flowing through the pore during the interaction.

The enzyme is preferably attached to a part of the pore or pore subunit that forms part of the cis side of a pore comprising the construct. In electrophysiology, the cis side is the grounded side by convention. If a hemolysin pore is inserted correctly into an elcetrophysiology apparatus, the Cap region is on the cis side. It is well known that, under a positive potential, nucleotides will migrate from the cis to the trans side of pores used for stochastic sensing. Positioning the enzyme at the cis side of a pore allows it to handle the construct such that a proportion of the nucleotides in the sequence enters the barrel or channel of the pore and interacts with it. Preferably, at least 20%, at least 40%, at least 50%, at least 80% or at least 90% of the nucleotides in the sequence enters the barrel or channel of the pore and interacts with it.

The site and method of covalent attachment is preferably selected such that mobility of the enzyme is constrained. This helps to ensure that the enzyme handles the construct in such a way that a proportion of the nucleotides in the construct interacts with the pore. For instance, constraining the ability of enzyme to move means that its active site can be permanently orientated towards the part of the pore or pore subunit that forms part of the opening of the barrel of channel of the pore. The mobility of the enzyme may be constrained by increasing the number of points at which the enzyme is attached to the pore or pore subunit and/or the use of specific linkers.

Molecular Adaptor

In some embodiments, the pore comprises a molecular adaptor that facilitates the interaction between the pore and the nucleotides or the construct. The presence of the adaptor improves the host-guest chemistry of the pore and nucleotides released from or present in the construct. The principles of host-guest chemistry are well-known in the art. The adaptor has an effect on the physical or chemical properties of the pore that improves its interaction with nucleotides. The adaptor typically alters the charge of the barrel or channel of the pore or specifically interacts with or binds to nucleotides thereby facilitating their interaction with the pore.

The adaptor mediates the interaction between nucleotides released from or present in the construct and the pore. The nucleotides preferably reversibly bind to the pore via or in conjunction with the adaptor. The nucleotides most preferably reversibly bind to the pore via or in conjunction with the adaptor as they pass through the pore across the membrane. The nucleotides can also reversibly bind to the barrel or channel of the pore via or in conjunction with the adaptor as they pass through the pore across the membrane. The adaptor preferably constricts the barrel or channel so that it may interact with the nucleotides.

The adaptor is typically cyclic. The adaptor preferably has the same symmetry as the pore. An adaptor having seven-fold symmetry is typically used if the pore is heptameric (e.g. has seven subunits around a central axis that contribute 14 strands to a transmembrane (3 barrel). Likewise, an adaptor having six-fold symmetry is typically used if the pore is hexameric (e.g. has six subunits around a central axis that contribute 12 strands to a transmembrane β barrel, or is a 12-stranded β-barrel). Any adaptor that facilitates the interaction between the pore and the nucleotide can be used. Suitable adaptors include, but are not limited to, cyclodextrins, cyclic peptides and cucurbiturils. The adaptor is preferably a cyclodextrin or a derivative thereof. The adaptor is more preferably heptakis-6-aminoβ-cyclodextrin (am7-βCD), 6-monodeoxy-6-monoamino-β-cyclodextrin (am1-βCD) or heptakis-(6-deoxy-6-guanidino)-cyclodextrin (gu7-βCD). Table 4 below shows preferred combinations of pores and adaptors.

TABLE 4
Suitable combinations of pores and adaptors
Number of strands in
the transmembrane
Pore β-barrel Adaptor
Leukocidin 16 γ-cyclodextrin (γ-CD)
OmpF 16 γ-cyclodextrin (γ-CD)
α-hemolysin (or a 14 β-cyclodextrin (β-CD)
variant thereof 6-monodeoxy-6-
discussed above) monoamino-β-cyclodextrin
(am1β-CD)
heptakis-6-amino-β-
cyclodextrin (am7-β-CD)
heptakis-(6-deoxy-6-
guanidino)-cyclodextrin
(gu7-β-CD)
OmpG 14 β-cyclodextrin (β-CD)
6-monodeoxy-6-
monoamino-β-cyclodextrin
(am1β-CD)
heptakis-6-amino-β-
cyclodextrin (am7-β-CD)
heptakis-(6-deoxy-6-
guanidino)-cyclodextrin
(gu7-β-CD)
NalP 12 α-cyclodextrin (α-CD)
OMPLA 12 α-cyclodextrin (α-CD)

The adaptor is preferably covalently attached to the pore. The adaptor can be covalently attached to the pore using any method known in the art. The adaptor may be attached directly to the pore. The adaptor is preferably attached to the pore using a bifunctional crosslinker. Suitable crosslinkers are well-known in the art. Preferred crosslinkers include 2,5-dioxopyrrolidin-1-yl 3-(pyridin-2-yldisulfanyl)propanoate, 2,5-dioxopyrrolidin-1-yl 4-(pyridin-2-yldisulfanyl)butanoate and 2,5-dioxopyrrolidin-1-yl8-(pyridin-2-yldisulfanyl)octananoate. The most preferred crosslinker is succinimidyl 3-(2-pyridyldithio)propionate (SPDP). Typically, the adaptor is covalently attached to the bifunctional crosslinker before the adaptor/crosslinker complex is covalently attached to the pore but it is also possible to covalently attach the bifunctional crosslinker to the pore before the bifunctional crosslinker/pore complex is attached to the adaptor.

The site of covalent attachment is selected such that the adaptor facilitates interaction of nucleotides released from or present in the construct with the pore and thereby allows detection of nucleotides. For pores based on α-HL, the correct orientation of the adaptor within the barrel or channel of the pore and the covalent attachment of adaptor to the pore can be facilitated using specific modifications to SEQ ID NO: 2. In particular, every subunit of the pore preferably has a glutamine at position 139 of SEQ ID NO: 2. One or more of the subunits of the pore may have an arginine at position 113 of SEQ ID NO: 2. One or more of the subunits of the pore may have a cysteine at position 119, 121 or 135 of SEQ ID NO: 2.

Interaction Between the Pore and Nucleotides

The methods may be carried out using any suitable membrane/pore system in which a pore having a nucleic acid handling enzyme, such as an exonuclease, attached thereto is inserted into a membrane. The methods are typically carried out using (i) an artificial membrane comprising a pore having a nucleic acid handling enzyme, such as an exonuclease, attached thereto, (ii) an isolated, naturally occurring membrane comprising a pore having a nucleic acid handling enzyme, such as an exonuclease, attached thereto, or (iii) a cell expressing a pore having a nucleic acid handling enzyme, such as an exonuclease, attached thereto. The methods are preferably carried out using an artificial membrane. The membrane may comprise other transmembrane and/or intramembrane proteins as well as other molecules in addition to the modified pore.

The membrane forms a barrier to the flow of ions, nucleotides and nucleic acids. The membrane is preferably a lipid bilayer. Lipid bilayers suitable for use in accordance with the invention can be made using methods known in the art. For example, lipid bilayer membranes can be formed using the method of Montal and Mueller (1972). Lipid bilayers can also be formed using the method described in International Application No. PCT/GB08/000563 and PCT/GB07/002856.

The methods of the invention may be carried out using lipid bilayers formed from any membrane lipid including, but not limited to, phospholipids, glycolipids, cholesterol and mixtures thereof. Any of the lipids described in International Application No. PCT/GB08/000563 may be used.

Methods are known in the art for inserting pores into membranes, such as lipid bilayers. Some of those methods are discussed above.

The nucleotide or construct may be contacted with the pore on either side of the membrane. The nucleotide or construct may be introduced to the pore on either side of the membrane. The nucleotide or construct is typically contacted with the side of the membrane on which the enzyme is attached to the pore. This allows the enzyme to handle the construct during the method.

A proportion of the nucleotides of the construct interacts with the pore and/or adaptor as it passes across the membrane through the barrel or channel of the pore. Alternatively, if the construct is digested by an exonuclease, the nucleotide may interact with the pore via or in conjunction with the adaptor, dissociate from the pore and remain on the same side of the membrane. The methods may involve the use of pores in which the orientation of the adaptor is fixed. In such embodiments, the nucleotide is preferably contacted with the end of the pore towards which the adaptor is oriented. Most preferably, the nucleotide is contacted with the end of the pore towards which the portion of the adaptor that interacts with the nucleotide is orientated.

The nucleotides may interact with the pore in any manner and at any site. As discussed above, the nucleotides preferably reversibly bind to the pore via or in conjunction with the adaptor. The nucleotides most preferably reversibly bind to the pore via or in conjunction with the adaptor as they pass through the pore across the membrane. The nucleotides can also reversibly bind to the barrel or channel of the pore via or in conjunction with the adaptor as they pass through the pore across the membrane.

During the interaction between a nucleotides and the pore, the nucleotide affects the current flowing through the pore in a manner specific for that nucleotide. For example, a particular nucleotide will reduce the current flowing through the pore for a particular mean time period and to a particular extent. In other words, the current flowing through the pore is distinctive for a particular nucleotide. Control experiments may be carried out to determine the effect a particular nucleotide has on the current flowing through the pore. Results from carrying out the method of the invention on a test sample can then be compared with those derived from such a control experiment in order to identify a particular nucleotide.

Apparatus

The methods may be carried out using any apparatus that is suitable for investigating a membrane/pore system in which a pore having a nucleic acid handling enzyme attached thereto is inserted into a membrane. The methods may be carried out using any apparatus that is suitable for stochastic sensing. For example, the apparatus comprises a chamber comprising an aqueous solution and a barrier that separates the chamber into two sections. The barrier has an aperture in which the membrane containing the pore is formed. The nucleotide or construct may be contacted with the pore by introducing the nucleic acid into the chamber. The nucleic acid may be introduced into either of the two sections of the chamber, but is preferably introduced into the section of the chamber containing the enzyme.

The methods may be carried out using the apparatus described in International Application No. PCT/GB08/000562.

The methods involve measuring the current passing through the pore during interaction with the nucleotides. Therefore the apparatus also comprises an electrical circuit capable of applying a potential and measuring an electrical signal across the membrane and pore. The methods may be carried out using a patch clamp or a voltage clamp. The methods preferably involves the use of a voltage clamp.

Conditions

The methods of the invention involve the measuring of a current passing through the pore during interaction with nucleotides of a construct. Suitable conditions for measuring ionic currents through transmembrane pores are known in the art and disclosed in the Examples. The method is carried out with a voltage applied across the membrane and pore. The voltage used is typically from āˆ’400 mV to +400 mV. The voltage used is preferably in a range having a lower limit selected from āˆ’400 mV, āˆ’300mV, āˆ’200 mV, āˆ’150 mV, āˆ’100 mV, āˆ’50 mV, āˆ’20 mV and 0 mV and an upper limit independently selected from +10 mV, +20 mV, +50 mV, +100 mV, +150 mV, +200 mV, +300 mV and +400 mV. The voltage used is more preferably in the range 120 mV to 170 mV. It is possible to increase discrimination between different nucleotides by a pore of the invention by varying the applied potential.

The methods are carried out in the presence of any alkali metal chloride salt. In the exemplary apparatus discussed above, the salt is present in the aqueous solution in the chamber. Potassium chloride (KCl), sodium chloride (NaCl) or caesium chloride (CsCl) is typically used. KCl is preferred. The salt concentration is typically from 0.1 to 2.5 M, from 0.3 to 1.9 M, from 0.5 to 1.8 M, from 0.7 to 1.7 M, from 0.9 to 1.6 M or from 1 M to 1.4 M. High salt concentrations provide a high signal to noise ratio and allow for currents indicative of the presence of a nucleotide to be identified against the background of normal current fluctations. However, lower salt concentrations may have to be used so that the enzyme is capable of functioning.

The methods are typically carried out in the presence of a buffer. In the exemplary apparatus discussed above, the buffer is present in the aqueous solution in the chamber. Any buffer may be used in the methods. One suitable buffer is Tris-HCl buffer. The methods are typically carried out at a pH of from 4.0 to 10.0, from 4.5 to 9.5, from 5.0 to 9.0, from 5.5 to 8.8, from 6.0 to 8.7 or from 7.0 to 8.8 or 7.5 to 8.5. The pH used is preferably about 7.5.

The methods are typically carried out at from 0° C. to 100° C., from 15° C. to 95° C., from 16° C. to 90° C., from 17° C. to 85° C., from 18° C. to 80° C., 19° C. to 70° C., or from 20° C. to 60° C. The methods may be carried out at room temperature. The methods are preferably carried out at a temperature that supports enzyme function, such as about 37° C. Good nucleotide discrimination can be achieved at low salt concentrations if the temperature is increased. However, lower temperatures, particularly those below room temperature, result in longer dwell times and can therefore be used to obtain a higher degree of accuracy.

In addition to increasing the solution temperature, there are a number of other strategies that can be employed to increase the conductance of the solution, while maintaining conditions that are suitable for enzyme activity. One such strategy is to use the lipid bilayer to divide two different concentrations of salt solution, a low salt concentration of salt on the enzyme side and a higher concentration on the opposite side. One example of this approach is to use 200 mM of KCl on the cis side of the membrane and 500 mM KCl in the trans chamber. At these conditions, the conductance through the pore is expected to be roughly equivalent to 400 mM KCl under normal conditions, and the enzyme only experiences 200 mM if placed on the cis side. Another possible benefit of using asymmetric salt conditions is the osmotic gradient induced across the pore. This net flow of water could be used to pull nucleotides into the pore for detection. A similar effect can be achieved using a neutral osmolyte, such as sucrose, glycerol or PEG. Another possibility is to use a solution with relatively low levels of KCl and rely on an additional charge carrying species that is less disruptive to enzyme activity.

Exonuclease-Based Methods

In one embodiment, the methods of sequencing involve contacting the construct with a pore having an exonuclease enzyme, such as deoxyribonuclease, attached thereto. Any of the exonuclease enzymes discussed above may be used in the method. The exonuclease releases individual nucleotides from one end of the construct. Exonucleases are enzymes that typically latch onto one end of a nucleic acid sequence and digest the sequence one nucleotide at a time from that end. The exonuclease can digest the nucleic acid in the 5′ to 3′ direction or 3′ to 5′ direction. The end of the nucleic acid to which the exonuclease binds is typically determined through the choice of enzyme used and/or using methods known in the art. Hydroxyl groups or cap structures at either end of the nucleic acid sequence may typically be used to prevent or facilitate the binding of the exonuclease to a particular end of the nucleic acid sequence.

The method involves contacting the construct with the exonuclease so that the nucleotides are digested from the end of the construct at a rate that allows identification of a proportion of nucleotides as discussed above. Methods for doing this are well known in the art. For example, Edman degradation is used to successively digest single amino acids from the end of polypeptide such that they may be identified using High Performance Liquid Chromatography (HPLC). A homologous method may be used in the present invention.

The rate at which the exonuclease can be altered by mutation compared to the wild type enzyme. A suitable rate of activity of the exonuclease in the method of sequencing involves digestion of from 0.5 to 1000 nucleotides per second, from 0.6 to 500 nucleotides per second, 0.7 to 200 nucleotides per second, from 0.8 to 100 nucleotides per second, from 0.9 to 50 nucleotides per second or 1 to 20 or 10 nucleotides per second. The rate is preferably 1, 10, 100, 500 or 1000 nucleotides per second. A suitable rate of exonuclease activity can be achieved in various ways. For example, variant exonucleases with a reduced or improved optimal rate of activity may be used in accordance with the invention.

Pushing or Pulling DNA Through the Pore

Strand sequencing involves the controlled and stepwise translocation of nucleic acid polymers through a pore. The majority of DNA handling enzymes are suitable for use in this application provided they hydrolyse, polymerise or process single stranded DNA or RNA. Preferred enzymes are polymerases, nucleases, helicases and topoisomerases, such as gyrases. The enzyme moiety is not required to be in as close a proximity to the pore lumen as for individual nucleotide sequencing as there is no potential for disorder in the series in which nucleotides reach the sensing moiety of the pore.

The two strategies for single strand DNA sequencing are the translocation of the DNA through the nanopore, both cis to trans and trans to cis, either with or against an applied potential. The most advantageous mechanism for strand sequencing is the controlled translocation of single strand DNA through the nanopore with an applied potential. Exonucleases that act progressively or processively on double stranded DNA can be used on the cis side of the pore to feed the remaining single strand through under an applied potential or the trans side under a reverse potential. Likewise, a helicase that unwinds the double stranded DNA can also be used in a similar manner. There are also possibilities for sequencing applications that require strand translocation against an applied potential, but the DNA must be first ā€œcaughtā€ by the enzyme under a reverse or no potential. With the potential then switched back following binding the strand will pass cis to trans through the pore and be held in an extended conformation by the current flow. The single strand DNA exonucleases or single strand DNA dependent polymerases can act as molecular motors to pull the recently translocated single strand back through the pore in a controlled stepwise manner, trans to cis, against the applied potential.

The following Example illustrates the invention:

1 Example

1.1 Generation of the Sequencing Template The desired template is generated by the ligation of artificial hairpin adaptors (referred to in this document as ā€œType I adaptorā€ and ā€œType II adaptorā€) to the blunt ends of the double stranded (dsDNA) template fragments. The adaptors are artificial, chemically synthesised DNA sequences that are designed to facilitate construction, purification and final release of the desired single stranded sequencing template. Being artificial sequences, these adaptors have a great degree of flexibility in their actual sequence and therefore functionality can be built into the sequences used.
1.2 Type I adaptor

The Type I adaptor (FIG. 1) is synthesised as a single stranded DNA (ssDNA) oligonucleotide in which the 5′ terminal nucleotides are complementary to the 3′ terminal nucleotides such that under appropriate conditions, an intramolecular hybridisation occurs, generating a blunt-ended ā€˜hairpin loop’ of DNA with a dsDNA region and a ssDNA ā€˜bubble’ region. The double stranded hybridised region is terminated with (for example) a sequence of bases which represent one half of the recognition sequence of a ā€˜rare cutting’ restriction endonuclease. The ā€˜bubble’ region is a single stranded sequence that can provides a hybridisable ā€˜hook’ for capture of the structure, and any ligation products containing the structure, onto a support surface or bead which is equipped with the complementary ssDNA sequence. The ā€˜bubble’ region may also contain a sequence that identifies a particular Type I adaptor from another otherwise identical Type I adaptor, and thus enables the multiplex analysis of ligation products derived from template DNAs from different individuals.

1.3 Type II adaptor

The Type II adaptor (FIG. 2) is not unlike the Type I adaptor in gross structure, being the product of an intramolecular hybridisation of a long oligonucleotide. The structure formed has a terminal end that also describes half of the palindromic rare-cutting restriction enzyme present at the terminal end of the Type I adaptor hairpin. Additionally, the double stranded region of the Type II adaptor contains the recognition sequence of a distinct rare-cutting restriction endonuclease (2ry in FIG. 2). The adaptor may also contain a sequence that can be used to identify the adaptor and is situated between the end describing half of the palindromic rare-cutting restriction enzyme (1ry in FIG. 2) and the recognition sequence of the distinct rare-cutting restriction endonuclease (2ry in FIG. 2). The bubble region of single stranded DNA of the Type II adaptor can be markedly smaller than that of the Type I adaptor, as although it also harbours a selectable marker, this is in the form of a [Biotin-dT], which enables the capture of any ligation products containing a Type II adaptor onto a surface of immobilised streptavidin.

1.4 Genomic Template

From high molecular weight genomic template, sequencing template may be prepared in a number of ways. An established method is the random fragmentation and end repair of the sheared DNA to blunt ends; it is an accepted and reliable method, and the proposed template generation scheme presumes that this will be the method of choice. However, with modification, the technique described could be modified to accommodate other methods of fragmentation that generate alternative termini, including ā€˜sticky’ ends.

1.5 Ligation of Adaptors to Randomly Fragmented and End Repaired Template DNA

The fragments of sheared DNA will be equipped with a 5′ PO4 and a 3′ OH on both strands. Dephosphorylation of the template would prevent concatamerisation of the template fragments, but would present a challenge of then having to repair the nicks left upon ligation of the 5′ phosphorylated adaptors. Use of excess concentrations of the adaptors with phosphorylated template DNA will limit the possibility of template:template ligations, but will mean that a large number of ligation products devoid of inserted template will be created (FIG. 3 and FIG. 4).

A variety of different ligation products will be generated by the combination of Type I, Type II and blunt ended templates:

    • Adaptor—adaptor products
      • Type I—Type 1 will not bind to streptavidin and will be eliminated prior to any RE treatments.
      • Type I—Type II will bind to streptavidin, but will be degraded by primary RE digestion.
      • Type II—Type I will bind to streptavidin, but will be degraded by primary RE digestion.
      • Type II—Type II will bind to streptavidin, and may crosslink streptavidin support beads, but will be degraded by primary RE digestion.
    • Adaptor—dsDNA template—adaptor products
      • Type I—dsDNA template—Type I will not bind to streptavidin and will be eliminated prior to any RE treatments.
      • Type I—dsDNA template—Type II will bind to streptavidin, will survive primary RE digestion and will release the desired product upon secondary RE digestion.
      • Type II—dsDNA template—Type I will bind to streptavidin, will survive primary RE digestion and will release the desired product upon secondary RE digestion.
      • Type II—dsDNA template—Type II will bind to streptavidin, and may crosslink streptavidin support beads, will survive primary RE digestion, but will release a ā€˜single stranded’ template product (not covalently linked) upon secondary RE digestion.

1.6 Isolation of the Desired Sequencing Template

A strategy for streamlined purification of the desired single stranded product is presented (FIG. 5). Post-ligation reaction, all dumbbell structures incorporating Type II adaptors are captured (by virtue of the biotin moiety carried on the Type II adaptors) onto an immobilised streptavidin surface, and any structure which only contain the Type I adaptors remain unbound and can be washed away. Treatment of the bound Type II adaptor structures with the primary restriction endonuclease will cleave those bound products formed by the ligation of two adaptors without any intervening template DNA. All released fragments can then be washed away, whereas the desired products are retained bound to the plate. Application of the secondary restriction enzyme will cleave those bound fragments within the captured Type II adaptor sequence, whether the product of the ligation has just one Type II adaptor or both ends have a Type II adaptor. The release products are either the desired covalently closed structures (ā…”rds of all released structures will be this form) or will be linearised sequences derived from the Type II:template:Type II ligation products (1/3rd of the released products will be this form). The non-closed end of the desired covalently closed structure will be derived from the Type II adaptor and may contain a sequence that may be used to identify that adaptor.

Transferring these released sequences to a fresh plate on which a single stranded DNA sequence complementary to the sequence of the Type I ā€˜bubble’ will enable capture of only those DNA species derived from a Type I:template:Type II ligation product. Washing will remove any other fragments of DNA and will leave only the desired covalently closed TypeI:template:Type II remnant species, which can then be released from the plate (heat, alkali wash) and be denatured ready for exonuclease sequencing.

The above purification scheme has the attraction of being automatable, and in delivering only one species of product: that desired for the sequencing reaction. This product can be released from the immobilised anti-Type I adaptor bubble plate by a simple alkali wash, after which the denatured template DNA (FIG. 6) might be neutralised in the presence of, for example, a buffer solution containing E. coli single stranded binding protein, which when bound to the denatured ssDNA will maintain its single stranded form; a prerequisite for maintaining the processivity of the E. coli Exonuclease I.

1.7 Exonuclease Sequencing of the Desired Sequencing Template

Upon generation of the desired structure, it will be amenable to exonuclease sequencing, with the exonuclease binding to and digesting the 3′ end of the single strand. The 5′ monophosphate nucleosides released will be identified in the pore and will give rise to (ideally) a sequence of bases that correspond to, in order (FIG. 7):

    • Sequence Start: The sequence of a remnant of the Type II adaptor, which possibly contains a sequence that may be used to identify the adaptor.
    • Genomic Sequence: The sequence of a template DNA (on the sense strand).
    • Type I Common: The sequence of the Type I adaptor (which is also the ā€˜capture’ sequence).
    • Type I Identifier: The sequence of the Type I adaptor used to specifically identify a ligation product in a multiplex sequencing reaction.
    • Comp. Genomic Sequence: The sequence of the template DNA (on the antisense strand, so the reverse complement of the sense strand sequence already generated).
    • Sequence End: The sequence of a remnant of the Type II adaptor (as the reverse complement of the first bases sequenced), which possibly contains a sequence that may be used to identify the adaptor.

Sequenceā€ƒlistingā€ƒ
SEQā€ƒIDā€ƒNO:ā€ƒ1ā€ƒ
ā€ƒā€ƒ1ā€ƒATGGCAGATTā€ƒCTGATATTAAā€ƒTATTAAAACCā€ƒGGTACTACAGā€ƒATATTGGAAGā€ƒCAATACTACAā€ƒGTAAAAACAGā€ƒ
ā€ƒ71ā€ƒGTGATTTAGTā€ƒCACTTATGATā€ƒAAAGAAAATGā€ƒGCATGCACAAā€ƒAAAAGTATTTā€ƒTATAGTTTTAā€ƒTCGATGATAAā€ƒ
141ā€ƒAAATCACAATā€ƒAAAAAACTGCā€ƒTAGTTATTAGā€ƒAACAAAAGGTā€ƒACCATTGCTGā€ƒGTCAATATAGā€ƒAGTTTATAGCā€ƒ
211ā€ƒGAAGAAGGTGā€ƒCTAACAAAAGā€ƒTGGTTTAGCCā€ƒTGGCCTTCAGā€ƒCCTTTAAGGTā€ƒACAGTTGCAAā€ƒCTACCTGATAā€ƒ
281ā€ƒATGAAGTAGCā€ƒTCAAATATCTā€ƒGATTACTATCā€ƒCAAGAAATTCā€ƒGATTGATACAā€ƒAAAGAGTATAā€ƒTGAGTACTTTā€ƒ
351ā€ƒAACTTATGGAā€ƒTTCAACGGTAā€ƒATGTTACTGGā€ƒTGATGATACAā€ƒGGAAAAATTGā€ƒGCGGCCTTATā€ƒTGGTGCAAATā€ƒ
421ā€ƒGTTTCGATTGā€ƒGTCATACACTā€ƒGAAATATGTTā€ƒCAACCTGATTā€ƒTCAAAACAATā€ƒTTTAGAGAGCā€ƒCCAACTGATAā€ƒ
491ā€ƒAAAAAGTAGGā€ƒCTGGAAAGTGā€ƒATATTTAACAā€ƒATATGGTGAAā€ƒTCAAAATTGGā€ƒGGACCATACGā€ƒATCGAGATTCā€ƒ
561ā€ƒTTGGAACCCGā€ƒGTATATGGCAā€ƒATCAACTTTTā€ƒCATGAAAACTā€ƒAGAAATGGTTā€ƒCTATGAAAGCā€ƒAGCAGATAACā€ƒ
631ā€ƒTTCCTTGATCā€ƒCTAACAAAGCā€ƒAAGTTCTCTAā€ƒTTATCTTCAGā€ƒGGTTTTCACCā€ƒAGACTTCGCTā€ƒACAGTTATTAā€ƒ
701ā€ƒCTATGGATAGā€ƒAAAAGCATCCā€ƒAAACAACAAAā€ƒCAAATATAGAā€ƒTGTAATATACā€ƒGAACGAGTTCā€ƒGTGATGATTAā€ƒ
771ā€ƒCCAATTGCATā€ƒTGGACTTCAAā€ƒCAAATTGGAAā€ƒAGGTACCAATā€ƒACTAAAGATAā€ƒAATGGACAGAā€ƒTCGTTCTTCAā€ƒ
841ā€ƒGAAAGATATAā€ƒAAATCGATTGā€ƒGGAAAAAGAAā€ƒGAAATGACAAā€ƒATā€ƒ
SEQā€ƒIDā€ƒNO:ā€ƒ2ā€ƒ
ā€ƒā€ƒ1ā€ƒADSDINIKTGā€ƒTTDIGSNTTVā€ƒKTGDLVTYDKā€ƒENGMHKKVFYā€ƒSFIDDKNHNKā€ƒKLLVIRTKGTā€ƒIAGQYRVYSEā€ƒ
ā€ƒ71ā€ƒEGANKSGLAWā€ƒPSAFKVQLQLā€ƒPDNEVAQISDā€ƒYYPRNSIDTKā€ƒEYMSTLTYGFā€ƒNGNVTGDDTGā€ƒKIGGLIGANVā€ƒ
141ā€ƒSIGHTLKYVQā€ƒPDFKTILESPā€ƒTDKKVGWKVIā€ƒFNNMVNQNWGā€ƒPYDRDSWNPVā€ƒYGNQLFMKTRā€ƒNGSMKAADNFā€ƒ
211ā€ƒLDPNKASSLLā€ƒSSGFSPDFATā€ƒVITMDRKASKā€ƒQQTNIDVIYEā€ƒRVRDDYQLHWā€ƒTSTNWKGTNTā€ƒKDKWTDRSSEā€ƒ
281ā€ƒRYKIDWEKEEā€ƒMTNā€ƒ
SEQā€ƒIDā€ƒNO:ā€ƒ3ā€ƒ
ā€ƒā€ƒ1ā€ƒATGGCAGATTā€ƒCTGATATTAAā€ƒTATTAAAACCā€ƒGGTACTACAGā€ƒATATTGGAAGā€ƒCAATACTACAā€ƒGTAAAAACAGā€ƒ
ā€ƒ71ā€ƒGTGATTTAGTā€ƒCACTTATGATā€ƒAAAGAAAATGā€ƒGCATGCACAAā€ƒAAAAGTATTTā€ƒTATAGTTTTAā€ƒTCGATGATAAā€ƒ
141ā€ƒAAATCACAATā€ƒAAAAAACTGCā€ƒTAGTTATTAGā€ƒAACAAAAGGTā€ƒACCATTGCTGā€ƒGTCAATATAGā€ƒAGTTTATAGCā€ƒ
211ā€ƒGAAGAAGGTGā€ƒCTAACAAAAGā€ƒTGGTTTAGCCā€ƒTGGCCTTCAGā€ƒCCTTTAAGGTā€ƒACAGTTGCAAā€ƒCTACCTGATAā€ƒ
281ā€ƒATGAAGTAGCā€ƒTCAAATATCTā€ƒGATTACTATCā€ƒCAAGAAATTCā€ƒGATTGATACAā€ƒAAAGAGTATAā€ƒGGAGTACTTTā€ƒ
351ā€ƒAACTTATGGAā€ƒTTCAACGGTAā€ƒATGTTACTGGā€ƒTGATGATACAā€ƒGGAAAAATTGā€ƒGCGGCCTTATā€ƒTGGTGCACAAā€ƒ
421ā€ƒGTTTCGATTGā€ƒGTCATACACTā€ƒGAAATATGTTā€ƒCAACCTGATTā€ƒTCAAAACAATā€ƒTTTAGAGAGCā€ƒCCAACTGATAā€ƒ
491ā€ƒAAAAAGTAGGā€ƒCTGGAAAGTGā€ƒATATTTAACAā€ƒATATGGTGAAā€ƒTCAAAATTGGā€ƒGGACCATACGā€ƒATCGAGATTCā€ƒ
561ā€ƒTTGGAACCCGā€ƒGTATATGGCAā€ƒATCAACTTTTā€ƒCATGAAAACTā€ƒAGAAATGGTTā€ƒCTATGAAAGCā€ƒAGCAGATAACā€ƒ
631ā€ƒTTCCTTGATCā€ƒCTAACAAAGCā€ƒAAGTTCTCTAā€ƒTTATCTTCAGā€ƒGGTTTTCACCā€ƒAGACTTCGCTā€ƒACAGTTATTAā€ƒ
701ā€ƒCTATGGATAGā€ƒAAAAGCATCCā€ƒAAACAACAAAā€ƒCAAATATAGAā€ƒTGTAATATACā€ƒGAACGAGTTCā€ƒGTGATGATTAā€ƒ
771ā€ƒCCAATTGCATā€ƒTGGACTTCAAā€ƒCAAATTGGAAā€ƒAGGTACCAATā€ƒACTAAAGATAā€ƒAATGGACAGAā€ƒTCGTTCTTCAā€ƒ
841ā€ƒGAAAGATATAā€ƒAAATCGATTGā€ƒGGAAAAAGAAā€ƒGAAATGACAAā€ƒATā€ƒ
SEQā€ƒIDā€ƒNO:ā€ƒ4ā€ƒ
ā€ƒā€ƒ1ā€ƒADSDINIKTGā€ƒTTDIGSNTTVā€ƒKTGDLVTYDKā€ƒENGMHKKVFYā€ƒSFIDDKNHNKā€ƒKLLVIRTKGTā€ƒIAGQYRVYSEā€ƒ
ā€ƒ71ā€ƒEGANKSGLAWā€ƒPSAFKVQLQLā€ƒPDNEVAQISDā€ƒYYPRNSIDTKā€ƒEYRSTLTYGFā€ƒNGNVTGDDTGā€ƒKIGGLIGAQVā€ƒ
141ā€ƒSIGHTLKYVQā€ƒPDFKTILESPā€ƒTDKKVGWKVIā€ƒFNNMVNQNWGā€ƒPYDRDSWNPVā€ƒYGNQLFMKTRā€ƒNGSMKAADNF
211ā€ƒLDPNKASSLLā€ƒSSGFSPDFATā€ƒVITMDRKASKā€ƒQQTNIDVIYEā€ƒRVRDDYQLHWā€ƒTSTNWKGTNTā€ƒKDKWTDRSSEā€ƒ
281ā€ƒRYKIDWEKEEā€ƒMTNā€ƒ
SEQā€ƒIDā€ƒNO:ā€ƒ5ā€ƒ
ā€ƒā€ƒā€ƒ1ā€ƒATGATGAATGā€ƒACGGTAAGCAā€ƒACAATCTACCā€ƒTTTTTGTTTCā€ƒACGATTACGAā€ƒAACCTTTGGCā€ƒACGCACCCCGā€ƒ
ā€ƒā€ƒ71ā€ƒCGTTAGATCGā€ƒCCCTGCACAGā€ƒTTCGCAGCCAā€ƒTTCGCACCGAā€ƒTAGCGAATTCā€ƒAATGTCATCGā€ƒGCGAACCCGAā€ƒ
ā€ƒ141ā€ƒAGTCTTTTACā€ƒTGCAAGCCCGā€ƒCTGATGACTAā€ƒTTTACCCCAGā€ƒCCAGGAGCCGā€ƒTATTAATTACā€ƒCGGTATTACCā€ƒ
ā€ƒ211ā€ƒCCGCAGGAAGā€ƒCACGGGCGAAā€ƒAGGAGAAAACā€ƒGAAGCCGCGTā€ƒTTGCCGCCCGā€ƒTATTCACTCGā€ƒCTTTTTACCGā€ƒ
ā€ƒ281ā€ƒTACCGAAGACā€ƒCTGTATTCTGā€ƒGGCTACAACAā€ƒATGTGCGTTTā€ƒCGACGACGAAā€ƒGTCACACGCAā€ƒACATTTTTTAā€ƒ
ā€ƒ351ā€ƒTCGTAATTTCā€ƒTACGATCCTTā€ƒACGCCTGGAGā€ƒCTGGCAGCATā€ƒGATAACTCGCā€ƒGCTGGGATTTā€ƒACTGGATGTTā€ƒ
ā€ƒ421ā€ƒATGCGTGCCTā€ƒGTTATGCCCTā€ƒGCGCCCGGAAā€ƒGGAATAAACTā€ƒGGCCTGAAAAā€ƒTGATGACGGTā€ƒCTACCGAGCTā€ƒ
ā€ƒ491ā€ƒTTCGCCTTGAā€ƒGCATTTAACCā€ƒAAAGCGAATGā€ƒGTATTGAACAā€ƒTAGCAACGCCā€ƒCACGATGCGAā€ƒTGGCTGATGTā€ƒ
ā€ƒ561ā€ƒGTACGCCACTā€ƒATTGCGATGGā€ƒCAAAGCTGGTā€ƒAAAAACGCGTā€ƒCAGCCACGCCā€ƒTGTTTGATTAā€ƒTCTCTTTACCā€ƒ
ā€ƒ631ā€ƒCATCGTAATAā€ƒAACACAAACTā€ƒGATGGCGTTGā€ƒATTGATGTTCā€ƒCGCAGATGAAā€ƒACCCCTGGTGā€ƒCACGTTTCCGā€ƒ
ā€ƒ701ā€ƒGAATGTTTGGā€ƒAGCATGGCGCā€ƒGGCAATACCAā€ƒGCTGGGTGGCā€ƒACCGCTGGCGā€ƒTGGCATCCTGā€ƒAAAATCGCAAā€ƒ
ā€ƒ771ā€ƒTGCCGTAATTā€ƒATGGTGGATTā€ƒTGGCAGGAGAā€ƒCATTTCGCCAā€ƒTTACTGGAACā€ƒTGGATAGCGAā€ƒCACATTGCGCā€ƒ
ā€ƒ841ā€ƒGAGCGTTTATā€ƒATACCGCAAAā€ƒAACCGATCTTā€ƒGGCGATAACGā€ƒCCGCCGTTCCā€ƒGGTTAAGCTGā€ƒGTGCATATCAā€ƒ
ā€ƒ911ā€ƒATAAATGTCCā€ƒGGTGCTGGCCā€ƒCAGGCGAATAā€ƒCGCTACGCCCā€ƒGGAAGATGCCā€ƒGACCGACTGGā€ƒGAATTAATCGā€ƒ
ā€ƒ981ā€ƒTCAGCATTGCā€ƒCTCGATAACCā€ƒTGAAAATTCTā€ƒGCGTGAAAATā€ƒCCGCAAGTGCā€ƒGCGAAAAAGTā€ƒGGTGGCGATAā€ƒ
1051ā€ƒTTCGCGGAAGā€ƒCCGAACCGTTā€ƒTACGCCTTCAā€ƒGATAACGTGGā€ƒATGCACAGCTā€ƒTTATAACGGCā€ƒTTTTTCAGTGā€ƒ
1121ā€ƒACGCAGATCGā€ƒTGCAGCAATGā€ƒAAAATTGTGCā€ƒTGGAAACCGAā€ƒGCCGCGTAATā€ƒTTACCGGCACā€ƒTGGATATCACā€ƒ
1191ā€ƒTTTTGTTGATā€ƒAAACGGATTGā€ƒAAAAGCTGTTā€ƒGTTCAATTATā€ƒCGGGCACGCAā€ƒACTTCCCGGGā€ƒGACGCTCGATā€ƒ
1261ā€ƒTATGCCGAGCā€ƒAGCAACGCTGā€ƒGCTGGAGCACā€ƒCGTCGCCAGGā€ƒTCTTCACGCCā€ƒAGAGTTTTTGā€ƒCAGGGTTATGā€ƒ
1331ā€ƒCTGATGAATTā€ƒGCAGATGCTGā€ƒGTACAACAATā€ƒATGCCGATGAā€ƒCAAAGAGAAAā€ƒGTGGCGCTGTā€ƒTAAAAGCACTā€ƒ
1401ā€ƒTTGGCAGTACā€ƒGCGGAAGAGAā€ƒTTGTCā€ƒ
SEQā€ƒIDā€ƒNO:ā€ƒ6ā€ƒ
ā€ƒā€ƒā€ƒ1ā€ƒMMNDGKQQSTā€ƒFLFHDYETFGā€ƒTHPALDRPAQā€ƒFAAIRTDSEFā€ƒNVIGEPEVFYā€ƒCKPADDYLPQā€ƒPGAVLITGITā€ƒ
ā€ƒā€ƒ71ā€ƒPQEARAKGENā€ƒEAAFAARIHSā€ƒLFTVPKTCILā€ƒGYNNVRFDDEā€ƒVTRNIFYRNFā€ƒYDPYAWSWQHā€ƒDNSRWDLLDVā€ƒ
ā€ƒ141ā€ƒMRACYALRPEā€ƒGINWPENDDGā€ƒLPSFRLEHLTā€ƒKANGIEHSNAā€ƒHDAMADVYATā€ƒIAMAKLVKTRā€ƒQPRLFDYLFTā€ƒ
ā€ƒ211ā€ƒHRNKHKLMALā€ƒIDVPQMKPLVā€ƒHVSGMFGAWRā€ƒGNTSWVAPLAā€ƒWHPENRNAVIā€ƒMVDLAGDISPā€ƒLLELDSDTLRā€ƒ
ā€ƒ281ā€ƒERLYTAKTDLā€ƒGDNAAVPVKLā€ƒVHINKCPVLAā€ƒQANTLRPEDAā€ƒDRLGINRQHCā€ƒLDNLKILRENā€ƒPQVREKVVAIā€ƒ
ā€ƒ351ā€ƒFAEAEPFTPSā€ƒDNVDAQLYNGā€ƒFFSDADRAAMā€ƒKIVLETEPRNā€ƒLPALDITFVDā€ƒKRIEKLLFNYā€ƒRARNFPGTLDā€ƒ
ā€ƒ421ā€ƒYAEQQRWLEHā€ƒRRQVFTPEFLā€ƒQGYADELQMLā€ƒVQQYADDKEKā€ƒVALLKALWQYā€ƒAEEIVā€ƒ
SEQā€ƒIDā€ƒNO:ā€ƒ7ā€ƒ
ā€ƒā€ƒā€ƒ1ā€ƒATGTTTCGTCā€ƒGTAAAGAAGAā€ƒTCTGGATCCGā€ƒCCGCTGGCACā€ƒTGCTGCCGCTā€ƒGAAAGGCCTGā€ƒCGCGAAGCCGā€ƒ
ā€ƒā€ƒ71ā€ƒCCGCACTGCTā€ƒGGAAGAAGCGā€ƒCTGCGTCAAGā€ƒGTAAACGCATā€ƒTCGTGTTCACā€ƒGGCGACTATGā€ƒATGCGGATGGā€ƒ
ā€ƒ141ā€ƒCCTGACCGGCā€ƒACCGCGATCCā€ƒTGGTTCGTGGā€ƒTCTGGCCGCCā€ƒCTGGGTGCGGā€ƒATGTTCATCCā€ƒGTTTATCCCGā€ƒ
ā€ƒ211ā€ƒCACCGCCTGGā€ƒAAGAAGGCTAā€ƒTGGTGTCCTGā€ƒATGGAACGCGā€ƒTCCCGGAACAā€ƒTCTGGAAGCCā€ƒTCGGACCTGTā€ƒ
ā€ƒ281ā€ƒTTCTGACCGTā€ƒTGACTGCGGCā€ƒATTACCAACCā€ƒATGCGGAACTā€ƒGCGCGAACTGā€ƒCTGGAAAATGā€ƒGCGTGGAAGTā€ƒ
ā€ƒ351ā€ƒCATTGTTACCā€ƒGATCATCATAā€ƒCGCCGGGCAAā€ƒAACGCCGCCGā€ƒCCGGGTCTGGā€ƒTCGTGCATCCā€ƒGGCGCTGACGā€ƒ
ā€ƒ421ā€ƒCCGGATCTGAā€ƒAAGAAAAACCā€ƒGACCGGCGCAā€ƒGGCGTGGCGTā€ƒTTCTGCTGCTā€ƒGTGGGCACTGā€ƒCATGAACGCCā€ƒ
ā€ƒ491ā€ƒTGGGCCTGCCā€ƒGCCGCCGCTGā€ƒGAATACGCGGā€ƒACCTGGCAGCā€ƒCGTTGGCACCā€ƒATTGCCGACGā€ƒTTGCCCCGCTā€ƒ
ā€ƒ561ā€ƒGTGGGGTTGGā€ƒAATCGTGCACā€ƒTGGTGAAAGAā€ƒAGGTCTGGCAā€ƒCGCATCCCGGā€ƒCTTCATCTTGā€ƒGGTGGGCCTGā€ƒ
ā€ƒ631ā€ƒCGTCTGCTGGā€ƒCTGAAGCCGTā€ƒGGGCTATACCā€ƒGGCAAAGCGGā€ƒTCGAAGTCGCā€ƒTTTCCGCATCā€ƒGCGCCGCGCAā€ƒ
ā€ƒ701ā€ƒTCAATGCGGCā€ƒTTCCCGCCTGā€ƒGGCGAAGCGGā€ƒAAAAAGCCCTā€ƒGCGCCTGCTGā€ƒCTGACGGATGā€ƒATGCGGCAGAā€ƒ
ā€ƒ771ā€ƒAGCTCAGGCGā€ƒCTGGTCGGCGā€ƒAACTGCACCGā€ƒTCTGAACGCCā€ƒCGTCGTCAGAā€ƒCCCTGGAAGAā€ƒAGCGATGCTGā€ƒ
ā€ƒ841ā€ƒCGCAAACTGCā€ƒTGCCGCAGGCā€ƒCGACCCGGAAā€ƒGCGAAAGCCAā€ƒTCGTTCTGCTā€ƒGGACCCGGAAā€ƒGGCCATCCGGā€ƒ
ā€ƒ911ā€ƒGTGTTATGGGā€ƒTATTGTGGCCā€ƒTCTCGCATCCā€ƒTGGAAGCGACā€ƒCCTGCGCCCGā€ƒGTCTTTCTGGā€ƒTGGCCCAGGGā€ƒ
ā€ƒ981ā€ƒCAAAGGCACCā€ƒGTGCGTTCGCā€ƒTGGCTCCGATā€ƒTTCCGCCGTCā€ƒGAAGCACTGCā€ƒGCAGCGCGGAā€ƒAGATCTGCTGā€ƒ
1051ā€ƒCTGCGTTATGā€ƒGTGGTCATAAā€ƒAGAAGCGGCGā€ƒGGTTTCGCAAā€ƒTGGATGAAGCā€ƒGCTGTTTCCGā€ƒGCGTTCAAAGā€ƒ
1121ā€ƒCACGCGTTGAā€ƒAGCGTATGCCā€ƒGCACGTTTCCā€ƒCGGATCCGGTā€ƒTCGTGAAGTGā€ƒGCACTGCTGGā€ƒATCTGCTGCCā€ƒ
1191ā€ƒGGAACCGGGCā€ƒCTGCTGCCGCā€ƒAGGTGTTCCGā€ƒTGAACTGGCAā€ƒCTGCTGGAACā€ƒCGTATGGTGAā€ƒAGGTAACCCGā€ƒ
1261ā€ƒGAACCGCTGTā€ƒTCCTGā€ƒ
SEQā€ƒIDā€ƒNO:ā€ƒ8ā€ƒ
ā€ƒā€ƒā€ƒ1ā€ƒMFRRKEDLDPā€ƒPLALLPLKGLā€ƒREAAALLEEAā€ƒLRQGKRIRVHā€ƒGDYDADGLTGā€ƒTAILVRGLAAā€ƒLGADVHPFIPā€ƒ
ā€ƒā€ƒ71ā€ƒHRLEEGYGVLā€ƒMERVPEHLEAā€ƒSDLFLTVDCGā€ƒITNHAELRELā€ƒLENGVEVIVTā€ƒDHHTPGKTPPā€ƒPGLVVHPALTā€ƒ
ā€ƒ141ā€ƒPDLKEKPTGAā€ƒGVAFLLLWALā€ƒHERLGLPPPLā€ƒEYADLAAVGTā€ƒIADVAPLWGWā€ƒNRALVKEGLAā€ƒRIPASSWVGLā€ƒ
ā€ƒ211ā€ƒRLLAEAVGYTā€ƒGKAVEVAFRIā€ƒAPRINAASRLā€ƒGEAEKALRLLā€ƒLTDDAAEAQAā€ƒLVGELHRLNAā€ƒRRQTLEEAMLā€ƒ
ā€ƒ281ā€ƒRKLLPQADPEā€ƒAKAIVLLDPEā€ƒGHPGVMGIVAā€ƒSRILEATLRPā€ƒVFLVAQGKGTā€ƒVRSLAPISAVā€ƒEALRSAEDLLā€ƒ
ā€ƒ351ā€ƒLRYGGHKEAAā€ƒGFAMDEALFPā€ƒAFKARVEAYAā€ƒARFPDPVREVā€ƒALLDLLPEPGā€ƒLLPQVFRELAā€ƒLLEPYGEGNPā€ƒ
ā€ƒ421ā€ƒEPLFLā€ƒ
SEQā€ƒIDā€ƒNO:ā€ƒ9ā€ƒ
TAGGGATAACAGGGTAATā€ƒ
SEQā€ƒIDā€ƒNO:ā€ƒ10ā€ƒ
TGTGTTCTATGTCTTATTCTTACTTCGTTATTCTTGTCTCTATTCTGTTTATGTTTCTTGTTTGTTAā€ƒ
SEQā€ƒIDā€ƒNO:ā€ƒ11ā€ƒ
TGTGTTCTATGTCTTā€ƒTT-(CH2)4-MALā€ƒ
SEQā€ƒIDā€ƒNO:ā€ƒ12ā€ƒ
TGTGTTCTATGTCTTATTCTTACTTā€ƒTT-(CH2)4ā€ƒ
SEQā€ƒIDā€ƒNO:ā€ƒ13ā€ƒ
TGTGTTCTATGTCTTATTCTTACTTCGTTATTCTTā€ƒTT-(CH2)4-MALā€ƒ
SEQā€ƒIDā€ƒNO:ā€ƒ14ā€ƒ
AAGACATAGAACACAā€ƒTT-(CH2)ā€ƒ4-MALā€ƒ
SEQā€ƒIDā€ƒNO:ā€ƒ15ā€ƒ
AAGTAAGAATAAGACATAGAACACAā€ƒTT-(CH2ā€ƒ)4-MALā€ƒ
SEQā€ƒIDā€ƒNO:ā€ƒ16ā€ƒ
AAGAATAACGAAGTAAGAATAAGACATAGAACACAā€ƒTT-(CH2)4-MALā€ƒ

    • 1-34. (canceled)

Claims

35. A method of preparing a nucleic acid construct for sequencing comprising:

(a) providing a double stranded nucleic acid template;

(b) covalently attaching a first hairpin adaptor at one end of the double stranded nucleic acid template and a second hairpin adaptor the other end of the double stranded nucleic acid template to form a circular nucleic acid construct;

wherein said first hairpin adaptor and said second hairpin adaptor are differentially selectable.

36. The method of claim 35, further comprising the step of determining the sequence of the double stranded nucleic acid construct.

37. The method of claim 36, wherein the sequence of the double stranded nucleic acid construct is determined by a sequencing by synthesis method.

38. The method of claim 35, further comprising the step of binding the nucleic acid construct to a surface.

39. The method of claim 35, wherein the first hairpin adaptor and the second adaptor each comprises a selectable binding moiety.

40. The method of claim 39, wherein at least one of the selectable binding moieties allows binding of the nucleic acid construct to a surface.

41. The method of claim 39, wherein the selectable binding moiety is a selectable nucleic acid sequence.

42. The method of claim 39, wherein the selectable binding moiety is a nucleic acid binding protein.

43. The method of claim 39, wherein the selectable binding moiety is biotin.

44. The method of claim 39, wherein the selective binding moiety is comprised within a hairpin loop of the hairpin adaptor.

45. The method of claim 35, wherein at least one of the first or second hairpin adaptors comprises a sticky end of either a 5′ or 3′ overhang.

46. The method of claim 35, wherein each hairpin adaptor comprises a region of double stranded nucleic acid formed by hybridization between two separate regions of a single stranded nucleic acid and the two regions of the single stranded nucleic acid are the same type of nucleic acid or are different types of nucleic acid.

47. The method of claim 35, wherein step (a) further comprises randomly fragmenting template nucleic acid.

48. The method of claim 35, wherein the sequence of the double stranded nucleic acid is known or can be predicted.

49. The method of claim 35, wherein the sequence of the double stranded nucleic acid is unknown.

50. A pair of adaptors for sequencing nucleic acids, wherein each of the adaptors of the same pair comprises a hairpin loop and each adaptor is differentially selectable from the other adaptor of the same pair.

51. The pair of adaptors of claim 50, wherein the first hairpin adaptor and the second adaptor of each pair each comprise a selectable binding moiety.

52. The pair of adaptors of claim 51, wherein the selectable binding moieties are capable of facilitating construction and purification of a nucleic acid for sequencing by binding to a surface.

53. A circular nucleic acid construct for use as a sequencing template comprising a double stranded nucleic acid template and a pair of adaptors of claim 50, wherein a first adaptor is covalently attached at one end of the double stranded nucleic acid and a second adaptor is covalently attached at the other end of the double stranded nucleic acid.

Resources

Images & Drawings included:

Sources:

Similar patent applications:

Recent applications in this class:

Recent applications for this Assignee: