Patent application title:

METHODS, SYSTEMS, AND COMPOSITIONS FOR NEURONAL DIFFERENTIATION OF MULTIPOTENT STROMAL CELLS

Publication number:

US20200063135A1

Publication date:
Application number:

16/578,893

Filed date:

2019-09-23

Abstract:

Some embodiments of the invention comprise methods, systems, and compositions to selectively induce, whether in vitro or in vivo, the neuronal differentiation of multipotent stromal cells through the application of microRNAs, including but not limited to miRNA-124, miRNA-137 and/or miRNA-9* expression products of those miRNAs, and molecules and compositions containing functional elements of those miRNAs. Some embodiments of the invention also comprise the therapeutic administration and use of such induced cells to treat mammalian injuries and diseases, including but not limited to, nervous system injuries or diseases that may otherwise result in decreased cell or system function.

Inventors:

Interested in similar patents?

Get notified when new applications in this technology area are published.

Classification:

C12N5/0619 »  CPC further

Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor; Animal cells or tissues; Human cells or tissues; Vertebrate cells; Cells of the nervous system Neurons

C12N2310/141 »  CPC further

Structure or type of the nucleic acid; Type of nucleic acid interfering N.A. MicroRNAs, miRNAs

C12N2510/00 »  CPC further

Genetically modified cells

C12N2501/13 »  CPC further

Active agents used in cell culture processes, e.g. differentation; Growth factors Nerve growth factor [NGF]; Brain-derived neurotrophic factor [BDNF]; Cilliary neurotrophic factor [CNTF]; Glial-derived neurotrophic factor [GDNF]; Neurotrophins [NT]; Neuregulins

C12N2501/65 »  CPC further

Active agents used in cell culture processes, e.g. differentation MicroRNA

C12N2506/1353 »  CPC further

Differentiation of animal cells from one lineage to another; Differentiation of pluripotent cells from connective tissue cells, from mesenchymal cells from mesenchymal stem cells from bone marrow mesenchymal stem cells (BM-MSC)

C12N2330/10 »  CPC further

Production naturally occurring

C12N15/113 »  CPC main

Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor; Recombinant DNA-technology; DNA or RNA fragments; Modified forms thereof Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides

A61K31/7105 »  CPC further

Medicinal preparations containing organic active ingredients; Carbohydrates; Sugars; Derivatives thereof; Compounds having three or more nucleosides or nucleotides Natural ribonucleic acids, i.e. containing only riboses attached to adenine, guanine, cytosine or uracil and having 3'-5' phosphodiester links

Description

CROSS-REFERENCE TO RELATED APPLICATIONS

This application is a Continuation of U.S. patent application Ser. No. 13/377,558, filed on Feb. 23, 2012, which is a national phase of PCT Patent Application No. PCT/US2010/038168, filed on Jun. 10, 2010, which claims the benefit of priority of U.S. Provisional Patent Application No. 61/185,773, filed on Jun. 10, 2009. The contents of the above applications are all hereby expressly incorporated by reference, in their entirety.

TECHNICAL FIELD

Without limitation, certain embodiments of the invention relate to induction and application of cell types for the treatment of mammalian nervous system injuries and diseases.

BACKGROUND

Certain nervous system injuries, autoimmune diseases affecting the central or peripheral nervous system, and neurodegenerative diseases are characterized by loss of specific cells, or abnormal functions of existing nerve cells, which cause the patient to present with different neurological signs and symptoms and potentially irreversible loss of neurological functions. As one example only, some patients suffering stroke, spinal cord injury, or other neural injury and degeneration experience loss of functioning cell types, or neurological conditions like Parkinson's disease and Alzheimer's disease which in turn results in loss of or abnormal function of system function. Currently therapeutic options for treating and restoring such cell and system functions are limited. Thus, a need remains for methods, systems, and compositions to promote additional therapies, including therapies addressed to replacement of missing or damaged nervous system cells, tissues, and functions.

BRIEF SUMMARY

Without limitation to only those embodiments described herein and without disclaimer, some embodiments of the invention comprise methods, systems, and compositions to selectively induce, whether in vitro or in vivo, the neuronal differentiation of multipotent stromal cells through the application of microRNAs, including but not limited to miRNA-124, miRNA-137 and/or miRNA-9* expression products of those miRNAs, and molecules and compositions containing functional elements of those miRNAs. Some embodiments of the invention also comprise the therapeutic administration and use of such induced cells to treat mammalian injuries and diseases, including but not limited to, nervous system injuries or diseases that may otherwise result in decreased cell or system function.

BRIEF DESCRIPTION OF THE DRAWINGS

Some embodiments of the present invention will now be described, by way of example only and without disclaimer of other embodiments, with reference to the accompanying drawings, in which:

FIG. 1 shows bright field images of MSCs treated with growth factors or transfected with control miRNA and miRNA-124 or miRNA-137 for 3, 5 and 9 days.

FIG. 2 is a data representation showing that miRNA-124, miRNA-137 and miRNA-9* induce neuronal markers in MSCs.

FIG. 3 shows Western Blot results following transfection of cells with tested miRNAs or treatment with DMEM.

FIG. 4 shows results of transfecting adipose and cord derived MSCs with control miRNA, miRNA-124, or miRNA-137.

DETAILED DESCRIPTION

Without limitation to only those embodiments expressly disclosed herein and without disclaiming any embodiments, some embodiments of the invention comprise methods, systems, and composition to selectively induce, whether in vitro or in vivo, the neuronal differentiation of multipotent stromal cells (ā€œMSCsā€) through the application of microRNAs (ā€œmiRNA(s)ā€ or ā€œmiR(s)ā€), including but not limited to, miRNA-124 and/or miRNA-137, and/or miRNA-9*, expression products of those miRNAs, and molecules and compositions containing functional elements of those miRNAs. Some embodiments of the invention also comprise the therapeutic administration and use of such induced cells to treat mammalian injuries and diseases, including but not limited to, nervous system injuries or diseases that may otherwise result in decreased cell or system function. In some embodiments, such induction of differentiated MSCs, and/or the resulting cells, may be used to treat cell, tissue, or organ damage in a patient by administering to said patient a therapeutically effective amount of an miRNA of interest, or of differentiated MSCs induced by such miRNAs.

We have discovered unexpectedly that certain miRNAs are capable of inducing long-term neuronal differentiation of MSCs for the use of cell-based therapies in subjects presenting with nervous system injury and disease, including but not limited to, neurodegenerative disorders and spinal injury. Such subjects may include mammals, including but not limited to, humans. Thus, we have discovered novel applications for such miRNAs and resulting induced MSCs which, among other possible uses, can reduce or alleviate the effects of certain nervous system injuries or diseases in mammals.

Without limitation, some embodiments of the invention comprise methods, systems, and/or compositions for inducing neuronal differentiation of MSCs through the use and expression of miRNA-124, miRNA-137, and/or miRNA-9*. MSCs are mesoderm-derived cells that typically reside in adult bone marrow, typically at very low concentration (about 1 in 10,000 nucleated cells). MSCs can differentiate to generate cells such as bone marrow stroma, blood vessels, fat, bone and cartilage. These cells may also have the potential to differentiate into neurons\ or glia-like cells depending on the environmental signals. Moreover, these cells may be further induced to express or maintained specific neuronal or glial phenotypes by incubation with different combinations of growth factors and hormones.

MSCs have been shown to exert therapeutic effects in a variety of neurological diseases and dysfunctions in experimental animal models and more recently in pilot clinical trials. Their effects have been mainly attributed to immunosuppressive and neuroprotective functions. In experimental autoimmune encephalitis (ā€œEAEā€), an animal model of multiple sclerosis (ā€œMSā€), treatment of mice with bone marrow derived MSCs resulted in significant suppression of disease manifestations. Some studies demonstrated that in addition to down regulation of autoimmunity neural differentiation of these cells increased their therapeutic effect in various instances such as the ischemic brain.

In our work, we tested the effect of three neuronal-associated miRNAs, miRNA-124, miRNA-137, and miRNA-9*, on the differentiation of human MSCs. These miRNAs are not normally expressed in MSCs. We discovered that the expression of miRNA-124, miRNA137, or miRNA-9* induced neuronal differentiation of MSCs, as indicated by the morphology of the cells and by the increased expression of βIII-tubulin and MAP2. miRNA-124, miRNA-137 and miRNA-9* induced an increase in tyrosine hydroxylase, suggesting differentiation of the MSCs to dopaminergic phenotype. One of the targets of pre-miRNA124 is the transcription factor REST that represses a large number of neuronal genes. Our results indicate that neuronal-associated miRNAs may induce long-term neuronal differentiation of MSCs for the use of cell-based therapy in neurodegenerative and neuroinflammatory disorders and spinal injury. One advantage of the use of miRNAs over the existing methods is that one can stably express pre-miRNAs in MSCs that will result in long-term neuronal differentiation, as compared with transient differentiation that is induced by treatment with growth factors. As such, easy access to patient's own bone marrow derived MSCs and the feasibility to enrich and expand MSCs in large numbers indicates that neuronal differentiation of such cells can serve as autologous neuronal stem cells that can be available for treatment of a large number of acquired or congenital neurological disorders associated with lack of or damaged neurons. As one example only without limitation, MSCs can be prepared from fat removed by liposuction and from cord blood or the placenta. Reduced immunogenicity of MSCs may facilitate the use of allogeneic neurons off the shelf or from matched or partially mismatched family member for treatment of conditions caused, as nonlimiting examples only, by congenital deficiencies of essential enzymes or other essential products.

Without limitation to only embodiments expressly disclosed herein, and without disclaiming any embodiments, some embodiments of the invention comprise:

1. the neuronal differentiation of MSCs through culture or other exposure to miRNAs, including but not limited to, miRNA124 and/or miRNA 137, and/or miRNA 9*.

2. transfection of MSCs with such miRNAs;

3. administration of MSCs induced in vitro into neuronal differentiation to a subject suffering from nervous system injury or disease; and/or

4. administration of MSCs transfected with such miRNAs to a subject suffering from nervous system injury or disease.

In some embodiments, without limitation, with reproducible transdifferentiation of MSCs to neurons, the therapeutic use of MSCs can be obtained and expanded, whether in vitro or in vivo, to include, as some examples only, treatment of cerebrovascular disease, spinal cord injury, treatment of neurodegenerative disorders such as amyotrophic lateral sclerosis (ā€œALSā€), multiple sclerosis (ā€œMSā€), and related motor neuron diseases. Ongoing clinical studies already indicate that infusion of MSCs intrathecally and intravenously can improve partially the clinical manifestation of the disease in patients with MS and to a lesser extent in patients with ALS. Such clinical studies provide evidence that both intrathecal and intravenous infusions of MSCs are safe procedures since none of the treated patients has developed any severe side effect. Thus, cell therapy with MSCs represents prophetically an important approach for the treatment of a large number of neurological disorders, especially where MSCs can be induced into neurons or oligodendrocytes and/or secrete factors that can induce neurogenesis of locally residing stem cells.

Examples

The following examples of some embodiments of the invention are provided without limiting the invention to only those embodiments described herein and without disclaiming any embodiments.

microRNAs

microRNAs (ā€œmiRNAsā€) represent a family of endogenous, small (as some nonlimited examples, 19-23 nucleotides) non-coding RNAs that function through the RNA interference (ā€œRNAiā€) pathway to effect post-transcriptional gene silencing. miRNAs target the mRNAs of specific genes based on complementarity, and mediate either mRNA cleavage (perfect complementarity) or translation repression (partial complementarity). miRNAs have been demonstrated to play important roles in development and may function as fundamental genetic regulatory elements that serve to establish or maintain specific expression profiles determining cell fate.

Manipulating neuronal differentiation of MSCs may involve regulatory pathways that orchestrate the program of gene expression during the differentiation process. Differentiation often requires shifts in the mRNA and protein constitution of cells. One class of gene regulatory molecules are the microRNAs, a subclass of small RNAs, that are thought to use the elements of the RNA-interference pathway to post transcriptionally down-regulate the expression of protein-coding genes. miRNAs may play an important role in cell differentiation since they are predicted to individually regulate hundreds of target genes simultaneously.

Methods

To determine the effect of miRNA-124, miRNA-137, and miRNA-9* on the differentiation of MSCs, we employed three different preparations of these cells in passages 4-12. MSC cells were plated in DMEM+10% FCS for 24 hr and were then transfected with double-stranded RNA oligonucleotides of the mature sequence of the three miRNAs and with a negative control oligonucleotide. The miRNAs used were as follows:

Dharmaconā€ƒmimicā€ƒproducts:
MI0000443/MIMAT0000422-Human
Selectedā€ƒPrecursor/Mature
Mature:
hsa-miR-124ā€ƒ[MIMAT0000422]
Precursor:
hsa-miR-124-1ā€ƒ[MI0000443]
Organism:
Human
Matureā€ƒSequence:
(SEQā€ƒIDā€ƒNO.ā€ƒ1)
UAAGGCACGCGGUGAAUGCC
MI0000454/MIMAT0000429-Human
Selectedā€ƒPrecursor/Mature
Mature:
hsa-miR-137ā€ƒ[MIMAT0000429]
Precursor:
hsa-miR-137ā€ƒ[MI0000454]
Organism:
Human
Matureā€ƒSequence:
(SEQā€ƒIDā€ƒNO.ā€ƒ2)
UUAUUGCUUAAGAAUACGCGUAG
miRNAā€ƒ9*ā€ƒsequence:
(SEQā€ƒIDā€ƒNO.ā€ƒ3)
AUAAAGCUAGAUAACCGAAAGU
miRNAā€ƒ9ā€ƒmimic:
(SEQā€ƒIDā€ƒNO.ā€ƒ4)
UCUUUGGUUAUCUAGCUGUAUGA

Following 3 days, cells were transferred to Neurobasal Medium (NB) supplemented with B27. Cell morphology was monitored every 24 hr and analysis of neuronal markers by either immunofluorescence staining, Western blot analysis or real-time PCR was performed following 5, 7 and 9 days post-transfection. As a positive control for the induction of neuronal differentiation, we used cells stimulated with combination of Shh, FGF8 and bFGF.

Results

miRNA-124, miRNA-137, and miRNA-9* promote neuronal differentiation of MSCs. The pictures of FIG. 1 are representative of six separate experiments that gave similar results. As presented in FIG. 1, transfection of the cells with miRNA-137, miRNA-124 or miRNA-9* decreased cell proliferation and induced morphological differentiation in the cells already after 72 hr of transfection. Transfection of the MSCs with miRNA-137 induced rapid and robust morphological changes and the cells acquired a typical neuronal phenotype with compact cell bodies and elongated processes with varicosities. miRNA-124-transfected cells exhibited a strong decrease in cell proliferation followed by the generation of a number of cell types; elongated cells with long processes, small cells with multiple shorter processes and flat star-like cells. Cells transfected with the control miRNA resembled the control untreated cells. Interestingly, the effect of miRNA-137 was more rapid and stronger than that of the GF. About 90% of the miRNA-137 transfected cells exhibited neuronal morphology.

miRNA-124, miRNA-137, and miRNA-9* increase the expression of neuronal markers in MSCs. To further examine the effect of miRNA-124, miRNA-137 and miRNA-9* on neuronal differentiation, we examined the expression of the neural stem cell marker, nestin, the astrocytic marker GFAP and the neuronal markers beta III-tubulin and tyrosine hydroxylase. Cells were transfected with the appropriate miRNA or treated with DMEM or with neurobasal medium+B27. Following 5 days, the expression of nestin mRNA was determined using real-time PCR and the expression of nestin, GFAP, beta III-tubulin and tyrosine hydroxylase was examined after 9 days of treatment by Western blot analysis. The results represent five different experiments that gave similar results. FIG. 2 shows that after 5 days of transfection, there was a large increase in nestin mRNA as determined by real-time PCR. In contrast, after 9 days of transfection with the different miRNAs we found an increase in the expression of beta III-tubulin, whereas no expression of nestin or GFAP was observed. In addition, we found that miRNA-137 and miRNA-9* induced a large increase in the expression of tyrosine hydroxylase, whereas a smaller increase was observed in miRNA-124 transfected cells. The expression of all these markers in the control miRNA transfected cells was absent or negligible.

miR-9* induced the dopaminergic marker, tyrosine hydroxylase, in MSCs. FIG. 3 shows Western Blot results following MSC transfection with the appropriate miRNAs or treatment with DMEM. Following 9 days, the expression tyrosine hydroxylase was examined by Western blot analysis. The results represent five different experiments that gave similar results. miRNA-9* induced the dopaminergic marker, tyrosine hydroxylase, in MSCs.

Our results demonstrate that miRNA-124, miRNA-137 and miRNA-9* induce neuronal differentiation of MSCs, albeit to respectively different degrees in our test model. miRNA-137 induces a more rapid and robust effect resulting in a homogenous population of neuronal cells. The high level of tyrosine hydroxylase expressed in these cells suggests that these cells display a dopaminergic phenotype.

miRNA-124 also induces neuronal differentiation as determined by the high level of βIII-tubulin compared to the control miRNA-treated cells. In our work, this treatment resulted in a mixed population of cells which expressed lower level of tyrosine hydroxylase. None of the treatments induced astrocytic differentiation as determined by the lack of GFAP expression.

Moreover, following 5 days of treatment, both miRNAs induced a large transient increase in nestin expression, indicating generation of neural stem cell-like or neuronal progenitor-like cells. A controlled differentiation of MSCs to NSC or NPC-like cells may be further exploited to differentiate these cells to different neuronal lineages or to neurons with different phenotypes using specific transcription factors or specific combination of growth factors.

miRNA-124 and miRNA-9* have been reported to be involved in neuronal differentiation and neurite outgrowth. Similarly, there is one report demonstrating the effect of miRNA137 on neuronal differentiation of glioma stem cells and NSCs. However, no effects of miRNAs have been reported on the neuronal differentiation of MSCs and no effect of miRNA124 and miRNA137 has been shown on the generation of neurons with a specific phenotype. Moreover, none of these miRNAs has been reported to induce cells with a NSC/NPC phenotype.

miRNA-124 and miRNA-137 induced neuronal differentiation in the Adipose and cord derived MSCs. Adipose and cord derived MSCs were transfected with control miRNA, miRNA-124 and miRNA-137 similar to the bone marrow MSCs (FIG. 4).

Preparation of adipose-derived MSCs: Adipose-derived MSCs were obtained from liposuction from the thighs or abdominal walls. 100-200 ml aspirates were processed in a special designed Cytori separator that separates the MSCs from the fats cells and debris. The cells were further processed and maintained as described for the bone-marrow derived MSCs.

Preparation of human umbilical (cord) MSCs: Fresh human umbilical cords were obtained after birth (with parental consent) and collected in DMEM at 4° C. The umbilical cord vessels were removed and the mesenchymal tissue (Wharton's jelly) was minced into small pieces. Following centrifugation, at 250Ɨg for 5 min the tissue was washed with serum-free DMEM was treated with collagenase at 37° C. for 18 h followed by digestion with 2.5% trypsin at 37° C. for 30 min. The dissociated MSCs were further dispersed and maintained in conditions similar to those described for bone marrow-derived MSCs.

After 12 days, mRNA was extracted and the levels of b3-tubulin and the house keeping gene S12 were determined using real-time PCR.

Our results (FIG. 4) demonstrate that miRNA-124 and miRNA-137 induce neuronal differentiation not only in bone-marrow derived MSCs but also in adipose-tissue and cord blood-derived cells. The neuronal marker beta III tubulin was induced in these cells following miRNA treatment. Each of these cell sources has its own advantages. Bone-marrow derived MSCs are very well characterized and have been used for over 20 years successfully with no oncogenic potential. Adipose-derived MSCs are less characterized but can be obtained in larger numbers and cord blood cells can be easily obtained in a non-invasive manner they do not require complete genetic compatibility between the donor and the patient and therefore are more accessible.

Construction of a plasmid containing pre-miRNA and GDNF. Since GDNF has been implicated in the survival of dopaminergic neurons, we constructed plasmids that co-express pre-miRNA-124 or pre-miRNA-137 together with GDNF under separate promoters.

Without limitation to only embodiments described herein, and without disclaiming any embodiments, steps for sequence and procedure of cloning the pre-miRNA GDNF vectors and that of the miRNAs are described with respect to step by step cloning of GDNF into premir vectors (CD-511_1 or PCDH-CMV-MCS-EF1-copGFP from System Biosciences).

cDNA of Homo sapiens glial cell derived neurotrophic factor (ā€œGDNFā€) template was obtained from Origene. For cloning GDNF into premir 124 and 137 vectors (System Biosciences), primers with Xho1 and Sal1 restriction enzyme digestion sites for GDNF ORF were designed as follows:

Forward:
(SEQā€ƒIDā€ƒNO.ā€ƒ5)
caccā€ƒctcgag(XhoI)ā€ƒatgā€ƒaagā€ƒttaā€ƒtggā€ƒgatā€ƒgtcā€ƒgtgā€ƒgct
gtcā€ƒtgc
Reverse:
(SEQā€ƒIDā€ƒNO.ā€ƒ6)
aaaā€ƒgtcgac(SalI)ā€ƒtcaā€ƒgatā€ƒacaā€ƒtccā€ƒacaā€ƒcctā€ƒtttā€ƒagc
ggaā€ƒatg

After PCR, the GDNF DNA product was cleaned, then digested with Xho1 and Sal1, and the DNA was cleaned again, resulting in DNA of GDNF now ready for cloning.

Xho1 restriction site was added into the vector of premir 124 and premir 137 by using primers:

Forward:
(SEQā€ƒIDā€ƒNO.ā€ƒ7)
gacā€ƒgccā€ƒaccā€ƒatgā€ƒgagā€ƒagcā€ƒctcā€ƒgagā€ƒ(XhoI)ā€ƒagcā€ƒggcā€ƒctg
cccā€ƒgcc
Reverse:
(SEQā€ƒIDā€ƒNO.ā€ƒ8)
ggcā€ƒgggā€ƒcagā€ƒgccā€ƒgctā€ƒctcā€ƒgagā€ƒ(XhoI)ā€ƒgctā€ƒctcā€ƒcatā€ƒggt
ggcā€ƒgtc

The GFP gene was removed from premir 124 and 137 vector by using restriction enzymes Xho1 and Sal1, then the vector was cleaned.

Ligation of GDNF and premir 124 and 137 vectors. The ligated plasmids were transformed into One shot Top10 chemical competent cell. Plasmids with premir 124 and 137 were selected by culturing the clones, following by processing with mini prep.

The plasmids were digested by using Xho1 and Sal1 to detect the insert of GDNF. The plasmids were then sequenced. The sequence of miR-124 and 137 and the backbone of the premir vector:

MiR-124:
(SEQā€ƒIDā€ƒNO.ā€ƒ9)
GAACAAAGAGCCTTTGGAAGACGTCGCTGTTATCTCATTGTCTGTG
TGATTGGGGGAGCTGCGGCGGGGAGGATGCTGTGGTCCCTTCCTCCGGCG
TTCCCCACCCCCATCCCTCTCCCCGCTGTCAGTGCGCACGCACACGCGCC
GCTTTTTATTTCTTTTTCCTGGTTTTCTTATTCCATCTTCTACCCACCCC
TCTTCCTTTCTTTCACCTTTCCTTCCTTCCTTCCTCCTTTCCTTCCTCAG
GAGAAAGGCCTCTCTCTCCGTGTTCACAGCGGACCTTGATTTAAATGTCC
ATACAATTAAGGCACGCGGTGAATGCCAAGAATGGGGCTGGCTGAGCACC
GTGGGTCGGCGAGGGCCCGCCAAGGAAGGAGCGACCGACCGAGCCAGGCG
CCCTCCGCAGACCTCCGCGCAGCGGCCGCGGGCGCGAGGGGAGGGGTCTG
GAGCTCCCTCCGGCTGCCTGTCCCGCACCGGAGCCCGTGGGGTGGGGAGG
TGTGCAGCCTGTGACAGACAGGGGCTTAGAGATGC
MiR-137:
(SEQā€ƒIDā€ƒNO.ā€ƒ10)
CAGCACTCTTCTGTGTTAAGTATTTGATTTTGTGATTTGTCTTTCAG
AATTGGAAATAGAGCGGCCATTTGGATTTGGGCAGGAAGCAGCCGAGCAC
AGCTTTGGATCCTTCTTTAGGGAAATCGAGTTATGGATTTATGGTCCCGG
TCAAGCTCAGCCCATCCCCAGGCAGGGGCGGGCTCAGCGAGCAGCAAGAG
TTCTGGTGGCGGCGGCGGCGGCAGTAGCAGCGGCAGCGGTAGCAGCGGCA
GCGGTAGCAGCGGCAGCGGCAGCTTGGTCCTCTGACTCTCTTCGGTGACG
GGTATTCTTGGGTGGATAATACGGATTACGTTGTTATTGCTTAAGAATAC
GCGTAGTCGAGGAGAGTACCAGCGGCAGGGGGGCAGCGGCCGCCCTCCCC
AGCCCACCAGCTGGCCACTAAACGCCCGTGGTTGCCAAGGTAGCACTTTC
TTGTTCTTTTCATTTCCTCGGGTGTTTTCGCACTGGTTCCACCGGAAAGG
CTGTGCGCTGCGCCTCTGGTGACCAGGACTGGA

The sequence of backbone vector (CD-511_1) was attached:

LOCUS CD511B_1_pCDH_CMV_7544 bp ds-DNA circular 16 Dec. 2008:

DEFINITION
ACCESSION
VERSION
SOURCE
ORGANISM
COMMENT
COMMENT ApEinfo:methylated:1
FEATURES Location/Qualifiers
misc_feature 2315..2764
/label=EF1ā€ƒpromoter
/ApEinfo_fwdcolor=cyan
/ApEinfo_revcolor=green
misc_feature 2765..2789
/label=EF1ā€ƒpromoter(1)
/ApEinfo_label=EF1ā€ƒpromoter
/ApEinfo_fwdcolor=cyan
/ApEinfo_revcolor=green
misc_feature 2874..3629
/label=copGFP
/ApEinfo_fwdcolor=#00ff00
/ApEinfo_revcolor=green
misc_feature 3639..4229
/label=WPRE
/ApEinfo_fwdcolor=cyan
/ApEinfo_revcolor=green
misc_feature 2790..2860
/label=EF1ā€ƒpromoter(2)
/ApEinfo_label=EF1ā€ƒpromoter
/ApEinfo_fwdcolor=cyan
/ApEinfo_revcolor=green
misc_feature 2765..2789
/label=EFfwdā€ƒprimer
/ApEinfo_fwdcolor=#ff80ff
/ApEinfo_revcolor=green
misc_feature 1922..2183
/label=CMV
/ApEinfo_fwdcolor=#ff80ff
/ApEinfo_revcolor=green
misc_feature 2272..2314
/label=MCS
/ApEinfo_fwdcolor=#80ff00
/ApEinfo_revcolor=green
misc_feature 2205..2271
/label=CMV(1)
/ApEinfo_label=CMV
/ApEinfo_fwdcolor=#ff80ff
/ApEinfo_revcolor=green
misc_feature 2184..2204
/label=DABā€ƒ90ā€ƒprimerā€ƒforward
/ApEinfo_fwdcolor=cyan
/ApEinfo_revcolor=green
ORIGIN
ā€ƒā€ƒā€ƒ1 acgcgtgtagā€ƒtcttatgcaaā€ƒtactcttgtaā€ƒgtcttgcaacā€ƒatggtaacgaā€ƒtgagttagca
ā€ƒā€ƒ61 acatgccttaā€ƒcaaggagagaā€ƒaaaagcaccgā€ƒtgcatgccgaā€ƒttggtggaagā€ƒtaaggtggta
ā€ƒ121 cgatcgtgccā€ƒttattaggaaā€ƒggcaacagacā€ƒgggtctgacaā€ƒtggattggacā€ƒgaaccactga
ā€ƒ181 attgccgcatā€ƒtgcagagataā€ƒttgtatttaaā€ƒgtgcctagctā€ƒcgatacaataā€ƒaacgggtctc
ā€ƒ241 tctggttagaā€ƒccagatctgaā€ƒgcctgggagcā€ƒtctctggctaā€ƒactagggaacā€ƒccactgctta
ā€ƒ301 agcctcaataā€ƒaagcttgcctā€ƒtgagtgcttcā€ƒaagtagtgtgā€ƒtgcccgtctgā€ƒttgtgtgact
ā€ƒ361 ctggtaactaā€ƒgagatccctcā€ƒagacccttttā€ƒagtcagtgtgā€ƒgaaaatctctā€ƒagcagtggcg
ā€ƒ421 cccgaacaggā€ƒgacctgaaagā€ƒcgaaagggaaā€ƒaccagagctcā€ƒtctcgacgcaā€ƒggactcggct
ā€ƒ481 tgctgaagcgā€ƒcgcacggcaaā€ƒgaggcgagggā€ƒgcggcgactgā€ƒgtgagtacgcā€ƒcaaaaatttt
ā€ƒ541 gactagcggaā€ƒggctagaaggā€ƒagagagatggā€ƒgtgcgagagcā€ƒgtcagtattaā€ƒagcgggggag
ā€ƒ601 aattagatcgā€ƒcgatgggaaaā€ƒaaattcggttā€ƒaaggccagggā€ƒggaaagaaaaā€ƒaatataaatt
ā€ƒ661 aaaacatataā€ƒgtatgggcaaā€ƒgcagggagctā€ƒagaacgattcā€ƒgcagttaatcā€ƒctggcctgtt
ā€ƒ721 agaaacatcaā€ƒgaaggctgtaā€ƒgacaaatactā€ƒgggacagctaā€ƒcaaccatcccā€ƒttcagacagg
ā€ƒ781 atcagaagaaā€ƒcttagatcatā€ƒtatataatacā€ƒagtagcaaccā€ƒctctattgtgā€ƒtgcatcaaag
ā€ƒ841 gatagagataā€ƒaaagacaccaā€ƒaggaagctttā€ƒagacaagataā€ƒgaggaagagcā€ƒaaaacaaaag
ā€ƒ901 taagaccaccā€ƒgcacagcaagā€ƒcggccactgaā€ƒtcttcagaccā€ƒtggaggaggaā€ƒgatatgaggg
ā€ƒ961 acaattggagā€ƒaagtgaattaā€ƒtataaatataā€ƒaagtagtaaaā€ƒaattgaaccaā€ƒttaggagtag
1021 cacccaccaaā€ƒggcaaagagaā€ƒagagtggtgcā€ƒagagagaaaaā€ƒaagagcagtgā€ƒggaataggag
1081 ctttgttcctā€ƒtgggttcttgā€ƒggagcagcagā€ƒgaagcactatā€ƒgggcgcagccā€ƒtcaatgacgc
1141 tgacggtacaā€ƒggccagacaaā€ƒttattgtctgā€ƒgtatagtgcaā€ƒgcagcagaacā€ƒaatttgctga
1201 gggctattgaā€ƒggcgcaacagā€ƒcatctgttgcā€ƒaactcacagtā€ƒctggggcatcā€ƒaagcagctcc
1261 aggcaagaatā€ƒcctggctgtgā€ƒgaaagataccā€ƒtaaaggatcaā€ƒacagctcctgā€ƒgggatttggg
1321 gttgctctggā€ƒaaaactcattā€ƒtgcaccactgā€ƒctgtgccttgā€ƒgaatgctagtā€ƒtggagtaata
1381 aatctctggaā€ƒacagattggaā€ƒatcacacgacā€ƒctggatggagā€ƒtgggacagagā€ƒaaattaacaa
1441 ttacacaagcā€ƒttaatacactā€ƒccttaattgaā€ƒagaatcgcaaā€ƒaaccagcaagā€ƒaaaagaatga
1501 acaagaattaā€ƒttggaattagā€ƒataaatgggcā€ƒaagtttgtggā€ƒaattggtttaā€ƒacataacaaa
1561 ttggctgtggā€ƒtatataaaatā€ƒtattcataatā€ƒgatagtaggaā€ƒggcttggtagā€ƒgtttaagaat
1621 agtttttgctā€ƒgtactttctaā€ƒtagtgaatagā€ƒagttaggcagā€ƒggatattcacā€ƒcattatcgtt
1681 tcagacccacā€ƒctcccaacccā€ƒcgaggggaccā€ƒcgacaggcccā€ƒgaaggaatagā€ƒaagaagaagg
1741 tggagagagaā€ƒgacagagacaā€ƒgatccattcgā€ƒattagtgaacā€ƒggatctcgacā€ƒggttaacttt
1801 taaaagaaaaā€ƒggggggattgā€ƒgggggtacagā€ƒtgcaggggaaā€ƒagaatagtagā€ƒacataatagc
1861 aacagacataā€ƒcaaactaaagā€ƒaattacaaaaā€ƒacaaattacaā€ƒaaaattcaaaā€ƒattttatcga
1921 tactagtattā€ƒatgcccagtaā€ƒcatgaccttaā€ƒtgggactttcā€ƒctacttggcaā€ƒgtacatctac
1981 gtattagtcaā€ƒtcgctattacā€ƒcatggtgatgā€ƒcggttttggcā€ƒagtacatcaaā€ƒtgggcgtgga
2041 tagcggtttgā€ƒactcacggggā€ƒatttccaagtā€ƒctccaccccaā€ƒttgacgtcaaā€ƒtgggagtttg
2101 ttttggcaccā€ƒaaaatcaacgā€ƒggactttccaā€ƒaaatgtcgtaā€ƒacaactccgcā€ƒcccattgacg
2161 caaatgggcgā€ƒgtaggcgtgtā€ƒacggtgggagā€ƒgtctatataaā€ƒgcagagctcgā€ƒtttagtgaac
2221 cgtcagatcgā€ƒcctggagacgā€ƒccatccacgcā€ƒtgttttgaccā€ƒtccatagaagā€ƒattctagagc
2281 tagcgaattcā€ƒgaatttaaatā€ƒggatccgcggā€ƒccgcaaggatā€ƒctgcgatcgcā€ƒtccggtgccc
2341 gtcagtgggcā€ƒagagcgcacaā€ƒtcgcccacagā€ƒtccccgagaaā€ƒgttggggggaā€ƒggggtcggca
2401 attgaacgggā€ƒtgcctagagaā€ƒaggtggcgcgā€ƒgggtaaactgā€ƒggaaagtgatā€ƒgtcgtgtact
2461 ggctccgcctā€ƒttttcccgagā€ƒggtgggggagā€ƒaaccgtatatā€ƒaagtgcagtaā€ƒgtcgccgtga
2521 acgttcttttā€ƒtcgcaacgggā€ƒtttgccgccaā€ƒgaacacagctā€ƒgaagcttcgaā€ƒggggctcgca
2581 tctctccttcā€ƒacgcgcccgcā€ƒcgccctacctā€ƒgaggccgccaā€ƒtccacgccggā€ƒttgagtcgcg
2641 ttctgccgccā€ƒtcccgcctgtā€ƒggtgcctcctā€ƒgaactgcgtcā€ƒcgccgtctagā€ƒgtaagtttaa
2701 agctcaggtcā€ƒgagaccgggcā€ƒctttgtccggā€ƒcgctcccttgā€ƒgagcctacctā€ƒagactcagcc
2761 ggctctccacā€ƒgctttgcctgā€ƒaccctgcttgā€ƒctcaactctaā€ƒcgtctttgttā€ƒtcgttttctg
2821 ttctgcgccgā€ƒttacagatccā€ƒaagctgtgacā€ƒcggcgcctacā€ƒgctagacgccā€ƒaccatggaga
2881 gcgacgagagā€ƒcggcctgcccā€ƒgccatggagaā€ƒtcgagtgccgā€ƒcatcaccggcā€ƒaccctgaacg
2941 gcgtggagttā€ƒcgagctggtgā€ƒggcggcggagā€ƒagggcaccccā€ƒcaagcagggcā€ƒcgcatgacca
3001 acaagatgaaā€ƒgagcaccaaaā€ƒggcgccctgaā€ƒccttcagcccā€ƒctacctgctgā€ƒagccacgtga
3061 tgggctacggā€ƒcttctaccacā€ƒttcggcacctā€ƒaccccagcggā€ƒctacgagaacā€ƒcccttcctgc
3121 acgccatcaaā€ƒcaacggcggcā€ƒtacaccaacaā€ƒcccgcatcgaā€ƒgaagtacgagā€ƒgacggcggcg
3181 tgctgcacgtā€ƒgagcttcagcā€ƒtaccgctacgā€ƒaggccggccgā€ƒcgtgatcggcā€ƒgacttcaagg
3241 tggtgggcacā€ƒcggcttccccā€ƒgaggacagcgā€ƒtgatcttcacā€ƒcgacaagatcā€ƒatccgcagca
3301 acgccaccgtā€ƒggagcacctgā€ƒcaccccatggā€ƒgcgataacgtā€ƒgctggtgggcā€ƒagcttcgccc
3361 gcaccttcagā€ƒcctgcgcgacā€ƒggcggctactā€ƒacagcttcgtā€ƒggtggacagcā€ƒcacatgcact
3421 tcaagagcgcā€ƒcatccaccccā€ƒagcatcctgcā€ƒagaacgggggā€ƒccccatgttcā€ƒgccttccgcc
3481 gcgtggaggaā€ƒgctgcacagcā€ƒaacaccgagcā€ƒtgggcatcgtā€ƒggagtaccagā€ƒcacgccttca
3541 agacccccatā€ƒcgccttcgccā€ƒagatcccgcgā€ƒctcagtcgtcā€ƒcaattctgccā€ƒgtggacggca
3601 ccgccggaccā€ƒcggctccaccā€ƒggatctcgctā€ƒaagtcgacaaā€ƒtcaacctctgā€ƒgattacaaaa
3661 tttgtgaaagā€ƒattgactggtā€ƒattcttaactā€ƒatgttgctccā€ƒttttacgctaā€ƒtgtggatacg
3721 ctgctttaatā€ƒgcctttgtatā€ƒcatgctattgā€ƒcttcccgtatā€ƒggctttcattā€ƒttctcctcct
3781 tgtataaatcā€ƒctggttgctgā€ƒtctctttatgā€ƒaggagttgtgā€ƒgcccgttgtcā€ƒaggcaacgtg
3841 gcgtggtgtgā€ƒcactgtgtttā€ƒgctgacgcaaā€ƒcccccactggā€ƒttggggcattā€ƒgccaccacct
3901 gtcagctcctā€ƒttccgggactā€ƒttcgctttccā€ƒccctccctatā€ƒtgccacggcgā€ƒgaactcatcg
3961 ccgcctgcctā€ƒtgcccgctgcā€ƒtggacaggggā€ƒctcggctgttā€ƒgggcactgacā€ƒaattccgtgg
4021 tgttgtcgggā€ƒgaaatcatcgā€ƒtcctttccttā€ƒggctgctcgcā€ƒctgtgttgccā€ƒacctggattc
4081 tgcgcgggacā€ƒgtccttctgcā€ƒtacgtcccttā€ƒcggccctcaaā€ƒtccagcggacā€ƒcttccttccc
4141 gcggcctgctā€ƒgccggctctgā€ƒcggcctcttcā€ƒcgcgtcttcgā€ƒccttcgccctā€ƒcagacgagtc
4201 ggatctccctā€ƒttgggccgccā€ƒtccccgcctgā€ƒgtacctttaaā€ƒgaccaatgacā€ƒttacaaggca
4261 gctgtagatcā€ƒttagccacttā€ƒtttaaaagaaā€ƒaaggggggacā€ƒtggaagggctā€ƒaattcactcc
4321 caacgaaaatā€ƒaagatctgctā€ƒttttgcttgtā€ƒactgggtctcā€ƒtctggttagaā€ƒccagatctga
4381 gcctgggagcā€ƒtctctggctaā€ƒactagggaacā€ƒccactgcttaā€ƒagcctcaataā€ƒaagcttgcct
4441 tgagtgcttcā€ƒaagtagtgtgā€ƒtgcccgtctgā€ƒttgtgtgactā€ƒctggtaactaā€ƒgagatccctc
4501 agacccttttā€ƒagtcagtgtgā€ƒgaaaatctctā€ƒagcagtagtaā€ƒgttcatgtcaā€ƒtcttattatt
4561 cagtatttatā€ƒaacttgcaaaā€ƒgaaatgaataā€ƒtcagagagtgā€ƒagaggaacttā€ƒgtttattgca
4621 gcttataatgā€ƒgttacaaataā€ƒaagcaatagcā€ƒatcacaaattā€ƒtcacaaataaā€ƒagcatttttt
4681 tcactgcattā€ƒctagttgtggā€ƒtttgtccaaaā€ƒctcatcaatgā€ƒtatcttatcaā€ƒtgtctggctc
4741 tagctatcccā€ƒgcccctaactā€ƒccgcccagttā€ƒccgcccattcā€ƒtccgccccatā€ƒggctgactaa
4801 ttttttttatā€ƒttatgcagagā€ƒgccgaggccgā€ƒcctcggcctcā€ƒtgagctattcā€ƒcagaagtagt
4861 gaggaggcttā€ƒttttggaggcā€ƒctagacttttā€ƒgcagagacggā€ƒcccaaattcgā€ƒtaatcatggt
4921 catagctgttā€ƒtcctgtgtgaā€ƒaattgttatcā€ƒcgctcacaatā€ƒtccacacaacā€ƒatacgagccg
4981 gaagcataaaā€ƒgtgtaaagccā€ƒtggggtgcctā€ƒaatgagtgagā€ƒctaactcacaā€ƒttaattgcgt
5041 tgcgctcactā€ƒgcccgctttcā€ƒcagtcgggaaā€ƒacctgtcgtgā€ƒccagctgcatā€ƒtaatgaatcg
5101 gccaacgcgcā€ƒggggagaggcā€ƒggtttgcgtaā€ƒttgggcgctcā€ƒttccgcttccā€ƒtcgctcactg
5161 actcgctgcgā€ƒctcggtcgttā€ƒcggctgcggcā€ƒgagcggtatcā€ƒagctcactcaā€ƒaaggcggtaa
5221 tacggttatcā€ƒcacagaatcaā€ƒggggataacgā€ƒcaggaaagaaā€ƒcatgtgagcaā€ƒaaaggccagc
5281 aaaaggccagā€ƒgaaccgtaaaā€ƒaaggccgcgtā€ƒtgctggcgttā€ƒtttccataggā€ƒctccgccccc
5341 ctgacgagcaā€ƒtcacaaaaatā€ƒcgacgctcaaā€ƒgtcagaggtgā€ƒgcgaaacccgā€ƒacaggactat
5401 aaagataccaā€ƒggcgtttcccā€ƒcctggaagctā€ƒccctcgtgcgā€ƒctctcctgttā€ƒccgaccctgc
5461 cgcttaccggā€ƒatacctgtccā€ƒgcctttctccā€ƒcttcgggaagā€ƒcgtggcgcttā€ƒtctcatagct
5521 cacgctgtagā€ƒgtatctcagtā€ƒtcggtgtaggā€ƒtcgttcgctcā€ƒcaagctgggcā€ƒtgtgtgcacg
5581 aaccccccgtā€ƒtcagcccgacā€ƒcgctgcgcctā€ƒtatccggtaaā€ƒctatcgtcttā€ƒgagtccaacc
5641 cggtaagacaā€ƒcgacttatcgā€ƒccactggcagā€ƒcagccactggā€ƒtaacaggattā€ƒagcagagcga
5701 ggtatgtaggā€ƒcggtgctacaā€ƒgagttcttgaā€ƒagtggtggccā€ƒtaactacggcā€ƒtacactagaa
5761 ggacagtattā€ƒtggtatctgcā€ƒgctctgctgaā€ƒagccagttacā€ƒcttcggaaaaā€ƒagagttggta
5821 gctcttgatcā€ƒcggcaaacaaā€ƒaccaccgctgā€ƒgtagcggtggā€ƒtttttttgttā€ƒtgcaagcagc
5881 agattacgcgā€ƒcagaaaaaaaā€ƒggatctcaagā€ƒaagatcctttā€ƒgatcttttctā€ƒacggggtctg
5941 acgctcagtgā€ƒgaacgaaaacā€ƒtcacgttaagā€ƒggattttggtā€ƒcatgagattaā€ƒtcaaaaagga
6001 tcttcacctaā€ƒgatccttttaā€ƒaattaaaaatā€ƒgaagttttaaā€ƒatcaatctaaā€ƒagtatatatg
6061 agtaaacttgā€ƒgtctgacagtā€ƒtaccaatgctā€ƒtaatcagtgaā€ƒggcacctatcā€ƒtcagcgatct
6121 gtctatttcgā€ƒttcatccataā€ƒgttgcctgacā€ƒtccccgtcgtā€ƒgtagataactā€ƒacgatacggg
6181 agggcttaccā€ƒatctggccccā€ƒagtgctgcaaā€ƒtgataccgcgā€ƒagacccacgcā€ƒtcaccggctc
6241 cagatttatcā€ƒagcaataaacā€ƒcagccagccgā€ƒgaagggccgaā€ƒgcgcagaagtā€ƒggtcctgcaa
6301 ctttatccgcā€ƒctccatccagā€ƒtctattaattā€ƒgttgccgggaā€ƒagctagagtaā€ƒagtagttcgc
6361 cagttaatagā€ƒtttgcgcaacā€ƒgttgttgccaā€ƒttgctacaggā€ƒcatcgtggtgā€ƒtcacgctcgt
6421 cgtttggtatā€ƒggcttcattcā€ƒagctccggttā€ƒcccaacgatcā€ƒaaggcgagttā€ƒacatgatccc
6481 ccatgttgtgā€ƒcaaaaaagcgā€ƒgttagctcctā€ƒtcggtcctccā€ƒgatcgttgtcā€ƒagaagtaagt
6541 tggccgcagtā€ƒgttatcactcā€ƒatggttatggā€ƒcagcactgcaā€ƒtaattctcttā€ƒactgtcatgc
6601 catccgtaagā€ƒatgcttttctā€ƒgtgactggtgā€ƒagtactcaacā€ƒcaagtcattcā€ƒtgagaatagt
6661 gtatgcggcgā€ƒaccgagttgcā€ƒtcttgcccggā€ƒcgtcaatacgā€ƒggataataccā€ƒgcgccacata
6721 gcagaactttā€ƒaaaagtgctcā€ƒatcattggaaā€ƒaacgttcttcā€ƒggggcgaaaaā€ƒctctcaagga
6781 tcttaccgctā€ƒgttgagatccā€ƒagttcgatgtā€ƒaacccactcgā€ƒtgcacccaacā€ƒtgatcttcag
6841 catcttttacā€ƒtttcaccagcā€ƒgtttctgggtā€ƒgagcaaaaacā€ƒaggaaggcaaā€ƒaatgccgcaa
6901 aaaagggaatā€ƒaagggcgacaā€ƒcggaaatgttā€ƒgaatactcatā€ƒactcttccttā€ƒtttcaatatt
6961 attgaagcatā€ƒttatcagggtā€ƒtattgtctcaā€ƒtgagcggataā€ƒcatatttgaaā€ƒtgtatttaga
7021 aaaataaacaā€ƒaataggggttā€ƒccgcgcacatā€ƒttccccgaaaā€ƒagtgccacctā€ƒgacgtctaag
7081 aaaccattatā€ƒtatcatgacaā€ƒttaacctataā€ƒaaaataggcgā€ƒtatcacgaggā€ƒccctttcgtc
7141 tcgcgcgtttā€ƒcggtgatgacā€ƒggtgaaaaccā€ƒtctgacacatā€ƒgcagctcccgā€ƒgagacggtca
7201 cagcttgtctā€ƒgtaagcggatā€ƒgccgggagcaā€ƒgacaagcccgā€ƒtcagggcgcgā€ƒtcagcgggtg
7261 ttggcgggtgā€ƒtcggggctggā€ƒcttaactatgā€ƒcggcatcagaā€ƒgcagattgtaā€ƒctgagagtgc
7321 accatatgcgā€ƒgtgtgaaataā€ƒccgcacagatā€ƒgcgtaaggagā€ƒaaaataccgcā€ƒatcaggcgcc
7381 attcgccattā€ƒcaggctgcgcā€ƒaactgttgggā€ƒaagggcgatcā€ƒggtgcgggccā€ƒtcttcgctat
7441 tacgccagctā€ƒggcgaaagggā€ƒggatgtgctgā€ƒcaaggcgattā€ƒaagttgggtaā€ƒacgccagggt
7501 tttcccagtcā€ƒacgacgttgtā€ƒaaaacgacggā€ƒccagtgccaaā€ƒgctgā€ƒ(SEQā€ƒIDā€ƒNO.ā€ƒ11)

We found that MSCs transfected with these plasmids secrete GDNF and express the respective miRNAs. Thus, the GDNF secreted by the differentiated dopaminergic neurons is expected to provide survival signals to the differentiated cells and to endogenous dopaminergic neurons.

Construction of inducible miRNAs. Implanted MSCs have been reported to migrate to damaged tissues in the central nervous systems and to exert neurotrophic and immunomodulatory effects. Specifically, in Parkinson's animal models, implanted MSCs have been shown to engraft in the lesioned striatum. In some embodiments, without limitation, inducible pre-miRNA expression vectors might be used that will allow the induction of the specific pre-miRNA expression at desired time points. Thus, MSCs would be transfected with the specific pre-miRNA and its expression would be induced at different time points prior or following the engraftment of the MSCs in the lesioned striatum. For such studies we have employed the inducible miRNA and living color, fluorescent protein reporters using the Tet-on system (Clontech). This system allows the induction of the specific miRNA by the addition of a promoter, as one example, only, by doxycyline, and the identification of cells in which the miRNA is produced.

In summary, we have demonstrated the ability of miRNA124, miRNA137 and miRNA-9* to induce transdifferentiation of MSCs to NSC/NPC and neurons with a specific neuronal phenotype (miRNA137). Additional neuronal miRNAs such as miRNA-9 and miR218 may also effect transdifferentiation of MSCs and induce neuronal differentiation.

An advantage of using miRNAs over the existing methods is that one can stably express pre-miRNAs in the MSCs which will result in long-term neuronal differentiation as compared with transient differentiation that is induced by treatment with growth factors.

Our work indicates that neuronal-associated miRNAs may be employed to induce long-term neuronal differentiation of MSCs for the use of cell-based therapy in neurodegenerative disorders and spinal injury, as some examples only, as shown by:

1. Neuronal differentiation of MSCs by microRNAs (miRNA-124, miRNA-137, miRNA-9*);

2. Specific dopaminergic differentiation of MSCs by miRNA-137, miRNA-124 and miRNA-9*; and

3. Induction by microRNAs of transient differentiation of MSCs to neural stem cell like- or neural progenitor-like cells. Transfection with the miRNAs provides a window of opportunity where cells can be differentiated to the different lineages of the central nervous system (neurons, astrocytes and oligodendrocytes) or to a specific neuronal phenotype using transcription factors or a specific combination of growth factors. This window can be controlled by level of miRNA expression or by a specific time point post-transfection.

The ability of miRNAs to transdifferentiate MSCs to uncommitted progenitor cells and to different neuronal cell subsets makes it possible to use these cells for treatment of a large variety of neurological diseases, including spinal cord and peripheral nerve injuries, damage to the central nervous system caused by hemorrhage or obstructive lesions (ā€œCVAā€) or to traumatic central or peripheral nerve injury. In addition, transdifferentiated MSCs may be employed in the case of neurodegenerative diseases caused by idiopathic autoimmune diseases (ā€œEAEā€) or diseases such as Parkinson's disease or Alzheimer/s disease or diseases with unknown etiology such as ALS. Moreover, improvement of neurological functions by transdifferentiated MSCs may also be used in various degenerative disorders caused by drug-induced neuronal damage and/or toxicity.

Thus, in our work, miRNA-124, miRNA-137 and miRNA-9* promote neural differentiation of MSC's, with accompanying morphological changes and expression of phenotypic markers.

The inducing miRNA(s) of some embodiments would be administered and dosed in accordance with good medical practice, taking into account the techniques of use to accomplish the desired effect of target MSCs, the clinical condition of the individual patient, the site and method of administration, scheduling of administration, patient age, sex, body weight and other factors known to medical practitioners. The ā€œpharmaceutically effective amountā€ for purposes herein is thus determined by such considerations as are known in the art. The amount must be effective to achieve improvement, including but not limited to, the desired differentiation of MSCs in vivo and/or in vitro, decreased damage or injury, or improvement or elimination of symptoms and other indicators as are selected as appropriate measures by those skilled in the art.

Embodiments of the invention may expand the therapeutic window for treatment of nervous system injury and diseases and could be applied to treatment of a large patient population which suffers such injury and diseases each year in the United States. Thus, in some embodiments, the invention comprises novel methods to prevent, control, or alleviate mammalian nervous system injury and disease, including without limitation, brain damage, neural degeneration, or spinal cord injury, through the selective application of inducing miRNAs comprising embodiments of the invention. In accordance with some embodiments, without limitation, one may effect such therapeutic intervention through the use and/or administration of one or more such miRNAs to induce differentiation in target cells in vivo or in vitro for use in treatment to limit the effects of such injury or disease. Thus, without limitation and without disclaimer of subject matter, some embodiments comprise novel compositions and methods to prevent, control, or alleviate mammalian injury, including without limitation, brain damage, through the selective application and/or induction of transdifferentiated MSCs.

This application may reference various publications by author, citation, and/or by patent number, including without limitation, articles, presentations, and United States patents. The disclosures of each of any such references in their entireties are hereby incorporated by reference into this application.

While the present invention has been particularly shown and described with reference to the foregoing preferred and alternative embodiments, it should be understood by those skilled in the art that various alternatives to the embodiments of the invention described herein may be employed in practicing the invention without departing from the spirit and scope of the invention as defined in the following claims. It is intended that the following claims define the scope of the invention and that the method and apparatus within the scope of these claims and their equivalents be covered thereby. This description of the invention should be understood to include all novel and non-obvious combinations of elements described herein, and claims may be presented in this or a later application to any novel and non-obvious combination of these elements. The foregoing embodiments are illustrative, and no single feature or element is essential to all possible combinations that may be claimed in this or a later application. Where the claims recite ā€œaā€ or ā€œa firstā€ element of the equivalent thereof, such claims should be understood to include incorporation of one or more such elements, neither requiring nor excluding two or more such elements.

Claims

What is claimed is:

1. A method of trans-differentiating mammalian multipotent stromal cells into neuronal stem cells, the method comprising the steps of:

a) providing a population of mammalian multipotent stromal cells; and

b) expressing microRNA-124 in the population of mammalian multipotent stromal cells so as to generate a population of neuronal stem cells expressing nestin,

thereby trans-differentiating mammalian multipotent stromal cells into neuronal stem cells.

2. The method of claim 1, wherein the mammal is a human.

3. The method of claim 1, further comprising step (c) comprising analyzing a marker in said population of neuronal stem cells, wherein said marker comprises a neuronal morphology.

4. The method of claim 1, wherein said mammalian multipotent stromal cells are derived from a tissue selected from the group consisting of adipose tissue, umbilical cord tissue, bone marrow tissue and placenta tissue.

5. The method of claim 1, further comprising expressing in said mammalian multipotent stromal cells glial derived neurotrophic factor (GDNF).

6. The method of claim 1, further comprising expressing in said mammalian multipotent stromal cells microRNA-137, microRNA-9* or both.

7. The method of claim 1, wherein said expressing comprises transfection, overexpression of exogenous miRNA or transduction of pre-miRNA.

8. A method of treating a mammal suffering from nervous system injury or disease, comprising:

a. performing the method of claim 1; and

b. administering said trans-differentiated mammalian multipotent stromal cells, secreted factors therefrom or both to said mammal;

thereby treating a mammal suffering from nervous system injury or disease.

9. The method of claim 8, wherein said mammal is a human.

10. The method of claim 8, further comprising expressing in said mammalian multipotent stromal cells microRNA-137, microRNA-9* or both.

11. The method of claim 8, wherein said nervous system injury is a spinal injury.

12. The method of claim 8, wherein said nervous system disease is a neurodegenerative disorder.

13. The method of claim 11, wherein said neurodegenerative disorder is selected from amyotrophic lateral sclerosis, and multiple sclerosis.

14. The method of claim 11, wherein said neurodegenerative disorder is a motor neuron disease.