BIFIDOBACTERIUM LONGUM

Description

FIELD OF THE INVENTION

The invention relates to the genome of a probiotic bifidobacteria strain, proteins encoded by the genome and exopolysaccharides produced by the proteins. Bifidobacteria are one of several predominant culturable bacteria present in human colonic microflora.

BACKGROUND OF THE INVENTION

Bifidobacteria are considered to be probiotics as they are living organisms which exert healthy effects beyond basic nutrition when ingested in sufficient numbers. A high level of ingested bifidobacteria must reach their site of action in order to exert a probiotic effect. A minimum level of approximately 10⁶-10⁷ viable bifidobacteria per gram intestinal contents has been suggested (Bouhnik, Y., Lait 1993). There are reports in the literature which show that in vivo studies completed in adults and in infants indicate that some strains of bifidobacteria are capable of surviving passage through the gastrointestinal tract. Significant differences have been observed between the abilities of different bifidobacteria strains to tolerate acid and bile salts, indicating that survival is an important criterion for the selection of potential probiotic strains.

Ingestion of bifidobacteria can improve gastrointestinal transit and may prevent or assist in the treatment of illnesses which may be caused by deficient or compromised microflora such as gastrointestinal tract (GIT) infections, constipation, irritable bowel syndrome (IBS), inflammatory bowel disease (IBD)—Crohn's disease and ulcerative colitis, food allergies, antibiotic-induced diarrhoea, cardiovascular disease, and certain cancers (e.g. colorectal cancer).

Because of their perceived health-promoting activities, bifidobacteria have in recent years enjoyed an increased amount of scientific scrutiny, which included the full genomic sequencing of a number of strains (reviewed by Liu et al., 2005). These genomic sequences will provide the genetic platforms that allow the study of the molecular mechanisms by which these micro organisms interact with their human host and elicit their probiotic function.

SUMMARY OF THE INVENTION

According to the invention there is provided an isolated and pourified Bifidobacterium longum strain, wherein the strain:

• • a) expresses an exopolysaccharide containing 6-deoxy talos; and
  • b) comprises nucleic acid sequence SEQ ID NO. 86 or nucleic acid sequences with at least 95% sequence homology thereto that codes for protein-tyrosine-phosphatase.

Excluded are the following strains:

• • 35624 (NCIMB 41003)
  • BL1207 (PTA-9608);
  • AH121A (NCIMB 41675);
  • AH1714 (NCIMB 41676); and
  • AH1206 (NCIMB 41382)

In one embodiment the Bifidobacterium longum strain comprises:

• • nucleic acid SEQ. ID NO. 86 or a nucleic acid sequence with at least 95% sequence homology thereto;
  • nucleic acid SEQ. ID NO. 62 or a nucleic acid sequence with at least 95% sequence homology thereto that codes for priming glcosyltransferase; and
  • at least one selected from the group comprising nucleic acid, SEQ ID No. 65, SEQ ID No. 66, SEQ ID No. 69, SEQ ID No. 72, SEQ ID No. 74 or nucleic acid sequences with at least 95% sequence homology thereto that codes for glcosyltransferase.

The strain may comprise at least two selected from the group comprising nucleic acid SEQ ID No. 65, SEQ ID No. 66, SEQ ID No. 69, SEQ ID No. 72, SEQ ID No. 74 or nucleic acid sequences with at least 95% sequence homology thereto.

The strain may comprise at least three selected from the group comprising nucleic acid SEQ ID No. 65, SEQ ID No. 66, SEQ ID No. 69, SEQ ID No. 72, SEQ ID No. 74 or nucleic acid sequences with at least 95% sequence homology thereto.

The strain may comprise at least four selected from the group comprising nucleic acid SEQ ID No. 65, SEQ ID No. 66, SEQ ID No. 69, SEQ ID No. 72, SEQ ID No. 74 or nucleic acid sequences with at least 95% sequence homology thereto.

The strain may comprise nucleic acid SEQ ID No. 65, SEQ ID No. 66, SEQ ID No. 69, SEQ ID No. 72, and SEQ ID No. 74 or nucleic acid sequences with at least 95% sequence homology thereto.

The strain may comprise at least one selected from the group comprising nucleic acid SEQ ID No. 71, SEQ ID No. 76 or nucleic acid sequences with at least 95% sequence homology thereto that codes for acyltransferase.

The strain may comprise nucleic acid SEQ ID No. 71 and SEQ ID No. 76 or nucleic acid sequences with at least 95% sequence homology thereto that codes for acyltransferase.

The invention also provides Bifidobacterium longum strain AH0097 having NCIMB accession number 41712 or mutants or variants thereof.

The invention also provides Bifidobacterium longum strain AH1172 having NCIMB accession number 41714 or mutants or variants thereof.

The mutant may be a genetically modified mutant.

The variant may be a naturally occurring variant of Bifidobacterium.

The Bifidobacterium strain may be probiotic.

In some cases the strain is in the form of a biologically pure culture.

Also provided is an isolated strain of Bifidobacterium longum AH0097 (NCIMB 41712).

Also provided is an isolated strain of Bifidobacterium longum AH1172 (NCIMB 41714).

The strain may be in the form of viable cells or in the form of non-viable cells.

In one case the Bifidobacterium strain is isolated from human feces.

The isolated and purified Bifidobacterium longum strain may be in the form of a bacterial broth.

The isolated and purified Bifidobacterium longum strain may be in the form of a freeze-dried powder.

The invention also provides a formulation comprising an isolated strain of Bifidobacterium longum of the invention.

The formulation may comprise an ingestible carrier.

The ingestible carrier may be a pharmaceutically acceptable carrier.

The ingestible carrier may be a food product

The food product may be selected from the group comprising acidified milk, yoghurt, frozen yoghurt, milk powder, milk concentrate, cheese spread, dressing and beverage.

The formulation may be in the form of a fermented food product.

The formulation may be in the form of a fermented milk product.

In one embodiment the carrier does not occur in nature.

The formulation may be the form of a capsule, a tablet, a pellet, or a powder.

In some cases the strain is present in the formulation at more than 10⁶ CFU per gram of ingestible carrier.

The invention also provides the use of a Bifidobacterium longum strain as a probiotic strain.

According to another aspect, the invention provides a method for identifying an exopolysaccharide expressing Bifidobacterium longum strain comprising the steps of:

• • a) obtaining a sample comprising bacteria;
  • b) extracting nucleic acid from the sample;
  • c) amplifying the extracted nucleic acid in the presence of at least two primers derived from a nucleic acid sequence selected from the group comprising: SEQ ID No 62 to SEQ ID No 86 or a nucleic acid sequence with at least 95% sequence homology thereto
  • d) identifying a bacterial strain that expresses an exopolysaccharide.

In one case the primer comprises at least 10 consecutive bases from a nucleic acid sequence selected from the group comprising: SEQ ID No. 62 to SEQ ID No. 86.

The primer may comprise a nucleic acid sequence selected from the group comprising: SEQ ID No. 12 to SEQ ID No. 61 or a nucleic acid sequence with at least 95% sequence homology thereto.

The step of identifying a bacterial strain that expresses an exopolysaccharide may comprise growing the bacterial strain on a Congo red agar plate.

In one case the sample is a mammalian sample.

The sample may be a human derived sample.

In one case the sample is a fecal sample.

Also provided is a Bifidobacterium longum strain identified by a method of the invention.

The invention also provides a method for the prophylaxis and/or treatment of undesirable inflammatory activity comprising administering a strain of the invention or a formulation of the invention.

The undesirable inflammatory activity may be undesirable gastrointestinal inflammatory activity such as inflammatory bowel disease eg. Crohns disease or ulcerative colitis, irritable bowel syndrome; pouchitis; or post infection colitis.

Also provided is a method for the prophylaxis and/or treatment of gastrointestinal cancer(s) comprising administering a strain of the invention or a formulation of the invention.

Also provided is a method for the prophylaxis and/or treatment of systemic disease such as rheumatoid arthritis comprising administering a strain of the invention or a formulation of the invention.

Also provided is a method for the prophylaxis and/or treatment of autoimmune disorders due to undesirable inflammatory activity comprising administering a strain of the invention or a formulation of the invention.

Also provided is a method for the prophylaxis of cancer comprising administering a strain of the invention or a formulation of the invention.

The invention also provides a method for the prophylaxis and/or treatment of diarrhoeal disease due to undesirable inflammatory activity, such as Clostridium difficile associated diarrhoea, Rotavirus associated diarrhoea or post infective diarrhoea or diarrhoeal disease due to an infectious agent, such as E. coli comprising administering a strain of the invention or a formulation of the invention.

Also provided is a method for the prevention and/or treatment of inflammatory disorders, immunodeficiency, inflammatory bowel disease, irritable bowel syndrome, cancer (particularly of the gastrointestinal and immune systems), diarrhoeal disease, antibiotic associated diarrhoea, pediatric diarrhoea, appendicitis, autoimmune disorders, multiple sclerosis, Alzheimer's disease, rheumatoid arthritis, coeliac disease, diabetes mellitus, organ transplantation, bacterial infections, viral infections, fungal infections, periodontal disease, urogenital disease, sexually transmitted disease, HIV infection, HIV replication, HIV associated diarrhoea, surgical associated trauma, surgical-induced metastatic disease, sepsis, weight loss, anorexia, fever control, cachexia, wound healing, ulcers, gut barrier function, allergy, asthma, respiratory disorders, circulatory disorders, coronary heart disease, anemia, disorders of the blood coagulation system, renal disease, disorders of the central nervous system, hepatic disease, ischaemia, nutritional disorders, osteoporosis, endocrine disorders, epidermal disorders, psoriasis and/or acne vulgaris comprising administering a strain of the invention or a formulation of the invention.

A Bifidobacterium longum strain in accordance with an embodiment of the invention may express or produce EPS at a yield of between about 1 mg/L to about 1000 mg/L of bacterial culture depending on growth conditions.

BRIEF DESCRIPTION OF THE DRAWINGS

The invention will be more clearly understood from the following description thereof given by way of example only with reference to the accompanying drawings in which;

FIG. 1 is a photograph of B. longum NCIMB 41712 (AH0097) grown on a Congo Red Agar plate; and

FIG. 2 is a photograph of B. longum NCIMB 41714 (AH1172) grown on a Congo Red Agar plate;

FIG. 3. is a graph of IL-10 secretion by PBMC stimulated with B. longum AH0097 or B. longum 35624 for 48 h (n=5):

FIG. 4: is a graph of TNF-α secretion by PBMC stimulated with B. longum AH0097 or B. longum 35624 for 48 h (n=5):

FIG. 5: is a graph of IL-10 secretion by PBMC stimulated with B. longum AH1172 or B. longum 35624 for 48 h (n=3): and

FIG. 6: TNF-α secretion by PBMC stimulated with B. longum AH1172 or B. longum 35624 for 48 h (n=4)

DETAILED DESCRIPTION OF THE INVENTION

A deposit of Bifidobacterium longum 35624 was made at the National Collections of Industrial and Marine Bacteria Limited (NCIMB) Ferguson Building, Craibstone Estate, Bucksburn, Aberdeen, AB21 9YA, Scotland, UK on Jan. 13, 1999 and accorded the accession number NCIMB 41003.

A deposit of Bifidobacterium longum strain AH0097 was made at the National Collections of Industrial and Marine Bacteria Limited (NCIMB) Ferguson Building, Craibstone Estate, Bucksburn, Aberdeen, AB21 9YA, Scotland, UK on May 6, 2010 and accorded the accession number NCIMB 41712.

A deposit of Bifidobacterium longum strain AH1172 was made at the National Collections of Industrial and Marine Bacteria Limited (NCIMB) Ferguson Building, Craibstone Estate, Bucksburn, Aberdeen, AB21 9YA, Scotland, UK on May 6, 2010 and accorded the accession number NCIMB 41714.

Given the size of the isolated polynucleotide it would not be uncommon for a point mutation or some other form of mutation to be present in the sequence. As such we encompass variants of SEQ ID No. 1 in the disclosure. As used herein, the term “variants”, means strains of Bifidobacteria that have a sequence identity of at least 99.5% or more with SEQ ID No. 1.

As used herein, the term “sequence homology” encompasses sequence homology at a nucleic acid and/or an amino acid (protein) level. Sequence homology is indicated as the overall percentage of identity across the nucleic acid and/or amino acid sequence. The sequence homology may be determined using standard techniques known to those skilled in the art. For example sequence homology may be determined using the on-line homology algorithm “BLAST” program. A sequence may have at least at least 95% or at least 96% or at least 97% or at least 98% or at least 99% sequence homology with the nucleic acid sequences described herein or the amino acid (protein) encoded thereby.

The present invention is based on the whole genome sequence of Bifidobacterium longum NCIMB 41003 (35624™). The genome sequence is listed in SEQ ID No. 1 of the attached sequence listing and comprises 2,264056 base pairs. Analysis of the genome sequence identified 1,734 genes having the open reading frames as set out in Table 1 below.

TABLE 1
Open reading frames of the genome of 35624.

Gene ID	Start	End	Strand	Predicted Function

B624_0001	1	1500	+	chromosomal replication initiator protein DnaA
B624_0002	2239	3360	+	DNA polymerase III, beta subunit
B624_0003	3442	4626	+	recF protein
B624_0004	4626	5093	+	hypothetical protein
B624_0005	5277	7364	+	DNA gyrase, B subunit
B624_0006	7435	10083	+	DNA gyrase, A subunit
B624_0007	10156	10719	+	hypothetical protein
B624_0008	11406	12116	+	hypothetical protein
B624_0009	12116	13699	+	Pectinesterase
B624_0010	14103	15446	−	NADP-specific glutamate dehydrogenase
B624_0011	15768	16199	−	AsnC-type transcriptional regulator
B624_0012	16405	17736	+	aspartate aminotransferase
B624_0013	17757	18746	−	hypothetical protein
B624_0014	19007	19600	+	hypothetical protein
B624_0015	19617	20462	+	hypothetical protein
B624_0016	20579	20821	+	hypothetical protein
B624_0017	21403	21735	−	transposase
B624_0018	22130	23497	−	Transcriptional regulatorscontaining a DNA-binding HTH
				domain and anaminotransferase domain (MocR family)
B624_0019	24132	25454	+	gabt-aminotransferase, class III superfamily
B624_0020	25675	26397	+	Metal-dependent hydrolase
B624_0021	26487	26849	+	Gluconate kinase
B624_0022	27115	28424	−	Hypothetical protein
B624_0023	28662	29138	−	Dps family protein
B624_0024	29263	30578	−	CBS domain protein
B624_0025	30841	31521	−	Prokaryotic-type carbonic anhydrases
B624_0026	31727	32287	+	alkyl hydrogen peroxide reductase
B624_0027	32458	34371	+	thioredoxin reductase
B624_0028	34494	35777	−	hypothetical protein
B624_0029	36333	37328	+	LacI-type transcriptional regulator
B624_0030	37558	40308	−	phosphoenolpyruvate carboxylase
B624_0031	40594	42471	+	protein of unknown function
B624_0032	42707	44342	+	possible sodium/proline symporter
B624_0033	44680	45663	−	hypothetical protein
B624_0034	45917	47533	+	amidohydrolase 3
B624_0035	47717	48805	−	tryptophanyl-tRNA synthetase
B624_0036	48939	49325	+	hypothetical protein
B624_0037	49437	49841	−	hypothetical protein
B624_0038	49986	52505	+	glycogen phosphorylase
B624_0039	52725	52940	−	hypothetical protein
B624_0040	53045	53880	+	Rhomboid family protein
B624_0041	54557	55029	−	hypothetical protein
B624_0042	55119	55907	+	hypothetical protein
B624_0043	55907	57142	+	Sortase
B624_0044	57196	57837	+	para-aminobenzoate synthase glutamineamidotransferase
				component II
B624_0045	58067	60136	−	serine/threonine protein kinase
B624_0046	60136	61083	−	serine/threonine protein kinase
B624_0047	61083	62546	−	pbpA
B624_0048	62546	64204	−	cell cycle protein
B624_0049	64204	65895	−	possible phosphoprotein phosphatase
B624_0050	65903	66430	−	FHA-domain-containing proteins
B624_0051	66463	67161	−	FHA domain protein
B624_0052	67349	69790	−	dipeptidyl peptidase IV
B624_0053	69900	70997	+	lysophospholipase L2
B624_0054	71089	72221	+	von Willebrand factor type A domain protein
B624_0056	72947	73348	+	hypothetical protein
B624_0058	75108	75608	+	heat shock protein, Hsp20 family
B624_0059	75938	76891	+	Methyl viologen exporter
B624_0060	77065	77520	−	hypothetical protein
B624_0061	77753	79132	+	esterase
B624_0062	79132	81702	+	Uncharacterized BCR
B624_0063	82241	83212	+	peptide methionine sulfoxide reductase
B624_0064	83506	86709	−	helicase-related protein
B624_0065	86785	87195	−	mutator MutT protein
B624_0066	88258	88587	+	hypothetical protein
B624_0067	88678	89139	+	acetyltransferase, GNAT family family
B624_0068	89226	90080	−	Hemolysin III-like membrane protein
B624_0069	90480	90842	+	hypothetical protein
B624_0070	91329	92639	−	queuine tRNA-ribosyltransferase
B624_0071	93056	95065	+	peptidase S1 and S6, chymotrypsin/Hap
B624_0072	95477	97636	+	cation-transporting ATPase, E1-E2 family
B624_0073	97816	98862	+	transcriptional regulator, LacI family
B624_0074	98874	99131	−	Sec-independent protein translocase protein TatB-like
				protein
B624_0075	99173	100215	−	Twin arginine targeting (Tat) protein translocase TatC
B624_0076	100215	100502	−	Twin-arginine translocationprotein, TatA/E family
B624_0077	101182	103584	+	Hypothetical protein
B624_0078	103674	106151	+	Bacterial surface proteins containing Ig-like domains
B624_0079	106547	107707	−	AAA+ superfamily ATPase
B624_0080	107911	109359	+	ferredoxin/ferredoxin--NADP reductase
B624_0081	109533	110450	+	heat shock protein HtpX
B624_0082	110667	111731	−	fructose-bisphosphate aldolase, class II
B624_0083	111947	113230	+	adenylosuccinate synthetase
B624_0084	113257	114837	+	CPA2 family monovalent cation: proton (H+) antiporter-2
B624_0085	115027	116094	+	CrcB-like protein family
B624_0086	116097	116489	+	protein with similarity to CrcB
B624_0087	116767	117849	+	sugar-binding transcriptional regulator, LacIfamily
B624_0088	118052	119842	+	Kup system potassium uptake protein [imported]
B624_0089	120262	121806	+	alpha-L-arabinofuranosidase
B624_0090	121993	123012	+	transcription regulator, LacI family [imported]
B624_0091	123104	124012	−	Alpha-glucosidase
B624_0093	124604	125803	+	probable integrase/recombinase
B624_0094	125803	126765	+	probable integrase/recombinase
B624_0095	126765	127817	+	integrase/recombinase XerC, probable [imported]
B624_0096	127910	128956	−	IS3 family transposase
B624_0097	129291	130814	+	ScrP-sucrose phosphorylase
B624_0098	131035	132669	+	ScrT
B624_0099	132736	133776	+	LacI family transcriptional regulator
B624_0100	134407	135771	+	major facilitator family transporter
B624_0101	135971	137020	+	ketol-acid reductoisomerase
B624_0102	137452	138501	+	ketol-acid reductoisomerase
B624_0103	138689	140500	−	alpha-amylase family protein
B624_0104	140663	141694	−	transcription regulator, LacI family [imported]
B624_0105	142008	144242	−	4-alpha-glucanotransferase
B624_0107	144829	145482	+	alpha-amylase
B624_0108	145500	146507	−	transcription regulator, LacI family [imported]
B624_0109	146777	147490	+	sugar ABC transporter, permease protein
B624_0110	147605	150139	+	glycosyl hydrolase, family 31
B624_0111	151125	153002	+	dnaK protein
B624_0112	153005	153658	+	co-chaperone GrpE
B624_0113	153753	154769	+	DnaJ protein
B624_0114	154787	155371	+	hspR
B624_0115	155647	156996	+	xanthine permease
B624_0116	157036	158154	+	possible acyl protein synthase/acyl-CoAreductase- like
				protein
B624_0117	158144	159640	+	possible acyl-CoA reductase
B624_0118	159697	160497	+	3-oxoacyl-acyl carrier protein reductase
B624_0119	160613	161281	+	Haloacid dehalogenase-like hydrolase, HAD superfamily
B624_0120	161435	162157	+	DedA protein
B624_0121	162635	163330	+	ATPase for chromosome partitioning
B624_0122	163340	164404	+	tadA ATPase
B624_0123	164407	165060	+	Flp pilus assembly protein
B624_0124	165060	165659	+	tadC
B624_0125	165947	166231	+	hypothetical protein
B624_0126	166240	166614	+	hypothetical protein
B624_0127	166667	167041	+	oppa3
B624_0128	167093	168220	+	BmrU protein
B624_0129	168424	169020	−	Transcriptional regulator
B624_0130	169216	172125	+	DNA polymerase III, tau/gamma subunit
B624_0131	172154	172753	+	recombination protein RecR
B624_0132	172756	173886	−	sortase family protein
B624_0134	174774	176054	+	hypothetical protein
B624_0135	176418	177179	+	aspartokinase, alpha and beta subunits
B624_0136	177238	177801	+	aspartokinase, alpha and beta subunits
B624_0137	177889	178980	−	aspartate-semialdehyde dehydrogenase
B624_0138	179148	179765	+	hypothetical protein
B624_0139	179774	181351	−	Calcineurin-like phosphoesterase
B624_0140	182040	183953	+	2-isopropylmalate synthase
B624_0141	184031	186433	−	penicillin-binding protein
B624_0142	186811	187959	+	phosphoesterase
B624_0143	188086	191169	+	DNA topoisomerase I
B624_0144	191450	192067	+	thymidylate kinase
B624_0145	192067	193215	+	DNA polymerase III, delta subunit
B624_0146	193337	193888	+	hypothetical protein
B624_0147	194034	195632	+	Dipeptidase
B624_0148	195767	197281	+	formate--tetrahydrofolate ligase
B624_0149	197684	198028	−	hypothetical protein
B624_0150	198230	198763	+	hypothetical protein
B624_0151	198817	200259	−	hypothetical protein
B624_0152	200521	201177	+	phosphoglycerate mutase family protein
B624_0153	201278	202228	+	hypothetical protein
B624_0154	202352	203224	+	Aldose 1-epimerase-like protein
B624_0155	203348	204496	−	extensin precursor (cell wallhydroxyproline-rich
				glycoprotein)
B624_0156	204684	204866	+	hypothetical protein
B624_0157	205053	206570	+	glutamyl-tRNA synthetase
B624_0158	207503	207988	+	hypothetical protein
B624_0159	208388	214285	+	endo-alpha-N-acetylgalactosaminidase
B624_0160	214390	215208	−	hypothetical protein
B624_0161	216652	218460	+	hypothetical protein
B624_0162	218640	219317	+	membrane antigen
B624_0163	219470	220744	+	Integral membrane protein
B624_0164	220769	222070	+	possible permease protein of ABC transportersystem
B624_0165	222107	223327	+	possible permease protein of ABC transportersystem
B624_0166	223346	224140	+	ABC transporter, ATP-binding protein
B624_0167	224259	224819	+	FMN-binding domain
B624_0168	224831	225427	−	Bacterial regulatory proteins, TetR family
B624_0169	225545	227704	−	phage infection protein
B624_0170	227704	230331	−	phage infection protein
B624_0171	230686	231969	+	membrane protein
B624_0172	232151	233602	+	6-phosphogluconate dehydrogenase, decarboxylating
B624_0173	233756	234595	−	6-phosphogluconolactonase
B624_0174	234825	235847	−	oxppcycle protein OpcA
B624_0175	235847	237382	−	glucose-6-phosphate 1-dehydrogenase
B624_0176	237706	239337	+	dipeptidase
B624_0177	239417	240448	−	Glycosyltransferase involved in cell wallbiogenesis
B624_0178	240475	241293	−	transcriptional regulator, TetR family
B624_0179	241407	242675	+	signal recognition particle-docking protein FtsY
B624_0180	243046	244338	+	ammonium transporter
B624_0181	244343	244678	+	Nitrogen regulatory protein P-II
B624_0182	244790	246613	+	protein-pII; uridylyltransferase
B624_0183	246653	248095	−	DNA-damage-inducible protein F
B624_0184	248370	249827	+	replicative DNA helicase
B624_0185	249830	251299	+	UDP-N-acetylmuramoylalanyl-D-glutamate--2,6-
				diaminopimelate ligase
B624_0186	251405	252154	+	cobyric acid synthase
B624_0187	252306	252590	+	hypothetical protein
B624_0188	252590	254407	+	ABC1 family
B624_0189	254428	255447	−	transcriptional regulator, LacI family
B624_0190	255933	257255	+	ABC superfamily ATP binding cassette transporter
B624_0191	257546	258469	+	sugar ABC transporter, permease protein
B624_0192	258493	259308	+	sugar permease of ABC transporter system
B624_0193	259473	261446	+	hypothetical protein
B624_0194	262147	267966	+	hypothetical
B624_0195	268074	271778	+	Glycosyl hydrolase
B624_0196	271911	272741	+	Hypothetical protein
B624_0197	272825	273835	−	prsA
B624_0198	273960	274439	−	hypothetical protein
B624_0199	274601	274891	+	ribosomal protein S6
B624_0200	274951	275604	+	Single-strand binding protein
B624_0201	275668	275913	+	ribosomal protein S18
B624_0202	275936	276379	+	ribosomal protein L9
B624_0203	276769	277026	+	ptsH
B624_0204	277029	278705	+	PTS Enzyme I
B624_0205	278942	279673	+	glycerol uptake facilitator protein
B624_0206	279763	282468	−	copper-translocating P-type ATPase
B624_0207	282580	282858	+	Conserved Protein Domain Family FrmR
B624_0208	282904	284325	+	possible DNA recombination protein RmuC
B624_0209	284325	284951	+	hypothetical protein
B624_0210	285048	285893	+	SpoU3
B624_0211	286063	286359	+	glutamyl-tRNA(Gln) amidotransferase, C subunit
B624_0212	286366	287904	+	glutamyl-tRNA(Gln) amidotransferase, A subunit
B624_0213	287933	289429	+	glutamyl-tRNA(Gln) amidotransferase, B subunit
B624_0214	289728	290789	+	acetyltransferase
B624_0215	290803	291114	+	hypothetical protein
B624_0216	291276	293141	+	hypothetical protein
B624_0217	293363	294973	+	hypothetical protein
B624_0218	295182	297248	+	transcription termination factor Rho
B624_0219	297559	297945	+	chorismate mutase
B624_0220	298190	300151	+	hypothetical protein
B624_0221	300383	303115	−	valyl-tRNA synthetase
B624_0222	303262	304785	−	ABC-type dipeptide transport system, periplasmic
				component
B624_0223	304850	305533	−	endonuclease III
B624_0224	305595	306392	−	Response regulator
B624_0225	306556	307257	−	hypothetical protein
B624_0226	307369	307950	−	integral membrane protein
B624_0227	308187	308678	−	inorganic pyrophosphatase
B624_0228	308908	310980	−	alpha-amylase family protein
B624_0229	311386	313377	+	LPXTG-motif cell wall anchor domain-containing protein
B624_0230	313988	315019	+	homoserine O-succinyltransferase
B624_0231	315484	316293	+	ATP synthase F0, A subunit
B624_0232	316400	316624	+	ATP synthase F0, C subunit
B624_0233	316684	317199	+	ATP synthase F0, B subunit
B624_0234	317237	318070	+	ATP synthase F1, delta subunit
B624_0235	318149	319777	+	ATP synthase F1, alpha subunit
B624_0236	319784	320704	+	ATP synthase F1, gamma subunit
B624_0237	320716	322185	+	ATP synthase F1, beta subunit
B624_0238	322188	322478	+	ATP synthase F1, epsilon subunit
B624_0239	322569	323336	+	nuclease of the RecB family
B624_0240	323388	324374	−	possible secreted peptidyl-prolyl cis-transisomerase
				protein
B624_0241	324455	325531	+	hypothetical protein
B624_0242	325534	326538	+	hypothetical protein
B624_0243	326790	327761	+	hypothetical protein
B624_0244	327850	328473	−	Uncharacterized protein in bacteria
B624_0245	329012	329398	+	endoribonuclease L-PSP
B624_0246	329584	330498	+	phospholipid/glycerol acyltransferase
B624_0247	330595	331593	+	glycerol-3-phosphate dehydrogenase, NAD-dependent
B624_0248	331783	332967	+	D-ala D-ala ligase
B624_0249	333223	334386	+	ABC transporter, periplasmic substrate-binding protein
B624_0250	334401	335348	+	spermidine/putrescine ABC transporter, permease protein
B624_0251	335348	336199	+	spermidine/putrescine ABC transporter, permeaseprotein
B624_0252	336207	337481	+	spermidine/putrescine ABC transporter, ATP- binding
				protein
B624_0253	337788	338828	+	CAAX amino terminal protease family proteinfamily
B624_0254	338873	339667	−	Mechanosensitive ion channel family
B624_0255	339751	341181	−	aspartate ammonia-lyase
B624_0256	341302	342030	−	Transcriptional regulator
B624_0257	342124	343527	−	hypothetical protein
B624_0258	343852	344400	−	methylated-DNA--protein-cysteinemethyltransferase
B624_0259	345162	346055	+	hypothetical protein
B624_0260	345928	347202	−	MFS transporter family protein
B624_0261	347393	348406	−	ribokinase
B624_0262	348810	349001	+	ribosomal protein L28
B624_0263	349104	351944	+	ATP-dependent DNA helicase RecG
B624_0264	352174	352782	+	methyltransferase
B624_0265	352812	353624	−	tRNA (guanine-N1)-methyltransferase
B624_0266	353698	355341	+	protease or peptidase
B624_0267	355422	356399	+	hypothetical protein
B624_0268	356482	357354	+	4-diphosphocytidyl-2C-methyl-D-erythritolsynthase
B624_0269	357367	358041	+	pyrrolidone-carboxylate peptidase
B624_0270	358192	359766	+	hypothetical protein
B624_0271	359884	361224	+	aminopeptidase C
B624_0272	361519	362649	+	phospho-2-dehydro-3-deoxyheptonate aldolase
B624_0273	362781	364010	+	phospho-2-dehydro-3-deoxyheptonate aldolase
B624_0274	364135	364845	+	MTA/SAH nucleosidase
B624_0275	365099	366427	+	ATPase, histidine kinase domain protein
B624_0276	366629	367330	+	response regulator
B624_0277	367583	368713	+	phosphate ABC transporter, phosphate-binding protein
B624_0278	368927	369877	+	pstC2
B624_0279	369880	370875	+	phosphate ABC transporter, permease protein
B624_0280	370931	371707	+	Phosphate import ATP-binding protein pstB
B624_0281	372005	372580	+	lemA protein
B624_0282	372647	374902	+	Membrane protein
B624_0283	374971	375831	+	oxidoreductase, aldo/keto reductase family
B624_0284	375932	376981	+	inosine-uridine preferring nucleoside hydrolase
B624_0285	377109	377729	−	16S rRNA processing protein RimM
B624_0286	377755	377985	−	KH domain protein
B624_0287	378009	378467	−	ribosomal protein S16
B624_0288	378703	379809	−	Endonuclease/Exonuclease/phosphatase familyfamily
B624_0289	379889	381547	−	signal recognition particle protein
B624_0290	381843	382748	+	Co/Zn/Cd cation transporter
B624_0291	382773	384419	−	cysteinyl-tRNA synthetase
B624_0292	384518	385363	+	amidotransferase
B624_0293	385414	387687	+	ABC transporter, ATP-binding protein
B624_0294	387746	388162	−	plasmid stability protein StbB
B624_0295	388175	388450	−	Plasmid stability protein
B624_0296	388609	389160	−	acetolactate synthase, small subunit
B624_0297	389180	391144	−	acetolactate synthase, large subunit, biosynthetic type
B624_0298	391308	392033	−	ribonuclease III
B624_0299	392189	392380	−	Ribosomal protein L32
B624_0300	392472	393098	−	Uncharacterized ACR protein
B624_0301	393191	394078	−	hypothetical protein
B624_0302	394089	394586	−	pantetheine-phosphate adenylyltransferase
B624_0303	394860	395150	+	hypothetical protein
B624_0304	395198	396205	−	K channel, beta subunit
B624_0305	396379	396804	+	transcription regulator, MerR family
B624_0306	396910	397533	−	hypothetical protein
B624_0307	397764	399083	+	nicotinate phosphoribosyltransferase
B624_0308	399369	400142	+	ribonuclease PH
B624_0309	400189	400944	+	Ham1 family
B624_0310	401394	402659	+	Methicillin resistance protein
B624_0311	402736	404043	+	FemAB family protein
B624_0312	404096	405373	+	Methicillin resistance protein
B624_0313	405462	406460	−	auxin efflux carrier
B624_0314	407182	408879	+	glucose-6-phosphate isomerase
B624_0315	409515	409877	+	ribosomal protein L19
B624_0316	410047	410901	+	lepB2
B624_0317	411024	411860	+	ribonuclease HII
B624_0318	411990	413102	+	transcription regulator, LacI family [imported]
B624_0319	413261	414904	+	probable sugar kinase
B624_0320	414992	415681	+	L-ribulose-5-phosphate 4-epimerase
B624_0321	415916	417430	+	L-arabinose isomerase
B624_0322	417620	418333	−	Glutamine amidotransferase
B624_0323	418607	420178	+	hypothetical protein
B624_0324	420330	421694	+	ABC superfamily ATP binding cassette transporter,
				membrane protein
B624_0325	421694	422914	+	permease protein
B624_0326	422930	423562	+	ABC transporter ATP-binding protein
B624_0327	423886	425706	−	long-chain-fatty-acid--CoA ligase
B624_0329	426606	429890	+	ABC transporter
B624_0331	431272	432618	+	solute binding protein of ABC transportersystem
B624_0332	432840	433799	+	sugar ABC transporter, permease protein
B624_0333	433805	434809	+	ABC-type sugar transport systems, permease components
B624_0334	434999	437128	+	beta-galactosidase
B624_0335	437175	438227	+	transcription regulator, LacI family [imported]
B624_0336	438426	441116	+	arabinogalactan endo-1,4-beta-galactosidase
B624_0337	441755	442621	+	2,5-didehydrogluconate reductase
B624_0338	442691	443368	+	extracellular deoxyribonuclease
B624_0339	443378	444745	−	Hypothetical protein
B624_0340	445003	446367	+	transport protein, NRAMP family
B624_0341	446472	448073	−	LinCd
B624_0342	448412	450007	+	glycosyl transferase CpsD
B624_0343	450098	452029	+	hypothetical protein
B624_0344	452091	453566	+	chain length determinant protein
B624_0345	453574	454725	+	glycosyl transferase, group 1family protein
B624_0346	454725	456065	+	Glycosyltransferase protein
B624_0347	456065	457126	+	UDP-glucuronate 5′-epimerase
B624_0348	457201	458448	+	UDP-glucose 6-dehydrogenase
B624_0349	458489	459550	+	glycosyl transferase, group 1 family protein
B624_0350	459581	460408	+	NAD dependent epimerase/dehydratase family
B624_0351	460446	460952	+	acetyltransferase
B624_0352	460985	461998	+	Glycosyl transferase
B624_0353	462020	463360	+	polymerase involved in polysaccharide synthesis
B624_0354	463363	464292	+	rhamnosyl transferase
B624_0355	464311	465753	+	flippase protein involved in polysaccharide biosynthesis
B624_0356	465774	466280	+	acetyltransferase
B624_0357	466366	467514	−	NAD-dependent epimerase/dehydratase family protein
B624_0358	467785	468615	−	integrase, catalytic region
B624_0359	468615	468770	−	transposase IS3/IS911 family protein
B624_0360	469189	470208	+	dTDP-glucose 4,6-dehydratase
B624_0361	470218	471303	+	dTDP-4-dehydrorhamnose 3,5-epimerase/dTDP-4-
				dehydrorhamnose reductase
B624_0362	471349	472245	+	glucose-1-phosphate thymidylyltransferase
B624_0364	472715	472858	+	hypothetical protein
B624_0365	473371	473802	−	hypothetical protein
B624_0366	474083	474640	−	phosphotyrosine protein phosphatase
B624_0367	474825	475331	−	hypothetical protein
B624_0368	475655	475867	−	transcriptional regulator
B624_0369	475860	476282	−	hypothetical protein
B624_0370	476415	477422	−	hypothetical protein
B624_0371	477495	477866	−	thioredoxin 2
B624_0372	478122	478751	+	hypothetical protein
B624_0373	478880	479734	+	alpha beta hydrolase
B624_0374	479747	481036	+	npy1
B624_0375	481065	481475	+	glycine cleavage system H protein
B624_0376	481547	482875	+	hypothetical protein
B624_0377	482940	485453	+	protease II
B624_0378	485521	486549	+	3-isopropylmalate dehydrogenase
B624_0379	486610	487692	+	lipoate-protein ligase a
B624_0380	487934	488650	+	probable transcriptional regulator
B624_0381	488766	491069	+	penicillin-binding protein
B624_0382	491264	492634	+	NADH-dependent flavin oxidoreductase
B624_0383	492807	493955	−	dihydroorotate dehydrogenase
B624_0384	494310	495122	+	DeoR-type regulator
B624_0385	495118	496365	+	galactose-1-phosphate uridylyltransferase
B624_0386	496385	497632	+	galactokinase
B624_0387	497718	497987	+	ACT domain protein
B624_0388	498126	499487	+	hypothetical protein
B624_0389	499800	500396	−	spoU
B624_0390	500480	501463	+	mutY
B624_0391	501531	502250	+	hypothetical protein
B624_0392	502408	505968	+	DNA-directed RNA polymerase, beta subunit
B624_0393	506139	510173	+	DNA-directed RNA polymerase, beta-prime subunit
B624_0394	510338	510967	−	FHA domain protein
B624_0395	510986	511498	−	hypothetical protein
B624_0396	511528	512457	−	phosphoprotein phosphatase
B624_0397	512457	514967	−	membrane protein
B624_0398	514967	516187	−	Protein of unknown function family
B624_0399	516215	517585	−	moxR2
B624_0400	517599	523580	−	fibronectin type III domain-containing protein
B624_0401	523750	525168	−	serine/threonine protein kinase
B624_0402	525300	529592	+	uvrd4
B624_0403	529592	533620	+	UvrD/REP helicase domain protein
B624_0404	533836	535152	+	transport protein
B624_0405	535491	536243	+	dihydrodipicolinate reductase
B624_0406	536409	537311	+	dihydrodipicolinate synthase
B624_0407	537399	539246	+	metallo-beta-lactamase superfamily protein
B624_0408	539291	541897	+	Peptidase family M1 domain protein
B624_0409	542078	542971	+	hypothetical protein
B624_0411	543954	545336	+	phosphoglucosamine mutase
B624_0412	545362	546012	+	polypeptide deformylase
B624_0413	546012	547472	+	DNA polymerase III
B624_0414	547492	547620	+	hypothetical protein
B624_0415	547858	548979	+	peptide chain release factor 2
B624_0416	548991	550121	+	ftsE
B624_0417	550135	551055	+	cell division ABC transporter, permease proteinFtsX
B624_0418	551161	552519	+	CHAP domain containing protein
B624_0419	552673	553146	+	SsrA-binding protein
B624_0420	553312	554265	+	amino acid ABC transporter, permease protein
B624_0421	554479	555420	+	hisj5
B624_0422	555554	556546	+	amino acid ABC transporter, permease protein
B624_0423	556566	557393	+	glutamine ABC transporter, ATP-binding protein
B624_0424	557604	559493	+	glucosamine--fructose-6-phosphateaminotransferase,
				isomerizing
B624_0425	559510	560271	+	Pseudouridylate synthases
B624_0426	560313	560525	−	hypothetical protein
B624_0427	560565	561554	−	transcriptional regulator, LacI family
B624_0428	561794	562717	+	sugar ABC transporter, permease protein
B624_0429	562776	563780	+	ABC-type sugar transport system, permease component
B624_0430	563975	566047	+	beta-D-galactosidase
B624_0431	566169	567185	+	transcriptional regulator, LacI family
B624_0432	567311	569008	−	alpha-L-arabinofuranosidase
B624_0433	569168	570517	+	solute binding protein of ABC transportersystem
B624_0434	570852	572192	+	probable solute binding protein of ABCtransporter system
				for sugars
B624_0435	572341	573729	+	sugar binding protein Sbp
B624_0436	573795	574562	−	transcription activator, probable Baf family[imported]
B624_0437	574688	576304	+	ABC transporter, periplasmic substrate-bindingprotein
B624_0438	576372	577346	+	membrane protein
B624_0439	577346	578245	+	peptide ABC transporter, permease protein
B624_0440	578245	579033	+	ABC transporter, nucleotide binding/ATPase protein
B624_0441	579029	579811	+	ABC transporter, ATP-binding protein
B624_0442	580296	581360	+	cystathionine beta-synthase
B624_0443	581455	582636	+	cystathionine gamma-synthase
B624_0444	582780	584501	−	ErfK/YbiS/YcfS/YnhG family
B624_0445	584661	586613	+	ATP-dependent DNA helicase RecQ
B624_0446	586729	587220	+	autoinducer-2 production protein LuxS
B624_0447	587378	587917	+	acetyltransferase, GNAT family
B624_0448	588181	589317	−	hypothetical protein
B624_0449	589890	591347	−	amino acid permease
B624_0450	591536	592891	+	alanine racemase
B624_0451	593099	594370	+	deoxyguanosinetriphosphate triphosphohydrolase
B624_0452	594537	596642	+	DNA primase
B624_0453	596838	597710	+	pyridoxine biosynthesis protein
B624_0454	597799	598434	+	glutamine amidotransferase subunit PdxT
B624_0455	598495	600156	+	aminotransferase, class I
B624_0456	600514	601443	+	possible beta-aspartyl-peptidase
B624_0457	601574	601726	−	hypothetical protein
B624_0458	601995	603179	+	Di- and tricarboxylate transporters
B624_0459	603210	603467	−	hypothetical protein
B624_0460	603651	605888	−	similar to alpha-L-arabinofuranosidase A
B624_0461	605923	606921	+	transcriptional regulator
B624_0462	607014	608219	−	Hypothetical protein
B624_0463	608621	609373	+	ABC transporter, ATP-binding protein
B624_0464	609373	610545	+	S-layer domain
B624_0465	610560	612116	+	ABC transporter, ATP-binding protein
B624_0466	612106	614232	−	1-deoxyxylulose-5-phosphate synthase
B624_0467	614478	615467	+	oxidoreductase
B624_0468	615566	616069	+	phosphoribosylaminoimidazole carboxylase, catalytic
				subunit
B624_0469	616095	617231	+	phosphoribosylaminoimidazole carboxylase,
				ATPasesubunit
B624_0470	617243	617668	+	furB
B624_0472	618183	619103	+	possible solute binding protein of ABCtransporter system
B624_0473	619367	621439	+	Phosphoglycerol transferase
B624_0474	621563	623197	+	Aldehyde dehydrogenase (NAD(P)(+))
B624_0475	623577	624842	−	phosphoribosylamine--glycine ligase
B624_0476	624872	625906	−	phosphoribosylformylglycinamidine cyclo-ligase
B624_0477	626029	627537	−	amidophosphoribosyltransferase
B624_0478	627944	628726	−	glutamine ABC transporter, ATP-binding protein
B624_0479	628726	629610	−	amino acid ABC transporter, permease protein
B624_0480	629723	630583	−	amino acid ABC transporter, periplasmic aminoacid-
				binding protein
B624_0481	630788	631255	−	hypothetical protein
B624_0482	631328	632698	−	Atz/Trz family protein
B624_0483	632741	634222	−	S-adenosyl-L-homocysteine hydrolase, NAD
				bindingdomain
B624_0484	634405	635991	+	structural gene for ultraviolet resistance
B624_0485	635991	636206	+	hypothetical protein
B624_0486	636246	637220	−	K channel, beta subunit
B624_0487	637331	638293	−	transcriptional regulator, HTH_1 family
B624_0488	638512	640023	+	Na/H antiporter
B624_0489	640043	640699	−	hypothetical protein
B624_0490	640699	642066	−	hypothetical protein
B624_0491	642042	643337	−	hypothetical protein
B624_0492	643478	647209	−	phosphoribosylformylglycinamidine synthase
B624_0493	647275	648024	−	phosphoribosylaminoimidazole-
				succinocarboxamidesynthase
B624_0494	648420	649754	−	phosphoribosylglycinamide formyltransferase
B624_0495	649928	651085	+	type 1 capsular polysaccharide biosynthesisprotein J
				(capJ)
B624_0496	651238	652260	−	hypothetical protein
B624_0497	652822	653880	+	transporter protein
B624_0498	654599	654967	+	ribosomal protein S12
B624_0499	654976	655443	+	ribosomal protein S7
B624_0500	655478	657598	+	translation elongation factor G
B624_0501	657774	658970	+	translation elongation factor Tu
B624_0502	659184	659909	+	hypothetical protein
B624_0503	660049	660864	+	transcriptional regulator, LysR family
B624_0504	661037	662098	+	membrane protein
B624_0505	662161	662643	−	Membrane protein
B624_0506	662721	663086	−	CrcB protein
B624_0507	663086	663619	−	protein with similarity to CrcB
B624_0508	663631	663987	+	hypothetical protein
B624_0509	664023	665063	+	alcohol dehydrogenase, zinc-containing
B624_0510	665416	665625	+	hypothetical protein
B624_0511	665652	667028	−	Hypothetical protein
B624_0512	667295	667462	−	hypothetical protein
B624_0513	667902	670487	+	excinuclease ABC, subunit A
B624_0514	670548	671903	+	MATE efflux family protein
B624_0515	671914	672603	+	endonuclease III
B624_0516	672783	673076	−	hypothetical protein
B624_0517	673095	673766	+	galactoside O-acetyltransferase
B624_0519	674207	675292	+	possible integral membrane permease protein
B624_0520	675318	675902	+	Beta-glucuronidase
B624_0521	676090	677523	−	glutamine synthetase, type I
B624_0522	677846	678625	−	hypothetical protein
B624_0523	678712	680199	−	dihydrolipoamide dehydrogenase
B624_0524	680351	680971	−	integral membrane protein
B624_0525	681063	682427	+	widely conserved protein in peptidase ordeacetlylase
				family
B624_0526	682730	683326	+	ABC superfamily ATP binding cassette transporter,
				membrane protein
B624_0527	683329	684801	+	ABC transporter, ATP-binding protein
B624_0528	684801	685625	+	possible permease protein of ABC transporter forcobalt
B624_0529	685824	686699	+	spoU rRNA methylase family protein [imported]
B624_0530	686756	687820	+	phenylalanyl-tRNA synthetase, alpha subunit
B624_0531	687831	690437	+	phenylalanyl-tRNA synthetase, beta subunit
B624_0532	690471	691154	+	hypothetical protein
B624_0533	691256	692347	+	N-acetyl-gamma-glutamyl-phosphate reductase
B624_0534	692347	693519	+	ornithine acetyltransferase/N-acetylglutamate synthase
				protein
B624_0535	693659	694612	+	acetylglutamate kinase
B624_0536	694605	695897	+	acetylornithine aminotransferase
B624_0537	695944	696906	+	ornithine carbamoyltransferase
B624_0538	696906	697415	+	arginine repressor
B624_0539	697501	698736	+	argininosuccinate synthase
B624_0540	699184	700653	+	argininosuccinate lyase
B624_0541	701005	701196	+	Sulfur transfer protein involved in thiamine biosynthesis
B624_0542	701211	702077	+	thiG protein
B624_0543	702157	702963	+	moeB
B624_0544	703023	703376	+	rhodanese-like domain protein
B624_0545	703550	704071	+	HD domain protein
B624_0546	704071	704835	+	hypothetical protein
B624_0547	704964	706283	+	tyrosyl-tRNA synthetase
B624_0548	706314	708086	+	hypothetical protein
B624_0549	708098	709135	+	Sugar phosphatases of the HADsuperfamily
B624_0550	709395	710165	+	hemolysin A
B624_0551	710153	710824	−	hypothetical protein
B624_0552	710965	711624	−	similar to a bacterial K( )-uptake system
B624_0553	711678	713141	−	Cation transport protein domain protein
B624_0554	713388	714407	+	poly(P)/ATP-NAD kinase
B624_0555	714410	716233	+	DNA repair protein RecN
B624_0556	716266	716910	+	hydrolase, haloacid dehalogenase-like family
B624_0557	717154	717525	+	transcriptional regulator, GntR family
B624_0558	717544	718467	+	ABC transporter, ATP-binding protein
B624_0559	718477	719091	+	hypothetical protein
B624_0560	719187	719903	+	hypothetical protein
B624_0561	719985	722768	−	calcium-translocating P-type ATPase, PMCA-type
B624_0562	722966	723238	+	hypothetical protein
B624_0563	723291	724778	−	threonine synthase
B624_0564	725001	725699	+	serine hydroxymethyltransferase
B624_0565	725707	727116	+	gamma-glutamyl phosphate reductase
B624_0566	727116	727694	+	phosphoribosylformylglycinamidine (FGAM) synthase,
				synthetase domain protein
B624_0567	727694	728476	+	nicotinate (nicotinamide) nucleotideadenylyltransferase
B624_0568	728580	729779	−	possible B-hexosaminidase
B624_0569	729952	733203	+	hypothetical protein
B624_0570	733340	733834	+	phosphinothricin acetyltransferase
B624_0571	734033	734629	+	peptidyl-tRNA hydrolase
B624_0572	734622	738203	+	transcription-repair coupling factor
B624_0573	738346	739290	+	oxidoreductase
B624_0574	739444	740739	+	phosphopyruvate hydratase
B624_0575	740833	741423	+	hypothetical protein
B624_0576	741423	741986	+	hypothetical protein
B624_0577	742052	743050	+	Ppx/GppA phosphatase
B624_0578	743410	744711	+	IS30 family, transposase [imported]
B624_0580	745605	747062	+	L-serine dehydratase 1
B624_0581	747207	747611	+	peptidyl-prolyl cis-trans isomerase, FKBP-type
B624_0582	747713	748189	+	transcription elongation factor GreA
B624_0583	748250	749191	−	hemolysin
B624_0584	749316	750086	+	hypothetical protein
B624_0585	750252	751736	+	histidine kinase-like protein
B624_0586	751815	752090	−	hypothetical protein
B624_0587	752207	754030	−	FtsK cell division protein
B624_0588	754203	755633	−	Cell envelope-related function transcriptional attenuator
				common domain protein
B624_0589	755815	756180	+	whiB1
B624_0590	756227	759319	+	membrane protein
B624_0591	759319	760857	+	Large exoproteins involved in heme utilization or
				adhesion
B624_0592	760966	761391	−	hypothetical protein
B624_0593	761480	762283	+	Hypothetical protein
B624_0594	762332	763015	+	Phosphoribosyl transferase domain protein
B624_0595	762937	763320	−	hypothetical protein
B624_0596	763391	764464	−	sensory box histidine kinase
B624_0597	764464	765183	−	DNA-binding response regulator MtrA
B624_0598	765222	767471	−	1,4-alpha-glucan branching enzyme
B624_0599	767649	768239	+	possible transcriptional regulator
B624_0600	768351	768872	+	2C-methyl-D-erythritol 2,4-cyclodiphosphatesynthase
B624_0601	768930	769760	−	zinc ABC transporter, permease protein
B624_0602	769830	770717	−	ABC transporter, ATP-binding protein
B624_0603	770893	772086	−	possible solute binding protein of ABCtransporter system
B624_0604	772190	773062	+	methylenetetrahydrofolate dehydrogenase/cyclohydrolase
B624_0605	773185	774657	+	30S ribosomal protein S1
B624_0606	774834	775448	+	dephospho-CoA kinase
B624_0607	775463	777571	+	excinuclease ABC, B subunit
B624_0608	777743	778726	+	TerC family protein
B624_0609	778897	780336	+	pyruvate kinase
B624_0610	780490	781086	−	possible NTP pyrophosphatase in MutT family
B624_0611	781432	782214	+	response regulator
B624_0612	782278	785127	+	DNA polymerase I
B624_0613	785300	786217	+	hypothetical protein
B624_0614	786266	786937	+	MutT/nudix family protein
B624_0615	786994	789132	+	glycogen operon protein GlgX
B624_0616	789186	789413	+	hypothetical protein
B624_0617	789420	790067	+	hypothetical protein
B624_0618	790243	790794	−	DNA-3-methyladenine glycosylase I
B624_0619	791884	792942	−	hypothetical protein
B624_0620	793226	793780	+	hypothetical protein
B624_0624	794937	795989	−	integrase/recombinase XerC, probable [imported]
B624_0625	795989	796951	−	probable integrase/recombinase
B624_0626	796951	798273	−	integrase/recombinase
B624_0627	798284	799564	−	IS3-Spn1, transposase
B624_0628	799635	800477	−	Transposase subunit
B624_0629	800762	802579	−	hypothetical Protein
B624_0630	803748	804065	−	hypothetical protein
B624_0631	804667	808221	+	DNA polymerase III, alpha chain
B624_0632	808297	808743	+	hypothetical protein
B624_0633	808952	810826	+	antigen, 67 kDa
B624_0634	810916	811413	+	NH2-acetyltransferase
B624_0635	817553	818377	−	2,5-diketo-D-gluconic acid reductase A
B624_0636	818484	819956	+	sugar kinase, FGGY family
B624_0637	819972	820262	+	Acylphosphatase
B624_0638	820367	821761	+	histidinol dehydrogenase
B624_0639	821761	822918	+	histidinol-phosphate aminotransferase
B624_0640	823007	823603	+	imidazoleglycerol-phosphate dehydratase
B624_0641	823606	824397	+	hypothetical protein
B624_0642	824435	825079	+	imidazole glycerol phosphate synthase,
				glutamineamidotransferase subunit
B624_0643	825152	825874	+	HisA/TrpF protein
B624_0644	826039	827415	−	hypothetical protein
B624_0645	827564	828898	+	Glutamine synthetase, catalytic domain
B624_0646	829137	829604	+	possible arabinose efflux permease
B624_0647	829657	830625	−	hypothetical protein
B624_0648	830625	834758	−	ATP-dependent helicase HrpA
B624_0649	834751	835404	−	hypothetical protein
B624_0650	835563	837065	+	GTP-binding protein
B624_0651	837249	838208	+	L-lactate dehydrogenase
B624_0652	838356	839291	−	cation efflux system protein
B624_0653	839460	840182	−	LexA repressor
B624_0654	840333	840680	+	LysM domain protein
B624_0655	840736	841173	+	transcriptional regulator NrdR
B624_0656	841314	842510	−	D-3-phosphoglycerate dehydrogenase
B624_0657	842524	844800	−	Superfamily I DNA and RNA helicases
B624_0658	845133	845651	+	hypothetical protein
B624_0659	845654	846730	+	S-adenosyl-methyltransferase MraW
B624_0660	846740	847186	+	hypothetical protein
B624_0661	847186	848985	+	penicillin-binding protein
B624_0662	849015	849884	+	hypothetical protein
B624_0663	849936	851384	+	UDP-N-acetylmuramoylalanyl-D-glutamyl-2,6-
				diaminopimelate--D-alanyl-D-alanylligase
B624_0664	851432	852535	+	rfe1
B624_0665	852593	854035	+	UDP-N-acetylmuramoylalanine--D-glutamate ligase
B624_0666	854025	855239	+	cell division protein, FtsW/RodA/SpoVE family
B624_0667	855258	856436	+	UDP-N-acetylglucosamine--N-acetylmuramyl-
				(pentapeptide)pyrophosphoryl-undecaprenol N-
				acetylglucosaminetransferase
B624_0668	856540	858075	+	UDP-N-acetylmuramate--alanine ligase
B624_0669	858078	859139	+	Cell division septal protein
B624_0670	859883	860983	+	hypothetical protein
B624_0671	861130	861813	+	von Willebrand factor
B624_0672	861906	862391	+	D-tyrosyl-tRNA(Tyr) deacylase
B624_0673	862494	863735	−	glucose/galactose transporter
B624_0674	863844	864230	−	Lactoylglutathione lyase and related lyases
B624_0675	864308	865201	−	fructokinase
B624_0676	865277	866488	−	transcription regulator ROK family
B624_0677	866715	867626	+	glucokinase
B624_0678	867792	868913	−	NagC/XylR-type transciptional regulator
B624_0679	869251	870060	+	glucosamine-6-phosphate isomerase
B624_0680	870119	871393	+	N-acetylglucosamine-6-phosphate deacetylase
B624_0681	871676	873307	+	dipeptide ABC transporter, dipeptide-bindingprotein
B624_0682	873480	874568	+	oligopeptide ABC transporter, permease protein
B624_0683	874573	875739	+	dipeptide ABC transporter, permease protein
B624_0684	875746	877452	+	ATP binding protein of ABC transporter
B624_0685	877508	878026	−	MutT/nudix family protein
B624_0686	878078	879670	−	Xaa-Pro aminopeptidase I
B624_0687	879977	880954	−	hypothetical protein
B624_0689	882044	883672	+	folC
B624_0690	883736	887410	+	SMC family, C-terminal domain family
B624_0691	887535	888527	−	hypothetical protein
B624_0692	888652	890202	−	mure1
B624_0693	890341	891126	+	RNA polymerase sigma-70 factor, ECF subfamily
B624_0694	891129	891446	+	hypothetical protein
B624_0695	891719	892660	−	Aldose 1-epimerase superfamily
B624_0696	892788	893741	−	Aldose 1-epimerase superfamily
B624_0697	894032	895021	+	hydroxymethylbutenyl pyrophosphate reductase
B624_0698	895067	895573	−	transcriptional regulator
B624_0699	895670	896725	−	glyceraldehyde-3-phosphate dehydrogenase, typeI
B624_0700	896968	897690	−	Thiamin pyrophosphokinase, catalytic domainfamily
B624_0702	899298	899930	+	Translation initiation factor IF-3, C-terminaldomain
B624_0703	899923	900105	+	ribosomal protein L35
B624_0704	900161	900541	+	ribosomal protein L20
B624_0705	900614	901537	+	Integrase
B624_0706	901668	904511	+	ABC transporter, ATP-binding protein
B624_0707	904776	905612	+	Soj family protein
B624_0708	905634	906545	+	chromosome segregation and condensation protein ScpA
B624_0709	906561	907274	+	Transcriptional regulator
B624_0710	907409	908233	+	MutT/nudix family protein
B624_0711	908296	909573	+	quinolinate synthetase complex, A subunit
B624_0712	909668	911296	+	L-aspartate oxidase
B624_0713	911303	912193	+	nicotinate-nucleotide pyrophosphorylase
B624_0714	912199	913443	+	possible pyridoxal-phosphate-dependentaminotransferase
B624_0715	913478	914824	+	major facilitator family transporter
B624_0716	915142	917070	+	GTP-binding elongation factor TypA/BipA
B624_0717	917173	917616	+	Alcohol dehydrogenase, class IV
B624_0718	917699	918673	+	prephenate dehydratase
B624_0719	918670	919734	+	prephenate dehydrogenase
B624_0720	919947	920201	+	hypothetical protein
B624_0721	920239	921303	+	phage integrase family protein
B624_0722	921559	923196	+	DppA2
B624_0723	923500	924423	+	ABC-type dipeptide/oligopeptide/nickel transport
				systems, permease components
B624_0724	924445	925446	+	dppC
B624_0725	925472	927478	+	ABC-type transporter, duplicated ATPasecomponent
B624_0726	927793	928650	−	exodeoxyribonuclease III
B624_0727	928775	929626	+	hypothetical protein
B624_0728	929645	930400	+	ABC-type Mn2+/Zn2+ transport systems, permease
				components
B624_0729	930390	931658	+	RNA methyltransferase, TrmA family
B624_0730	931673	932365	+	lipoprotein
B624_0731	932483	935032	+	ATPase, P-type (transporting), HAD superfamily,
				subfamily IC
B624_0732	935156	937852	+	aconitate hydratase 1
B624_0733	938001	938360	+	DNA-damage-inducible protein J
B624_0734	938363	938851	+	hypothetical protein
B624_0735	938917	941019	−	Uncharacterized protein
B624_0736	941112	941750	−	hypothetical protein
B624_0737	941793	942548	−	DNA-binding response regulator
B624_0738	942553	943812	−	histidine kinase sensor
B624_0739	944117	944959	+	hypothetical protein
B624_0740	945143	946039	+	membrane protein
B624_0741	946182	947195	+	integral membrane protein with duf6
B624_0742	947234	947962	−	GTP pyrophosphokinase
B624_0743	948103	949554	+	tRNA-i(6)A37 thiotransferase enzyme MiaB
B624_0744	949568	950551	+	tRNA delta(2)-isopentenylpyrophosphatetransferase
B624_0745	950591	951337	−	Fic protein family family
B624_0746	951549	954437	+	cell division protein FtsK
B624_0747	954620	955267	+	CDP-diacylglycerol--glycerol-3-phosphate3-
				phosphatidyltransferase
B624_0748	955282	955812	+	competence/damage-inducible protein CinA
				domainprotein
B624_0749	955875	956387	+	Transcriptional regulators
B624_0750	956502	956732	+	hypothetical protein
B624_0751	957036	958226	+	recA protein
B624_0752	958232	958822	+	regulatory protein RecX
B624_0753	959005	959544	+	hypothetical protein
B624_0754	959702	960361	+	S30AE family protein
B624_0755	960526	963417	+	preprotein translocase, SecA subunit
B624_0758	964674	965717	+	anthranilate phosphoribosyltransferase
B624_0759	965964	966656	−	hypothetical protein
B624_0760	966717	967418	+	phospholipid/glycerol acyltransferase
B624_0761	967476	969746	−	serine/threonine protein kinase
B624_0762	969893	970972	−	probable bifunctional short chain isoprenyl diphosphate
				synthase
B624_0763	971179	971838	+	hypothetical protein
B624_0764	972044	973465	+	RNA polymerase principal sigma factor; sigma 70
B624_0765	973526	975799	+	DNA gyrase, subunit B
B624_0766	975969	977192	+	MFS family major facilitator transporter
B624_0767	977239	978228	+	ribokinase
B624_0768	978247	982977	+	DEAD/DEAH box helicase domain protein
B624_0769	982994	983779	−	hypothetical protein
B624_0770	983927	986653	−	DNA gyrase A subunit
B624_0771	986904	988169	+	hypothetical protein
B624_0772	988185	989273	−	hypothetical protein
B624_0773	989432	989722	+	hypothetical protein
B624_0774	989725	990198	+	deoxyuridine 5triphosphate nucleotidohydrolase
B624_0775	990335	992656	+	GTP pyrophosphokinase
B624_0777	993226	994425	+	Site-specific recombinase XerD
B624_0778	994425	995387	+	probable integrase/recombinase
B624_0779	995387	996439	+	integrase/recombinase XerC, probable
B624_0780	996532	997095	−	integrase catalytic subunit
B624_0781	997107	997619	−	hypothetical protein
B624_0782	997719	998255	−	peptidyl-prolyl cis-trans isomerase
B624_0783	998331	999296	−	Uncharacterized protein
B624_0784	999519	999623	−	hypothetical protein
B624_0785	999683	1000615	−	membrane protein
B624_0786	1000894	1001295	+	Hypothetical protein
B624_0787	1001329	1002621	−	SAM-dependent methyltransferases
B624_0788	1002690	1003532	+	possible phosphoglycerate mutase
B624_0789	1003650	1004597	+	magnesium transporter, CorA family
B624_0790	1004615	1005538	+	solute binding protein of ABC transporter system
B624_0791	1005584	1008544	+	leucyl-tRNA synthetase
B624_0792	1008708	1009484	+	competence protein ComEA helix-hairpin- helixrepeat
				region domain protein
B624_0793	1009484	1011235	+	membrane protein
B624_0794	1011378	1012721	+	prolidase (X-Pro dipeptidase) or chlorohydrolase
B624_0795	1012791	1013759	+	DNA polymerase III, delta subunit
B624_0796	1013783	1014346	+	Hypothetical protein
B624_0797	1014411	1015289	+	Metal-dependent proteases, molecular chaperone
B624_0798	1015308	1015859	+	ribosomal-protein-alanine acetyltransferase
B624_0799	1015859	1016899	+	O-sialoglycoprotein endopeptidase
B624_0800	1017569	1018501	+	probable integrase/recombinse
B624_0801	1018564	1018887	−	hypothetical protein
B624_0802	1018909	1019862	−	hypothetical protein
B624_0803	1019849	1020439	−	hypothetical protein
B624_0804	1020474	1021376	−	Fic protein family family
B624_0805	1021357	1021929	−	hypothetical protein
B624_0806	1021949	1023763	−	hypothetical protein
B624_0807	1023782	1024864	−	hypothetical protein
B624_0808	1024893	1025600	−	hypothetical protein
B624_0809	1025761	1026843	−	TraG-related protein
B624_0810	1026843	1027799	−	hypothetical protein
B624_0811	1027799	1028257	−	hypothetical protein
B624_0812	1028379	1028669	+	hypothetical protein
B624_0813	1028786	1030942	+	Topoisomerase IA
B624_0814	1031020	1031448	+	hypothetical protein
B624_0815	1031753	1032193	+	Bacterial mobilisation protein (MobC)
B624_0817	1032621	1033400	−	Fic protein family family
B624_0818	1033518	1034822	+	relaxase/mobilization nuclease family protein
B624_0819	1034848	1036128	−	hipA transcription regulator protein
B624_0820	1036128	1036439	−	hypothetical protein
B624_0821	1036545	1037675	−	hypothetical protein
B624_0822	1038015	1038551	−	hypothetical protein
B624_0823	1038618	1040423	−	conjugative transfer gene complex protein
B624_0824	1040507	1041145	−	hypothetical protein
B624_0825	1041250	1042281	−	hypothetical protein
B624_0826	1042389	1042865	−	hypothetical protein
B624_0827	1043244	1044839	−	ATP binding protein-like protein
B624_0828	1044857	1046341	−	hypothetical protein
B624_0829	1046369	1048357	−	hypothetical protein
B624_0830	1048370	1048669	−	hypothetical protein
B624_0831	1048710	1049189	−	hypothetical protein
B624_0832	1049206	1050405	−	hypothetical protein
B624_0833	1050435	1051070	−	hypothetical protein
B624_0834	1051396	1056213	−	hypothetical protein
B624_0835	1056508	1057458	−	hypothetical protein
B624_0836	1057844	1058440	−	ATPases involved inchromosome partitioning
B624_0837	1058539	1059152	−	hypothetical protein
B624_0838	1059167	1059448	−	ATPases involved inchromosome partitioning
B624_0839	1059569	1060042	−	possible WhiB-like transcription factor
B624_0840	1060036	1061400	−	hypothetical protein
B624_0841	1061400	1061597	−	hypothetical protein
B624_0842	1061748	1061894	−	hypothetical protein
B624_0843	1061958	1062263	−	hypothetical protein
B624_0844	1062260	1062601	−	hypothetical protein
B624_0845	1062779	1062997	−	hypothetical protein
B624_0846	1063127	1063546	+	hypothetical protein
B624_0847	1064092	1064778	+	peptidase M23B
B624_0848	1064862	1066490	−	hypothetical protein
B624_0849	1066742	1067959	−	isocitrate dehydrogenase, NADP-dependent
B624_0850	1068087	1069208	+	IMP dehydrogenase family protein
B624_0851	1069373	1069861	+	hypothetical protein
B624_0852	1069955	1072039	+	long-chain-fatty-acid--CoA ligase
B624_0853	1072049	1072534	+	polypeptide deformylase
B624_0854	1072894	1073736	+	ribosomal protein S2
B624_0855	1073818	1074666	+	translation elongation factor Ts
B624_0856	1074843	1075580	+	uridylate kinase
B624_0857	1075660	1076208	+	ribosome recycling factor
B624_0858	1076234	1077217	+	phosphatidate cytidylyltransferase
B624_0859	1077431	1078597	+	23S rRNA m(2)A-2503 methyltransferase
B624_0860	1078604	1079149	−	thij
B624_0861	1079324	1080091	+	Imidazole glycerol phosphate synthase subunit hisF
B624_0862	1080228	1080620	+	phosphoribosyl-AMP cyclohydrolase
B624_0863	1080704	1082257	+	anthranilate synthase component I
B624_0864	1082328	1082564	−	hypothetical protein
B624_0865	1082576	1084174	+	ATP binding protein of ABC transporter
B624_0866	1084221	1084925	+	oxidoreductase, short- chaindehydrogenase/reductase
				family
B624_0867	1084999	1085364	+	protein with unknownfunction
B624_0868	1085423	1086091	−	hypothetical protein
B624_0869	1086091	1087701	−	ATP binding protein of ABC transporter
B624_0870	1087704	1088402	−	cobalt ABC transporter permease
B624_0871	1088405	1089049	−	Permeases of the major facilitator superfamily
B624_0872	1089249	1090877	+	hypothetical protein
B624_0873	1090877	1091548	+	hypothetical protein
B624_0874	1091548	1095093	+	hypothetical protein
B624_0875	1095161	1096351	+	hypothetical protein
B624_0876	1096521	1097084	+	hypothetical protein
B624_0877	1097352	1100384	+	excinuclease ABC, A subunit
B624_0878	1100532	1102895	+	excinuclease ABC, C subunit
B624_0879	1103007	1103975	+	aroE
B624_0880	1103978	1104961	+	P-loop-containing kinase
B624_0881	1105163	1106110	+	Uncharacterized protein
B624_0882	1106282	1107484	+	phosphoglycerate kinase
B624_0883	1107546	1108346	+	triosephosphate isomerase
B624_0884	1108413	1108658	+	preprotein translocase, SecG subunit
B624_0885	1108763	1109710	+	L-2-hydroxyisocaproate/malate/lactate dehydrogenase-
				like protein
B624_0886	1109710	1110558	+	hypothetical protein
B624_0887	1110672	1112225	+	aminotransferase, class I
B624_0888	1112360	1113466	−	hypothetical protein
B624_0889	1113642	1114976	−	branched-chain amino acid transport system IIcarrier
				protein
B624_0890	1115108	1116208	−	transaldolase
B624_0891	1116332	1118437	−	transketolase
B624_0892	1118812	1119927	+	heat-inducible transcription repressor HrcA
B624_0893	1119986	1121128	+	dnaJ protein
B624_0894	1121180	1121968	−	fructosamine kinase
B624_0895	1122113	1122994	+	Undecaprenyl-diphosphatase
B624_0896	1123157	1123987	−	hypothetical protein
B624_0897	1124807	1126837	+	threonyl-tRNA synthetase
B624_0898	1126980	1127561	+	Diadenosine tetraphosphate (Ap4A) hydrolase and other
				HIT family hydrolase
B624_0899	1127703	1128455	+	hypothetical protein
B624_0900	1128464	1129045	+	crossover junction endodeoxyribonuclease RuvC
B624_0901	1129106	1129729	+	Holliday junction DNA helicase RuvA
B624_0902	1129732	1130793	+	Holliday junction DNA helicase RuvB
B624_0903	1130861	1131292	+	preprotein translocase, YajC subunit
B624_0904	1131359	1131937	+	adenine phosphoribosyltransferase
B624_0905	1132037	1133236	+	succinyl-CoA synthetase, beta subunit
B624_0906	1133239	1134147	+	succinyl-CoA synthase, alpha subunit
B624_0907	1134170	1135546	+	membrane protein
B624_0908	1135581	1137131	+	purine biosynthesis protein purH (Includes:
				Phosphoribosylaminoimidazolecarboxamide
				formyltransferase and IMP cyclohydrolase)
B624_0909	1137484	1138449	−	Glycerol uptake facilitator and related permeases
B624_0910	1138645	1139412	+	ribosomal large subunit pseudouridine synthase B
B624_0911	1139412	1141538	+	cytidylate kinase/GTP-binding protein
B624_0912	1141896	1143422	+	UDP-glucose pyrophosphorylase
B624_0913	1143565	1145475	+	Hypothetical protein
B624_0914	1145489	1145803	+	hypothetical protein
B624_0915	1145819	1148407	+	Superfamily II RNA helicase
B624_0916	1148524	1148868	+	hypothetical protein
B624_0917	1149001	1149717	+	haloacid dehalogenase domain-containing protein
				hydrolase
B624_0918	1149744	1149995	+	hypothetical protein
B624_0919	1150135	1150539	−	hypothetical protein
B624_0920	1150673	1151302	−	MerR type transcriptional regulator
B624_0921	1151406	1151846	−	possible signal transduction protein
B624_0922	1151856	1152674	−	hypothetical protein
B624_0923	1152693	1153022	−	small basic protein
B624_0924	1153025	1153999	−	hypothetical protein
B624_0925	1153992	1154606	−	CDP-diacylglycerol--glycerol-3-phosphate3-
				phosphatidyltransferase
B624_0926	1154623	1155471	−	ATP phosphoribosyltransferase
B624_0927	1155486	1155746	−	phosphoribosyl-ATP pyrophosphohydrolase
B624_0928	1155812	1156477	−	ribulose-phosphate 3-epimerase
B624_0929	1156556	1157500	−	prolipoprotein diacylglyceryl transferase
B624_0930	1157614	1158486	−	tryptophan synthase, alpha subunit
B624_0931	1158507	1160591	−	tryptophan synthase, beta subunit
B624_0932	1161120	1161968	−	nfo
B624_0933	1163206	1164216	−	hypothetical protein
B624_0934	1164570	1164860	−	hypothetical protein
B624_0935	1165260	1165715	−	hypothetical protein
B624_0936	1165903	1166406	+	acetyltransferase
B624_0937	1166567	1166746	+	hypothetical protein
B624_0938	1166793	1167323	−	hypothetical protein
B624_0939	1167392	1167961	−	acetyltransferase, GNAT family
B624_0940	1168315	1169001	−	hypothetical protein
B624_0941	1169017	1169823	−	hypothetical protein
B624_0942	1169832	1170527	−	ABC transporter related protein
B624_0943	1170676	1171263	+	Respose regulator
B624_0946	1172956	1173576	−	hypothetical protein
B624_0947	1173576	1174301	−	hypothetical protein
B624_0948	1174309	1174962	−	ABC transporter related protein
B624_0949	1175271	1176518	+	transposase
B624_0950	1176714	1177379	−	two component transcriptional regulator, LuxR family
B624_0951	1177379	1178596	−	histidine protein kinase
B624_0952	1178638	1179060	−	hypothetical protein
B624_0953	1179039	1180061	−	hypothetical protein
B624_0954	1180057	1180815	−	macrolide export ATP-binding/permease protein MacB
B624_0955	1181154	1181684	−	hypothetical protein
B624_0956	1182016	1182315	+	hypothetical protein
B624_0957	1182321	1182662	+	hypothetical protein
B624_0958	1182847	1183050	−	hypothetical protein
B624_0962	1184840	1185853	−	hypothetical protein
B624_0963	1186097	1186555	−	hypothetical protein
B624_0964	1187212	1188783	+	APC family amino acid-polyamine-organocation
				transporter
B624_0965	1188993	1189640	−	signal peptidase I-2
B624_0966	1189721	1190146	−	hypothetical protein
B624_0967	1190467	1191420	+	hypothetical protein
B624_0968	1191479	1191801	+	hypothetical protein
B624_0969	1192540	1193727	+	Aspartate transaminase
B624_0970	1193770	1195530	+	YjeF family protein
B624_0971	1195635	1196261	+	Hydrolase (HAD superfamily)
B624_0972	1196366	1197286	+	transcriptional regulator, LysR family
B624_0973	1197447	1198565	−	Hydrolases or acyltransferases (alpha/beta hydrolase
				superfamily)
B624_0974	1198783	1198932	−	hypothetical protein
B624_0975	1199044	1199736	−	orotate phosphoribosyltransferase
B624_0976	1199748	1200716	−	dihydroorotate dehydrogenase
B624_0977	1200722	1201543	−	dihydroorotate dehydrogenase, electron transfer subunit
B624_0978	1201682	1202632	−	orotidine 5′-phosphate decarboxylase
B624_0979	1202653	1204146	−	dihydroorotase
B624_0980	1204146	1204562	−	Aspartate carbamoyltransferase regulatory chain
B624_0981	1204565	1205524	−	aspartate carbamoyltransferase
B624_0982	1205669	1208896	−	glutamate-ammonia ligase adenylyltransferasefamily
B624_0983	1208955	1209905	−	Penicillin V acylase and related amidases
B624_0984	1210042	1210893	−	5,10-methylenetetrahydrofolate reductase
B624_0985	1210955	1213255	−	5-methyltetrahydropteroyltriglutamate--homocysteineS-
				methyltransferase
B624_0986	1213369	1213923	−	phosphohistidine phosphatase SixA
B624_0987	1214024	1215091	−	protein-L-isoaspartate methyltransferase
B624_0988	1215168	1215803	+	phospholipase/carboxylesterase
B624_0989	1215850	1216806	−	oxidoreductase, aldo/keto reductase 2 family
B624_0990	1217063	1217995	+	esterase/lipase
B624_0991	1218234	1219178	+	Alcohol dehydrogenase, zinc- binding dehydrogenase
				family
B624_0993	1220459	1221484	+	transposase
B624_0994	1221484	1221948	+	hypothetical protein
B624_0995	1221948	1222706	+	hypothetical protein
B624_0996	1222896	1223972	+	hypothetical protein
B624_0997	1224236	1224811	+	hypothetical protein
B624_0999	1225221	1226144	−	hypothetical protein
B624_1000	1226238	1227140	−	hypothetical protein
B624_1001	1227158	1228765	−	hypothetical protein
B624_1002	1229279	1230097	−	ADP-ribosylglycohydrolase
B624_1003	1230187	1230412	+	hypothetical protein
B624_1005	1232085	1232906	+	hypothetical protein
B624_1006	1233000	1233548	−	alkyl hydroperoxide reductase/Thiol specific antioxidant/
				Mal allergen
B624_1007	1233681	1234511	−	carbon-nitrogen hydrolase
B624_1008	1234511	1235365	−	hydrolase, haloacid dehalogenase-like family
B624_1009	1235520	1236365	−	modF
B624_1010	1236462	1237709	−	rfag1
B624_1011	1237841	1238302	−	hypothetical protein
B624_1012	1238382	1239917	−	gltD
B624_1013	1239922	1244490	−	glutamate synthase, large subunit
B624_1014	1244835	1245116	+	hypothetical protein
B624_1015	1245175	1246197	−	dihydrodipicolinate reductase-like protein
B624_1016	1246656	1246979	+	hypothetical protein
B624_1017	1247042	1247227	−	hypothetical protein
B624_1018	1247493	1248536	−	ChaR3 protein
B624_1019	1249123	1250073	+	hypothetical protein
B624_1020	1250541	1250888	−	hypothetical protein
B624_1021	1251177	1252538	+	norm1
B624_1022	1252915	1254216	+	integrase
B624_1023	1254323	1255450	−	glycerate kinase
B624_1024	1255637	1256734	+	transcriptional regulator, LacI family
B624_1025	1256820	1258226	−	oxygen-independent coproporphyrinogen III oxidase
B624_1026	1258229	1260106	−	GTP-binding protein LepA
B624_1027	1260253	1260510	+	Ribosomal protein S20
B624_1028	1260768	1261556	−	hypothetical protein
B624_1029	1261807	1262703	−	MazG family protein
B624_1030	1262903	1264027	−	branched-chain amino acid aminotransferase
B624_1031	1264254	1264871	−	ribosomal 5S rRNA E-loop binding proteinCtc/L25/TL5
B624_1032	1265298	1266332	+	hypothetical protein
B624_1033	1266474	1267895	−	NAD(P) transhydrogenase subunit beta
B624_1034	1267898	1268200	−	NAD/NADP transhydrogenase alpha subunit-like protein
B624_1035	1268219	1269379	−	NAD(P) transhydrogenase subunit alpha part 1
B624_1036	1269798	1271828	+	long-chain-fatty-acid--CoA ligase
B624_1037	1271887	1272948	−	GTP-binding protein Era
B624_1038	1272953	1274383	−	CBS domain protein
B624_1039	1274462	1275007	−	metal-dependent hydrolase
B624_1040	1275000	1276172	−	PhoH family protein
B624_1041	1276194	1276529	−	Hit family protein
B624_1042	1276581	1277375	−	Uncharacterized protein in bacteria
B624_1043	1277619	1278494	+	rRNA methylases
B624_1044	1278698	1279939	+	glucose-1-phosphate adenylyltransferase
B624_1045	1280035	1280625	−	mrp protein
B624_1046	1280635	1281186	−	SUF system FeS assembly protein, NifU family
B624_1047	1281201	1282472	−	aminotransferase, class-V
B624_1048	1282614	1283390	−	FeS assembly ATPase SufC
B624_1049	1283419	1284651	−	FeS assembly protein SufD
B624_1050	1284660	1286156	−	FeS assembly protein SufB
B624_1051	1286383	1287975	−	hypothetical protein
B624_1052	1288225	1289883	−	CTP synthase
B624_1053	1290032	1291585	−	dipeptidase
B624_1054	1291684	1292127	−	3-dehydroquinate dehydratase, type II
B624_1055	1292294	1293913	−	shikimate kinase/3-dehydroquinate synthase
B624_1056	1293999	1295183	−	chorismate synthase
B624_1057	1295247	1295717	+	TadV, prepilin type IV peptidase
B624_1058	1295891	1297069	−	Periplasmic solute-binding protein
B624_1059	1297083	1297538	−	YqgF family crossover junction endodeoxyribonuclease,
				YrrK
B624_1060	1297550	1300228	−	alanyl-tRNA synthetase
B624_1061	1300359	1300592	−	hypothetical protein
B624_1062	1300595	1300990	−	Hypothetical protein
B624_1063	1301196	1301867	−	phosphoglycerate mutase
B624_1064	1302020	1304008	+	Acyltransferase family domain protein
B624_1065	1304105	1304728	−	Ribosomal protein S4 and related proteins
B624_1066	1304930	1305895	−	ABC transporter, ATP-binding protein
B624_1067	1305900	1307114	−	ABC superfamily ATP binding cassette transporter,
				membrane protein
B624_1068	1307208	1307603	−	hypothetical protein
B624_1069	1307751	1310480	−	hypothetical protein
B624_1070	1310567	1311145	+	xanthine phosphoribosyltransferase
B624_1071	1311199	1312560	+	xanthine/uracil permease family protein
B624_1072	1312696	1312902	−	transcription regulator
B624_1073	1312912	1313169	−	hypothetical protein
B624_1074	1313326	1314144	−	hydrolase, alpha/beta fold family
B624_1075	1314432	1315367	+	hypothetical protein
B624_1076	1315462	1315860	−	glyoxalase family protein
B624_1077	1316019	1316630	+	Pyrazinamidase/nicotinamidase
B624_1078	1316885	1318360	+	Transcriptional regulator containing an HTH domain and
				an uncharacterized domain shared with the mammalian
				protein Schlafen
B624_1079	1318371	1319780	−	ABC-type multidrug transport system permease
				component
B624_1080	1319770	1321005	−	ABC-type multidrug transport system permease
				component
B624_1081	1321109	1322089	−	ABC-type multidrug transport system, ATPase component
B624_1082	1322475	1323824	+	Signal transduction histidine kinase
B624_1083	1323827	1324477	+	response regulator of two-component system
B624_1084	1324667	1325287	−	Phosphate transport regulator
B624_1085	1325308	1326357	−	phosphate transporter family protein
B624_1086	1326480	1326674	−	Uncharacterized small protein
B624_1087	1326735	1329131	−	carbon starvation protein A
B624_1088	1329376	1330668	+	alpha amylase
B624_1089	1330703	1331314	−	hypothetical protein
B624_1090	1331486	1333669	−	possible ATP-dependent RNA helicase
B624_1091	1334052	1335338	−	uracil-xanthine permease
B624_1092	1335446	1336273	−	Fructose-2,6-bisphosphatase
B624_1093	1336327	1336905	−	hypothetical protein
B624_1094	1337061	1337612	+	transcriptional regulator
B624_1095	1337738	1338898	−	virion core protein
B624_1096	1339275	1340816	−	hypothetical protein
B624_1097	1341250	1341687	+	hypothetical protein
B624_1098	1341752	1343449	+	serine/threonine protein kinase
B624_1099	1343493	1344980	−	efflux transporter protein
B624_1100	1345295	1347343	−	hypothetical protein
B624_1101	1347576	1347758	−	hypothetical protein
B624_1102	1347947	1348309	+	hypothetical protein
B624_1103	1348405	1349910	−	hypothetical protein
B624_1104	1349906	1351072	−	hypothetical protein
B624_1105	1351310	1351477	+	hypothetical protein
B624_1106	1351660	1352478	+	phosphoesterase or phosphohydrolase
B624_1107	1352565	1354004	+	hypothetical protein
B624_1108	1354223	1354612	+	hypothetical protein
B624_1109	1354729	1355193	+	hypothetical protein
B624_1110	1355496	1356380	−	hypothetical protein
B624_1111	1356380	1357450	−	Site-specific recombinase XerD
B624_1112	1357650	1358675	+	transposase
B624_1113	1358675	1359139	+	hypothetical protein
B624_1114	1359139	1359897	+	hypothetical protein
B624_1115	1360305	1361396	−	GTP-binding protein YchF
B624_1116	1361533	1362351	−	pyrroline-5-carboxylate reductase
B624_1117	1362416	1363891	−	proline iminopeptidase
B624_1118	1363977	1366433	+	histidine kinase sensor of two-component system
B624_1119	1366458	1367345	+	response regulator
B624_1120	1367384	1370233	−	transport protein
B624_1121	1370265	1371176	−	ABC-type antimicrobial peptide transport system, ATPase
				component
B624_1122	1371528	1372841	−	O-acetylhomoserine sulfhydrylase
B624_1123	1373315	1374184	+	pyridoxal kinase
B624_1124	1374553	1374924	+	endonuclease
B624_1125	1374983	1376515	+	Mg chelatase-related protein
B624_1126	1376515	1378212	+	DNA processing protein DprA
B624_1127	1378272	1380134	+	sdhA
B624_1128	1380233	1381195	+	Succinate dehydrogenase iron-sulfur protein
B624_1129	1381292	1381954	+	O-methyltransferase
B624_1130	1382006	1382944	−	Rossmann fold nucleotide-binding protein
B624_1131	1383180	1384595	−	clpx
B624_1132	1385070	1386485	−	ATP-dependent Clp protease, ATP-binding subunitClpX
B624_1133	1386610	1387308	−	ATP-dependent Clp protease, proteolytic subunit 2
B624_1134	1387317	1387937	−	ATP-dependent Clp protease, proteolytic subunit 1
B624_1135	1388046	1388423	−	hypothetical protein
B624_1136	1388538	1390001	−	voltage-gated chloride channel family protein
B624_1137	1390189	1391565	−	trigger factor
B624_1138	1391623	1392921	−	3-5 exonuclease domain protein
B624_1139	1392921	1393556	−	Permeases of the majorfacilitator superfamily
B624_1140	1393622	1394500	−	pyruvate formate-lyase 1 activating enzyme
B624_1141	1394613	1396985	−	formate acetyltransferase
B624_1142	1397254	1397520	−	hypothetical protein
B624_1143	1397531	1399225	−	NH(3)-dependent NAD synthetase
B624_1144	1399577	1400725	−	Peptidase, M20/M25/M40 family
B624_1145	1400817	1401500	−	permease protein of ABC transporter system
B624_1146	1401500	1402702	−	ABC transporter, ATP-binding protein
B624_1147	1402839	1403816	−	ABC-type transport system protein
B624_1148	1404020	1404847	+	hydrolase, haloacid dehalogenase-like family
B624_1149	1404975	1407449	−	D-xylulose 5-phosphate/D-fructose 6-
				phosphatephosphoketolase
B624_1150	1407895	1409454	+	GMP synthase
B624_1151	1409930	1410304	+	arsb1
B624_1152	1410328	1410720	+	arsenical resistance protein/arsenate reductase
B624_1154	1412111	1413136	+	transposase
B624_1155	1413136	1413600	+	possible Transposase
B624_1156	1413600	1414358	+	hypothetical protein
B624_1159	1416510	1417160	+	hypothetical protein
B624_1160	1417164	1418444	+	hypothetical protein
B624_1161	1418440	1418820	+	hypothetical protein
B624_1162	1419070	1420548	+	ATP-dependent Zn protease
B624_1163	1420727	1422598	+	lipopolysaccharide modification acyltransferase
B624_1164	1422690	1423706	+	prsA
B624_1165	1423991	1425370	+	nucleotidyl transferase
B624_1166	1425377	1425787	+	iojap-related protein
B624_1167	1425942	1426637	+	phosphoglycerate mutase
B624_1168	1427294	1428961	+	phosphate acetyltransferase
B624_1169	1429099	1429695	+	acetate kinase
B624_1170	1429718	1430326	+	Acetate kinase
B624_1171	1430503	1431837	−	3-phosphoshikimate 1-carboxyvinyltransferase
B624_1172	1431867	1433036	−	membrane protein
B624_1173	1433357	1433766	+	hypothetical protein
B624_1175	1434688	1436172	−	galactoside symporter
B624_1176	1436515	1439583	+	beta-galactosidase
B624_1178	1441301	1442047	−	hypothetical protein
B624_1179	1442167	1442559	−	hypothetical protein
B624_1180	1442574	1442990	−	hypothetical protein
B624_1183	1445667	1445948	+	hypothetical protein
B624_1184	1446119	1446796	+	hypothetical protein
B624_1185	1447254	1448801	+	DNA-cytosine methyltransferase
B624_1189	1452909	1453127	+	IS861, transposase OrfB
B624_1191	1453837	1455122	−	hypothetical protein
B624_1192	1455179	1455604	−	cell division protein FtsZ
B624_1193	1455752	1459864	−	DNA helicase/exodeoxyribonuclease V, subunit A
B624_1194	1459861	1463163	−	ATP-dependent nuclease, subunit B
B624_1195	1463295	1465928	−	DNA polymerase III, alpha subunit
B624_1196	1466012	1467055	+	hypothetical protein
B624_1197	1467089	1467952	−	ribonuclease BN
B624_1199	1468949	1469908	−	pseudouridylate synthase
B624_1200	1469911	1470456	−	lipoprotein signal peptidase
B624_1201	1470481	1471857	−	hypothetical protein
B624_1202	1472000	1472299	−	integral membrane protein
B624_1203	1472424	1472900	−	hypothetical protein
B624_1204	1472916	1474124	−	Tubulin/FtsZ family, C- terminal domain
B624_1205	1474239	1475480	−	tRNA-dihydrouridine synthase
B624_1206	1475628	1477097	−	glycyl-tRNA synthetase
B624_1207	1477533	1478474	+	hydroxyethylthiazole kinase
B624_1208	1478560	1481310	+	thiamine biosynthesis protein ThiE/ThiC
B624_1209	1481353	1481679	−	hypothetical protein
B624_1210	1481820	1482626	+	phosphomethylpyrimidine kinase
B624_1211	1482680	1483054	+	Uncharacterized protein
B624_1212	1483563	1484939	+	permease protein
B624_1213	1485207	1485515	+	hypothetical protein
B624_1214	1485571	1485978	+	hypothetical protein
B624_1215	1486039	1487433	+	Serpin (serine protease inhibitor) superfamily
B624_1216	1487480	1488517	+	transcriptional regulator, LacI family
B624_1217	1488734	1490068	+	oligosaccharide: H+ symporter
B624_1218	1490082	1491635	+	sucrose-6-phosphate hydrolase
B624_1219	1491833	1492612	+	ABC transporter, permease protein, cysTW family
B624_1220	1492876	1493943	+	pyrimidine precursor biosynthesis enzyme
B624_1221	1494070	1495254	+	inosine-uridine preferring nucleoside hydrolase
B624_1222	1495416	1496201	−	undecaprenyl diphosphate synthase
B624_1223	1496207	1496923	−	DNA repair protein RecO
B624_1224	1496975	1498684	−	Hydrolases of the alpha/beta superfamily
B624_1225	1498808	1500025	−	1-hydroxy-2-methyl-2-(E)-butenyl 4-diphosphatesynthase
B624_1226	1500028	1501215	−	1-deoxy-D-xylulose 5-phosphate reductoisomerase
B624_1227	1501215	1502915	−	Pyridoxine biosynthesis enzyme
B624_1228	1503387	1503800	−	hypothetical protein
B624_1229	1503919	1504797	−	PDZ domain family protein
B624_1230	1505018	1506760	+	hypothetical protein
B624_1231	1506836	1508407	−	ATP-dependent DNA helicase PcrA
B624_1232	1508553	1510205	+	aminoglycoside phosphotransferase
B624_1233	1510357	1510578	+	ATP-binding protein
B624_1234	1510645	1511535	−	PHP domain N-terminal region family
B624_1235	1511673	1512407	+	membrane protein
B624_1236	1512419	1513309	−	diaminopimelate epimerase
B624_1237	1513417	1514208	+	glutamate racemase
B624_1238	1514340	1515182	+	esterase-like protein
B624_1239	1515255	1516151	−	Membrane protease subunits, stomatin/prohibitin
B624_1242	1517316	1517573	+	transcriptional regulator
B624_1243	1517692	1517940	−	Glutaredoxin and related proteins
B624_1244	1518187	1519422	−	cystathionine beta-lyase
B624_1245	1519661	1520560	−	glutamine ABC transporter, periplasmicglutamine-
				binding protein (glnH)
B624_1246	1520629	1521417	−	amino acid ABC transporter, ATP-binding protein
B624_1247	1521413	1522084	−	amino acid ABC transporter, permease protein
B624_1248	1522074	1522730	−	amino acid ABC transporter, permease protein
B624_1249	1522958	1523605	+	Phospholipase/Carboxylesterase
B624_1250	1523620	1525872	−	Translation elongation factor
B624_1251	1526019	1526723	+	DNA polymerase III alpha subunit
B624_1252	1526731	1527318	−	guanylate kinase
B624_1253	1527501	1528418	−	orotidine 5′-phosphate decarboxylase
B624_1254	1528421	1531801	−	carbamoyl-phosphate synthase, large subunit
B624_1255	1531806	1533029	−	carbamoyl-phosphate synthase, small subunit
B624_1256	1533219	1533788	−	transcription antitermination factor NusB
B624_1257	1533846	1534409	−	Elongation factor P (EF-P)
B624_1258	1534514	1535248	+	ATP-binding protein of ABC transporter system
B624_1259	1535248	1536033	+	ABC type permease
B624_1260	1536066	1536770	−	ErfK/YbiS/YcfS/YnhG family protein
B624_1261	1536878	1539331	−	hypothetical protein
B624_1262	1539444	1540754	−	hypothetical protein
B624_1263	1541413	1543257	+	glycosyltransferase
B624_1264	1543710	1544741	−	3-hydroxybutyryl-CoA dehydrogenase
B624_1265	1544959	1546782	−	alpha-glucosidase
B624_1267	1547359	1549491	−	20 family glycoside hydrolase
B624_1268	1549605	1550417	−	ABC transporter, permease protein, MalFG family
B624_1270	1551035	1551862	+	hypothetical protein
B624_1271	1552142	1553254	−	mrp
B624_1272	1553434	1556193	−	DNA ligase, NAD-dependent
B624_1273	1556261	1559881	−	hypothetical protein
B624_1274	1559979	1562237	+	pmt family glycosyltransferase
B624_1275	1562375	1564141	+	hypothetical protein
B624_1276	1564204	1564986	−	ABC transporter, ATP-binding protein
B624_1277	1565037	1566299	−	aminotransferase, class I
B624_1278	1566573	1567337	−	ROK family protein
B624_1279	1567559	1568365	+	Nitroreductase family protein
B624_1280	1568413	1569423	−	glycosyltransferase
B624_1281	1569675	1570325	+	hypothetical protein
B624_1282	1570459	1572888	+	ABC transporter, ATP-binding protein
B624_1283	1572963	1573265	+	RNA-binding protein
B624_1284	1573370	1573732	−	hypothetical protein
B624_1285	1573842	1574456	+	hypothetical protein
B624_1286	1574885	1575301	+	hypothetical protein
B624_1287	1575432	1576415	−	D-isomer specific 2-hydroxyacid dehydrogenase family
				protein
B624_1288	1576714	1578168	+	drug resistance transporter, EmrB/QacA family
B624_1289	1578399	1579418	−	sugar ABC transporter permease
B624_1290	1579418	1580485	−	ribose ABC transporter, permease protein
B624_1291	1580490	1582028	−	ATP binding protein of ABC transporter
B624_1292	1582172	1583152	−	ribose ABC transporter, periplasmicD-ribose- binding
				protein
B624_1293	1583472	1585199	−	Lipoprotein lpqB
B624_1294	1585199	1586893	−	sensor histidine kinase MtrB
B624_1295	1586893	1587612	−	hypothetical protein
B624_1296	1587674	1589050	−	recombination factor protein RarA
B624_1297	1589136	1591700	−	DEAD box family helicase
B624_1298	1591837	1592907	−	hypothetical protein
B624_1299	1592976	1593215	−	hypothetical protein
B624_1300	1593208	1593801	−	5′-nucleotidase/2′,3′-cyclic phosphodiesterase and
				relatedesterases
B624_1301	1593841	1595379	−	hypothetical protein
B624_1302	1595471	1596568	−	glutamine ABC transporter, glutamine-
				bindingprotein/permease protein
B624_1303	1596577	1597251	−	glutamine ABC transporter, permease protein
B624_1304	1597254	1598090	−	amino acid ABC transporter, amino acid- bindingprotein
B624_1305	1598125	1598964	−	amino acid ABC transporter, ATP-binding protein
B624_1306	1599518	1600468	+	hypothetical protein
B624_1307	1600932	1602728	−	aspartyl-tRNA synthetase
B624_1308	1602767	1604164	−	histidyl-tRNA synthetase
B624_1309	1604264	1605721	+	hypothetical protein
B624_1310	1605933	1607723	−	5′-nucleotidase family protein
B624_1311	1607898	1608653	−	Amidase-like protein
B624_1312	1608742	1610115	−	proline/betaine transporter
B624_1313	1610308	1611807	−	Purine catabolism regulatory protein-like family
B624_1314	1611950	1613266	+	cytosine deaminase-like protein
B624_1315	1613452	1616058	−	ATP-dependent Clp protease, ATP-binding subunitClpC
B624_1316	1616208	1617170	+	Universal stress protein UspA and related nucleotide-
				binding proteins
B624_1317	1617288	1618472	−	hypothetical protein
B624_1318	1618484	1618870	−	cspB
B624_1319	1618943	1620790	−	baes1
B624_1320	1620965	1621693	−	winged helix family two component transcriptional
				regulator
B624_1321	1621689	1622492	−	hypothetical protein
B624_1322	1622567	1622854	+	hypothetical protein
B624_1323	1622957	1624579	−	chaperone
B624_1324	1624820	1625056	−	cold-shock domain family protein
B624_1325	1625289	1625969	−	hypothetical protein
B624_1326	1626085	1626771	+	uracil-DNA glycosylase
B624_1327	1626814	1627890	+	ATPase, MoxR family
B624_1328	1627890	1628837	+	Protein of unknown function family
B624_1329	1628840	1629388	+	hypothetical protein
B624_1330	1629388	1630443	+	Uncharacterized protein containing a von Willebrand
				factor type A (vWA) domain
B624_1331	1630443	1631471	+	hypothetical protein
B624_1332	1631471	1632070	+	cell surface elastin binding protein EbpS
B624_1333	1632316	1632660	+	hypothetical protein
B624_1334	1632660	1634261	+	hypothetical protein
B624_1335	1634531	1634893	+	hypothetical protein
B624_1336	1635034	1635672	−	hypothetical protein
B624_1337	1635805	1637238	+	adenylosuccinate lyase
B624_1338	1637373	1639931	+	hypothetical protein
B624_1339	1640080	1640358	+	DNA-binding protein HU
B624_1340	1640480	1641937	−	Pup-ligase protein
B624_1341	1641940	1642203	−	hypothetical protein
B624_1342	1642234	1643133	−	possible inositol monophosphatase
B624_1343	1643139	1644803	−	Proteasome component
B624_1344	1644828	1646390	−	rpt1
B624_1345	1646454	1647170	−	hypothetical protein
B624_1346	1647200	1647919	+	phosphoserine phosphatase SerB
B624_1347	1647962	1650271	+	primosomal protein N
B624_1348	1650333	1651034	+	alpha beta hydrolase
B624_1349	1651061	1652044	+	methionyl-tRNA formyltransferase
B624_1350	1652142	1653992	−	dihydroxy-acid dehydratase
B624_1351	1654203	1654484	+	DNA-directed RNA polymerase, omega subunit
B624_1352	1654765	1655982	+	S-adenosylmethionine synthetase
B624_1353	1667321	1667608	−	CRISPR-associated protein Cas2
B624_1354	1667697	1668725	−	CRISPR-associated protein Cas1
B624_1355	1668725	1669423	−	CRISPR-associated protein Cas4
B624_1356	1669465	1670313	−	CRISPR-associated protein, Csh2 family protein
B624_1357	1670320	1672275	−	CRISPR-associated RAMP Csd1 family protein
B624_1358	1672281	1672982	−	CRISPR-associated protein, CT1134 family
B624_1359	1672992	1675427	−	CRISPR-associated helicase Cas3
B624_1361	1677053	1680361	−	isoleucyl-tRNA synthetase
B624_1362	1680955	1682163	+	maly2
B624_1363	1682280	1683785	−	melb1
B624_1364	1684111	1687299	+	lacz1
B624_1365	1687365	1688372	−	lacr-type transcription regulator
B624_1366	1688522	1689964	−	major facilitator superfamily mfs_1
B624_1367	1690007	1690906	−	Ribokinase
B624_1368	1690909	1692111	−	alcohol dehydrogenase, iron-containing
B624_1369	1692111	1692794	−	Phosphoglycolate phosphatase
B624_1370	1692921	1693901	−	inosine-uridine preferring nucleoside hydrolase
B624_1371	1693960	1694913	−	Fructokinase
B624_1372	1694909	1695553	−	N-(5′phosphoribosyl)anthranilateisomerase
B624_1373	1695603	1696415	−	ABC transporter, ATP-binding protein
B624_1374	1696415	1697242	−	hypothetical protein
B624_1375	1697246	1698055	−	Cobalt transport protein
B624_1376	1698062	1698712	−	hypothetical protein
B624_1377	1698969	1700846	+	hypothetical protein
B624_1378	1700977	1702989	−	ABC transporter, ATP-binding/permease protein
B624_1379	1702989	1704944	−	ABC transporter, ATP-binding protein
B624_1380	1704944	1705474	−	transcriptional regulator, MarR family
B624_1382	1707015	1708349	−	bglc
B624_1383	1708509	1710902	−	bglx2
B624_1385	1711383	1712657	−	glutamate--cysteine ligase
B624_1386	1713223	1718037	+	domain protein
B624_1387	1718044	1718883	+	hypothetical protein
B624_1388	1719052	1724187	−	Activator of 2-hydroxyglutaryl-CoA dehydratase
B624_1389	1724418	1725143	−	anaerobic ribonucleoside-triphosphate reductaseactivating
				protein
B624_1390	1725294	1727699	−	anaerobic ribonucleoside-triphosphate reductase
B624_1391	1728167	1729534	+	exodeoxyribonuclease VII, large subunit
B624_1392	1729587	1729886	+	exodeoxyribonuclease VII, small subunit
B624_1393	1730013	1730534	+	NADP(H) oxidoreductase
B624_1394	1730676	1732538	−	long-chain-fatty-acid--CoA ligase
B624_1395	1732765	1733166	−	Large-conductance mechanosensitivechannel, MscL
B624_1396	1733337	1733762	−	Nucleoside deoxyribosyltransferase
B624_1397	1733887	1734102	−	Histone acetyltransferaseHPA2 and related
				acetyltransferases
B624_1398	1734587	1735696	+	hypothetical protein
B624_1399	1735718	1736683	−	exopolyphosphatase
B624_1400	1736864	1738084	−	probable aspartate aminotransferase
B624_1401	1738178	1739230	+	oxidoreductase, Gfo/Idh/MocA family
B624_1402	1739267	1739779	−	patch repair protein
B624_1403	1739862	1740377	+	acetyltransferase, GNAT family
B624_1404	1740356	1740841	−	hypothetical protein
B624_1405	1741026	1745207	−	helicase, Snf2 family
B624_1406	1745285	1746367	+	DeoR-type transcriptional regulator
B624_1407	1746604	1747620	+	tetrahydrodipicolinate N-succinyltransferase(dapD)
B624_1408	1747840	1749129	−	citrate synthase I
B624_1409	1749406	1750185	−	methionine aminopeptidase, type I
B624_1410	1750378	1751355	−	membrane protein
B624_1411	1751532	1753703	+	Peptidase M13, neprilysin
B624_1412	1753792	1754526	−	single-stranded DNA-binding protein (ssb)subfamily
B624_1413	1754805	1756646	−	prolyl-tRNA synthetase
B624_1415	1757392	1758561	−	pflA
B624_1416	1758551	1760338	−	Protein of unknown function family
B624_1417	1760391	1761806	−	TPR domain protein
B624_1418	1761858	1762505	−	oligoribonuclease
B624_1419	1762676	1764226	−	inosine-5′-monophosphate dehydrogenase
B624_1420	1764282	1765562	−	Phospho-N-acetylmuramoyl-pentapeptide-transferase
B624_1421	1765562	1766233	−	Sua5/YciO/YrdC/YwlC family protein
B624_1422	1766408	1767082	+	Acetyltransferase
B624_1423	1767220	1767921	−	branched-chain amino acid ABC transporter, ATP- binding
				protein
B624_1424	1767924	1768781	−	branched chain amino acid ABC transporter, ATP- binding
				protein
B624_1425	1768781	1769866	−	branched-chain amino acid ABC transporter, permease
				protein
B624_1426	1769874	1770797	−	branched-chain amino acid ABC transporter, permease
				protein
B624_1427	1771042	1772226	−	branched-chain amino acid ABC transporter, aminoacid-
				binding protein
B624_1428	1772502	1773407	−	HemK family modification methylase
B624_1429	1773473	1774558	−	peptide chain release factor 1
B624_1430	1774715	1774924	−	ribosomal protein L31
B624_1431	1775256	1776482	−	transcription regulator ROK family
B624_1432	1776702	1778219	+	xylulokinase
B624_1433	1778416	1778760	+	hypothetical protein
B624_1434	1778773	1779114	+	hypothetical protein
B624_1436	1779656	1780930	−	transposase, Mutator family
B624_1437	1781199	1782545	−	xylose isomerase
B624_1440	1783425	1784222	−	hypothetical protein
B624_1441	1785149	1785565	−	polypeptide deformylase
B624_1442	1785576	1786421	−	2,5-diketo-D-gluconic acid reductase
B624_1444	1787291	1787791	−	MarR-type transcriptional regulator
B624_1445	1787998	1788333	−	hypothetical protein
B624_1446	1788358	1789572	−	ABC-type xylose transport system, permease component
B624_1447	1789575	1791125	−	ABC-type xylose transport system ATPase component
B624_1448	1791229	1792383	−	ABC-type xylose transport system periplasmic component
B624_1449	1792635	1793801	+	ROK family protein
B624_1450	1793842	1794705	+	sugar ABC transporter, ATP-binding protein
B624_1451	1794736	1795683	−	glucokinase
B624_1452	1796516	1798192	+	ATP binding protein of ABC transporter
B624_1453	1798507	1799409	+	acyl-CoA thioesterase II
B624_1454	1799511	1800035	−	hypothetical protein
B624_1455	1800213	1801622	−	dihydroneopterin aldolase
B624_1456	1801736	1802608	−	dihydropteroate synthase
B624_1457	1802699	1803295	−	GTP cyclohydrolase I
B624_1458	1803391	1805478	−	cell division protein FtsH
B624_1459	1805478	1806038	−	hypoxanthine phosphoribosyltransferase
B624_1460	1806028	1807191	−	ATPase
B624_1461	1807285	1808772	−	D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-
				alanine-endopeptidase
B624_1462	1808798	1810468	−	hypothetical protein
B624_1463	1810468	1811421	−	ATP-binding protein of ABC transporter system
B624_1464	1811519	1812739	−	glycosyl transferase domain protein
B624_1465	1812742	1814253	−	hypothetical protein
B624_1466	1814329	1815252	+	glycosyltransferase for cell wall membrane
B624_1467	1815481	1816629	−	Lactaldehyde reductase
B624_1468	1817069	1818370	+	cyclopropane-fatty-acyl-phospholipid synthase
B624_1469	1818482	1819687	+	Permeases of the majorfacilitator superfamily
B624_1470	1820205	1821215	−	UDP-glucose 4-epimerase
B624_1471	1821543	1822400	+	methyltransferase
B624_1472	1822698	1823195	−	hypothetical protein
B624_1473	1823244	1823708	−	hypothetical protein
B624_1474	1823795	1824079	+	hypothetical protein
B624_1475	1825086	1826453	−	hypothetical protein
B624_1476	1827699	1828901	−	Phage integrase family
B624_1477	1829429	1830229	+	azlC protein
B624_1478	1830229	1830558	+	branched-chain amino acid permease
B624_1479	1830743	1831258	−	phosphotyrosine protein phosphatase
B624_1480	1831385	1832044	−	dihydrofolate reductase
B624_1481	1832157	1833026	−	thymidylate synthase
B624_1482	1833154	1833564	+	hypothetical protein
B624_1483	1833629	1834663	−	Universal stress protein UspA and related nucleotide-
				binding proteins
B624_1484	1834835	1835572	−	P60 extracellular protein, invasion associatedprotein Iap
B624_1485	1835733	1836476	−	NLP/P60 family domain protein
B624_1486	1836692	1837645	−	Surface antigen
B624_1487	1838039	1839178	+	phosphoserine aminotransferase
B624_1488	1839305	1839562	+	hypothetical protein
B624_1489	1839693	1840883	−	sensor histidine kinase
B624_1490	1841074	1841745	+	phosphate transport system regulatory proteinPhoU
B624_1491	1842110	1842847	−	phosphoglycerate mutase
B624_1492	1842910	1843872	−	1,4-dihydroxy-2-naphthoateoctaprenyltransferase
B624_1493	1843937	1845616	−	lysyl-tRNA synthetase
B624_1494	1846117	1847304	+	AraJ-like protein probably involvedin transport of
				arabinose polymers
B624_1495	1847394	1849754	+	TPR Domain domain protein
B624_1496	1849833	1850462	+	hypothetical protein
B624_1497	1850618	1852216	−	hypothetical protein
B624_1498	1852325	1853062	−	hypothetical protein
B624_1499	1853062	1854780	−	Hypothetical protein
B624_1500	1854894	1856174	+	histidine protein kinase
B624_1501	1856174	1856866	+	transcription regulator, LuxR family
B624_1502	1856920	1857939	−	UDP-glucose 4-epimerase
B624_1503	1858012	1859556	−	galactose-1-phosphate uridylyltransferase
B624_1504	1859606	1860682	−	aminoglycoside phosphotransferase
B624_1505	1860713	1862965	−	lacto-n-biose phosphorylase
B624_1506	1863426	1864382	−	sugar ABC transporter, permease protein
B624_1507	1864382	1865350	−	MalF-type ABC sugar transport systems permease
				component
B624_1508	1865546	1866859	−	solute binding protein of ABC transporter forsugars
B624_1509	1867217	1867369	−	hypothetical protein
B624_1510	1867867	1869150	−	seryl-tRNA synthetase
B624_1511	1869384	1870562	+	Diacylglycerol kinase catalytic domain(presumed) protein
B624_1512	1870573	1871409	−	transcription antiterminator, BglG family
B624_1513	1871430	1873829	−	PTS system component
B624_1514	1874293	1875843	+	major facilitator family transporter
B624_1515	1875934	1877607	+	phosphoglucomutase, alpha-D-glucosephosphate- specific
B624_1516	1878343	1879437	−	hypothetical protein
B624_1517	1879668	1880087	+	BadM/Rrf2 family transcriptional regulator
B624_1518	1880224	1881837	+	Pyridine nucleotide-disulphide oxidoreductase family
				protein
B624_1519	1882380	1883360	+	RNase H
B624_1520	1883494	1884189	+	ribose 5-phosphate isomerase
B624_1521	1884629	1885258	−	hypothetical protein
B624_1522	1885386	1886921	+	DNA repair protein RadA
B624_1523	1886942	1888063	−	riboflavin biosynthesis protein RibF
B624_1524	1888164	1889324	−	tRNA pseudouridine synthase B
B624_1525	1889329	1889799	−	ribosome-binding factor A
B624_1526	1889953	1892877	−	translation initiation factor IF-2
B624_1527	1893150	1894214	−	transcription elongation factor
B624_1528	1894356	1895147	+	lipoprotein
B624_1529	1895194	1896234	−	LacI-type transcriptional regulator
B624_1530	1896770	1897951	−	Alpha-L-arabinofuranosidase
B624_1531	1897936	1898334	−	Alpha-L-arabinofuranosidase
B624_1532	1899147	1899944	−	Transglutaminase-like superfamily domain protein
B624_1533	1900154	1902331	−	Domain of unknown function (DUF404) family
B624_1534	1902601	1903515	+	tRNA pseudouridine synthase I
B624_1535	1903603	1904142	−	ribosomal protein L17
B624_1536	1904245	1905237	−	RNA polymerases L/13 to 16 kDa subunit
B624_1537	1905321	1905716	−	ribosomal protein S11
B624_1538	1905807	1906181	−	ribosomal protein S13p/S18e
B624_1539	1906333	1906443	−	ribosomal protein L36
B624_1540	1906470	1906685	−	translation initiation factor IF-1
B624_1541	1906865	1907422	−	adenylate kinase
B624_1542	1907595	1908929	−	preprotein translocase, SecY subunit
B624_1543	1909207	1909656	−	ribosomal protein L15
B624_1544	1909662	1909844	−	ribosomal protein L30
B624_1545	1909853	1910551	−	ribosomal protein S5
B624_1546	1910581	1910949	−	ribosomal protein L18
B624_1547	1910954	1911490	−	ribosomal protein L6
B624_1548	1911511	1911906	−	ribosomal protein S8
B624_1549	1911999	1912181	−	ribosomal protein S14p/S29e
B624_1550	1912186	1912755	−	ribosomal protein L5
B624_1551	1912755	1913087	−	ribosomal protein L24
B624_1552	1913092	1913457	−	ribosomal protein L14
B624_1553	1913555	1913812	−	ribosomal protein S17
B624_1554	1913818	1914066	−	ribosomal protein L29
B624_1555	1914069	1914485	−	ribosomal protein L16
B624_1556	1914495	1915295	−	ribosomal protein S3
B624_1557	1915301	1915657	−	ribosomal protein L22
B624_1558	1915677	1915952	−	ribosomal protein S19
B624_1559	1915971	1916798	−	ribosomal protein L2
B624_1560	1916838	1917131	−	ribosomal protein L23
B624_1561	1917140	1917793	−	ribosomal protein L4/L1 family
B624_1562	1917803	1918441	−	ribosomal protein L3
B624_1563	1918461	1918766	−	ribosomal protein S10
B624_1564	1918999	1920027	+	hypothetical protein
B624_1565	1920366	1923092	−	PutA2
B624_1566	1923607	1924797	+	probable repressor in the Rok (NagC/XylR)family
B624_1567	1924797	1927334	+	glycogen operon protein GlgX
B624_1568	1927431	1927919	−	ribosomal protein S9
B624_1569	1927945	1928391	−	ribosomal protein L13
B624_1570	1928792	1930954	−	4-alpha-glucanotransferase
B624_1571	1931125	1931865	−	Leucine rich repeat variant
B624_1572	1931876	1932514	−	hypothetical protein
B624_1573	1932579	1933592	−	possible 2-hydroxyacid dehydrogenase
B624_1574	1933669	1935009	−	capA protein
B624_1575	1935547	1936491	−	Permease protein
B624_1576	1936720	1937991	+	DNA-damage-inducible protein P
B624_1577	1938024	1939256	−	aminotransferase
B624_1578	1939374	1939691	−	fdxC
B624_1579	1939755	1941278	−	possible cationic amino acid transporter
B624_1580	1941433	1942653	−	UDP-N-acetylenolpyruvoylglucosamine reductase
B624_1581	1942930	1943094	−	ribosomal protein L33
B624_1582	1943529	1944245	+	cystathionine gamma lyase
B624_1583	1944924	1945214	−	chaperonin, 10 kDa
B624_1584	1945390	1946811	−	hypothetical protein
B624_1585	1946895	1947557	−	possible acetytransferase
B624_1586	1947644	1948360	+	5-formyltetrahydrofolate cyclo-ligase- relatedprotein
B624_1587	1948527	1948709	+	hypothetical protein
B624_1588	1948950	1949516	+	cation transport ATPase
B624_1589	1949617	1949814	−	hypothetical protein
B624_1590	1949820	1953440	−	hypothetical protein
B624_1591	1953452	1954999	−	hypothetical protein
B624_1592	1955200	1955577	−	ribosomal protein L7/L12
B624_1593	1955689	1956207	−	ribosomal protein L10
B624_1594	1956479	1957306	−	hypothetical protein
B624_1595	1957561	1958952	+	Permease protein
B624_1596	1959385	1962123	−	polyribonucleotide nucleotidyltransferase
B624_1597	1962444	1962710	−	ribosomal protein S15
B624_1598	1962882	1963562	−	hypothetical protein
B624_1599	1964088	1966964	−	possible extracellular exo-xylanase
B624_1600	1967190	1969712	−	endo-1,4-beta-xylanase D
B624_1601	1970329	1971432	+	IS30 family, transposase [imported]
B624_1602	1971591	1972274	−	Membrane protein involved in the export of O-antigen and
				teichoic acid
B624_1603	1972411	1973088	−	hypothetical protein
B624_1604	1973553	1974794	−	Large exoproteins involved in heme utilization or
				adhesion
B624_1605	1974994	1977441	−	von Willebrand factor type A domain protein
B624_1606	1978150	1978326	−	hypothetical protein
B624_1607	1978353	1978898	−	phosphopantethiene protein transferase
B624_1608	1979459	1988974	−	Fatty acid synthase
B624_1609	1989016	1990635	−	propionyl-CoA carboxylase, beta chain
B624_1610	1990631	1992592	−	Acetyl-/propionyl-CoA carboxylase alpha chain
B624_1611	1993105	1993701	+	B624_oY protein
B624_1612	1993739	1994710	−	B624_otin--acetyl-CoA-carboxylase ligase
B624_1613	1994874	1996895	+	hypothetical protein
B624_1614	1996904	1997731	+	hypothetical protein
B624_1615	1997829	1998578	−	transcriptional regulator
B624_1616	1998629	1999459	−	transcriptional regulator, IclRfamily
B624_1617	2011797	2012486	−	ribosomal protein L1
B624_1618	2012505	2012933	−	ribosomal protein L11
B624_1619	2013199	2014089	−	transcription termination/antitermination factorNusG
B624_1620	2014122	2014346	−	preprotein translocase SecE subunit
B624_1621	2014593	2015795	−	aspartate aminotransferase [imported]
B624_1622	2015889	2017019	−	spo0B-associated GTP-binding protein
B624_1623	2017023	2018711	−	GTP-binding protein
B624_1624	2018783	2019028	−	ribosomal protein L27
B624_1625	2019054	2019359	−	ribosomal protein L21
B624_1626	2019502	2022534	−	ribonuclease, Rne/Rng family
B624_1627	2022850	2024052	−	succinyl-diaminopimelate desuccinylase
B624_1628	2024159	2025100	+	auxin efflux carrier
B624_1629	2025282	2026727	−	permease protein
B624_1630	2026727	2027818	−	ABC transporter, ATP-binding protein
B624_1631	2027996	2029441	−	Maf-like protein
B624_1632	2029581	2030690	−	homoserine kinase
B624_1633	2030800	2032113	−	homoserine dehydrogenase
B624_1634	2032276	2033865	−	diaminopimelate decarboxylase
B624_1635	2033871	2035730	−	arginyl-tRNA synthetase
B624_1636	2035944	2036606	+	AcrR-type transcriptional regulator
B624_1637	2036606	2037880	+	permease
B624_1638	2037970	2038899	+	LysR-type transcriptional regulator
B624_1639	2038996	2040246	+	probable aminotransferase
B624_1640	2040298	2041620	−	UDP-N-acetylglucosamine1-carboxyvinyltransferase
B624_1641	2041869	2043212	+	NADH oxidase
B624_1642	2043424	2044548	−	dihydroorotate dehydrogenase family protein
B624_1643	2044591	2046273	−	CAAX amino terminal protease family proteinfamily
B624_1644	2046594	2047283	−	3-isopropylmalate dehydratase small subunit
B624_1645	2047369	2048769	−	3-isopropylmalate dehydratase, large subunit
B624_1646	2049063	2049860	+	transcriptional regulator, IclR family
B624_1647	2050021	2051391	−	Phosphohydrolases
B624_1648	2051896	2054130	+	polyphosphate kinase
B624_1649	2054291	2055487	+	Phosphohistidine phosphatase SixA
B624_1650	2055627	2056298	+	hypothetical protein
B624_1651	2056564	2057871	−	hypothetical protein
B624_1652	2058175	2058813	+	uracil phosphoribosyltransferase
B624_1653	2058864	2059340	+	hypothetical protein
B624_1654	2059542	2060648	−	Glycerophosphoryl diester phosphodiesterase
B624_1655	2060677	2061747	−	Glutamyl-tRNA synthetase 1
B624_1656	2061933	2064599	−	ATP-dependent Clp protease, ATP-binding subunitClpB
B624_1657	2064821	2066377	−	histidine ammonia-lyase
B624_1658	2066617	2067489	+	transcriptional regulator, IclR family
B624_1659	2067489	2067662	+	hypothetical protein
B624_1660	2067741	2068559	−	Fumarylacetoacetate hydrolase family protein
B624_1661	2068665	2069906	−	hypothetical protein
B624_1662	2070097	2071272	−	UDP-galactopyranose mutase
B624_1663	2071555	2072670	+	dTDP-glucose 4,6-dehydratase
B624_1664	2072827	2074311	+	hypothetical protein
B624_1665	2074307	2075068	+	hypothetical protein
B624_1667	2075763	2076530	−	IS1533, OrfB
B624_1668	2076530	2077987	−	Transposase and inactivated derivatives
B624_1669	2078280	2079218	−	glycosyltransferase
B624_1670	2079313	2079666	−	sialic acid-specific9-O-acetylesterase
B624_1671	2080049	2081173	+	Acyltransferase family
B624_1672	2081181	2082893	−	hypothetical protein
B624_1673	2082902	2085928	−	Glycosyltransferase family A
B624_1674	2085935	2087170	−	glycosyl transferase, group 2family protein
B624_1675	2087259	2088509	−	polysaccharide ABC transporter, ATP- binding protein
B624_1676	2088515	2089351	−	polysaccharide ABC transporter, permease protein
B624_1677	2089580	2091367	+	Glycosyl transferase family 8
B624_1678	2091457	2092698	−	UDP-glucose 6-dehydrogenase
B624_1679	2092974	2093636	+	dTDP-glucose 4,6-dehydratase
B624_1680	2093654	2094844	−	o-acetyltransferase
B624_1681	2094847	2097099	−	hypothetical protein
B624_1682	2097441	2098844	+	antimicrobial peptide ABC superfamily ATP binding
				cassette transporter, permease protein
B624_1683	2098844	2099962	+	salx-type abc antimicrobial peptide transport system
				atpase component
B624_1684	2100089	2100790	+	HD superfamily hydrolase
B624_1685	2100871	2101728	−	hypothetical protein
B624_1686	2101825	2104335	−	kup3
B624_1687	2104481	2105437	−	hydrolase, TatD family
B624_1688	2105717	2106784	+	Fic protein family family
B624_1689	2106816	2108621	−	ABC transporter, ATP-binding/permease protein
B624_1690	2108635	2110542	−	ABC transporter, ATP-binding/permease protein
B624_1691	2111297	2112703	−	alpha-galactosidase
B624_1692	2113077	2114231	+	transcriptional regulator, LacI family
B624_1693	2114409	2115356	−	probable AraC/XylS-type transcriptionalregulator
B624_1694	2115401	2117626	−	Hypothetical protein
B624_1695	2117851	2119374	+	aminopeptidase C
B624_1696	2119555	2120628	+	hypothetical protein
B624_1697	2120701	2121335	+	hypothetical protein
B624_1698	2121673	2123535	−	methionyl-tRNA synthetase
B624_1699	2123873	2124496	+	hypothetical protein
B624_1700	2124496	2124864	+	hypothetical protein
B624_1701	2124897	2125904	−	hypothetical protein
B624_1702	2126487	2127902	−	possible symporter
B624_1703	2127984	2129027	+	thiamine biosynthesis lipoprotein ApbE
B624_1704	2129186	2131012	−	ABC transporter, ATP-binding/permease protein
B624_1705	2131231	2133099	−	ABC transporter, ATP-binding/permease protein
B624_1706	2133289	2133807	−	transcriptional regulator, MarR family
B624_1708	2135008	2138841	−	Glycosyl hydrolases family
B624_1709	2139209	2143594	−	hypothetical protein
B624_1710	2143901	2145394	−	ATP-dependent DNA helicase recG
B624_1711	2145737	2147257	−	amino acid permease
B624_1712	2147448	2151185	−	permease protein
B624_1713	2151199	2151897	−	ABC transporter, ATP-binding protein
B624_1714	2152041	2152607	+	probable TetR-like transcriptional regulator
B624_1715	2152832	2154310	+	aromatic amino acid transport protein AroP
B624_1716	2154575	2155774	+	transposase IS116/IS110/IS902 family protein
B624_1717	2155961	2160952	−	Glycosyl hydrolases family 43
B624_1718	2161359	2164649	−	Glycosyl hydrolases family 43
B624_1719	2164997	2168191	−	possible arabinosidase
B624_1720	2168529	2169131	−	hypothetical protein
B624_1721	2169340	2170179	−	sugar ABC transporter, permease protein
B624_1722	2170182	2171033	−	sugar ABC transporter, permease protein
B624_1723	2171416	2172429	+	transcription regulator, LacI family
B624_1724	2172690	2174015	−	possible solute binding protein of ABCtransporter
B624_1725	2174424	2175134	−	phosphoglycerate mutase
B624_1726	2175226	2175600	+	hypothetical protein
B624_1727	2175786	2176550	+	nitroreductase family protein
B624_1728	2176846	2179572	+	hypothetical protein
B624_1729	2179572	2181908	+	hypothetical protein
B624_1730	2182027	2182278	−	hypothetical protein
B624_1731	2188511	2189263	+	regulatory protein, SIR2 family
B624_1732	2189415	2190677	−	threonine dehydratase
B624_1733	2190928	2192745	−	alpha-glucosidase
B624_1734	2192872	2194731	−	alpha-galactosidase
B624_1735	2194766	2196433	−	Glucosidase
B624_1736	2196537	2197364	−	ABC transporter permease protein
B624_1737	2197364	2198320	−	MalF-type ABC sugar transport systems permease
				component
B624_1738	2198408	2199730	−	MalE-type ABC sugar transport system periplasmic
				component
B624_1739	2199980	2201095	−	hypothetical protein
B624_1740	2201159	2202484	−	sugar ABC superfamily ATP binding cassette transporter,
				substrate binding protein
B624_1741	2202692	2203717	+	LacI-type transcription regulator
B624_1742	2203838	2204854	+	LacI-type transcriptional regulator
B624_1743	2204919	2205782	−	sugar ABC transporter, permease protein
B624_1744	2205804	2206730	−	sugar ABC transporter, permease protein
B624_1745	2206755	2208041	−	sugar ABC transporter, sugar-binding protein
B624_1746	2208215	2209420	+	NagC/XylR-type transcriptional regulator
B624_1747	2209591	2211894	−	alpha-galactosidase
B624_1748	2212017	2212463	−	cytidine and deoxycytidylate deaminase
B624_1749	2212589	2214658	+	Na/H antiporter
B624_1750	2214858	2215613	−	Esterase protein
B624_1751	2215735	2216592	−	hypothetical protein
B624_1752	2216949	2217527	+	deoxycytidine triphosphate deaminase
B624_1753	2217593	2219320	+	hypothetical protein
B624_1754	2219543	2222527	−	calcium-transporting ATPase
B624_1755	2222713	2223582	−	protein probably involved in xylan degradation, possible
				xylan esterase
B624_1756	2223622	2224932	−	hypermease of the major facilitator superfamily protein
B624_1757	2225005	2225994	+	RNA methyltransferase, TrmH family, group 3
B624_1758	2226107	2227501	−	lipopolysaccharide kinase
B624_1759	2227740	2228864	−	ATP binding protein of ABC transporter for sugars
B624_1760	2229226	2230419	−	glycosyl transferase domain protein
B624_1761	2230486	2231475	−	Ribonucleotide reductase, beta subunit
B624_1762	2231704	2233896	−	ribonucleoside-diphosphate reductase, alphasubunit
B624_1763	2234015	2234470	−	nrdI protein
B624_1764	2234470	2234733	−	Glutaredoxin
B624_1765	2235324	2235971	−	Transcriptional regulators
B624_1766	2235958	2236635	−	Ribosomal protein L1
B624_1767	2236828	2237592	+	ion transporter
B624_1768	2237788	2238891	+	hypothetical protein
B624_1769	2239035	2239400	−	Beta-glucosidase-related glycosidases
B624_1770	2239837	2241951	+	Serine/threonine protein kinase
B624_1771	2242132	2243106	+	hypothetical protein
B624_1772	2243633	2245111	+	G5 domain protein
B624_1773	2245147	2246067	+	dimethyladenosine transferase
B624_1774	2246067	2247014	+	kinase, GHMP family, group 2
B624_1775	2247064	2247690	+	hypothetical protein
B624_1776	2247781	2249193	−	pcnA
B624_1777	2249280	2250569	+	NUDIX domain protein
B624_1778	2250569	2252836	+	hypothetical protein
B624_1779	2252836	2254560	+	Hypothetical protein
B624_1780	2254646	2256706	+	hypothetical protein
B624_1781	2256829	2257845	+	thioredoxin reductase
B624_1782	2258158	2259516	−	chromosome partitioning protein ParB
B624_1783	2259519	2260487	−	Soj family protein
B624_1784	2260741	2261403	−	methyltransferase GidB
B624_1785	2261558	2262088	−	R3H domain protein
B624_1786	2262215	2263219	−	inner membrane insertion protein
B624_1787	2263219	2263533	−	hypothetical protein
B624_1788	2263533	2263889	−	ribonuclease P protein component
B624_1789	2263925	2264056	−	ribosomal protein L34

The Open reading frames (ORF) listed in Table 1 are defined by their position in the genomic sequence of SEQ ID No. 1. For example B624_0001 is defined by the nucleotide sequence of base numbers 1 and 1500 (inclusive) of SEQ ID No. 1.

EXAMPLES

The following examples further describe and demonstrate embodiments within the scope of the invention. The examples are given solely for the purpose of illustration and are not to be construed as limitations of the present invention, as many variations thereof are possible without departing from the spirit and scope of the invention.

Example 1—Isolation of Bifidobacterium longum 35624

Appendices and sections of the large and small intestine of the human G.I.T., obtained during reconstructive surgery, were screened for probiotic bacterial strains. All samples were stored immediately after surgery at −80° C. in sterile containers. Frozen tissues were thawed, weighed and placed in cysteinated (0.05%) one quarter strength Ringers' solution. Each sample was gently shaken to remove loosely adhering microorganisms. Following transfer to a second volume of Ringers' solution, the sample was vortexed for 7 min to remove tightly adhering bacteria. In order to isolate tissue embedded bacteria, samples were also homogenised in a Braun blender. The solutions were serially diluted and spread-plated (100 μl) on to the following agar media: RCM (reinforced clostridial media) and RCM adjusted to pH 5.5 using acetic acid; TPY (trypticase, peptone and yeast extract), Chevalier, P. et al. (1990). MRS (deMann, Rogosa and Sharpe); ROG (acetate medium (SL) of Rogosa); LLA (Liver-lactose agar of Lapiere); BHI (brain heart infusion agar); LBS (Lactobacillus selective agar) and TSAYE (tryptone soya agar supplemented with 0.6% yeast extract). All agar media was supplied by Oxoid Chemicals with the exception of TPY agar. Plates were incubated in anaerobic jars (BBL, Oxoid) using CO₂ generating kits (Anaerocult A, Merck) for 2-5 days at 37° C.

Gram positive, catalase negative rod-shaped or bifurcated/pleomorphic bacteria isolates were streaked for purity on to complex non-selective media (TPY). Isolates were routinely cultivated in TPY medium unless otherwise stated at 37° C. under anaerobic conditions. Presumptive Bifidobacteria species were stocked in 40% glycerol and stored at −20° and −80° C.

Approximately fifteen hundred catalase negative bacterial isolates from different samples were chosen and characterised in terms of their Gram reaction, cell size and morphology, growth at 15° C. and 45° C. and fermentation end-products from glucose. Greater than sixty percent of the isolates tested were Gram positive, homofermentative cocci arranged either in tetrads, chains or bunches. Eighteen percent of the isolates were Gram negative rods and heterofermentative coccobacilli.

The remaining isolates (twenty-two percent) were predominantly homofermentative coccobacilli. Thirty eight strains were characterised in more detail. All thirty eight isolates tested negative both for nitrate reduction and production of indole from tryptophan.

Bifidobacterium longum 35624 was chosen for full genome sequencing from this group of strains due to its proven anti-inflammatory activity in murine models of colitis (McCarthy et.al., 2004) and its immunomodulatory effects following oral consumption by Irritable Bowel Syndrome (IBS) patients (O'Mahony et al., 2005).

Example 2—Sequencing the Genome of Bifidobacterium longum 35624

Chromosomal DNA from bifidobacteria was isolated as previously described (O'Riordan and Fitzgerald, 1998). The genome sequence of 35624 was sequenced using a Roche 454 FLX Titanium instrument by the commercial sequencing service providers Agencourt Bioscience (Beverly, Mass.) and Eurofins MWG Operon (Germany) and then assembled, after which remaining gaps were closed using Sanger Sequencing of PCR products. Sequence reads were initially assembled using Phred (Ewing and Green, 1998; Ewing et al., 1998), Phrap (P. Green, University of Washington), RepeatMasker (AFA. Smit, R. Hubley, & P. Green) and the Staden software package (Staden et al., 2000). Final assembly of 35624 was verified using Newbler v 2.3. The accession number for the 35624 genome sequence is CP013673.

Example 3—Analysing the Genome of Bifidobacterium longum 35624

Prediction of putative open reading frames (ORFs) was performed using PRODIGAL prediction software and supported by BLASTX [58] alignments. Results of Prodigal/BLASTX were combined manually and a preliminary identification of ORFs was performed on the basis of BLASTP analysis against a non-redundant protein database provided by the National Centre for Biotechnology. Using the ORF finding outputs and associated BLASTP results, Artemis (Rutherford et al., 2000) was employed for visualisation and manual editing in order to verify, and if necessary, redefine the start of every predicted coding region, or to remove or add coding regions. The assignment of protein function to predicted coding regions was performed manually. In addition, the individual members of the revised gene/protein data set were searched against the protein family (Pfam) (Punta et al., 2012) and COG (Tatusov et aL, 2000)COG databases. Ribosomal RNA (rRNA) and transfer RNA (tRNA) genes were detected using RNAMMER and tRNA-scanSE, respectively.

Example 4—Identifying Unique Genes in the Genome of Bifidobacterium longum 35624

We identified a region from base numbers 448412 to 474640 (inclusive) of SEQ ID No. 1 that we designated exopolysaccharide (EPS) region 1 (SEQ ID No. 2). The EPS region 1 encodes a cluster of genes B624_0342 to B624_0366 (Table 2).

Reversible protein phosphorylation is a major mechanism in the regulation of fundamental signalling events in all living organisms. Tyrosine phosphorylation is today recognized as a key regulatory device of bacterial physiology, linked to exopolysaccharide production, virulence, stress response and DNA metabolism (Grangeasse et al., 2012). Tyrosine phosphatase together with tyrosine kinase are responsible for controlling polysaccharide biosynthesis and export, but the underlying mechanism remains unclear (Grangeasse et al., 2012).

TABLE 2
ID and functions of eps624 cluster genes.

Gene ID	Start	Stop	Strand	Predicted Function

B624_0342	448412	450007	+	priming glycosyltransferase
B624_0343	450098	452029	+	hypothetical protein
B624_0344	452091	453566	+	tyrosine kinase
B624_0345	453574	454725	+	glycosyltransferase
B624_0346	454725	456065	+	glycosyltransferase
B624_0347	456065	457126	+	UDP- glucuronate 5′
				epimerase
B624_0348	457201	458448	+	UDP- glucose 6-
				dehydrogenase
B624_0349	458489	459550	+	glycosyltransferase
B624_0350	459581	460408	+	NAD dependent epimerase/
				dehydratase
B624_0351	460446	460952	+	acyltransferase
B624_0352	460985	461998	+	glycosyltransferase
B624_0353	462020	463360	+	polymerase
B624_0354	463363	464292	+	glycosyl transferase
B624_0355	464311	465753	+	flippase
B624_0356	465774	466280	+	acyltransferase
B624_0357	466366	467514	−	NAD dependent epimerase/
				dehydratase
B624_0358	467785	468615	−	integrase
B624_0359	468615	468770	−	transposase
B624_0360	469189	470208	+	rhamnose biosynthesis
B624_0361	470218	471303	+	rhamnose biosynthesis
B624_0362	471349	472245	+	rhamnose biosynthesis
B624_0363	472438	472654	+	Pseudogene; transposase
B624_0364	472715	472858	+	hypothetical protein
B624_0365	473371	473802	−	hypothetical protein
B624_0366	474083	474640	−	protein-tyrosine-phosphatase

Example 5—Isolation and Screening of EPS-Producing Bifidobacterial Strain from Fecal Samples

Fecal Sample Preparation

Fecal samples were collected by the subjects using a Kendall precision commode specimen collection system. The collected samples were stored chilled in a cold pack prior to sample processing. Only samples that are less than twenty four hours old were used in the evaluations.

A 10.0 g sample of mixed fecal material was placed into a plastic stomaching bag containing 90 ml of saline. The suspension was stomached for 2 minutes. The suspension was filtered through a gauze pad contained within a disposable funnel. Following the filtration, 45 ml of the filtered fecal homogenate was transferred to a 50 ml disposable centrifuge tube. This fecal suspension was further used for DNA extraction or for bacterial isolation.

Screening Fecal Samples Using Three TaqMan Real-Time PCR Assays.

Fecal Sample DNA Preparation.

A 2.0 ml aliquot of the fecal homogenate was pelleted using a microcentrifuge. The pellets were resuspended in 20 mg/ml lysozyme, for 2 hours at 37° C. DNA was extracted using a QIAamp DNA Stool Mini Kit (Qiagen). The DNA concentration was measured by Pico Green assay (Molecular Probes). Once the DNA concentration was measured, the DNA was stored at 4° C.

TaqMan Real-Time PCR Reactions.

The test samples were diluted to a concentration of DNA of 2 ng/μl so that 5 μl contained a total of 10 ng DNA. Samples were assayed by a total of three separate assays.

The following reaction mix was made:

Water	15.75	μl
10 μM forward primer	1.5	μl	(300 nM final concentration)
10 μM reverse primer	1.5	μl	(300 nM final concentration)
10 μM TaqMan probe	1	μl	(200 nM final concentration)
BSA (20 mg/ml)	0.25	μl	(0.1 ug/ml final concentration)
TaqMan Universal Master	25	μl
Mix

A bulk mix was made for the number of samples to be assayed. A 45 μl aliquot was dispensed into each well of a 96 well microtitre plate, then 5 μl DNA was added to each well. The plate was spun briefly, and placed into the thermocycler (ABI 7900 HT). The standard TaqMan thermocycling protocol was used.

TaqMan RT-PCR Program.

The standard TaqMan quantitative PCR thermocycling protocol is as follows:

Step 1: 95° C. for 10 minutes (to activate the AmpliTaq Gold polymerase)
Step 2: 95° C. for 15 seconds (the denaturation step)
Step 3: 60° C. for 60 seconds (the priming/polymerization step)
Steps 2 and 3 are repeated 40 times. Fluorescent data is collected at step 3.

Primers and Probes for Three TaqMan RT-PCR Assays.

The fecal sample DNAs were screened using a EPS gene-specific assay and two B. longum 35624 gene-specific assays (UNK1 and UNK2). The specific genes used and their TaqMan primer sets are shown in Table 3 below.

TABLE 3
35624 Primer set for TaqMan PCR

					TaqMan
Target			Genome	Genome	Probe
Gene	Name	Sequence 5′-3′	start	end	label

BI01615	UNK-1F1	CCATGAGCGGTTTCACGAA (SEQ ID No. 4)	1451446	1451428	5′ 6-FAM
(UNK-1)	UNK1-R1	TTGGACGGTGCCTGTGATTA (SEQ ID No. 5)	1451393	1451412	3′ NFQ-MG
	UNK1-MGB1	CGGGCAATCAAC (SEQ ID No. 6)	1451426	1451415
BI02420t	UNK2-F1	ACTTGACGTACCGTTTTGAGATTTC (SEQ ID No. 7)	1656479	1656503	5′ 6-FAM
(UNK-2)	UNK2-R1	CTAAGCATGGCAAGGCTGATAGT (SEQ ID No. 8)	1656562	1656540	3′ NAF-MBG
	UNK2-MGB1	TGCGACCAACACGC (SEQ ID No. 9)	1656525	1656538
BI00783	EPS-F1	GGGTCCAATAAGAAGGTTCCATATT (SEQ ID No. 10)	454491	456515	5′ 6-FAM
(EPS)	EPS-R1	GCATGTGCCAACAGCTCATC (SEQ ID No. 11)	456591	456572	3′ TAMR
	EPS-TAMRA	CGGATGACAAGGTAGATAATCCAGTGAGCCTATAC	456519	456553
		(SEQ ID No. 12)

The fecal samples which showed high DNA concentration by the B. longum 35624 EPS gene-specific assay, but negative reactions by using B. longum 35624 gene-specific assays, were further used for the isolation of potential EPS-producing bacteria.

Example 6—Isolation and Characterization of Strain B. longum AH0097 and Strain B. longum

AH1172 from Fecal Samples.

One milliliter of bacterial suspension (see Example 5 above) was transferred to 9.0 ml of sterile phosphate-buffered saline which constituted the 10⁻¹ dilution. One milliliter of this 10⁻¹ dilution was transferred to 9.0 ml of sterile phosphate-buffered saline which was the 10⁻² dilution. This process was continued until the 10⁻¹⁰ dilution was prepared. Then, 0.1 ml of each dilution was plated onto the surfaces of Reinforced Clostridial Agar (RCA) plates (BD or equivalent) and Lactobacillus Man-Rogosa Sharpe agar (MRSA) plates (BD or equivalent). The plates were incubated under anaerobic condition (COY anaerobic Chamber) at 33° C.±2° C. for 48-72 hours.

Following incubation, single colonies (a total of approximately 100 colonies) were picked from RCA and MRSA plates and further streaked on new plates for isolate purification. The plates with the streaked colonies were incubated under anaerobic conditions (COY anaerobic Chamber) at 33° C.±2° C. for 48 to 72 hours. After incubation, the pure colonies observed on plates were then submitted for DNA extraction.

Screening Fecal Isolates Using Three TaqMan Real-Time PCR Assays

The bacterial DNA was extracted using the Preman™ Ultra Sample Preparation Reagent and Protocol (Applied Biosystems). The DNA was further analyzed using three TaqMan RT-PCR assays (EPS gene-specific assay [EPS-1] and two B. longum 35624 gene-specific assays [UNK1 and UNK2] as described above in Example 5. Two isolates showed positive results for the B. longum 35624 EPS gene-specific assay, and negative results for the B. longum35624 gene-specific assays. Both isolates were therefore further identified using 16S rDNA sequencing. Identification of potential EPS-producing strain by 16S rDNA sequencing. The 16S rRNA gene fragment was amplified and sequenced using ABI Full Gene PCR kit (Applied Biosystems, Foster City, Calif.).

(1). 16S rRNA Gene Amplification:

PCR amplification was carried out on a GeneAmp PCR System 9700 thermal cycler with the following program:

Initial Hold: 95° C. for 10 minutes
30 Cycles: 95° C. for 30 seconds (Denaturing)
60° C. for 30 seconds (Annealing)
72° C. for 45 seconds (Extension)
Final Extension: 72° C. for 10 minutes
(2). 16S rRNA Gene Sequencing:

Sequencing was further performed on the thermal cycler using the following program:

Cycles: 96° C. for 10 seconds (Denaturing)
50° C. for 5 seconds (Annealing)
60° C. for 4 minutes (Extension)
Final step Hold at 4° C.

The sequencing PCR product was further purified using DyeEX™ 2.0 spin kit and sequenced using 3130 xl Genetic Analyzer (Applied Biosystems, Foster City, Calif.).

(3) Sequence Data Analysis:

Comparison of the consensus sequences with GenBank sequences was done by using Basic Local Alignment Search Tool (BLAST). The GenBank search indicated that the B. longum35624 EPS gene-specific positive, but B. longum 35624 gene-specific negative isolates were both Bifidobacterium longum. These strains were designated names by Alimentary Health, AH0097 and AH1172.

Example 7—Isolation and Screening of EPS-Expressing Bifidobacterial longum Strains

Isolation of Bacterial Strains

Bacteria were isolated from bowel tissue and/or fecal samples using the methodology described in Example 1 above. In particular, Bifidobacterium longum AH0097 and Bifidobacterium longum strain AH1172 were isolated from fecal samples from healthy adult human subjects.

EPS Gene Cluster Screen

Bacterial strains were screened for the presence of genes from EPS cluster 1 (Table 2 above) using the primers listed in Tables 4 below. Briefly, the following methodology was used for the PCR EPS cluster gene screen:

10 ml Modified Rogosa broth media (+0.05% cysteine) was inoculated aseptically with a freshly grown colony of the bacterial strain and incubated anaerobically at 37° C. until turbid (about 16 to about 24 hours). The broth cultures were centrifuged and DNA was isolated from the resultant pellet using a Sigma™ extraction procedure. A nanodrop was used to ascertain the concentration of DNA in the sample and samples were diluted using DEPC water to a final concentration of 50 ng/μl DNA per sample. The template DNA samples were used in individual PCR reactions with the primer sets listed in Tables 4 below under the following conditions:

	Temp	Time
Step	(° C.)	(sec)

1	95	240
2	95	45
3	60	45
4	72	45	repeat steps 2 to 4, 25 times
5	4	hold

The primers were specifically designed to amplify a PCR product of approximately 500 base pair for the 25 genes of EPS clusters 1. PCR products were visualised following agarose gel electrophoresis with an appropriate DNA ladder for reference sizing. The presence (YES) or absence (NO) of a 500 bp PCR product is indicated in Table 5 below.

TABLE 4
Primers for screening bacterial strains for the
presence of genes from EPS cluster 1

Gene ID	Primer name	LRFR	Sequence	SEQ ID NO.
B624_0342	1.01	L	tat gtt gcc ggc att tat ca	SEQ ID No. 12
B624_0342	1.01	R	tgc gcg ttc atg tca ata at	SEQ ID No. 13
B624_0343	1.02	L	ggc gta gca agt tca agg ag	SEQ ID No. 14
B624_0343	1.02	R	aat aac cgc tgc agg aac ac	SEQ ID No. 15
B624_0344	1.03	L	gtg cag gac ggt aat gga gt	SEQ ID No. 16
B624_0344	1.03	R	gct tcg ggt ctg gat cat ta	SEQ ID No. 17
B624_0345	1.04	L	tgc tga caa gtg gag tct gg	SEQ ID No. 18
B624_0345	1.04	R	cca cgt cta cga gca act ca	SEQ ID No. 19
B624_0346	1.05	L	gaa agc gaa gag tgg tct gg	SEQ ID No. 20
B624_0346	1.05	R	ccg gct gat ttg atg aga tt	SEQ ID No. 21
B624_0347	1.06	L	tgc cgc tgt act ggt cac	SEQ ID No. 22
B624_0347	1.06	R	gca tgt gcc aac agc tca	SEQ ID No. 23
B624_0348	1.07	L	cca aca cgt atc tgg cac tg	SEQ ID No. 24
B624_0348	1.07	R	tcg gag cca aag aag gta ga	SEQ ID No. 25
B624_0349	1.08	L	ata ccg cgt atg ctt tgg ac	SEQ ID No. 26
B624_0349	1.08	R	aaa cgg taa cca ctc gct tg	SEQ ID No. 27
B624_0350	1.09	L	atg gga tcg atg cat gaa at	SEQ ID No. 28
B624_0350	1.09	R	ttc tcg gca ata aac cgt tc	SEQ ID No. 29
B624_0351	1.10	L	cca gcg gtt att tcg ttg tt	SEQ ID No. 30
B624_0351	1.10	R	ggt ggc atg atc ctt atg ct	SEQ ID No. 31
B624_0352	1.11	L	gct atc ttc acc gca ttg gt	SEQ ID No. 32
B624_0352	1.11	R	cca gtc agg gaa ggt cac at	SEQ ID No. 33
B624_0353	1.12	L	tga aat aca cgc aac ccg ta	SEQ ID No. 34
B624_0353	1.12	R	aatgcgtcaaaaccgatacc	SEQ ID No. 35
B624_0354	1.13	L	gga aag caa tga gga agc tg	SEQ ID No. 36
B624_0354	1.13	R	gat ttg atg caa agc aag ca	SEQ ID No. 37
B624_0355	1.14	L	gtg agt acc gtt tcc gca at	SEQ ID No. 38
B624_0355	1.14	R	ttc ctt ggt tcc cgt gat ag	SEQ ID No. 39
B624_0356	1.15	L	gct ggg att ttg gaa gtg aa	SEQ ID No. 40
B624_0356	1.15	R	tgt tac ccc cgg cat aat aa	SEQ ID No. 41
B624_0357	1.16	L	acc ggt aac gtt cag att gc	SEQ ID No. 42
B624_0357	1.16	R	gca ata ccg cct tga cct ta	SEQ ID No. 43
B624_0358	1.17	L	ttg tac cac cac acg tac cg	SEQ ID No. 44
B624_0358	1.17	R	cgc gag ttc aat ggc tat g	SEQ ID No. 45
B624_0359	1.18	L	aca tcg acc tcc atc tcc ag	SEQ ID No. 46
B624_0359	1.18	R	ata cgt aac agc ggc tcc ac	SEQ ID No. 47
B624_0360	1.19	L	aag tac gat gtg cgc tac ca	SEQ ID No. 48
B624_0360	1.19	R	cat cac ggt cag gat gtc ac	SEQ ID No. 49
B624_0361	1.20	L	cga ata cac gga cat caa cg	SEQ ID No. 50
B624_0361	1.20	R	gag aat cga gca gct gga ac	SEQ ID No. 51
B624_0362	1.21	L	tgg gag agg agt tca tcg ac	SEQ ID No. 52
B624_0362	1.21	R	gta tcc agc cat gcg taa cc	SEQ ID No. 53
B624_0363	1.22	L	taatgggcgg acggaaagtt	SEQ ID No. 54
B624_0363	1.22	R	tgccctccgt gaaatacagg	SEQ ID No. 55
B624_0364	1.23	L	caacgatgtc catatcgcct	SEQ ID No. 56
B624_0364	1.23	R	gcgccctgtt gttgatgatg	SEQ ID No. 57
B624_0365	1.24	L	ccgattccgc cattcgtttc	SEQ ID No. 58
B624_0365	1.24	R	ggccacatcg aaaatcacgg	SEQ ID No. 59
B624_0366	1.25	L	gaattggctt gcagagcggc	SEQ ID No. 60
B624_0366	1.25	R	acagaatcag gtcggcttgc	SEQ ID No. 61

TABLE 5
Results of EPS cluster 1 gene screen In which YES indicates the
presence and NO indiates the absence of a 500 bp PCR product.

	Primer	B. longum	B. longum	B. longum
Gene ID	set	35624	AH1172	AH0097

B624_0342	1.01	YES	YES	YES
B624_0343	1.02	YES	YES	YES
B624_0344	1.03	YES	YES	YES
B624_0345	1.04	YES	YES	YES
B624_0346	1.05	YES	YES	YES
B624_0347	1.06	YES	YES	YES
B624_0348	1.07	YES	YES	YES
B624_0349	1.08	YES	YES	YES
B624_0350	1.09	YES	YES	YES
B624_0351	1.10	YES	YES	YES
B624_0352	1.11	YES	NO	YES
B624_0353	1.12	YES	YES	YES
B624_0354	1.13	YES	YES	YES
B624_0355	1.14	YES	YES	YES
B624_0356	1.15	YES	YES	YES
B624_0357	1.16	YES	YES	YES
B624_0358	1.17	YES	YES	NO
B624_0359	1.18	YES	YES	YES
B624_0360	1.19	YES	YES	YES
B624_0361	1.20	YES	YES	NO
B624_0362	1.21	YES	YES	YES

Predicted Role of eps₆₂₄ Genes to eps₆₂₄ Structure.

The eps₆₂₄ cluster encodes a number of key enzymes that are predicted to be required for EPS production, by means of the so-called Wzx/Wzy-dependent pathway, which typically employs a priming glycosyltransferase (pGT), one or more glycosyl transferases (GHs), a flippase, and a polymerase to produce an extracellular heteropolysaccharide (Schmid et al., 2015). The first gene (corresponding to locus tag BL_0342 and designated here as pgt624) of the eps₆₂₄ gene cluster is predicted to encode the pGT, which adds the first monosaccharide to a cytoplasmic, membrane-bound carrier molecule undecaprenyl as part of the oligosaccharidic subunit biosynthesis (Salazar et al., 2009). The eps₆₂₄ cluster encodes five additional GTs (corresponding to locus tags BL_0345, BL_0346, BL_0349 and BL_0352), which are predicted to each add one monosaccharide to the carrier molecule so as to complete the oligosaccharidic subunit, prior to its export to the external side of the membrane by a flippase (predicted to be encoded by a gene corresponding to locus tag BL_0355) and its subsequent use by a polymerase (putatively specified by locus tag BL_0353) to produce the EPS polymer. Interestingly, two adjacent genes of the eps₆₂₄ cluster, corresponding to B624_0347 and 118 B624_0348, are predicted to encode a UDP-glucuronate 5′-epimerase and a UDP-glucose 6-dehydrogenase, suggesting that one of the incorporated monosaccharides of the EPS is an epimer of glucuronic acid, e.g. galacturonic acid or mannuronic acid. Three genes located within the eps₆₂₄ cluster, corresponding to locus tags B624_0360 through to B624_0362), encode enzymes known to be involved in the biosynthesis of dTDP-L-rhamnose (Marumo et al., 1992), while the deduced protein products of B624_0350 and B624_0357 are predicted to encode NAD-dependent reductase/epimerase enzymes. Such enzymes have been shown to be involved in the rerouting of the dTDP-L-rhamnose biosynthesis pathway towards the production of dTDP-D-fucose or dTDP-6-deoxy-L-talose (Gaugler and Gabriel, 1973; Nakano et al., 2000; Yoshida et al., 1999). The eps₆₂₄ cluster also encodes two predicted acetyl transferases, similar to enzymes that have previously been shown to perform O-acetylation reactions on particular sugar components (such as 6-deoxy-L-talose) in polysaccharides (Knirel et al., 2002). Furthermore, the genes with locus tags B624_0344 and B624_0366 represent putative tyrosine kinase and phosphotyrosine protein phosphatase activities, respectively, which have been associated with controlling EPS export and polymerisation (Grangeasse et al., 2012). Therefore, based on the gene content of the eps₆₂₄ cluster, we predict that the EPS produced by 35624 is composed of a repeating subunit that consists of six monosaccharides, of which one is an epimer of glucuronic acid, one or two others are either D-fucose or 6-deoxy-talose, and some of which may be 0-acetylated.

The genes located within the eps₆₂₄ cluster, corresponding to locus tags B624_0342 through to B624_0366, are required for the production of the B. longum 35624 subsp. longum specific EPS. The production of an EPS by a bacterium minimally requires a priming glycosyltransferase (pGT), one or more glycosyl transferases (GHs), a flippase, and a polymerase to produce an extracellular heteropolysaccharide. The number of glycosyl transferases may vary thereby affecting the length of oligosaccharidic subunit. Additionally, the presence of acetyl transferases may result in the 0-acetylation of some of the monosaccharides.

Protein-Tyrosine-Phosphatase

Reversible protein phosphorylation is a major mechanism in the regulation of fundamental signalling events in all living organisms. Tyrosine phosphorylation is today recognized as a key regulatory device of bacterial physiology, linked to exopolysaccharide production, virulence, stress response and DNA metabolism (Grangeasse et al., 2012). Tyrosine phosphatase together with tyrosine kinase are responsible for controlling polysaccharide biosynthesis and export, but the underlying mechanism remains unclear (Grangeasse et al., 2012). In the B. longum subsp. longum 35624 genome B624_0344 encodes tyrosine kinase while B624_0366 encodes tyrosine phosphatase. B624_0366 was not previously identified as being part of the eps₆₂₄ cluster in patent application PCT/IE2009/000079 published as WO2010/055499A.

Congo Red Agar Screen

A Congo red agar screen was used to phenotypically screen for EPS expressing bacterial strains. Briefly, 10 ml Modified Rogosa broth media (+0.05% cysteine) was inoculated aseptically with a freshly grown colony of the bacterial strain and incubated anaerobically at 37° C. until turbid (about 16 to about 24 hours). The broth cultures were aseptically streaked onto Congo Red Agar plates and incubated anaerobically at 37° C. for 48 hours. It is believed that EPS produced as a by-product of the growth and/or metabolism of certain strains prevents the uptake of the Congo red stain resulting in a cream/white colony morphology. Stains that produce less EPS take up the Congo red stain easily, resulting in a pink/red colony morphology. Strains that do not produce an EPS stain red and look almost transparent in the red agar background.

Referring to FIGS. 1 and 2, the following colony morphologies were observed:

TABLE 6
Colony morphologies from Congo red agar screen

Bacterial Strain	Colony morphology
B. longum 35624	Convex, mucoid, bright white colonies
B. longum AH0097 (FIG. 1)	Convex, mucoid, bright white colonies
B. logum AH0172 (FIG. 2)	Convex, mucoid, bright white colonies

The control of inflammatory diseases is exerted at a number of levels. The controlling factors include hormones, prostaglandins, reactive oxygen and nitrogen intermediates, leukotrienes and cytokines. Cytokines are low molecular weight biologically active proteins that are involved in the generation and control of immunological and inflammatory responses. A number of cell types produce these cytokines, with neutrophils, monocytes and lymphocytes being the major sources during inflammatory reactions due to their large numbers at the injured site.

Multiple mechanisms exist by which cytokines generated at inflammatory sites influence the inflammatory response. Chemotaxis stimulates homing of inflammatory cells to the injured site, whilst certain cytokines promote infiltration of cells into tissue. Cytokines released within the injured tissue result in activation of the inflammatory infiltrate. Most cytokines are pleiotropic and express multiple biologically overlapping activities. As uncontrolled inflammatory responses can result in diseases such as IBD, it is reasonable to expect that cytokine production has gone astray in individuals affected with these diseases.

15 B. longum 35624, B. longum AH0097 and B. longum AH1172 Induce Nearly Identical Cytokine Profiles in PBMCs.

Peripheral blood mononuclear cells (PBMCs) were isolated from fresh human peripheral blood using BD Vacutainer CPT tubes (BD catalog 362761), as per the manufacturer's instructions. PBMCs were washed and resuspended in Dulbecco's MEM (Gibco catalog 10569-010) plus 25 mM HEPES, 10% fetal bovine serum (Sigma catalog F4135), and 1% penicillin/streptomycin (Sigma catalog P0781). 2×10⁵ PBMCs (in 200 μl of DMEM) were plated into each well of a 96-well culture plate.

Bacteria were grown in Difco MRS media and harvested just after entering into stationary phase. All cells were grown under anaerobic conditions at 37° C. Growth curves (OD vs # of live cells) were constructed for each growth condition, and washed cells were normalized by cell number before addition to the PBMCs.

Bacteria (20 μl in phosphate buffered saline (PBS)) were added to each well of PBMCs to give the total number of bacteria as indicated for each experiment. Five different amounts of bacteria were tested: 2E07, 1E07, 5E6, 2E6 and 1E6 were added to separate wells of PBMCs. A no-bacteria control also was run. All assays were done in triplicate. After a 2-day incubation at 37° C., the plates were spun at 300×g, and the supernatants were removed and stored frozen at −80° C. until analysis.

Cytokines in the culture supernatants were assayed using a 96-well assay kit from Meso Scale Discovery (Gaithersburg, Md.; catalog K15008B-1). Human Interleukin 10 (11-10), and Tumor Necrosis Factor alpha (TNFa) were quantitated and reported as picograms per milliliter. Each sample was assayed in duplicate.

FIGS. 3 to 6 show the results of a representative experiment. For each cytokine shown, B. longum 35624, B. longum AH0097 and B. longum AH1172 induce nearly identical levels of cytokines. These levels are very different than the levels induced by other Bifidobacterial strains that they were compared to.

The control of inflammatory diseases is exerted at a number of levels. The controlling factors include hormones, prostaglandins, reactive oxygen and nitrogen intermediates, leukotrienes and cytokines. Cytokines are low molecular weight biologically active proteins that are involved in the generation and control of immunological and inflammatory responses, while also regulating development, tissue repair and haematopoiesis. A number of cell types produce these cytokines, with neutrophils, monocytes and lymphocytes being the major sources during inflammatory reactions due to their large numbers at the injured site. They provide a means of communication between leukocytes themselves and also with other cell types. Most cytokines are pleiotrophic and express multiple biologically overlapping activities. Cytokine cascades and networks control the inflammatory response rather than the action of a particular cytokine on a particular cell type (Arai K I, et al., 1990). Waning of the inflammatory response results in lower concentrations of the appropriate activating signals and other inflammatory mediators leading to the cessation of the inflammatory response. As uncontrolled inflammatory responses can result in diseases such as IBD, it is reasonable to expect that cytokine production has gone astray in individuals affected with these diseases.

Interleukin-10 (IL-10) is an anti-inflammatory cytokine which is produced by many cell types including monocytes, macrophages, dendritic cells, mast cells and lymphocytes (in particular T regulatory cells). IL-10 down-regulates the expression of pro-inflammatory Th1 cytokines, MHC class II antigens, and co-stimulatory molecules on antigen presenting cells. It also enhances B cell survival, proliferation, and antibody production. This cytokine can block NF-κB activity, and is involved in the regulation of the JAK-STAT signaling pathway. Murine knock-out studies have demonstrated the essential role for IL-10 in immunoregulation as IL-10KO mice develop severe colitis. In addition, bacteria which are potent inducers of IL-10 have been shown to promote T regulatory cell differentiation in vivo thus contributing to immunological homeostasis (O'Mahony et al., AJP 2006; O'Mahony et al., PLoS Pathogens 2008).

Tumor necrosis factor alpha (TNFα) is a pivotal proinflammatory cytokine as it initiates a cascade of cytokines and biological effects resulting in the inflammatory state. Therefore, agents which inhibit TNFα are currently being used for the treatment of inflammatory diseases, e. g. infliximab.

Compositions and Methods for Formulating EPS Producing Strains

Compositions

The following table demonstrates compositions incorporating the freeze dried bacteria expressing the EPS.

	Weight (%)

Material	A	B	C	D	E

Freeze-dried bacteria	5.3	6.0	5.0	10	5.0
Microcrystalline cellulose	93.7		72.0
Maltodextrin		93.5
Fumed silica			2.0
Ascorbic acid			10.0
Tricalcium citrate			10.0
Potato starch				89.0
Psyllium husk					94.0
Magnesium stearate	1.0	0.5	1.0	1.0	1.0
Total	100	100	100	100	100

To ensure adequate shelf life of the composition the following dry handling procedures can used. The mixing and filling operations can be performed in a humidity-controlled environment where the RH can be maintained below 50%, alternatively below 40%. The freeze-dried bacteria can be pre-concentrated to the desired CFU/g to achieve the desired total amount in each dosage unit based on the fraction of freeze-dried bacteria and total amount of mixed powder to be dosed. The freeze-dried bacterial can be added to the mixing cavity of, for example, a Pharmatech mixer along with the appropriate amount of stabilizing excipient such as microcrystalline cellulose, potato starch or the like. The stabilizing excipients can be pre-dried to have low water contents, for example, less than 10%, alternatively less than 6% water content. The head space within the mixing cavity can be flushed with a dry gas, such as nitrogen, so that the relative humidity is maintained at a low level. The powders can then be mixed for 20 minutes at a mixing speed of 60 rpm to ensure good mixing. Once mixing is completed, the powder can be handled and stored in a low Rh environment, for example, below 50% RH, or below 40% RH.

The appropriate amount of the resulting dry-blended powder to achieve the desired CFU per dosage unit can then be filled into appropriately sized capsules, for example, a gelatin or hydroxypropyl methyl cellulose (HPMC) capsule under a dry environment. Alternatively, an appropriate amount of the resulting powder can be filled into a sachet and sealed under a dry environment. The resulting capsules or sachets can be stored at room temperature (20-30° C.) or alternatively at reduced temperature (4° C.) to extend shelf life.

	Freeze-dried		Powder
Powder	Bacteria (CFU)	Unit	Quantity (g)	CFU/Unit

A	1 × 1010	Gelatin capsule	0.2	1.1 × 108
B	1 × 1011	HPMC capsule	0.25	1.5 × 109
C	1 × 1012	Gelatin capsule	0.18	9.0 × 109
D	1 × 109	Sachet	1.0	1.0 × 108
E	1 × 1011	Sachet	2.0	1.0 × 1010

Alternatively, the freeze-dried bacteria can be incorporated into a dairy product such as yogurt or into a chewable dosage form using standard techniques.

	Weight (%)

			Chewable
	Material	Yogurt	Dose Form

	Freeze-dried bacteria	8	3
	Milk	70
	Sugar	20
	Starch	2
	Microcrystalline cellulose		15
	Compressible sugar		40
	Fructose		40
	Citric acid		0.5
	Magnesium stearate		1
	Flavor		0.5
	Total	100	100

Methods of Use

The compositions described herein are intended to be used as prophylactic, therapeutic or non-therapeutic treatments to alleviate diseases and conditions that affect animals, preferably mammals and humans. The compositions may be administered to subjects as a pharmaceutical, OTC or supplement, for example DSHEA, product. Non-limiting examples of prophylactic, therapeutic or non-therapeutic treatments can be for inflammatory diseases or conditions, or modulation of the immune system. The diseases and conditions can include inflammatory bowel disease, irritable bowel syndrome, diarrhea due to a range of causes such as travel or antibiotic treatment, allergy, asthma, fever control, nutritional disorders, maintaining or improving the condition of the gastrointestinal tract or skin, and respiratory disorders or infections. In particular, these compositions can be used to treat or prevent adverse conditions of the gastrointestinal tract.

Typically, the compositions are given to a subject as part of a dose regimen. The dose regimen can be varied depending on the specific state that is being treated or prevented and the unit dose format. For example, the total amount of bacteria administered per dose can range from 1×10⁶ to 1×10¹² CFU per dose, preferably from ax10⁸-1×10¹⁰ CFU per dose. The unit dose, when provided as a capsule can be swallowed directly with or without fluid. The powder contained in a sachet can be ingested directly or mixed with a liquid like milk or juice or mixed with a food such as yogurt. If already incorporated into a food supplement such as yogurt or into a chewable form the dose can be taken by eating. The dose regimen can proscribe administration at least once per month, at least once per week, at least once per day or more than once per day.

The dimensions and values disclosed herein are not to be understood as being strictly limited to the exact numerical values recited. Instead, unless otherwise specified, each such dimension is intended to mean both the recited value and a functionally equivalent range surrounding that value. For example, a value disclosed as “40” is intended to mean “about 40”. All documents cited in the Detailed Description of the Invention are, in relevant part, incorporated herein by reference; the citation of any document is not to be construed as an admission that it is prior art with respect to the present invention. To the extent that any meaning or definition of a term in this document conflicts with any meaning or definition of the same term in a document incorporated by reference, the meaning or definition assigned to that term in this document shall govern.

While particular embodiments of the present invention have been illustrated and described, it would be obvious to those skilled in the art that various other changes and modifications can be made without departing from the spirit and scope of the invention. It is therefore intended to cover in the appended claims all such changes and modifications that are within the scope of this invention.

REFERENCES

• Altschul, S. F., Madden, T. L., Schaffer, A. A., Zhang, J., Zhang, Z., Miller, W., and Lipman, D. J. (1997). Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res 25, 3389-3402.
• Altschul S. F., Gish W., Miller W., Myers E. W. and Lipman D. J. (1990) Basic local alignment search tool. J Mol Biol. 215: 403-410.
• Bateman, A., Bimey, E., Cerruti, L., Durbin, R., Etwiller, L., Eddy, S. R., Griffiths-Jones, S., Howe, K. L., Marshall, M., and Sonnhammer, E. L. (2002). The Pfam protein families database. Nucleic Acids Res 30, 276-280.
• Bendtsen J. D., Nielsen H., von Heijne G. and Brunak S. (2004) Improved prediction of signal peptides: SignalP 3.0. J Mol Biol. 340: 783-795.
• Bouhnik Y Survival And Effects Of Bacteria Ingested In Fermented Milk In Man Lait 73 (2): 241-247 1993
• Busch W, Saier M H The Transporter Classification (TC) system, 2002 Critical Reviews In Biochemistry And Molecular Biology 37 (5): 287-337 2002
• Chevalier, P. et al. (1990) J Appl. Bacteriol 68, 619-624)
• Coutinho & Henrissat, 1999
• Delcher A L, Harmon D, Kasif S, White O, Salzberg S L Improved microbial gene identification with GLIMMER Nucleic Acids Research 27 (23): 4636-4641 Dec. 1, 1999
• Eddy, S. R. The HMMER software tools.
• Eddy S R A memory-efficient dynamic programming algorithm for optimal alignment of a sequence to an RNA secondary structure BMC BIOINFORMATICS 3: Art. No. 18 2002

Green, P. The Phred/Phrap/Consed system home page.

Griffiths-Jones S, Moxon S, Marshall M, Khanna A, Eddy S R, Bateman A Rfam: annotating non-coding RNAs in complete genomes Nucleic Acids Research 33: D121-D124 Sp. Iss. SI Jan. 1, 2005

• Krogh A, Larsson B, von Heijne G, Sonnhammer E L L., Predicting transmembrane protein topology with a hidden Markov model: Application to complete genomes Journal Of Molecular Biology 305 (3): 567-580 Jan. 19, 2001
• Kurtz S, Schleiermacher C REPuter: fast computation of maximal repeats in complete genomes Bioinformatics 15 (5): 426-427 MAY 1999
• Lowe T M, Eddy S R tRNAscan-SE: A program for improved detection of transfer RNA genes in genomic sequence Nucleic Acids Research 25 (5): 955-964 Mar. 1, 1997
• Liu M, van Enckevort F H, Siezen R J, Genome update: lactic acid bacteria genome sequencing is booming Microbiology 2005, vol 151 pp 3811-3814
• McCarthy et al., 2004
• O'Mahony L, McCarthy J, Kelly P, Hurley G, Luo F, Chen K, O'Sullivan G C, Kiely B, Collins J K, Shanahan F, Quigley E M: Lactobacillus and bifidobacterium in irritable bowel syndrome: symptom responses and relationship to cytokine profiles. Gastroenterology. 2005 March; 128(3):541-51.
• O'Mahony et al., AJP 2006
• O'Mahony et al., PLoS Pathogens 2008
• Riley, 1993
• Riley, 1998a
• Rutherford, K., Parkhill, J., Crook, J., Horsnell, T., Rice, P., Rajandream, M. A., and Barrell, B. (2000). Artemis: sequence visualization and annotation. Bioinformatics 16, 944-945.
• Salzberg S, Delcher A L, Fasman K H, Henderson J. A decision tree system for finding genes in DNA Journal Of Computational Biology 5 (4): 667-680 WIN 1998
• Suzek, B. E., Ermolaeva, M. D., Schreiber, M., and Salzberg, S. L. (2001). A probabilistic method for identifying start codons in bacterial genomes. Bioinformatics 17, 1123-1130.
• Tatusov, R. L., The XUGNITOR software.
• Volfovsky et al., 2001
• Wheeler et al., 2005