US20200164052A1
2020-05-28
16/594,436
2019-10-07
Antigenic polypeptides of the growth factor receptor HER2, for breaking the tolerance of a host against self HER2. The antigenic polypeptides include HER2 polypeptides with single amino acid substitutions of lysine for glutamine, arginine for glutamine, or aspartic acid for asparagine. Gene expression constructs, vaccine compositions, and immunization methods including the substituted HER2 polypeptides. Methods for immunizing mammalian subjects with heterologous unsubstituted HER2 antigenic polypeptides, including polypeptides of feline and bear HER2. A diagnostic method of determining whether a mammalian subject is sufficiently immunocompetent to respond to immunotherapies directed at breaking tolerance to self HER2.
Get notified when new applications in this technology area are published.
A61K39/0011 » CPC main
Medicinal preparations containing antigens or antibodies; Vertebrate antigens Cancer antigens
C07K16/3015 » CPC further
Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants from tumour cells Breast
C07K16/2863 » CPC further
Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against receptors for growth factors, growth regulators
A61K2039/53 » CPC further
Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA DNA (RNA) vaccination
A61K2039/572 » CPC further
Medicinal preparations containing antigens or antibodies characterised by the type of response, e.g. Th1, Th2 cytotoxic response
G01N2800/52 » CPC further
Detection or diagnosis of diseases Predicting or monitoring the response to treatment, e.g. for selection of therapy based on assay results in personalised medicine; Prognosis
A61K2039/575 » CPC further
Medicinal preparations containing antigens or antibodies characterised by the type of response, e.g. Th1, Th2 humoral response
A61K2039/55522 » CPC further
Medicinal preparations containing antigens or antibodies characterised by a specific combination antigen/adjuvant; Organic adjuvants Cytokines; Lymphokines; Interferons
A61K2039/552 » CPC further
Medicinal preparations containing antigens or antibodies characterised by the host/recipient, e.g. newborn with maternal antibodies Veterinary vaccine
A61K39/00 IPC
Medicinal preparations containing antigens or antibodies
G01N33/574 » CPC further
Investigating or analysing materials by specific methods not covered by groups -; Biological material, e.g. blood, urine ; Haemocytometers; Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing; Immunoassay; Biospecific binding assay; Materials therefor for cancer
C07K16/32 » CPC further
Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against translation products of oncogenes
C07K16/30 IPC
Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants from tumour cells
C07K16/28 IPC
Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
C07K14/71 » CPC further
Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans; Receptors; Cell surface antigens; Cell surface determinants for growth factors; for growth regulators
A61K39/39 » CPC further
Medicinal preparations containing antigens or antibodies characterised by the immunostimulating additives, e.g. chemical adjuvants
This invention was made with government support under grant no. CA076340 awarded by the National Institutes of Health and grant no. W81XWH-11-1-0050 awarded by the US ARMY/Medical Research and Materiel Command. The government has certain rights in the invention.
The invention relates to the field of antigens and vaccines for inducing a host to initiate immune response to the growth factor receptor HER2, and particularly for breaking tolerance to self HER2. The invention related particularly to the induction of anti-HER2 immunity for the treatment and prevention of mammary carcinomas and other HER2 expressing tumors in humans and other mammalian species.
One of the foremost barriers to cancer immunotherapy and immunoprevention is the phenomenon of tolerance, the immune system's safeguard against autoimmune disease. Most tumor antigens are self antigens showing little or no difference from their normal counterparts in amino acid sequence and three dimensional structure.
The immune system generally becomes tolerant to self antigens early in life. T lymphocyte clones specifically reactive to self antigens are either deleted or anergized during thymic development, or are kept in check at the periphery, mainly by diverse populations of regulatory T cells (Treg). Especially important are natural Treg which develop in the thymus upon high affinity recognition of antigens in the thymic stroma (Colombo and Piconese, 2007). It is often impossible to predict an antigen and immunization protocol that will break tolerance to a self antigen to achieve effective vaccination. This problem has defeated the development of many vaccines intended to induce immune response against tumor antigens (Wei et al, 2004).
A most promising tumor antigen in breast and other carcinomas is HER2 (ErbB-2, neu). HER2 is amplified in ˜30% of all breast cancers and is over-expressed in several other epithelial-derived neoplasms including ovarian cancer, small cell lung cancer, and cancers of the head and neck (Slamon, et al., 1989, Yu and Hung, 2000; Tzahar and Yarden. 1998).
HER2 receptors include an extracellular domain (ECD) of about 630 amino acids, a single membrane-spanning transmembrane region (TM), and an intracellular domain (ICD) including a cytoplasmic tyrosine kinase. The ECD contains four domains arranged as a tandem repeat of a two-domain unit consisting of a ˜190-amino acid L domain (domains I and III) followed by a ˜120-amino acid cysteine-rich domain (domains II and IV) (Witton, 2003, Roskoski, 2014).
Other members of the HER family of receptors, HER1, HER3, and HER4, bind extracellular growth factor (EGF) family ligands, but HER2 itself does not. Instead, it acts as a co-receptor, the preferred binding partner of the other HER family receptors. Ligand binding brings about heterodimerization of HER family receptors with HER2, leading to tyrosine kinase activation, and the activation of downstream signaling pathways. Overexpression of HER2, commonly seen in carcinomas, promotes spontaneous receptor dimerization and the activation of signaling pathways, in the absence of a ligand (Olayioye, 2001).
The presence of HER2 specific T cells and antibodies in breast and ovarian cancer patients indicate this molecule as a target of immunoprevention and therapy (Disis, et al., 1994; Peoples, et al., 1995; Fisk, et al., 1997; Kobayashi, et al., 2000). Passive immunotherapy, by administration of the anti-HER2 moAb (monoclonal antibody), Herceptin®, is used to treat patients with advanced breast cancer (Cobleigh, et al., 1999). Unfortunately, since ErbB-2 is a self antigen, and its sequence is typically unmodified in cancer, tumor hosts show strong immune tolerance against immune tolerance to HER2.
A HER2 tolerance breaking strategy that has shown some promise is to immunize a host with xenogeneic (heterologous) HER2, that is, HER2 from a different species than that of the immunized host. The strategy depends on the development of antigens that are sufficiently foreign to the HER2 of the host species to break tolerance to HER2, but sufficiently similar to elicit T cells and antibodies that cross react with the host HER2.
Some success has been attained with this strategy. It was found, for example, that heterologous vaccination with rat HER2 (rat neu) produced a degree of T cell response in human-HER2-tolerant transgenic mice. More complete responses were produced by vaccinating the transgenic mice with a hybrid antigen combining components of rat and human HER2 (Jacob, et al, 2006; Jacob, et al., 2010).
There is a need for more effective tolerance breaking antigens, for use in therapeutic and preventative vaccination against mammary carcinoma and other HER2-expressing cancers. There is also a need for monoclonal antibodies to such antigens, because such antibodies are themselves potential cross reacting reagents that can target HER2 expressing tumor cells.
There is also a need for antigens and methods useful for breaking tolerance to self HER2 in cats, for the treatment and prevention of mammary carcinoma in domestic feline populations. Feline mammary cancer is an important veterinary problem. The domestic cat population is estimated at 1 billion worldwide (Mullikin, et al., 2010) with approximately 95 million residing in US households (www.humanesociety.org/issues/pet_overpopulation/facts/pet_ownership_statistics.html) About 15% of unsprayed domestic cats spontaneously develop mammary tumors, 90% of which are malignant. Most of the malignancies are adenocarcinomas, with progression and histopathology similar to that of human breast cancer. HER2 expression has been reported in these tumors (Hayden, et al., 1971; Munson and Moresco, 2007; Gimenez, et al., 2010; Soares, et al., 2013; DeMaria, et al., 2005). Furthermore, successful HER2-targeted immunotherapies in outbred cat populations can lead directly to improved immunotherapies for human patients, which is not the case for immunotherapies developed with inbred rodent model populations. That is because the amino acid sequences of human and feline HER2 are more similar than those of human and mouse or rat neu (see, e.g., FIG. 6B), and because outbred cat populations exhibit a genetic diversity similar to that of human populations. There is therefore a need for antigens, vaccines, and methods for breaking tolerance to self HER2 for the therapeutic and preventative vaccination of mammary carcinomas of domestic cats.
Even with improved antigens and vaccines, a roadblock to breaking HER2 tolerance is the immunocompromised status of many cancer patients at the time of presentation for treatment. A competent immune system is required to meet the challenge of mounting a response to a self antigen. The induction of regulatory T cells, and the effects chemotherapy and radiation treatments can all contribute to a compromised immune system. There is a need for a diagnostic method for screening human and animal candidates for immunocompetence before the start of extended courses of tolerance-breaking immunotherapies.
The present invention provides antigenic HER2 polypeptides for breaking tolerance to self HER2 of an animal subject, the HER2 polypeptides including at least one point mutation in the extracellular domain of HER2.
The present invention also provides isolated HER2 antigenic polypeptides for inducing immune response against HER2 in a subject of a mammalian species. The HER2 polypeptides include an amino substitution of glutamine with lysine at position 141 of precursor feline HER2, or at position 119 of mature feline HER2, or at homologous positions of the HER2 of other species.
The present invention further provides HER2 gene expression constructs for the expression of these substituted antigenic HER2 polypeptides in living cells.
The present invention still further provides HER2 vaccine compositions for inducing immunity to HER2 in a mammalian subject, including an effective amount of one of the substituted HER2 gene expression constructs, and an effective amount of an adjuvant.
The present invention also provides methods for inducing an immune response to HER2 in a mammalian subject, including the steps of administering a substituted HER2 vaccine composition, and inducing an immune response to HER2.
The present invention further provides a method for inducing immune response to HER2 in a mammalian subject, using heterologous HER2 polypeptides. The method includes the steps of administering an effective amount of a gene expression construct encoding a heterologous unsubstituted (i.e. wild type) feline or bear HER2 polypeptide; administering an effective amount of an immunological adjuvant; expressing the gene construct in cells of the mammalian subject; and inducing an immune response against HER2 in the mammalian subject.
The present invention still further provides a method for inducing immune response to HER2 in a cat, including the steps of administering, to a cat, an effective amount of a gene expression construct encoding an antigenic polypeptide of human HER2, bear HER2, mouse HER2, rat neu, or human-rat chimeric HER2neu; administering an effective amount of an immunological adjuvant; expressing the gene construct in the cells of the cat, and inducing an immune response against HER2 in the cat.
The present invention also provides antigenic polypeptides for inducing immune response against HER2 in a mammalian subject, the antigenic polypeptides including either a substitution of glutamine with lysine at position 329 of precursor human HER2; a substitution of glutamine with lysine at position 307 of mature human HER2; a substitution of glutamine with arginine at position 429 of precursor human HER2; a substitution of glutamine with arginine at position 407 of mature human HER2; a substitution of asparagine with arginine at position 438 of precursor human HER2; and a substitution of asparagine with arginine at position 416 of mature human HER2. The invention provides these antigenic peptides as isolated peptides, gene expression vectors, and vaccine compositions.
The present invention further provides monoclonal antibodies selective for all of the previously mentioned substituted antigenic HER2 polypeptides.
The present invention still further provides a diagnostic test to determine whether a mammalian subject is sufficiently immunocompetent to respond to immunotherapy directed at self HER2.
The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the Office upon request and payment of the necessary fee.
Other advantages of the present invention are readily appreciated as the same becomes better understood by reference to the following detailed description when considered in connection with the accompanying drawings wherein:
FIG. 1 shows a table of primer pairs used for the authentication of feline mammary tumor lines;
FIG. 2 shows the authentication of the feline mammary tumor lines K248 and K12 via short tandem repeat (STR) analysis at 4 loci: FCA733 (Felis catus Failed Axon Connector, human homolog), FCA 749 (Thyroglobulin), MACROD2 (MACRO Domain Containing 2), and feline mtCR (Mitochondrial Control Region/d-Loop); PCR amplification was conducted using primer pairs listed in the table above; template DNAs were prepared with a DNeasy kit (Qiagen) from cultures of cat mammary tumor lines K248 and K12 or the human ovarian cancer line SKOV3 as a negative control; the left-hand panel shows predicted product sizes of STR regions from FCA733 (lanes 1-3), FCA749 (lanes 4-6), or MACROD2 (lanes 8-10); ladder (1 kb+, Invitrogen) is in lane 7; the right-hand panel shows product sizes of the feline mtCR PCR amplified in duplicate, with ladder in lanes 3 and 6; Amplified products matched expected sizes based on the current cat genome sequence assembly (c.f. www.ncbi.nlm.nih.gov/genome/guide/cat/) and the Felis catus mitochondrion (NC_001700.1); PCR products were verified by sequencing;
FIG. 3A shows expression of HER2 in feline mammary carcinoma by flow cytometric analysis of cell surface EGFR (HER1), HER2, HER3 and MHCI expression (open histograms) in FMC cell lines K12 and K248; human SKOV3 cells are included as controls; shaded histograms are unstained controls;
FIG. 3B shows expression of HER2 in feline mammary carcinoma by immunohistochemical analysis of three primary FMC samples and FMC line K248 outgrowth in SCID mice using polyclonal Ab to huHER2; H&E stains are shown in parallel;
FIG. 4A shows RTK (receptor tyrosine kinase) analysis of protein lysates from primary FMC tumor with paired uninvolved stromal tissue; phospho-Akt (S473) detection is indicated with a box;
FIG. 4B shows RTK analysis of FMC cell lines K12 and K248 were analyzed by PathScan RTK signaling array (Cell Signaling Technology). Phospho-Akt (S473) detection is indicated with a box; human SKOV3 was the control;
FIG. 5A shows RTK activity in FMC, as determined by Western blot analysis of total HER2, pHER2 (Y1248), total Akt and pAkt (S473) in primary FMC samples; feline PBL (peripheral blood leukocytes) was the negative control.
FIG. 5B shows the sensitivity of FMC cell lines to receptor tyrosine kinase inhibitors; cells were cultured in gefitinib or lapatinib for 48 h and the percentage of proliferative cells was measured with Alamar Blue by comparison to untreated controls; *p<0.001 two-way ANOVA with Dunnet's posttest;
FIG. 6A shows the amino acid sequences of human, cat, bear, rat, and mouse HER2, compared by clustal alignment ([*], identical a.a., [:], strongly similar a.a., [.], weakly similar a.a.); the signal peptide and transmembrane region are indicated with lines;
FIG. 6B summarizes the results of BLASTP analysis of full-length HER2 a.a. sequence identity;
FIG. 6C (top panel) shows a schematic of HER2 domains, and (bottom panel) flow cytometric analyses of the binding of four moAb to human HER2 (TA-1, N29, N12, Trastuzumab) and one moAb to rat neu (7.16.4); 3T3 cells transfected to express the indicated HER2 ECTM were stained with 1 μg/mL of the indicated moAb (open histogram) with detection by PE-conjugated secondary antibody; secondary antibody alone (shaded histogram) was the negative control;
FIG. 6D shows an annotated amino acid sequence of precursor feline HER2, highlighting the site of the 141 substitution;
FIG. 7 shows a construct for the expression of prefeHer2-Q141K (“feHER2-K”) in a host animal;
FIG. 8A shows the sequence of the feHER2ecd-hFc fusion protein;
FIG. 8B shows a schematic of the feHER2ecd-hFc fusion protein (top panel) and a Western blot verifying its composition (bottom panel);
FIG. 9A shows a flow cytometric analysis of the binding of 3T3/prefeHER2-Q141K by moAb to HER2/neu, with staining and analysis conducted as in FIG. 6C;
FIG. 9B shows antibody response to pprefeHER2, pprefeHER2-Q141K and pprehuHER2 in BALB/c mice before (Pre) and two weeks after 1× and 2× vaccination given in 2 wk intervals; horizontal lines depict the mean for each group (*p<0.05, **p<0.005 one-way ANOVA with Tukey's posttest);
FIG. 9C shows T cell response to feline and human HER2 in 2× vaccinated mouse splenocytes (n=4) or naïve mouse splenocytes (n=3) as measured by ELISPOT in triplicates using 10 μg recombinant antigen (*p<0.05, **p<0.01 two-way ANOVA with Dunnet's posttest);
FIG. 10A shows induction of anti-HER2 antibody in cats including feline anti-huHER2 (left panel), rat neu (rat HER2) (middle panel) or feHER2 (right panel) IgG titer induced by pE2Neu and pfeGM-CSF vaccination; serum samples were collected just before and 2 weeks after each of 4 vaccinations given in 3 week intervals. Antigen binding was analyzed by flow cytometry using transfected 3T3 cells;
FIG. 10B shows induction of anti-HER2 antibody in cats, including feline anti-huHER2 (left), feHER2-K (middle) or feHER2 (right) IgG titer induced by the indicated vaccines; serum samples were collected just before and 2 weeks after each of 4 vaccinations given in 3 week intervals; antigen binding was analyzed by flow cytometry using transfected 3T3 cells;
FIG. 10C shows the binding of immune sera to 3T3/feHER2 cells (top left panel), K12 tumor cells (top right panel) or K248 tumor cells (bottom panel), either prior to (shaded histogram) and two weeks after, the 4th vaccination (open histogram) with the indicated vaccines; each overlayed histogram represents an individual cat;
FIG. 11A shows a specificity control of mouse immune serum: binding of moAb TA-1 at indicated concentrations to 3T3 cells expressing prefeHER2, prefeHER2-Q141K, or prehuHER2; un-transfected 3T3 cells were the control;
FIG. 11B shows a specificity control of mouse immune serum: binding of immune serum from vaccinated mice to un-transfected 3T3 cells; each panel depicts the binding of pre-, post 1× and post 2× vaccination serum from an individual mouse;
FIG. 11C shows a specificity control of feline immune serum, based on an experiment with 3 cats; pre-vaccination (gray shaded) and two weeks post 4× vaccination (open histogram); serum was incubated at a 1:50 dilution with untransfected 3T3 cells followed by PE-anti-feline IgG; each panel represents an individual cat;
FIG. 11D shows a specificity control of feline immune serum, based on an experiment with 15 cats; pre-vaccination (gray shaded) and two weeks post 4× vaccination (open histogram); serum was incubated at a 1:50 dilution with untransfected 3T3 cells followed by PE-anti-feline IgG. Each panel represents an individual cat;
FIG. 12A shows a cartoon model of the effect of a Q141K substitution in feline HER2;
FIG. 12B shows a space filling model of the effect of a Q141K substitution in feline HER2;
FIG. 12C shows an surface electrostatic model of the effect of a Q141K substitution in feline HER2;
FIG. 13A shows the induction of human HER2-specific T cells in cats; PBMC were harvested after 4× vaccination and stimulated with 10 μg/mL rhuHER2-huFc or an IgG control; results are presented as IFNγ spot forming units (SFU)/106 PBMC; *p<0.05, **p<0.01 Mann-Whitney test;
FIG. 13B shows the induction of feline HER2-specific T cells in cats; PBMC were harvested after 4× vaccination and stimulated with 10 μg/mL rfeHER2-huFc or human IgG control; results are presented as IFNγ spot forming units (SFU)/106 PBMC; *p<0.05, **p<0.01 Mann-Whitney test;
FIG. 13C shows induction of feline HER2-specific T cells in cats; HER2 specific T cell response to feline HER2 is shown after a total of 7 vaccinations with pfeHER2-K with or without pE2Neu; *p<0.05, **p<0.01 Mann-Whitney test;
FIG. 13D shows human HER2 specific T cell response induced by pE2Neu or pbearHER2 followed by pfeHER2; *p<0.05, **p<0.01 Mann-Whitney test;
FIG. 13E shows feline HER2-specific T cell response induced by pE2Neu or pbearHER2 followed by pfeHER2; *p<0.05, **p<0.01 Mann-Whitney test;
FIG. 14A shows the binding of anti-human HER2 antibodies to 3T3 cells transiently transfected by lipofection with human HER2 mutant constructs encoding amino acid substitutions, with binding of moAb to HER2, Ab5 and N12 was measured by flow cytometry; Ab4 specific to rat neu is the negative control;
FIG. 14B shows the location of the amino acid substitutions shown in FIG. 14A on a schematic diagram of human HER2;
FIG. 15 shows a summary of results of a flow cytometric analysis of humoral immune response of wild-type BALB/c mice to human HER2 including amino acid substitutions; wild type BALB/c mice were electro-vaccinated i.m. with 60 ug HER2 construct+60 ug pmGMCSF divided in two sites; serum was collected 3 weeks after immunization and binding to Her2-expressing SKOV3 cells was assessed by flow cytometry;
FIG. 16 shows binding of HER2 transgenic (HER2Tg) mouse immune serum to 3T3 EKB cells transfected to express WT human HER2;
FIG. 17 shows a characterization of HER2 and EGFR expression in the human cancer cell lines used to detect the presence of HER2 and EGFR antibodies in the sera of immunized mice;
FIG. 18 shows an analysis of the binding of anti-human HER2 antibodies, induced in BALB Her2Tg mice by two rounds of vaccination with HER2 mutant DNA encoding amino acid substitutions, to the human cancer cell lines characterized in FIG. 17; * p<0.05, **p<0.005, by 2-tail student's t test; and
FIG. 19 shows an analysis of humoral immune response in BALB Her2Tg mice to human Her2 ECTM including amino acid substitutions; female BALB Her2Tg mice were electro-vaccinated twice at a 2-week interval; serum was collected 2 weeks after immunizations, and binding to HER2-expressing SKOV3 and TNBC SUM159 cells was assessed by flow cytometry; HER2 Ab levels elicited by each mutant construct were compared to the wild type pE2TM; * p<0.05, **p<0.005, by 2-tail student's t test.
The compositions and methods according to the present invention represent solutions to the problem of immunological tolerance of tumor hosts to the HER2 antigens of their tumors. They represent the first reported examples of deliberately introduced point mutations that convert HER2 polypeptides into antigens capable of breaking tolerance to self HER2, and inducing an immune response reactive to self HER2. In an exemplary embodiment, a point mutation brings about the substitution of glutamine with lysine (Q-K) in the amino acid sequence QLRSLTEILKGGVLI (SEQ ID NO: 109) of HER2 domain I, rendering the sequence KLRSLTEILKGGVLI (SEQ ID NO: 110).
In a related embodiment, the present invention includes isolated antigenic polypeptides for breaking tolerance and inducing immune response against HER2 in a mammalian subject. The polypeptides include a substitution of glutamine with lysine with (Q-K) or a with a conservative amino acid of lysine, at position 141 (Q141K) of precursor feline HER2, or at a homologous position of the precursor HER2 of another animal species. Precursor HER2 (preHER2) is defined as HER2 including a signal peptide, an extracellular domain (ECD) and a transmembrane domain (TM). For brevity, the term Q-K substitution will refer to both a substitution of Q with K, and to a substitution of Q with a conservative amino acid, such as arginine. Also included in this embodiment are antigenic polypeptides of mature HER2 (mHER2), that is, HER2 lacking a signal peptide, and including the ECD and TM. In mHER2, the Q-K substitution is at position 119 of mfeHER2, or at a homologous position of the mature HER2 of another species.
The specification of the Q141K or Q119K substitution at a “homologous position of the HER2 of another animal species” indicates that the substitution is made to the Q that is in the lead position in a highly conserved 15 aa sequence in domain I of ErbB2, the conserved sequence being QLRSLTEILKGGVLI (see, for example, the underlined feature of SEQ ID NO: 39 as shown in FIG. 6D for precursor feline HER2. Exemplary amino acid and nucleotide sequences of HER2 polypeptides are listed in Table 4.
A standardized notation system will be used to denote specific forms of HER2 polypeptides. The notation will refer both to a polypeptide gene product, and to the gene construct employed to induce expression of the gene product in an organism. In the notation system, the animal species from which the HER2 is derived will be abbreviated and italicized and placed before HER2. The identity and location of an amino acid substitution if any, will be hyphenated after HER2. A wild-type HER2 will lack a designated substitution. The designation of a precursor or mature form will be abbreviated “pre” or “m”, respectively, and placed to the left of the species. If the construct is included in a vector, the vector abbreviation will appear as the left-most term. For example:
An annotated amino acid sequence of unsubstituted prefeHER2 (SEQ ID NO: 39) and prefeHER2-Q141K (SEQ ID NO: 7) is shown in FIG. 6D. Other exemplary embodiments of the antigenic HER2 polypeptides having a Q141K or homologous substitution are described in Example 2. They include precursor feline HER-2 having a Q-K substitution at position 141 (prefeHER2-Q141K), precursor bear HER-2 having a Q-K mutation at position 141 (prebearHER2-Q141K), precursor human HER-2 having a Q-K mutation at position 141 (prehumHER2-Q141K), precursor mouse HER-2 having a Q-K mutation at position 142 (premouseHER2-Q142K), precursor rat HER-2 having a Q-K mutation at position 145 (preratHER2-Q145K), and precursor human rat chimeric HER2 having a Q-K mutation at position 141 (preE2Neu-Q141K). They also include mature feline HER2 having a Q-K substitution at position 119 (mfeHER2-Q119K); mature bear HER2 having a Q-K substitution at position 119 (mbearHER2-Q119K); mature human HER2 having a Q-K substitution at position 119 (mhumHER2-Q119K); mature mouse HER-2 having a Q-K substitution at position 120 (mmouseHER2-Q120K); mature rat HER2 (rat neu) having a Q-K substitution at position 120 (mratHER2-Q120K); and mature human rat chimeric HER2 having a Q-K substitution at position 119 (mE2Neu-Q119K)
Exemplary amino acid sequences for each of the substituted antigens as follows: prefeHER2-Q141K, SEQ ID NO: 7; prebearHER2-Q141K, SEQ ID NO: 8; prehumHER2-Q141K, SEQ ID NO: 9; premouseHER2-Q142K, SEQ ID NO: 10; preratHER2-Q145K, SEQ ID NO: 11; preE2Neu-Q141K, SEQ ID NO: 12; mfeHER2-Q119K, SEQ ID NO: 1; mbearHER2-Q119K, SEQ ID NO: 2; mhumHER2-Q119K, SEQ ID NO: 3; mmouseHER2-Q120K, SEQ ID NO: 4; mratHER2-Q120K, SEQ ID NO: 5; and mE2Neu-Q119K, SEQ ID NO: 6. It will be understood that the disclosed amino acid sequences are exemplary, and that the present invention encompasses all immunologically equivalent sequences.
The development of the antigenic HER2 polypeptides of the present invention was initiated on the basis of experiments in which it was found that heterologous electrovaccination with rat neu (rat HER2) overcame T cell tolerance in human HER2 transgenic (Tg) mice. The term “heterologous”, when used to refer to HER2, or another antigen, indicates that the antigen is derived from an animal species or species hybrid that is different from the species of the animal being vaccinated. Unfortunately, heterologous vaccination of human HER2 Tg mice with rat neu did not produce an effective humoral (B cell) response. The resulting immune sera did not cross react with human HER2 (Jacob, et al., 2006).
A hybrid antigen was next developed, which included portions of human HER2 and rat HER2 (rat neu), which will be referred to as E2Neu. This hybrid antigen included human HER2 extracellular domains (ECD) 1/2, rat neu ECD 3/4 and the rat neu transmembrane domain. E2Neu was incorporated into a gene construct for expression in animals, specifically the plasmid vector pE2Neu. The vector was delivered, as a component of a vaccine, to human HER2 Tg mice. The pE2Neu vaccine was found to induce both humoral and cellular (T cell) immunity against human HER2 in human HER2 Tg mice (Jacob, et al., 2010).
Because a chimeric human/rat form of HER2 broke tolerance as well as the pure heterologous rat form, and gave a more complete immune response than the pure rat form, it was hypothesized that results can be further improved by immunization with forms of HER2 that are more minimally altered from the HER2 of a human host or experimental animal.
In one test of this hypotheses, animal hosts were immunized with self HER2 containing point mutations, to afford immunogenicity while preserving HER2 epitopes. In experiments disclosed in Examples 3 and 4, certain point mutations in HER2 were found to confer enhanced immunogenicity in vaccination experiments. Each point mutation produced a single amino acid substitution in HER2.
Vaccination experiments with wild type and substituted forms of HER2 are described in Example 3. These vaccination experiments were performed not only in mice but also in a novel and highly realistic outbred cat tumor immunity model, which was utilized in experiments disclosed in Examples 1-4. Feline HER2 is more closely related to human HER2 than are the HER2s of mice or rats (FIG. 6B). Outbred cats show a range of genetic diversity, including MHC molecule diversity, comparable to that of humans, and not found in inbred rodent models.
In the experiments of Example 3, cats were immunized with a genetic vaccine including an expression vector which induced expression of the prefeHER2Q141K as well as wild type controls and heterologous HER2 forms. It was found that prefeHer2-Q141K was sufficiently foreign to break tolerance to self HER2 (i.e. feHER2) in outbred cats, inducing both antibodies and T cells reactive with feHer2. The antibodies and T cells were also reactive with Her2 molecules of humans and other species. Because these findings were obtained in the highly realistic outbred cat vaccine test system, it is reasonably predictable that they will also be applicable to other animal species. That is, it is predictable that HER2-K mutant antigens of cats and other animal species, in which Q141 or a homologous Q is substituted with K, will produce anti HER2 immunity in those animal species, when included in an appropriate vaccine composition. Indeed, it found, in experiments disclosed in Example 4, that the homologous substituted human HER2 polypeptide, prehumHER2-Q141K, broke tolerance to human HER2 in human HER2 transgenic mice.
Extrapolating from these findings, it is also predictable that the corresponding mature forms of HER2-Q141K, will also be effective in inducing immunity. The lack of a signal peptide is expected to have no effect on the reactivity of the Q-K substitution epitope, which is over a hundred residues distant, in the ECD. When expressed in a host cell, the mature forms of HER2 would not be processed into the secretory pathway and inserted into the cell membrane, but they would nonetheless be available to antigen presenting cells upon apoptosis or necrosis of the expressing cells. Thus, the previously enumerated mature forms of HER2, including a Q-K substitution at position 119 of feline HER2, or at a homologous position in other species, are also encompassed by the present invention.
In a related embodiment, the present invention includes gene expression constructs such as those utilized in Examples 2-4. The expression constructs include a nucleic acid sequence encoding an antigenic polypeptide of the HER2 of an animal species, and specifically encoding the Q141K substitution at position 141 of precursor feline HER2 (prefeHER2-Q141K), or at position 119 of mature feline HER2 (mfeHER2-Q119K), and at homologous positions of the precursor and mature forms of HER2 of other animal species. The expression construct additionally includes at least one promoter operatively linked to said nucleic acid sequence encoding a HER2 polypeptide, for expression of said antigenic peptide in a living cell.
The encoded constructs, and exemplary nucleic acid sequences encoding them, include: mfeHER2-Q119K, SEQ ID NO: 13; mbearHER2-Q119K, SEQ ID NO: 14; mhumHER2-Q119K, SEQ ID NO: 15; mmouseHER2-Q120K, SEQ ID NO: 16; mratHER2-Q120K, SEQ ID NO: 17; mE2Neu-Q119K, SEQ ID NO: 18; prefeHER2-Q141K; SEQ ID NO: 19; prebearHER2-Q141K, SEQ ID NO: 20; prehumHER2-Q141K, SEQ ID NO: 21; premouseHER2-Q142K, SEQ ID NO: 22; preratHER2-Q145K, SEQ ID NO: 23; and mE2Neu-Q141K, SEQ ID NO: 24. It will be understood that the recited nucleic acid sequences are only exemplary, and that each specified polypeptide can be encoded by one or more synonymous nucleic acid sequences without departing from the scope of the present invention. The nucleic acid sequences are preferably DNA sequences, but may alternatively comprise at least one RNA molecule.
The gene construct also includes at least one promoter operatively linked to the nucleic acid sequence encoding a HER2 Q-K substituted polypeptide, to promote expression of the gene product in a mammal or other organism. The promoter or other regulatory element is selected to ensure that the nucleic acid sequence is transcribed and translated into the antigenic polypeptide upon introduction into a living cell. An exemplary promoter is the cytomegalovirus (CMV) promoter, but any suitable promoter known in the art can be utilized, including, but not limited to, the cytomegalovirus (CMV) promoter, the Rous sarcoma virus (RSV) promoter; the SV40 virus promoter, and the mammalian housekeeping promoter EF1 (elongation factor 1).
A preferred expression vector is the naked DNA plasmid vector pVAX1 (Life Technologies, Grand Island, N.Y.), but any suitable vector system known in the art can be employed with routine modifications, depending on the cell type in which expression is to be obtained. In the Examples, gene constructs are expressed in mammalian hosts and in cultured mammalian cells, but with suitable expression vectors they can also be expressed in bacteria, yeasts, insect cells, and any other desired host. Appropriate techniques or references thereto can be found in Green and Sambrook (2012).
In a related embodiment, the present invention includes a vaccine composition for inducing immunity to HER2 in a mammalian subject. The vaccine composition includes an effective amount of at least one of the previously enumerated isolated HER2 polypeptide antigens or, more preferably, an effective amount of at least one of the previously mentioned gene expression constructs. The gene expression construct is expressible the living cells of the mammalian subject. The vaccine composition preferably includes an adjuvant to amplify immune response to the antigen. The present invention also includes methods for inducing immune response to HER2 in a mammalian subject, including the steps of administering an effective amount of the vaccine composition, and inducing an immune response to HER2.
An effective amount of vaccine composition is defined as one which produces an observable antigen-specific humoral and/or cellular immune response, and if administered as a therapy, a reduction in a population HER2-expressing target cells. The effective amount of a particular vaccine composition can be determined by one skilled in the art on the basis of preliminary trials in which increasing doses are given, and, as warranted, multiple courses of administration are tested. The extent of T or B cell response is measured by, for example, ELISA, cytotoxicity or growth suppression assays, and ELISPOT or other cytokine release assays. The effective amount can be adjusted to account for differences in host weight, species, or physical condition.
Exemplary gene constructs for vaccination techniques, according to the present invention, include HER2 antigens encoded into the naked DNA plasmid expression vector pVax, as described in detail in Examples 3 and 4. The preferred adjuvant is GM-CSF, administered either in soluble form or as a nucleic acid expression vector, which results in GM-CSF expression at a vaccination site. Preferably, the GM-CSF is preferably delivered as an expression plasmid.
Alternatively, the HER2 antigen gene constructs of the present invention can be cloned into any plasmid, or bacterial, or viral vector that can serve as a vaccine vector, to transfect or transduce mammalian cells. Examples include a retrovirus vector, an adenovirus vector, a lentivirus vector, a vaccinia virus vector, a pox virus vector, an adenovirus-associated vector, a virus-like particle, a Salmonella vector, a Shigella vector, a Listeria vector, a Yersinia vector, and an Escherichia vector. Techniques for expression of proteins using viral vectors can be found in Adolph, K. ed. “Viral Genome Methods” CRC Press, Florida (1996) and in Harrop, et al., 2006. Techniques for the use of attenuated bacterial vectors such as Salmonella, Shigella, Listeria, Yersinia, and Escherichia species are found for example in Vassaux et al., 2006. Vaccination is preferably accompanied by a cytokine adjuvant, such as -1, -2, -3, -6, -12, gamma-interferon, tumor necrosis factor, GM-CSF, or flt-3 ligand, delivered either as an expression construct, or as a cytokine protein.
Although electrovaccination is the preferred delivery mode, the gene expression constructs of the present invention can alternatively be packaged into liposomes or coated onto colloidal gold particles prior to administration. The gene expression constructs can then be administered intradermally, subcutaneously or intramuscularly by injection or by gas driven particle bombardment. Alternatively, the gene expression constructs can be administered to host cells ex vivo. Host cells, such as bone-marrow derived cells, can be induced to express the HER2 polypeptide antigens, and then reintroduced to the host to effect immunization. Appropriate techniques can be found in Sudowe, S. and Reske-Kunz, A. B. eds. “Biolistic DNA Delivery: Methods and Protocols”, Humana Press, New York City (2012), and Raz, E., ed. “Gene Vaccination: Theory and Practice, Springer, New York City (1998).
The antigenic HER2 polypeptides of the present invention can also be administered as isolated polypeptides, as a component of a vaccine composition that can also include at least one adjuvant, including but not limited to incomplete or complete Freund's adjuvant, alum, QS21, TITERMAX; cytokines, and cytokines such as, interleukins-1, -2, -3, -6, -12, gamma-interferon, tumor necrosis factor, GM-CSF, or flt-3 ligand. The vaccine composition, with or without adjuvant, can be administered in a pure preparation, or admixed with a pharmaceutically acceptable carrier, diluent, or excipient, as a sterile suspension, emulsion, or in a lipid carrier such as a liposome. Delivery can be by subcutaneous, intradermal, intramuscular, intranasal, or intravenous routes.
In another embodiment, the present invention includes antibodies that selectively bind each of the substituted HER2 antigenic polypeptides disclosed herein. The term “selectively binds”, when applied to an antibody of the present invention, indicates that the antibody (a) binds at a level above background to a particular substituted HER2 antigenic polypeptide, with background taken as the level of binding of a nonspecific reference agent such as a matched immunoglobulin isotype control; and (b) binds at a level at or below background to the corresponding wild type HER2 peptide.
With the amino acid sequences disclsosed herein, one skilled in the art can readily generate antibodies selective for each of the substituted HER2 polypeptides. Thus, the present invention includes monoclonal antibodies selective for substituted HER2 polypeptides, the substituted HER2 polypeptides being selected from the group consisting of: prefeHER2-Q141K mfeHER2-Q119K, prebearHER2-Q141K, mbearHER2-Q119K, prehumHER2-Q141K, mhumHER2-Q119K, premouseHER2-Q142K, mmouseHER2-Q120K, preratHER2-Q145K, mratHER2-Q120K, preE2Neu-Q141K, mE2Neu-Q119K, prehumHER2-Q329K, mhumHER2-Q307K, prehumHER2-Q429R, mhumHER2-Q407R; prehumHER2-N438D, and mhumHER2-N416D. Monoclonal antibodies according to the present invention can be obtained by using the polypeptides or their antigenic fragments as the antigens. For example, an antibody can be obtained by preparing hybridomas by fusion of myelomas, or other mammalian cells capable of infinite proliferation, with antibody-producing cells collected from mammals immunized with one of the antigens. Hybridoma clones capable of producing monoclonal antibody are cultured in vivo or in vitro. The preferred method of immunizing a mammal is by electrovaccination with expression vectors encoding mutant HER2, as described in Examples 3 and 4.
Alternatively, immunizations can be performed with purified or partially purified antigenic polypeptides. For example, the antigens can be in the form of live or killed cells expressing mutant HER2, or the partially purified culture supernatants or homogenates of such cells. In another alternative, the antigens are prepared chemically by peptide synthesis based on the amino acid sequences disclosed herein for the substituted polypeptides.
Immunization with antigenic polypeptides is performed by techniques well known in the art. For example, antigens, preferably in combination appropriate adjuvants, are injected into mammals intradermally, subcutaneously, intramuscularly, intraperitoneally, or intravenously. Rodents such as rats, mice and hamsters can be used. Depending upon species, the total dose of the antigens is generally in the range of about 5-500 μg of purified antigen or equivalent per animal.
Immunizations are performed 2-5 times at an interval of 1-2 Weeks. After the course of immunization, the animal's spleen is extracted and dispersed into a suspension of spleen cells. The antibody-producing cells and the myeloma cells obtained in the above are fused into a cell fusion mixture containing the objective hybridomas.
Suitable myeloma cells include mouse myeloma lines, such as P3-NS1-Ag4-1 cells (ATCC TIB18), P3-X63-Ag8 cells (ATCC TIB9), SP2/O—Ag14 cells (ATCC CRL1581), and other mutants which lack the HGPRT (hypoxanthine-guanine phosphoribosyltransferase) gene.
Cell fusion is carried out by techniques well known in the art, such as incubation with polyethylene glycol or Sendai virus, or by electric pulse. For example, fusion partners are suspended in fusion media containing fusion accelerators, and incubated at about 30-40° C. for about 1-5 min. Conventional serum-free media such as minimum essential medium (MEM), RPMI 1640 medium, and Iscove's Modified Dulbecco's Medium (IMDM) are preferred fusion media. To select hybridomas, the resultant cell fusion mixture is transferred to selection media such as HAT medium, and incubated at about 30-40° C. for from 3 days to 3 weeks, after which point only hybridomas are expected to survive. Detailed fusion and selection protocols are found in Harlow and Lane 1988 and Pandey, 2010.
Hybridomas are cultured as monoclonal populations, and antibodies secreted into culture are screened for reactivity with the immunizing antigen, preferably expressed on cells. Screening is preferably by immunofluorescence assays such as those described in Example 1. Alternatively, well known assays such as enzyme linked immunoassay and radioimmunoassay are used. See, for example Harlow and Lane, 1988
For selection of antibodies specifically reactive to the substituted HER2 antigens of the present invention, immunoassay screening techniques are employed to determine which of the monoclonal antibodies are reactive with the substituted antigen but not to the corresponding non-substituted antigen. Preferably, the immunoassay is an immunofluorescence assay, and the targets for immunofluorescence staining are cells transfected with either the substituted or non-substituted form of the HER2 antigen. Exemplary techniques for transfecting 3T3 cells with HER2 antigen constructs, and for assaying specific antibody binding to the transfected cells, are described in Piechocki, et al., 2001. Hybridoma clones secreting antibodies that bind specifically to the substituted form of the HER2 antigen, but not to the unsubstituted form, are producing the selective antibodies of the present invention. These clones are cultured or stored according to standard techniques. The monoclonal antibodies produced by these clones are harvested from culture in vivo, for example from animal ascites culture, or in vitro, from culture medium. The antibodies are purified by techniques such as protein A or Protein G affinity chromatography, salting out, dialysis, ultrafiltration, ion-exchange chromatography, affinity chromatography, high performance liquid chromatography (HPLC), gel electrophoresis, and isoelectrophoresis, or an appropriate combination of techniques. Once purified, the monoclonal antibodies are refrigerated, frozen, or lyophilized for storage.
Alternatively, one skilled in the art can utilize the HER2 antigens of the present invention to generate monoclonal antibodies by antibody phage display techniques. For example, cats are vaccinated with feHER2 or feHER2-Q141K, and RNA is extracted from bone marrow cells or PBLs. The RNA is used for the preparation of oligo dT-primed cDNA libraries, as described by Konthur and Walter (2002). Variable heavy (VH) and variable light (VL) chain orfs are PCR amplified based on reported sequences (www.ncbi.nlm.nih.gov/genome?term=felis%20catus), then Ig cDNA libraries are generated following the protocol described by Hammers and Stanley (2014). For screening purposes, phagemids such as pCombo3X are used to express these two chains as an scFv fused to the pill minor capsid protein of an engineered filamentous bacteriophage (originally derived from M13) (Hammers and Stanley 2014). The cognate antigen used for screening is recombinant fe HER2ecd-Fc (SEQ ID NO: 69), which is immobilized on sterile dishes via Fc binding. Screening is carried out with the pCombo3x/feHER2scFv library. A round of screening consists of binding of the feHER2scFv library to immobilized feHER2ecd-Fc to capture clones with high-affinity binding (“biopanning”), washing to remove background non-binding phage, elution of bound phage/scFv, infection of competent E. coli, expression and recovery via addition of helper phage, and preparation of recovered phage/scFv library for another round of screening. Several rounds of such screening are required to achieve sufficient purity of the aHER2 fe-scFv for functional and genetic analysis. Affinities of ˜1 nMolar are readily achievable (Hammers and Stanley 2014; Carmen and Jemutus 2002). The cloned aHER2-fe-scFv can be 1) used directly as a recombinant scFv, 2) stabilized by fusion to an Fc domain (as in SEQ ID NO: 69) for use in vivo, or 3) reconstructed into full-length IgG light and heavy chains for production of aHER2 monoclonal Ab's of interest.
Human anti-HER2 mAb's are engineered by the same protocol using human PBLs for generating the initial Ig cDNA libraries.
In another embodiment, the present invention includes methods for immunizing a mammalian subject against HER2, using heterologous, unsubstituted (“wild type”) antigenic polypeptides of bear HER2 or feline HER2. While these HER2 polypeptides are known, naturally occurring polypeptides, their inclusion in a method to induce immunity against HER2 represents a novel use. The methods include vaccination with an effective amount of expression construct, as previously described for the methods involving Q to K mutants of HER2. The unsubstituted bear and feline HER2 polypeptides were found to be effective antigens in experiments testing the hypothesis that anti-HER2 response can be achieved by immunization of a host with HER2 that is heterologous, but relatively closely matched to self HER2. Cat and bear HER2 are more closely related to human HER2 than is, for example, rodent HER2 (FIG. 6B). As disclosed in Example 3, bear HER2 broke the HER2 tolerance of cats, and induced both antibodies and T cells that reacted against feline HER2.
Therefore, the present invention includes a method for inducing immune response to HER2 in a mammalian subject, beginning with the step of administering, to a mammalian subject, an effective amount of a gene construct comprising a nucleic acid sequence encoding a heterologous antigenic polypeptide selected from the group consisting of precursor unsubstituted bear HER2 (prebearHER2); mature unsubstituted bear HER2 (mbearHER2); precursor unsubstituted feline HER2 (prefeHER2); and mature unsubstituted feline HER2 (mfeHER2). The gene construct additionally includes at least one promoter for expression of said antigenic peptide in a living cell. The step of administering the gene construct is followed by the steps of administering an effective amount of an immunological adjuvant, expressing the gene construct in cells of the mammalian subject, and inducing an immune response against HER2 in the mammalian subject.
In another embodiment, the present invention includes methods for immunizing cats against self HER2 with vaccines including antigenic polypeptides including the ECD and TM domains of wild type human, mouse, rat, or bear, HER2, and the human-rat hybrid E2neu. Both the precursor and mature forms are included. Use of these antigens for the immunization in experimental rodent models is known, but their administration to cats as an effective anti-HER2 vaccine in cats is a novel use. These antigens are known but their use in methods of inducing immunity to self HER2 in cats is novel. Again, the methods include vaccination with an effective amount of expression construct, as previously described. Exemplary antigenic polypeptides included in the HER2 antigens include: prebearHER2, SEQ ID NO: 37; mbearHER2, SEQ ID NO: 38; prefeHER2. SEQ ID NO: 39; mfeHER2, SEQ ID NO: 40; prehumHER, SEQ ID NO: 45; mhumHER2, SEQ ID NO: 46; premouseHER2, SEQ ID NO: 47; mmouseHER2, SEQ ID NO: 48; preratHER2, SEQ ID NO: 49; mratHER2, SEQ ID NO: 50; preE2Neu, SEQ ID NO: 51; and mE2Neu, SEQ ID NO: 52. Where the antigenic polypeptides are administered in the form of expression constructs, they can be encoded in the following exemplary polynucleotide sequences, or in synonymous sequences thereof: prebearHER2, SEQ ID NO: 41; mbearHER2, SEQ ID NO: 42; prefeHER2, SEQ ID NO: 43; mfeHER2, SEQ ID NO: 44; prehumHER, SEQ ID NO: 53; mhumHER2, SEQ ID NO: 54; premouseHER2, SEQ ID NO: 55; mmouseHER2, SEQ ID NO: 56; preratHER2, SEQ ID NO: 57; mratHER2, SEQ ID NO: 58; preE2Neu, SEQ ID NO: 59; and mE2Neu, SEQ ID NO: 60.
An additional panel of substituted human HER2 polypeptides was also found to break tolerance to human HER2 in mice transgenically expressing human HER2 (human Tg mice), in experiments described in Example 4. Human HER2 is self HER2 in human HER2 Tg mice, and these mice are well known to exhibit strong tolerance to human HER2 (Piechocki, et al., 2003). The additional HER2 polypeptides found to be effective tolerance-breakers included precursor human HER2 having a Q-K substitution at amino acid 329, or a substitution of arginine for glutamine (Q-R) at amino acid 429, or a substitution of aspartic acid for asparagine (N-D) at position 438. The mature forms of these substituted HER2 antigens are reasonably predicted to be equivalently immunogenic to the precursor forms, for reasons previously stated.
Therefore, the present invention provides antigenic polypeptides for inducing immune response against HER2 in a mammalian subject, The polypeptides include at least the extracellular and transmembrane domains of human HER2, the extracellular domain including at least one of the following amino acid substitutions: glutamine with lysine (Q-K) or a conservative amino acid of lysine, at position 141 of precursor humanHER2 (prehumHER2-Q141K); glutamine with lysine (Q-K) or a conservative amino acid of lysine, at position 119 of mature humanHER2 (mhumHER2-Q119K); glutamine with lysine (Q-K) or a conservative amino acid of lysine, at position 329 of precursor humanHER2 (prehumHER2-Q329K); glutamine with lysine (Q-K) or a conservative amino acid of lysine, at position 307 of mature humanHER2 (mhumHER2-Q307K); glutamine with arginine (Q-R), or a conservative amino acid of arginine, at position 429 of precursor human HER2 (prehumHER2-Q429R); glutamine with arginine (Q-R), or a conservative amino acid of arginine, at position 407 of mature human HER2 (mhumHER2-Q407R); asparagine with aspartic acid (N-D), or a conservative amino acid of aspartic acid, at position 438 of precursor human HER2 (prehumHER2-N438D); and asparagine with aspartic acid (N-D), or a conservative amino acid of aspartic acid, at position 416 of mature human HER2 (mhumHER2-N416D).
Exemplary amino acid sequences for each of the substituted antigens as follows: prehumHER2-Q141K (SEQ ID NO: 9); mhumHER2-Q119K (SEQ ID NO: 3;); prehumHER2-Q329K (SEQ ID NO: 28); mhumHER2-Q307K (SEQ ID NO: 25); prehumHER2-Q429R (SEQ ID NO: 29); mhumHER2-Q407R (SEQ ID NO: 26); prehumHER2-N438D (SEQ ID NO: 30); and mhumHER2-N416D (SEQ ID NO: 27). It will be understood that the disclosed amino acid sequences are exemplary, and that the present invention encompasses all immunologically equivalent sequences.
The antigenic peptides are provided as isolated polypeptides, and also as polypeptides encoded as nucleic acid sequences in gene constructs. Each gene construct additionally includes at least one promoter operatively linked to the nucleic acid sequence, with the promoter inducing the expression of the encoded antigenic polypeptide in a living cell.
The encoded constructs, and exemplary nucleic acid sequences encoding them, include: prehumHER2-Q141K, SEQ ID NO: 21; mhumHER2-Q119K, SEQ ID NO: 15; prehumHER2-Q329K, SEQ ID NO: 34; mhumHER2-Q307K, SEQ ID NO: 231; prehumHER2-Q429R, SEQ ID NO: 35; mhumHER2-Q407R, SEQ ID NO: 32; prehumHER2-N438D, SEQ ID NO: 36; and mhumHER2-N416D, SEQ ID NO: 33. It will be understood that the recited nucleic acid sequences are only exemplary, and that each specified polypeptide can be encoded by one or more synonymous nucleic acid sequences without departing from the scope of the present invention. The nucleic acid sequences are preferably DNA sequences, but may alternatively comprise at least one RNA molecule.
In a related embodiment, the present invention provides the additional panel of HER2 antigen constructs in a vaccine composition for inducing immunity to HER2 in a mammalian subject, the vaccine composition including an effective amount of at least one of the gene constructs and an effective amount of an adjuvant. An exemplary use of these vaccine compositions is disclosed in Example 4.
In another related embodiment, the present invention includes monoclonal antibodies selective for each member of the additional panel of substituted human HER2 polypeptides. As previously stated, with the amino acid sequences disclosed herein, one skilled in the art can readily generate antibodies selective for each of the substituted HER2 polypeptides.
In order to respond to vaccines against self HER2, a host must possess an immune system sufficiently competent to overcome tolerance in response to vaccination. The immunodepression characteristic of mammary carcinomas and other cancers can prevent the success of even the most potent vaccine. In one embodiment, the present invention includes a diagnostic method for determining whether a host is capable of making a response to self HER2.
In the diagnostic method, a sufficient amount of vaccine known to break tolerance to the HER2 of host species is administered to a candidate host for anti-HER2 immunotherapy. A vaccine “known to induce immune response” is a vaccine which has been shown to produce a measurable benefit to at least a subset of similarly disposed mammalian hosts, for example in a clinical or preclinical trial. The vaccines include those that incorporate the substituted HER2 polypeptide antigens of the present invention, which are shown to induce immunity in Examples 3 and 4. After the vaccine has been administered, the subject is monitored for the development of cellular and/or humoral immunity to self HER2, for example by means of the immunoassays described in Example 3. If detectable immune response is detected, then the candidate host is recognized as being sufficiently immunocompetent to respond to immunotherapy directed at self HER2. Ideally, the diagnostic test represents a minimal, initial course of vaccination, with the results determining whether a more extensive course of vaccination will next be administered.
The invention is further described in detail in reference to the following examples, which are provided for the purpose of illustration only, and are not intended to be limiting. Thus, the present invention should in no way be construed as being limited to the following examples, but rather, be construed to encompass any and all variations which become evident as a result of the teaching provided herein.
Expression and Function of HER-2 in Feline Mammary Carcinoma Cell Lines and Explants.
Materials and Methods
Animals and Tissues
BALB/c mice were purchased from Charles River Laboratory. Pathogen free (SPF) purpose bred domestic shorthair cats aged 6 months-2 years were obtained from Liberty Research, Inc (Liberty, N.Y.). Animals were housed and maintained in the Department of Laboratory Animal Resource (DLAR) facility at the Wayne State University School of Medicine in accordance with Institutional Animal Care and Use Committee guidelines. The experimental cats were adopted as domestic pets by the care taker community after completion of the study. A black bear legally harvested in Ontario, Canada was the donor of the liver tissue.
Feline mammary carcinoma (FMC) samples were obtained from mastectomy tissues of two feline patients treated at Oakland Veterinary Referral Services (OVRS) in Michigan with consent from the cat owners (Table 1).
| TABLE 1 |
| Feline Mammary Carcinoma Patients |
| Cat | Breed | Sex | Spayed | Age | |
| OVRS-1A | Rex | F | Y | 8 | |
| OVRS-1B | 9 | ||||
| OVRS-2 | DSH | F | Y | 13 | |
| CSU-133 | Persian | F | N | 12 | |
| CSU-418 | DLH | F | Y | 5 | |
| CSU-1646 | DSH | F | Y | 5 | |
OVRS-1A and OVRS-1B are two independent primary tumors from the same cat. Three additional mammary tumor samples with paired, uninvolved stromal tissues were purchased from Colorado State University (CSU-133, 418, and 1646).
Cell Lines
K248 established from a pulmonary metastasis of a Siamese cat mammary carcinoma was provided by Dr. John Hilkens and the late Dr. Wim Misdorp at the Netherland Cancer Institute (Minke, et al., 2010). Mammary carcinoma line K12 from a 14 year old cat was established by Dr. William Hardy, Jr. and provided by Dr. Jaime Modiano of the University of Pennsylvania, PA (Modiano, et al., 1991). SKOV3 cells were purchased from the American Type Culture Collection. MCF7 cells were obtained from Lisa Polin of the Karmanos Cancer Institute. All cells were maintained in Dulbecco's Modified Eagle's Medium supplemented with fetal bovine sera, penicillin and streptomycin. The feline origin of K248 and K12 cells was authenticated by short tandem repeat (STR) analysis of four loci (FIGS. 1 and 2.).
Immunohistochemical Analysis
Pathological diagnoses were performed according to the WHO classification for tumors in domestic animals. For feline HER2 detection, epitopes were retrieved with sodium citrate buffer (pH 6.0) and histological grade primary antibodies were applied according to manufacturer's recommendation (HER2, clone Z4881, Invitrogen) followed by broad-spectrum HRP polymer conjugate (SuperPicTure™ Polymer Detection Kit, Zymed) and DAB substrate (Pierce Biotech). Feline mammary tumor cells, K248, were injected subcutaneously in SCID mice. Tumor explants were used as controls.
Cell Proliferation Assay
Cells were plated at 2-5,000/well in 96-well plates and treated with gefitinib or lapatinib in quintuplicate for 48 h. Alamar Blue reagent (Life Technologies) was added and fluorescence measured after 3-4 h. The % proliferative activity was determined relative to the average of untreated samples.
Western Blot Analysis
Cells or tissues were lysed in a non-ionic detergent lysis buffer (Gibson, et al., 2013) with protease inhibitor cocktail (Roche Diagnostics) immediately after the addition of phosphatase inhibitors (NEB). Total protein was quantified by BCA assay (Pierce Biotech). Ten μg protein was boiled in Laemmli buffer, separated with 8% SDS-polyacrylamide (PAGE) gel and transferred onto PVDF membrane for overnight incubation with antibody to HER2 (42/c-erbB-2, BD Biosciences), phospho-HER2 Y1248 (polyclonal, Cell Signaling Technology), Akt (polyclonal, Cell Signaling Technology), phospho-Akt S473 (587F11, Cell Signaling Technology) or b-Actin (I-19, Santa Cruz Biotech). After washing in TBS-Tween, membranes were incubated with horseradish peroxidase (HRP)-conjugated secondary antibody before washing and development using enhanced chemiluminescent reagents (Thermo Scientific).
Flow Cytometric Analysis
HER2/neu epitopes were detected by moAb TA-1 (Calbiochem), Trastuzumab (Genentech), 7.16.4 (Calbiochem), N12, and N29 (hybridoma lines were generous gifts of Dr. Yosef Yarden, Weissman Institute, Isreal). moAb to human EGFR (528, Santa Cruz Biotech), HER3 (SGP1, eBioscience) and HLA-ABC (W6/32, eBioscience) were used as indicated. Phycoerythrin-conjugated goat anti-mouse or anti-human IgG was the secondary antibody (Jackson ImmunoResearch). Flow cytometric analysis was performed using FACS Canto II and data analyzed with FlowJo (Tree Star).
To measure antibody level in immune sera, mouse or feline sera were incubated with 3T3 cells transfected to express the designated antigen and detected by PE-conjugated anti-mouse or feline IgG secondary antibody (SantaCruz). Mouse antibody concentrations were extrapolated from a standard curve of HER2 moAb TA-1. Feline antibody titers were determined by serial dilution until binding was no longer detected above isotype control.
Results
In a step toward establishing an outbred cat model of HER2 immunity, the expression and signaling functions of HER2 in feline mammary carcinoma cell lines was characterized. These HER2 properties were also compared those of spontaneous feline mammary carcinomas and known HER2-expressing cell lines.
Expression of HER2 in Feline Mammary Carcinoma (FMC)
Expression of ERBB family receptor tyrosine kinase (RTK) in FMC was measured by flow cytometry. Surface expression of HER1 (EGFR), HER2, and HER3 was detected in K12 and K248 cells, using moAbs to their human homologs (FIG. 3A) (FIG. 3A). MHC I expression was also detected with moAb W6/32 to a constant region of human MHC I. Control human ovarian cancer cell line SKOV3 showed elevated HER2, while lacking HER3 expression (Gostring, et al., 2012). Feline HER2 expression in primary FMC clinical samples (Table 1) was detected by IHC staining (FIG. 3B). Membrane staining of HER2 was detected in all three primary FMC samples and in K248 explant, consistent with membrane staining of K248 cells by flow cytometry (FIG. 3A). Membranous expression of HER2 in FMC would be expected to permit recognition by effectors of both humoral and cellular immunity. Cytoplasmic staining was also detected in OVRS-1A and the K248 explant and may indicate accumulation of incompletely or incorrectly processed HER2. The clinical significance of cytoplasmic HER2 remains unclear but T cells would be expected to recognize cytoplasmically derived peptides in the context of MHC I and II molecules.
Receptor Tyrosine Kinase (RTK) Activity in FMC
Activation of RTK signaling in FMC was tested using a human RTK array (R&D Systems), FIGS. 4A and 4B. Although cross-reactivity with feline antigens by all antibodies in this array was not verified, AKT phosphorylation (S473) was elevated in 3/3 FMC tissue samples CSU-133, 418, and 1646, compared to their paired, uninvolved stromal tissue. AKT phosphorylation was also observed in K12 and K248 cells consistent with RTK pathway activation in FMC. HER2 (Y1248) and downstream AKT (S473) phosphorylation in primary FMC tissue was further tested by Western blotting (FIG. 5A). Total and phosphorylated HER2 and AKT were detected in FMC OVRS-2, CSU-133, CSU-418 and CSU-1646, demonstrating activation of HER2 and downstream RTK signaling events.
To further test if ERRB RTK signaling is required for FMC cell proliferation, FMC cell lines K12 and K248 were cultured with or without ERRB family tyrosine kinase inhibitors gefitinib or lapatinib. Both K12 and K248 exhibited dose-dependent inhibition of cell proliferation. SKOV3 and MCF7 cells were the positive and negative control, respectively (FIG. 5B). Therefore, FMC express functional tyrosine kinase receptors which trigger downstream signaling and cell proliferation.
The results show that the FMC cell lines are useful models for the induction and effects of anti-HER2 immune response.
Cloning and Characterization of Substituted Feline Her2, and Her2 of Other Species
Materials and Methods
DNA Cloning and Construction
Cloning primer sequences are shown in Table 2.
| TABLE 2 |
| CLONING PRIMERS |
| cDNA product | Primer | Sequence (5′ to 3′) | SEQ ID NO |
| Feline HER2 ECTM | Forward | ATTAC TACAA GCTTG AGACC ATGGA GCTGG | SEQ ID NO: 70 |
| (prefeHER2) | CGGCC TGGT | ||
| Feline HER2 ECTM | Reverse | TACTA ATCTA GATCA CATCG TGTAC TTCCG | SEQ ID NO: 71 |
| (prefeHER2) | GATCT TCTG | ||
| Feline HER2 ECD- | Forward | CACCA AGCTT GAGAC CATGG AGCTG G | SEQ ID NO: 72 |
| Fc | (HER2 | ||
| ECD) | |||
| Feline HER2 ECD- | Reverse | GATTT GGGCT CGGAC GTCAC AGGGC TGG | SEQ ID NO: 73 |
| Fc | (HER2 | ||
| ECD) | |||
| Feline HER2 ECD- | Forward | CTGTG ACGTC CGAGC CCAAA TCTTG TGAC | SEQ ID NO: 74 |
| Fc | (Fc tag) | ||
| Feline HER2 ECD- | Reverse | TCTAG ATTAT TTACC CGGAG ACAGG GAGAG | |
| Fc | (Fc tag) | GCTC | SEQ ID NO: 75 |
| Black bear HER2 | Forward | TAAGC TTGAG ACCAT GGAGC TGGCG GCCTG | |
| ECTM | GTG | SEQ ID NO: 76 | |
| (prebearHER2) | |||
| Black bear HER2 | Reverse | CTCTA GATTC ACATC GTGTA CTTCC GGATC | |
| ECTM | TTC | SEQ ID NO: 77 | |
| (prebearHER2) | |||
| Feline GM-CSF | Forward | CACCA TGTGG CTGCA GAACC TGCTT TTCCT G | SEQ ID NO: 78 |
| Feline GM-CSF | Reverse | TTACT TCTGG TCTGG TCCCC AGCAG TC | SEQ ID NO: 79 |
| prefeHER2-Q141-K | Forward | GCGGGAGCTGaAGCTCCGAAG | SEQ ID NO: 103 |
| and mfeHER2- | |||
| Q119-K | |||
| prefeHER2-Q141-K | Reverse | AGCCCTCCTAGGGCAGCCCCTGTAG | SEQ ID NO: 104 |
| and mfeHER2- | |||
| Q119-K | |||
| prebearher2-Q141K | Forward | AAGCCTCACAGAGATCCTGAAG | SEQ ID NO: 111 |
| and mbearher2- | |||
| Q119K | |||
| prebearher2-Q141K | Reverse | CGAAGCTTCAGCTCCCGCAGCCCTC | SEQ ID NO: 112 |
| and mbearher2- | |||
| Q119K | |||
| pre mouseHER2- | Forward | AGTCTCACAGAGATCTTGAAGG | SEQ ID NO: 113 |
| Q142K and | |||
| mmouseHER2- | |||
| Q120K | |||
| pre mouseHER2- | Reverse | TCGAAGCTTCAGCTCCCGCAGCCC | SEQ ID NO: 114 |
| Q142K and | |||
| mmouseHER2- | |||
| Q120K | |||
| preratHER2-Q145K | Forward | GCTTCGAAGTCTCACAGAGATC | SEQ ID NO: 115 |
| and mratHER2- | |||
| Q120K | |||
| preratHER2-Q145K | Reverse | TTCAGCTCCCGCAGCCCCTCTG | SEQ ID NO: 116 |
| and mratHER2- | |||
| Q120K | |||
| pre humHER2- | Forward | GCTGAAGCTTCGAAGCCTCACAG | SEQ ID NO: 117 |
| Q141K, preE2Neu- | |||
| Q141K, | |||
| mhumHER2- | |||
| Q119K, and | |||
| mE2Neu-Q119K | |||
| pre humHER2- | Reverse | TCCCGCAGGCCTCCTGGGGAGG | SEQ ID NO: 118 |
| Q141K, preE2Neu- | |||
| Q141K, | |||
| mhumHER2- | |||
| Q119K, and | |||
| mE2Neu-Q119K | |||
Feline HER2 (ERBB2) cDNA was cloned from cell line K248 (39), K12 (40), and the ovary of a domestic shorthair cat using a Protoscript kit (New England Biolabs) which showed identical sequences for all three sources. The confirmed full-length precursor feline ERBB2 (prefeHER2) cDNA sequence has been submitted to Genbank (# JN990983). For vaccination, a stop codon was introduced after codon 687 to delete the oncogenic intracellular domain, then subcloned into pVax1, giving pprefeHER2 which contains the signal peptide, extracellular and transmembrane domains of feline HER2 (FIG. 7). The pprefeHER2-K nucleotide substitution in codon 141 of extracellular domain I was cag->aag, based on our reported sequence of feline ERBB2 (Genbank JN990983) and was generated by PCR-based methods and verified by DNA sequencing. Homologous Q-K substituted antigens for bear, mouse, and other species of HER2 are similiarly generated, using the primers given in Table 2.
Black bear HER2 cDNA was similarly cloned from the liver tissue of a black bear. The cDNA sequence was submitted to Genbank (# JQ040508). DNA vaccine pprebearHER2 encoding the signal peptide, extracellular and transmembrane domains was constructed by PCR similar to pprefeHER2.
Results
Feline HER2 (ERBB2) cDNA cloned from K12, K248 and normal feline ovary showed identical sequences (GenBank Accession JN990983). The amino acid. translate of full-length feline HER2 shared 93% sequence identity with human HER2 (FIGS. 6A and 6B). Black bear HER2 (GenBank Accession JQ040508) had 96% and 92% a.a. sequence identity with feline and human HER2, respectively. The comparative data in FIG. 6B also show that human HER2 is more closely related to the HER2 of cats and black bears than they are to the HER2 of experimental rodents.
The feline, black bear, human and rat HER2 (rat neu) extracellular and transmembrane regions (ECTM) were individually transfected into 3T3 cells. Epitope expression was compared by staining with moAbs to human HER2 (TA-1, N12, N29 and trastuzumab) or rat neu (7.16.4) (McKenzie, et al., 1989; Stancovski, et al., 1991; Hudziak, et al., 1989; Drebin, et al., 1984) (FIG. 6C). Feline HER2 was recognized by all five moAbs. The closely related black bear HER2 was recognized by four moAbs, except trastuzumab, signifying structural disparity at this epitope. moAb 7.16.4 identifies a rat neu epitope which is present in feline and black bear, but not human HER2. Overall, there are high levels of epitope sharing among HER2 molecules from these 4 species, with cat HER2 expressing all 5 epitopes recognized by the panel of moAbs.
Immunogenicity of Substituted and Heterologous her Antigenic Polypeptides
Materials and Methods
Generation of Recombinant Feline HER2 and Human Fc Fusion Protein-feHER2ecd-Fc
The secreted fusion protein feHER2ecd-hFc (SEQ ID NO: 69) was generated to serve as a stimulator for T cells in vitro. feHER2ecd-hFc was synthesized by fusing the 3′ end of the signal peptide-extracellular domain region of feHER2 (codons 1-653) to the hinge-CH2-CH3 region of human IGHG1. This codon 1-653 region of feHER2 (Genbank JN990983) was PCR amplified with forward primer 5′ CACCA AGCTT GAGAC CATGG AGCTG G (SEQ ID NO: 72) and reverse primer 5′-GATTT GGGCT CGGAC GTCAC AGGGC TGG (SEQ ID NO: 73), giving a 1986 bp product. IGHG1 cDNA (BC080557; Openbiosystems) was PCR amplified with primers 5′-CTGTG ACGTC CGAGC CCAAA TCTTG TGAC (SEQ ID NO: 74) and 5′-TCTAG ATTAT TTACC CGGAG ACAGG GAGAG GCTC (SEQ ID NO: 75), giving a 716 bp product consisting of codons 248-479. These two DNAs, which overlap by 22 bases, were fused by overlap extension-primed DNA synthesis giving 2676 bp product, which was then cloned into the HindIII and XbaI sites of the mammalian expression vector pVax1. The sequence coded by this feHER2ecd-hFc fusion cDNA, confirmed by DNA sequence analysis, is shown in FIG. 8A (feHER2ecd in uppercase, hFc in lowercase).
A schematic of feHER2ecd-hFc is shown in the upper panel of FIG. 8B. A Western blot verifying the fusion protein is shown in the lower panel of FIG. 8B. For production of feHER2ecd-hFc, murine 3T3 cells were transfected with the pVax/feHER2-hFc vector, and recombinant feHER2-Fc in culture supernatant was quantified by ELISA using mouse anti-human HER2 capture moAb (clone TA-1, Calbiochem), which cross-reacts with feline HER2. Rabbit anti-human IgG was the detection antibody (Jackson Immunoresearch). huHER2-¬Fc was purchased from Sino Biologicals.
Stimulation of T Cells In Vitro with Recombinant HER2ecd-Fc.
Feline PBMC were isolated by ficoll separation (GE Healthcare). Cells were plated at 2×105/well in round bottom 96-well plates and cultured with 10 μg/mL feHER2Fc (3T3 supernatant equivalent as described above), huHER2Fc, human IgG control or control 3T3 conditioned medium for 72 h. Total well contents were then transferred to feline IFNγ ELISPOT plates (R&D Systems) and incubated for an additional 48 h prior to enumeration.
Analysis of T Cell Response by ELISPOT
Mouse splenocytes or feline PBMC isolated by Ficoll separation (GE Healthcare) were maintained in Roswell Park Memorial Institute Medium supplemented with fetal bovine sera, penicillin/streptomycin. Feline PBMC were supplemented with 0.5 ng/mL feline IL-2 (R&D Systems). Cells were plated at 2×105/well in round bottom 96-well plates and cultured with 10 μg/mL feHER2Fc (3T3 supernatant equivalent as described above), huHER2Fc, human IgG control (Jackson Immunolabs) or control 3T3 conditioned medium for 48 (mouse) or 72 (feline) hours. Total well contents were then transferred to mouse or or feline (R&D Systems) IFNγ ELISPOT plates and incubated for an additional 48 hours prior to detection and enumeration as per manufacturer protocol. Visualized cytokine spots were enumerated using the ImmunoSpot analyzer (CTL, Shaker Heights, Ohio) and expressed as the number of cytokine-producing cells per 106 splenocytes or PBMC.
Feline GM-CSF
(CSF2) cDNA was amplified from a randomly-primed cDNA library (Protoscript kit from New England Biolabs) prepared from ConA-stimulated feline peripheral blood mononuclear cells (PBMC). Codons 1 through 67 were PCR amplified with forward primer 5′-ATGTG GCTGC AGAAC CTGCT TTTCC TG (SEQ ID NO: 80) and reverse primer 5′-CTCAG GGTCA AACAT TTCAG AGAC (SEQ ID NO: 81). Codons 60 through 145 were amplified with primers 5′-GTCTC TGAAA TGTTT GACCC TGAGG (SEQ ID NO: 82) and 5′-TTACT TCTGG TCTGG TCCCC AGCAG TC (SEQ ID NO: 83). These two PCR products with fused by overlap extension priming PCR, giving a 435 bp full-length CSF2 orf, which was cloned into expression vector pcDNA3.1 blunt Topo (Invitrogen). The orf sequence from a clone in the correct orientation was in accord with the consensus of feline CSF2 cDNAs in Genbank (AY878357, NM001009840, AF053007 and AF138140).
Electrovaccination of Mice and Cats
Mice were injected with an admix of 50 μg each of vaccine plasmid and plasmid encoding murine GM-CSF (pmuGM-CSF) in 50 μl PBS in the gastrocnemius muscle (Jacob, et al., 2006). Conductive gel was applied on the skin over the injection sites. Electroporation was conducted with NEPA21 electroporator (Napagene) using a tweezer electrode. Three 50 msec degenerating bipolar pulses of 100 V were administered at each site. Cats were injected with 1.5 mg each of HER2 vaccine plasmid and pfeGM-CSF in 1.5 mL PBS, divided equally over three injection sites in the biceps femoris or quadriceps. Two rounds of electroporation were applied to each site as described using a 1.5 cm2 caliper electrode (BTX).
Results
Note that in FIGS. 9-13, an abbreviated notation is used for the HER2 polypeptides. The term Q141K is shortened to “K”. The prefix “pre” is omitted. For example, the plasmid “pprefeHER2-Q141K” is given as pfeHER2.
Immunogenicity of Substituted and Heterologous Forms of HER2.
Recombinant prefeHER2-Q141K was expressed in 3T3 cells and characterized by flow cytometry (FIG. 9A). Positive staining by the panel of five moAbs indicated preservation of 5 HER2/neu epitopes after Q→K substitution. Improved binding of feHER2-K by neu specific moAb 7.16.4 compared to WT prefeHER2 (compare to FIG. 6C) suggests a possible structural alteration of this epitope.
The immunogenicity of prefeHER2 and prefeHER2-Q141K was initially characterized in BALB/c mice by electrovaccination with pprefeHER2, prefeHER2-Q141K, or control pprehuHER2 (encoding human HER2 ECTM), each of which were admixed with pmuGM-CSF encoding murine GM-CSF (Jacob, et al., 2010; Radkevich-Brown, et al., 2009; Jacob, et al., 2006; Jacob, et al., 2007) Antisera of vaccinated mice were tested for reactivity against 3T3 cells transfected with pprefeHER2 (“3T3/HER2”), pprefeHer2-Q141K (“3T3/HER2-K”), or control pprehuHER2 (“3T3/huHER2”). Expression of with pprefeHER2, pprefeHer2-Q141K, or control pprehuHER2. on individually transfected 3T3 cells was comparable, as verified with moAb TA-1 binding at 2 different concentrations (FIG. 11A).
After 2× immunization, mice produced 59±19, 49±13 and 39±20 μg/mL IgG to their cognate antigens, respectively, as measured with 3T3 cells transfected with individual test antigens (FIG. 9B). The results indicate that antibodies induced by vaccination with pprefeHER2 or pprefeHER2-Q141K are highly cross-reactive, with both antibodies recognizing dominant foreign epitopes on feline HER2 (FIG. 9B left and middle panels). Therefore, the Q141K substitution appears to create only subtle changes which did not alter the immune response to the dominant foreign epitopes. Modest cross-reactivity between feline and human HER2 immune sera was also observed. Neither pre-, nor post-vaccination mouse serum bound un-transfected 3T3 cells (FIG. 11B), supporting HER2 specificity of the immune sera.
To measure T cell response after vaccination, a feline HER2 extracellular domain (ECD) and human Ig Fc fusion protein, feHER2-Fc, was generated as the test antigen, as previously described and shown in FIG. 8B. Splenocytes from immunized BALB/c mice were stimulated by incubation with feHER2-Fc or control huHER2-Fc, and IFNγ-producing T cells were enumerated by ELISPOT.
The results (FIG. 9C) show that T cell responses to feline HER2 were induced by vaccination with pprefeHER2 (“pfeHER2”), pprefeHER2-Q141K (“pfeHER2-K”) or pprehuHER2 (“phuHER2”). This finding indicates cross-reactivity between feline and human HER2 antigen. This finding also indicates that the Q141K substitution does not alter mouse T cell response to the WT HER2 protein. The greater responses produced by in vitro stimulation with huHER2-Fc, relative to feHER2-Fc, probably reflects the different forms of the stimulating preparations, with purified huHER2-Fc protein stimulating more effectively than secreted feHER2-Fc in culture supernatant.
Anti-HER2 Vaccinations in the Feline Model System
The feasibility of DNA electrovaccination in cats was initially tested with ppreE2Neu encoding a fusion protein of human HER2 and rat neu. This construct was previously found to be effective at inducing both humoral and cellular immunity in HER2 Tg mice (Jacob, et al., 2010).
Three healthy purpose-bred, pathogen-free domestic shorthair cats 12-24 months of age (Liberty Research Inc. Liberty, N.Y.) were injected with ppreE2Neu and pfeGM-CSF in three legs in the biceps femoralis or quadriceps. Each injection site was subjected to 2 rounds of electroporation. Vaccination was administered 4× at 3 week intervals. Blood was collected through the jugular vein 2 weeks after each vaccination.
Humoral Response of Cats to ppreE2Neu
Antibodies to huHER2, rat neu, and feHER2 were quantitated by flow cytometric analysis of feline antibody binding to 3T3 cells transfected with prehuHER2, rat neu, or prefeHER2, as previously described.
Human HER2 binding IgG reached a titer of 1:400,000 in two of three cats and 1:100,000 in the third (FIG. 10A, left panel). Rat neu binding Ab ranged from 1:25,000 to 1:100,000 (FIG. 10A, middle panel). The robust response validated the effectiveness of DNA electrovaccination in cats.
Vaccination with ppreE2Neu induced antibody that cross reacted with wild type feline HER2 as determined by binding to 3T3 cells expressing prefeHER2 (“3T3/feHER2” in FIG. 10A, right panel). Neither pre-, nor post 4th-vaccination feline serum stained non-transfected 3T3 cells, illustrating the HER2/neu-specific reactivity of the immune sera (FIG. 11C).
Humoral Responses of Cats to Vaccines Including Bear and Substituted Feline HER2
A panel of HER2 vaccines were tested in fifteen additional healthy cats between 5-8 months of age. Cats were electrovaccinated four times with pprefeHER2, pprefeHER2-K, pprebearHER2, ppreE2Neu, or an admixture of pprefeHER2-K and ppreE2Neu. Results are shown in FIG. 10B. In each panel of FIG. 10B, the antibody target-binding cell type is listed at the top of the panel. The graphs show IgG titers obtained with each of five vaccines, which are listed in the FIG. 10B legend.
Consistent with the results shown previously in FIG. 10A, the six cats that received ppreE2Neu either alone or in combination with pprefeHER2-K developed high levels of IgG antibody to human HER2 (FIG. 10B, left panel). Peak titers were achieved after three vaccinations. Immune sera induced by pprebearHER2 cross-reacted with human HER2, and the titers increased after each booster immunization. pprefeHER2 or pprefeHER2-K immunization did not induce significant antibody response to human HER2.
Recognition of prefeHER2-Q141K by immune sera was measured by their binding to 3T3/prefeHER2-Q141K (FIG. 10B, middle panel, “3T3/feHER2-K”). A prominent response (˜1:120,000) was induced by pfeHER2-K+pE2Neu. Individually, pfeHER2-K, pE2Neu or pbearHER2 induced moderate titers averaging ˜1:6,000. The enhancement of immune response to pprefeHER2-K and to pbearHER2 by admixture with pE2Neu suggests a synergistic or adjuvant effect of the heterologous pE2Neu. Vaccination with pprefeHER2 did not generate a significant antibody response to prefeHER2-Q141K.
Antibodies binding to 3T3 cells expressing wild type prefeHER2 (“3T3/feHER2”) were detected at a dilution of between 1:1,600-1:3,200 of immune sera from pE2Neu, pfeHER2-K+pE2Neu, or pbearHER2 vaccinated cats (FIG. 10B, right panel). These results show that these heterologous vaccines break tolerance to self feHER2, and induce antibodies which cross react with self feHER2. The specificity of HER2 antigen recognition was validated by the absence of binding to un-transfected 3T3 cells after 4× vaccination (FIG. 11D).
Immune sera from mice immunized only with pprefeHER2 or pprefeHER2-K showed negligible antibody binding to 3T3/feHER2 (FIG. 10B, right panel). The pprefeHER2-K vaccine showed much greater effect, however, when the immune sera were tested against feline mammary carcinoma cells. These cells constitute a much more realistic system, for the carcinoma cells express not only HER2 but also HER1 and HER3, which are capable of heterodimerizing with HER2 (Olayioye, 2001).
FIG. 10C shows the results of antibody binding experiments, in which immune sera were tested at 1:50-1:100 dilution, not only against 3T3 expressing only prefeHER2 (left panel), but also against feline mammary carcinoma cells of cell lines K12 (middle panel) and K248 (right panel), which express HER1, HER2, and HER3. Sera from cats immunized with pprefeHer2 (“pfeHER2”) showed little binding to any of the test cells. Sera from cats immunized with pprefeHer2-Q141K (“pfeHER2-K”) also showed little or low level binding to 3T3/feHER2, but they showed significant binding to K12 and K248 cells (FIG. 10C, middle and right panel, second line of each panel). Although other immune sera recognized 3T3/feHER2, they reacted minimally with K12 or K248 cells.
These findings indicate that vaccines including feline HER2 with a Q to K mutation at position 141 is sufficiently foreign to break tolerance to normal self HER2 in the cat model. The findings also suggest that vaccines including feline HER2 with a Q to K mutation at position 141 induce antibodies specific for epitopes whose expression is related to some combination of HER2, HER1 and/or HER3, a combination that is exposed naturally on feline mammary carcinoma cells.
The findings also indicate that prebearHER2, when administered as a heterologous vaccination to cats, is sufficiently foreign from feline HER2 to break tolerance, but sufficiently similar to induce antibodies that cross react with feline HER2.
FIGS. 12A-12C show the predicted 3D structure of feHER2-Q141K domains I-Ill using cartoon and space-filling models. The predicted effect of substituting Q with K at a.a. 141 is portrayed by an electrostatic surface model (SYBYL-X 2.1.1 software; Tripos), where the electropositive side chain of K is indicated by red and Q is shown in blue (FIG. 12C). It is hypothesized that feHER2-Q141K recapitulates a cryptic HER2 epitope naturally displayed when wild type feHER2 is heterodimerized or associated with other ERBB family members on a cell surface. Cats immunized with heterologous ppreE2Neu or pprebearHER2 produced antibodies that recognize dominant epitopes on wild type feHER2 as well as feHER2-Q141K expressed on 3T3 cells, but not the cryptic epitope exhibited by K12 or K248 cells. This seemingly subtle, but potentially critical difference in HER2 epitope recognition could only have been detected in vaccination experiments with the outbred cat system, wherein genetically un-manipulated cats naturally express HER1, 2, and 3.
T Cell Responses of Cats to Substituted and Heterologous HER2 Vaccines
Cats were vaccinated with plasmids encoding prefeHER2-Q141K (“pfeHER2-K” in FIG. 13) or the heterologous non-substituted antigens prebearHER2 (“pbearHER2”) or preE2neu (“pE2neu”), with combinations of these plasmids, as admixtures or as initial and booster vaccinations. The reactivity of the induced T cells to human HER2 was measured first. Immune PBMC were cultured with recombinant huHER2-Fc for three days before IFNγ ELISPOT analysis (FIG. 13A). The 6 cats receiving pE2Neu, with or without pfeHER2-K, responded to human HER2 at 130-750 SFU/106 PBMC, validating the effectiveness of DNA electrovaccination (FIG. 13A). pbearHER2 immune T cells also cross-reacted with human HER2, producing an average of ˜160 SFU/106 PBMC. Vaccination with pfeHER2-K alone did not induce T cells that recognized human HER2.
IFN-γ T cell response to feHER2-Fc was measured to evaluate reactivity to self HER2. Of the 10 evaluated cats, three produced significant feHER2 specific T cell responses, with one cat each from the pfeHER2-K (˜100 SFU per million cells), pE2Neu (˜270 IFNγ spots) and pbearHER2 (˜280 IFNγ spots) groups (FIG. 13B). The observed T cell responses indicate the immunogenic nature of both the heterologous bear and E2Neu and the Q-K substituted HER2 vaccines. The 30% response rate may reflect the heterogeneous genetic background of outbred cats, as in humans.
Three bi-weekly booster vaccinations were given to five cats that received pfeHER2-K or pfeHER2-K+pE2Neu (FIG. 13C). Only 1 of the 3 cats receiving the admixed vaccine converted from a non-responder to a responder after three boosters (˜135 SFU/106 PBMC). Therefore, a total of 40% T cell response rate to self HER2 was achieved in healthy cats. Those cats initially receiving pE2Neu or pbearHER2 were boosted 3× with pfeHER2-K (FIG. 13D). Responses to recombinant human or feline HER2 did not increase, suggesting that cross-reactive T cells, not common epitopes in HER2 from pE2Neu or bear HER2, contributed to feline HER2 reactivity.
The cats tolerated the vaccination procedure without signs of pain or discomfort after they recovery from anesthesia. No adverse side effects were detected 6-12 months after the final vaccination and the cats continue to thrive.
Taken together, the experimental results disclosed in Example 3 validate a new vaccine design strategy of including a single residue substitution in a tumor self antigen. The results show that, in the feline mammary cancer test system, a feline HER2 antigenic polypeptide with a Q to K substitution at position 141 is sufficiently foreign to break tolerance, yet induces antibodies cross reactive with normal feline HER2, and with the HER2 molecules of humans and other species. Because the outbred cat system is a realistic system which reflects antigen and MHC diversity of natural human and animal populations, it is reasonably predictable that other species of HER2 including a Q to K substitution at position 141, or at an analogous position, will also be effective at immunizing against mammary carcinomas and other HER2 expressing cancers in other animal species, including humans.
The results of immunizations of cats with wild type bear HER2 validate the strategy of immunization of a host with HER2 that is heterologous, but relatively closely matched to self HER2. This indicates that bear HER2 is an effective antigen for the immunization and treatment of feline cancer hosts. Because of the similarity of bear, cat, and human HER2 (FIG. 6B), it is reasonably predictable that bear HER2 will be an effective antigen for immunizing humans, and possibly other mammals, against HER2-expressing tumor cells. This conclusion is further supported by the generalizability of results from the highly realistic, genetically diverse, outbred cat model.
Additional Antigenic Her2 Polypeptides Including Amino Acid Substitutions
To further test the hypothesis that minimally altered variants of self HER2 can break tolerance and induce immunity to self HER2, an additional panel of substituted HER2 was generated. All of the substituted forms were based on the precursor form of human HER2 (prehumHER2).
Materials and Methods
Generation of Substituted Variants of Human HER2.
Seven vaccine expression plasmids were constructed. Each encoded either a single point-mutated human precursor HER2 ECTM construct (pprehumHER2-Q141K, SEQ ID NO: 9; pprehumHER2-Q213K, SEQ ID NO: 84; pprehumHER2-Q239K, SEQ ID NO: 85; pprehumHER2-Q329K SEQ ID NO: 28; pprehumHER2-Q429R SEQ ID NO: 29; and pprehumHER2-N438D SEQ ID NO: 30); or a human precursor HER2 ECTM construct with 3 a.a. substitutions (pprehumHER2-NNT 124-126 DSG, SEQ ID NO: 85). The primer sequences for all constructs are listed in Table 3 below. For brevity, the constructs, and the polypeptides they encode, will be referred to in the following disclosure only by their substitutions, that is, respectively, Q141K, Q213K, Q239K, Q329K Q429R N438D, and NNT124DSG. In FIGS. 16 and 18, the terms are further abbreviated to, respectively, 141, 213, 239, 329, 429, 438, and 124.
| TABLE 3 |
| PCR primers for generating HER2 point variants |
| AA | Primer sequence (5′→3′; reverse primer, ital.; | |
| Species | substitution | mutant, lowercase) |
| Human | q141k | GCTGaAGCTTCGAAGCCTCACAGAG (SEQ ID NO: 87) |
| ″ | ″ | TCCCGCAGGCCTCCTGGGGAGGC (SEQ ID NO: 88) |
| ″ | q213k | TGAGGATTGTaAGAGCCTGAC (SEQ ID NO: 89) |
| ″ | ″ | GAACTCTCTCCCCAGCAG (SEQ ID NO: 90) |
| ″ | q239k | CTGCCATGAGaAGTGTGCTGC (SEQ ID NO: 91) |
| ″ | ″ | CAGTCAGTGGGCAGTGGC (SEQ ID NO: 92) |
| ″ | q320k | AAGAGGTGACAGCAGAGGATGGAAC (SEQ ID NO: 93) |
| ″ | ″ | tGTTGTGCAGGGGGCAGACGAG (SEQ ID NO: 94) |
| ″ | q329k | GGATGGAACAaAGCGGTGTGA (SEQ ID NO: 95) |
| ″ | ″ | TCTGCTGTCACCTCTTGG (SEQ ID NO: 96) |
| ″ | q429r | CCAGAACCTGagAGTAATCCGGG (SEQ ID NO: 97) |
| ″ | ″ | AAGACGCTGAGGTCAGGC (SEQ ID NO: 98) |
| ″ | n438d | AATTCTGCACgATGGCGCCTA (SEQ ID NO: 99) |
| ″ | ″ | CGTCCCCGGATTACTTGC (SEQ ID NO: 100) |
| ″ | nnt124dsg | ggcACACCTGTCACAGGGGCCTCCCCAG (SEQ ID NO: 101) |
| actgtcCAGCGGGTCTCCATTGTCTAGCAC (SEQ ID NO: 102) | ||
| Cat | q141k | GCGGGAGCTGaAGCTCCGAAG (SEQ ID NO: 103) |
| ″ | ″ | AGCCCTCCTAGGGCAGCCCCTGTAG (SEQ ID NO: 104) |
| ″ | r398q | TGAGCAGCTCcaAGTGTTTGAGGCTCTGGAG (SEQ ID NO: 105) |
| ″ | ″ | GGCTGCAGGGGGGCAGTG (SEQ ID NO: 106) |
| ″ | n421d | CAGCTTGCCTgACCTCAGTGTC (SEQ ID NO: 107) |
| ″ | ″ | TCTGGCCACGCTGAGATG (SEQ ID NO: 108) |
New England Biolab's Q5 Site-Directed Mutagenesis Kit was used with these primers to generate the variant vaccines, which were confirmed by DNA sequencing.
Stable HER2 expression of six gene constructs was confirmed in transiently transfected 3T3 cells by flow cytometry using anti-human HER2 moAbs Ab5 and N12 (FIGS. 14A and 14B). One construct, Q213K, was not expressed, and was removed from the test panel.
Electrovaccination of Mice and Cats
Mice were injected with an admix of 50 μg each of vaccine plasmid and plasmid encoding murine GM-CSF (pmuGM-CSF) in 50 μl PBS in the gastrocnemius muscle. Conductive gel was applied on the skin over the injection sites. Electroporation was conducted with NEPA21 electroporator (Napagene) using a tweezer electrode. Three 50 msec degenerating bipolar pulses of 100 V were administered at each site. Cats were injected with 1.5 mg each of HER2 vaccine plasmid and pfeGM-CSF in 1.5 mL PBS, divided equally over three injection sites in the biceps femoris or quadriceps. Two rounds of electroporation were applied to each site as described using a 1.5 cm2 caliper electrode (BTX).
Results
In Vivo Expression of Substituted HER2 Polypeptides and Immune Activation in Wild Type (WT) BALB/c Mice
The six verified constructs were advanced to vaccination tests as plasmid vaccines in wild type BALB/c mice. The plasmids pE2TM (prehumHER2) and pE2Neu (human HER2-rat neu hybrid ECTM) were employed as controls. There were 3 mice in each group. It was previously reported that pE2Neu induced significantly higher levels of anti-human HER2 Ab and T cell response in HER2 Tg mice than does pE2TM, showing the efficacy to overcome immune tolerance by incorporating heterologous neu sequence in ECD domains 3 and 4 (Jacob, et al., 2010). Because human HER2 with or without mutations are foreign proteins in WT mice, anti-HER2 antibody response is expected as long as the vaccine construct is expressed in vivo. Of the 6 mutants, five constructs except prehumHER2-Q239K induced anti-human HER2 Ab in at least one animal to show their successful expression in vivo and antibody induction after a single electrovaccination (FIG. 15).
Wild type BALB/c mice were electro-vaccinated i.m. with 60 ug HER2 construct+60 ug pmGMCSF divided in two sites. Serum was collected 3 weeks after immunization and binding to Her2-expressing SKOV3 cells was assessed by flow cytometry.
Of the 6 substituted polypeptides, all induced anti-human HER2 Ab in at least one animal (FIG. 15). This shows that the substituted polypeptides, prehumHER2-Q141K, prehumHER2-Q329K, prehumHER2-Q329K, prehumHER2-Q429R, prehumHER2-N438D, and prehumHER2-NNT124-126DSG were successfully expressed in vivo, and induced the expression of anti human-HER2 antibody after a single electrovaccination (FIG. 15).
Immune Activation in Human HER2 Transgenic (Tg) Mice
The five positive mutant constructs identified in WT BALB/c mice were advanced to human HER2 transgenic (Tg) mice (in BALB/c background). Mice received electrovaccinations twice, 2 wks apart, and immune sera were collected 2 wks after the final vaccination. Binding of immune sera to 3T3 cells that express human HER2, but not other human ERBB members, showed induction of anti-human HER2 antibodies by all 5 test vaccines as well as by control pE2TM or pE2Neu (FIG. 16).
The finer specificity of the immune sera was further tested with 5 human cancer cell lines. Breast cancer line SKBR3 and ovarian cancer line SKOV3 have amplified HER2 as shown by the binding to moAb Ab5, N12, N29 and Herceptin (FIG. 17). They also express HER1 (EGFR). Three triple negative breast cancer cell lines SUM149, SUM 159 and MDA MB231 show lower levels of HER2 expression. MDAMB231 has elevated HER1 (EGFR) expression.
All test immune sera except those from mice immunized with prehumHER2-NNT124DSG (“124”) showed significant binding to the 5 human cancer cell lines (FIG. 18), indicating their immunogenic nature. To determine whether the substituted HER2 vaccines were more effective in overcoming immune tolerance than WT pE2TM, the change in their antibody level relative to pE2TM immune serum was calculated (FIG. 19). Of interest is that Q329K immune serum that showed comparable binding to SKOV3 as pE2TM immune serum. The same immune serum appears to bind MDA MB231 more effectively than pE2TM immune serum (p<0.05). Note that SKOV3 cells express high levels of HER2, moderate EGFR and no HER3 (see FIG. 3A). MDA MB231 cells express moderate levels of HER2, elevated HER1. It is hypothesized that HER2 epitopes on SKOV 3 and MDA-MB231 differ, and some unique HER2 epitopes on MDA MB231 are mimicked by HER2 Q329K. Perhaps MDA MB231 and K12/K248 cat mammary tumor cells share common HER2 structural features. Feline HER2 Q141K immune sera preferentially bind K12/K248, but minimally to 3T3 cells expressing feline HER2.
It is proposed that an increased immune response to substituted HER2 vaccines is due to alteration of the amino acid charges or position of charges of HER2. The aa substitutions can be visualized by space-filling modeling (Protein Data Bank ID #2a91; www.rcsb.org/;) 3D view of “The crystal structure of a truncated ErbB2 ectodomain reveals an active conformation, poised to interact with other ErbB receptors” (Garrett, et al., 2003). Amino acid substitutions on the outer surface of HER2 3D structure would presumably be directly accessible to B-cell receptors, and predispose to anti-HER2 antibody production. In contrast, the Q329K substitution which also increases the charge is beneath the surface, but may still trigger subtle changes in antigenicity.
The results indicate that prehumHER2-Q141K prehumHER2-Q329K, prehumHER2-Q429R, and prehumHER2-N438D, are effective antigens for breaking tolerance to self human HER2, as determined in the transgenic human HER2 mouse model. The finding that prehumHER2-Q141K breaks tolerance to self human HER2 reinforces the previously disclosed finding from the cat system, that prefeHER2-Q141K breaks tolerance to self feline HER2 (Example 3). The concordance of these two findings supports the generalizability of results from the outbred cat model to human HER2 immunobiology.
In addition, as previously stated, it is predictable that the mature forms of these substituted antigenic polypeptides, mhumHER2-Q119K, mhumHER2-Q407K, mhumHER2-Q429R, and mhumHER2-N438D are also effective as tolerance-breaking antigens. The lack of a signal peptide is expected to have no effect on the reactivity of the Q-K substitution epitope, which is over a hundred residues distant, in the ECD. Even if not processed onto the surface of a host cell, the mature forms of HER2 are nonetheless be available to antigen presenting cells upon apoptosis or necrosis of the expressing cells. Exemplary amino acid sequences of these substituted HER2 antigens are: mhumHER2-Q119K, SEQ ID NO: 3; mhumHER2-Q407K, SEQ ID NO: 26; mhumHER2-Q429, SEQ ID NO: 29; and mhumHER2-N438D, SEQ ID NO: 30.
Finally, it is predictable that conservatively substituted variants of the substituted peptides of the present invention will also be effective antigens. For example, arginine can be substituted for lysine 141 in prehumHER2-Q141K and lysine 329 in prehumHER2-Q329K; lysine can be substituted for arginine 429 in prehumHER2-Q429R, and glutamic acid can be substituted for aspartic acid 438 prehumHER2-N438D.
The invention has been described in an illustrative manner, and it is to be understood that the terminology that has been used is intended to be in the nature of words of description rather than of limitation.
Obviously, many modifications and variations of the present invention are possible in light of the above teachings. It is, therefore, to be understood that within the scope of the appended claims, the invention can be practiced otherwise than as specifically described.
| TABLE 4 |
| Amino acid and nucleotide sequences for substituted and wild type HER2 |
| polypeptides |
| mfeHER2-Q119K, SEQ ID NO: 1 |
| 1 | tqvctgtdmk lrlpaspeth ldmlrhlyqg cqvvqgnlel tylhanasls lqdiqevqg |
| 61 | yvliahnqvk qvplqrlriv rgtqlfedny alavldngdp ldsgtpatga lgglrelkl |
| 121 | rslteilkgg vliqrnpqlc hqdtilwkdi fhknnqlalm lidtnrsrac pcspackds |
| 181 | hcwgassgdc qsltrtvcag gcarckgpqp tdccheqcaa gctgpkhsdc aclhfnhsg |
| 241 | icelhcpalv tyntdtfesm pnpegrytfg ascvtacpyn ylstdvgsct vcplnnqev |
| 301 | taedgtqrce kcskpcarvc yglgmehlre aravtsaniq efvgckkifg laflpesfe |
| 361 | gdpasntapl qpeqlrvfea leeitgylyi sawpdslpnl svfqnlrvir rvlhdgays |
| 421 | ltlqglgisw lglrslrelg sgialihrns rlcfvhtvpw dqlfrnphqa lhsanrped |
| 481 | ecageglacy plcahghcwg pgptqcvncs qflrgqecve ecrviqglpr yvkdrfclp |
| 541 | chpecqpqng svtclgsead qcvacahykd ppfcvarcps gvkpdlsfmp wkfadeegt |
| 601 | cqpcpincth scadldekgc paeqraspvt siiaavvgil lvvvvglvlg likrrrqki |
| 661 | rkytm |
| mbearHER2-Q119K, SEQ ID NO: 2 |
| 1 | tqvctgtdmk lrlpaspeth ldmlrhlyqa cqvvqgnlel tylpanasls lqdiqevqg |
| 61 | yvliahsqvr qvplqrlriv rgtqlfedny alavldngep pkgdtsvaga pgglrelkl |
| 121 | rslteilkgg vliqrnpqlc hqdtliwkdi fhknnqlalt lidtnrsrac pcspackdp |
| 181 | hcwgassgdc qsltrtvcag gcarckgpkp tdccheqcaa gctgpkhsdc aclhfnhsg |
| 241 | icelhcpalv tyntdtfesm pnpegrytfg ascvtacpyn ylstdvgsct vcplnnqev |
| 301 | taedgtqrce kcsrpcarvc yglgmehlre aravtsaniq efagckkifg laflpesfe |
| 361 | gdpasntapl qpeqlrvfea leeitgylyi sawpdslpnl svfqnlrvir rvlhdgays |
| 421 | ltlqglgisw lglrslrelg sglalihrna rlcfihtvpw eqlfrnphqa lhsanrpea |
| 481 | ecvgeglacy plcahghcwg pgptqcvncs qflrgqecve ecrelhglpr yvkdryclp |
| 541 | chpecrpqng svtcfgsead qcvacahykd ppscvarcps gvkpdlsfmp wkfadeegt |
| 601 | cqpcpincth scgdldergc paeqraspvt siiaavvgil lavvmglvlg likrrrqki |
| 661 | rkytm |
| mhumHER2-Q119K, SEQ ID NO: 3 |
| 1 | tqvctgtdmk lrlpaspeth ldmlrhlyqg cqvvqgnlel tylptnasls lqdiqevqg |
| 61 | yvliahnqvr qvplqrlriv rgtqlfedny alavldngdp lnnttpvtga pgglrelKl |
| 121 | rslteilkgg vliqrnpqlc yqdtilwkdi fhknnqlalt lidtnrsrac pcspmckgs |
| 181 | rcwgessedc qsltrtvcag gcarckgplp tdccheqcaa gctgpkhsdc aclhfnhsg |
| 241 | icelhcpalv tyntdtfesm pnpegrytfg ascvtacpyn ylstdvgsct vcplhnqev |
| 301 | taedgtqrce kcskpcarvc yglgmehlre vravtsaniq efagckkifg laflpesfd |
| 361 | gdpasntapl qpeqlqvfet leeitgylyi sawpdslpdl svfqnlqvir rilhngays |
| 421 | ltlqglgisw lglrslrelg sglalihhnt hlcfvhtvpw dqlfrnphqa lhtanrped |
| 481 | ecvgeglach qlcarghcwg pgptqcvncs qflrgqecve ecrvlqglpr yvnarhclp |
| 541 | chpecqpqng svtcfgpead qcvacahykd ppfcvarcps gvkpdlsymp wkfpdeega |
| 601 | cqpcpincth scvdlddkgc paeqrasplt siisavvgil lvvvlgvvfg likrrqqki |
| 661 | rkytm |
| mmouseHER2-Q120K , SEQ ID NO: 4 |
| 1 | tqvctgtdmk lrlpaspeth ldmlrhlyqg cqvvqgnlel tylpanasls flqdiqevqg |
| 61 | ymliahnrvk hvplqrlriv rgtqlfedky alavldnrdp ldnvttaapg rtpeglrelk |
| 121 | lrslteilkg gvlirgnpql cyqdmvlwkd vlrknnqlap vdmdtnrsra cppcaptckd |
| 181 | nhcwgesped cqiltgtict sgcarckgrl ptdccheqca agctgpkhsd claclhfnhs |
| 241 | gicelhcpal ityntdtfes mlnpegrytf gascvttcpy nylstevgsc tlvcppnnqe |
| 301 | vtaedgtqrc ekcskpcagv cyglgmehlr garaitsdni qefagokkif gslaflpesf |
| 361 | dgnpssgvap lkpehlqvfe tleeitgyly isawpesfqd lsvfqnlrvi rgrilhdgay |
| 421 | sltlqglgih slglrslrel gsglalihrn thlcfvntvp wdqlfrnphq allhsgnrpe |
| 481 | eacgleglvc nslcarghcw gpgptqcvnc sqflrgqecv eecrvwkglp reyvrgkhcl |
| 541 | pchpecqpqn ssetcygsea dqceacahyk dssscvarcp sgvkpdlsym piwkypdeeg |
| 601 | icqpcpinct hscvdlderg cpaeqraspv tfiiatvvgv llfliivvvi gilikrrrqk |
| 661 | irkytm |
| mratHER2-Q120K, SEQ ID NO: 5 |
| 1 | tqvctgtdmk lrlpaspeth ldmlrhlyqg cqvvqgnlel tyvpanasls flqdiqevqg |
| 61 | ymliahnqvk rvplqrlriv rgtqlfedky alavldnrdp qdnvaastpg rtpeglrelk |
| 121 | lrslteilkg gvlirgnpql cyqdmv1wkd vfrknnqlap vdidtnrsra cppcapackd |
| 181 | nhcwgesped cqiltgtict sgcarckgrl ptdccheqca agctgpkhsd claclhfnhs |
| 241 | gicelhcpal vtyntdtfes mhnpegrytf gascvttcpy nylstevgsc tlvcppnnqe |
| 301 | vtaedgtqrc ekcskpcary cyglgmehlr garaitsdnv qefdgckkif gslaflpesf |
| 361 | dgdpssgiap lrpeqlqvfe tleeitgyly isawpdslrd lsvfqnlrii rgrilhdgay |
| 421 | sltlqglgih slglrslrel gsglalihrn ahlcfvhtvp wdqlfrnphq allhsgnrpe |
| 481 | edcgleglvc nslcahghcw gpgptqcvnc shflrgqecv eecrvwkglp reyvsdkrcl |
| 541 | pchpecqpqn ssetcfgsea dqcaacahyk dssscvarcp sgvkpdlsym piwkypdeeg |
| 601 | icqpcpinct hscvdlderg cpaeqraspv tfiiatvvgv llflilvvvv gilikrrrqk |
| 661 | irkytm |
| mE2Neu-Q119K, SEQ ID NO: 6 |
| 1 | tqvctgtdmk lrlpaspeth ldmlrhlyqg cqvvqgnlel tylptnasls flqdiqevqg |
| 61 | yvliahnqvr qvplqrlriv rgtqlfedny alavldngdp lnnttpvtga spgglrelkl |
| 121 | rslteilkgg vliqrnpqlc yqdtilwkdi fhknnqlalt lidtnrsrac hpcspmckgs |
| 181 | rcwgessedc qsltrtvcag gcarckgplp tdccheqcaa gctgpkhsdc laclhfnhsg |
| 241 | icelhcpalv tyntdtfesm pnpegrytfg ascvtacpyn ylstdvgsct lvcplhnqev |
| 301 | taedgtqrce kcskpcarvc yglgmehlre vravtsaniq efagckkifg slaflpesfd |
| 361 | gdpasntaef aplrpeqlqv fetleeitgy lyisawpdsl rdlsvfqnlr iirgrilhdg |
| 421 | aysltlqglg ihslglrslr elgsglalih rnahlcfvht vpwdqlfrnp hqallhsgnr |
| 481 | peedcglegl vcnslcahgh cwgpgptqcv ncshflrgqe cveecrvwkg lpreyvsdkr |
| 541 | clpchpecqp qnssetcfgs eadqcaacah ykdssscvar cpsgvkpdls ympiwkypde |
| 601 | egicqpcpin cthscvdlde rgcpaeqras pvtfiiatvv gvllflilvv vvgilikrrr |
| 661 | qkirkytm |
| prefeHER2-Q141K, SEQ ID NO: 7 |
| 1 | melaawcrwg lllallpsga tgtqvctgtd mklrlpaspe thldmlrhly qgcqvvqgnl |
| 61 | eltylhanas lsflqdiqev qgyvliahnq vkqvplqrlr ivrgtqlfed nyalavldng |
| 121 | dpldsgtpat gaalgglrel klrslteilk ggvliqrnpq lchqdtilwk difhknnqla |
| 181 | lmlidtnrsr acqpcspack dshcwgassg dcqsltrtvc aggcarckgp qptdccheqc |
| 241 | aagctgpkhs dclaclhfnh sgicelhcpa lvtyntdtfe smpnpegryt fgascvtacp |
| 301 | ynylstdvgs ctivcpinnq evtaedgtqr cekcskpcar vcyglgmehl rearavtsan |
| 361 | iqefvgckki fgslaflpes fegdpasnta plqpeqlrvf ealeeitgyl yisawpdslp |
| 421 | nlsvfqnlrv irgrvlhdga ysltlqglgi swlglrslre lgsglalihr nsrlcfvhtv |
| 481 | pwdqlfrnph qallhsanrp edecagegla cyplcahghc wgpgptqcvn csqflrgqec |
| 541 | veecrvlqgl preyvkdrfc lpchpecqpq ngsvtclgse adqcvacahy kdppfcvarc |
| 601 | psgvkpdlsf mpiwkfadee gtcqpcpinc thscadldek gcpaeqrasp vtsiiaavvg |
| 661 | illvvvvglv lgilikrrrq kirkytm |
| prebearHER2-Q141K SEQ ID NO: 8 |
| 1 | melaawcrwg lllallpsga agtqvctgtd mklrlpaspe thldmlrhly qacqvvqgnl |
| 61 | eltylpanas lsflqdiqev qgyvliahsq vrqvplqrlr ivrgtqlfed nyalavldng |
| 121 | eppkgdtsva gatpgglrel klrslteilk ggvliqrnpq lchqdtilwk difhknnqla |
| 181 | ltlidtnrsr acqpcspack dphcwgassg dcqsltrtvc aggcarckgp kptdccheqc |
| 241 | aagctgpkhs dclaclhfnh sgicelhcpa lvtyntdtfe smpnpegryt fgascvtacp |
| 301 | ynylstdvgs ctivcpinnq evtaedgtqr cekcsrpcar vcyglgmehl rearavtsan |
| 361 | iqefagckki fgslaflpes fegdpasnta plqpeqlrvf ealeeitgyl yisawpdslp |
| 421 | nlsvfqnlrv irgrvlhdga ysltlqglgi swlglrslre lgsglalihr narlcfihtv |
| 481 | pweqlfrnph qallhsanrp eaecvgegla cyplcahghc wgpgptqcvn csqflrgqec |
| 541 | veecrelhgl preyvkdryc lpchpecrpq ngsvtcfgse adqcvacahy kdppscvarc |
| 601 | psgvkpdlsf mpiwkfadee gtcqpcpinc thscgdlder gcpaeqrasp vtsiiaavvg |
| 661 | illavvmglv lgilikrrrq kirkytm |
| prehumHER-Q141K SEQ ID NO: 9 |
| 1 | melaalcrwg lllallppga astqvctgtd mklrlpaspe thldmlrhly qgcqvvqgnl |
| 61 | eltylptnas lsflgdigev qgyvliahnq vrqvplqrlr ivrgtqlfed nyalavldng |
| 121 | dpinnttpvt gaspgglrel Klrslteilk ggvliqrnpq lcyqdtilwk difhknnqla |
| 181 | ltlidtnrsr achpcspmck gsrcwgesse dcqsltrtvc aggcarckgp 1ptdccheqc |
| 241 | aagctgpkhs dclaclhfnh sgicelhcpa lvtyntdtfe smpnpegryt fgascvtacp |
| 301 | ynylstdvgs ctivcplhnq evtaedgtqr cekcskpcar vcyglgmehl revravtsan |
| 361 | iqefagckki fgslaflpes fdgdpasnta plqpeqlqvf etleeitgyl yisawpdslp |
| 421 | dlsvfqnlqv irgrilhnga ysltlqglgi swlglrslre lgsglalihh nthlcfvhtv |
| 481 | pwdqlfrnph qallhtanrp edecvgegla chqlcarghc wgpgptqcvn csqflrggec |
| 541 | veecrvlqgl preyvnarhc lpchpecqpq ngsvtcfgpe adqcvacahy kdppfcvarc |
| 601 | psgvkpdlsy mpiwkfpdee gacqpcpinc thscvdlddk gcpaegrasp ltsiisavvg |
| 661 | illvvvlgvv fgilikrrqq kirkytm |
| premouseHER-Q142K, SEQ ID NO: 10 |
| 1 | melaawcrwg fllallspga agtqvctgtd mklrlpaspe thldmlrhly qgcqvvqgnl |
| 61 | eltylpanas lsflgdigev qgymliahnr vkhvplqrlr ivrgtqlfed kyalavldnr |
| 121 | dpldnvttaa pgrtpeglre lklrslteil kggvlirgnp qlcygdmvlw kdvlrknnql |
| 181 | apvdmdtnrs racppcaptc kdnhcwgesp edcgiltgti ctsgcarckg rlptdccheq |
| 241 | caagctgpkh sdclaclhfn hsgicelhcp alityntdtf esmlnpegry tfgascvttc |
| 301 | pynylstevg sctivcppnn gevtaedgtq rcekcskpca gvcyglgmeh lrgaraitsd |
| 361 | nigefagckk ifgslaflpe sfdgnpssgv aplkpehlqv fetleeitgy lyisawpesf |
| 421 | qdlsvfqnlr virgrilhdg aysltlqglg ihslglrslr elgsglalih rnthlcfvnt |
| 481 | vpwdqlfrnp hgallhsgnr peeacglegl vcnslcargh cwgpgptqcv ncsqflrgge |
| 541 | cveecrvwkg lpreyvrgkh clpchpecqp qnssetcygs eadqceacah ykdssscvar |
| 601 | cpsgvkpdls ympiwkypde egicqpcpin cthscvdlde rgcpaegras pvtfiiatvv |
| 661 | gvllfliivv vigilikrrr qkirkytm |
| preratHER2-Q145K, SEQ ID NO: 11 |
| 1 | miimelaawc rwgfllallp pgiagtqvct gtdmklrlpa spethldmlr hlyggcqvvg |
| 61 | gnleltyvpa naslsflqdi gevggymlia hnqvkrvplq rlrivrgtql fedkyalavl |
| 121 | dnrdpqdnva astpgrtpeg lrelklrslt eilkggvlir gnpq1cygdm vlwkdvfrkn |
| 181 | nqlapvdidt nrsracppca packdnhcwg espedcgilt gtictsgcar ckgrlptdcc |
| 241 | heqcaagctg pkhsdclacl hfnhsgicel hcpalvtynt dtfesmhnpe grytfgascv |
| 301 | ttcpynylst evgsctivcp pnnqevtaed gtqrcekcsk pcarvcyglg mehlrgarai |
| 361 | tsdnvqefdg ckkifgslaf lpesfdgdps sgiaplrpeq lqvfetleei tgylyisawp |
| 421 | dslrdlsvfq nlriirgril hdgaysltlq glgihslglr slrelgsgla lihrnahlcf |
| 481 | vhtvpwdqlf rnphgallhs gnrpeedcgl eglvcnslca hghcwgpgpt qcvncshflr |
| 541 | ggecveecry wkglpreyvs dkrclpchpe cqpqnssetc fgseadqcaa cahykdsssc |
| 601 | varcpsgvkp dlsympiwky pdeegicqpc pincthscvd ldergcpaeq raspvtfiia |
| 661 | tvvgvllfli lvvvvgilik rrrqkirkyt m |
| preE2Neu-Q141K SEQ ID NO: 12 |
| 1 | melaalcrwg lllallppga astqvctgtd mklrlpaspe thldmlrhly qgcqvvqgnl |
| 61 | eltylptnas lsflqdiqev qgyvliahnq vrqvplqrlr ivrgtqlfed nyalavldng |
| 121 | dplnnttpvt gaspgglrel klrslteilk ggvliqrnpq lcyqdtilwk difhknnqla |
| 181 | ltlidtnrsr achpcspmck gsrcwgesse dcqsltrtvc aggcarckgp 1ptdccheqc |
| 241 | aagctgpkhs dclaclhfnh sgicelhcpa lvtyntdtfe smpnpegryt fgascvtacp |
| 301 | ynylstdvgs ctivcplhnq evtaedgtqr cekcskpcar vcyglgmehl revravtsan |
| 361 | igefagckki fgslaflpes fdgdpasnta efaplrpeql qvfetleeit gylyisawpd |
| 421 | slrdlsvfqn lriirgrilh dgaysltlqg lgihslglrs lrelgsglal ihrnahlcfv |
| 481 | htvpwdqlfr nphqallhsg nrpeedcgle glvcnslcah ghcwgpgptq cvncshflrg |
| 541 | qecveecrvw kglpreyvsd krclpchpec qpqnssetcf gseadqcaac ahykdssscv |
| 601 | arcpsgvkpd lsympiwkyp deegicqpcp incthscvdl dergcpaeqr aspvtfiiat |
| 661 | vvgvllflil vvvvgilikr rrqkirkytm |
| mfeHER2-Q119K, SEQ ID NO: 13 |
| 1 | acccaagtgt gcaccggcac agacatgaag ctgcggctcc cagccagtcc cgagacccac |
| 61 | ctggacatgc tccgccacct ctaccagggc tgtcaagtgg tacagggcaa cctggagctc |
| 121 | acctacctgc atgccaatgc cagcctctcc ttcctgcagg atatccagga ggtgcaaggc |
| 181 | tatgtgctca ttgcccacaa ccaagtgaaa caggtcccac tgcagaggct acgaatcgtg |
| 241 | cgaggcaccc agctctttga ggacaactac gccctggccg tgctggacaa cggagaccca |
| 301 | ctggacagtg gcacccctgc tacaggggct gccctaggag ggctgcggga gctgaagctc |
| 361 | cgaagcctca cagagatcct gaagggaggg gtcctcattc agcggaaccc gcagctctgc |
| 421 | caccaggaca cgattctgtg gaaggacatc ttccacaaga acaaccagct ggccctcatg |
| 481 | ctgatagaca ccaaccgctc tcgggcctgc caaccctgtt ctccagcttg taaagactcc |
| 541 | cactgctggg gagcaagttc cggggactgt cagagcttga ctcgaactgt ctgtgctggc |
| 601 | ggctgtgccc gctgcaaggg cccgcagccc accgactgct gccacgagca atgtgctgct |
| 661 | ggctgcacgg gccccaagca ttctgactgc ctggcctgcc tccacttcaa ccacagtggc |
| 721 | atctgtgagc tgcactgccc agccctggtc acctacaaca cggacacctt cgaatccatg |
| 781 | cccaaccctg agggccgtta taccttcggt gccagctgtg tgactgcctg tccctacaac |
| 841 | tacctgtcta cggacgtggg atcctgcacc ctggtctgtc ccctgaacaa ccaagaggtg |
| 901 | acagctgagg atggaacaca gcggtgtgag aaatgcagca agccctgtgc ccgagtgtgc |
| 961 | tacggcctag gcatggagca cctgcgggag gcgagggcag tcaccagtgc caacatccaa |
| 1021 | gaatttgtcg gctgcaagaa gatctttggg agcctggcgt ttctgccaga gagctttgag |
| 1081 | ggggacccag cctccaacac tgcccccctg cagcctgagc agctcagagt gtttgaggct |
| 1141 | ctggaggaga ttacaggtta cctgtacatc tcagcgtggc cagacagctt gcctaacctc |
| 1201 | agtgtcttcc agaacctcag agtgatccgg ggccgagttc tgcatgacgg tgcttactcg |
| 1261 | ctgacccttc aagggctggg catcagctgg ctggggctgc gctcgctgcg ggagctgggc |
| 1321 | agtgggctgg ccctcatcca ccgcaactcc cgcctctgct tcgtacacac ggtgccctgg |
| 1381 | gaccagctct tccggaaccc ccaccaggcc ctgctccaca gcgccaaccg gccagaggac |
| 1441 | gagtgcgcgg gtgagggcct ggcctgctat ccgctgtgtg cccacgggca ctgctggggt |
| 1501 | ccgggaccca cccagtgtgt caactgcagc cagttccttc ggggccagga gtgcgtggag |
| 1561 | gaatgccgag tattgcaggg gcttccccgg gagtatgtga aggataggtt ctgtctgcca |
| 1621 | tgccacccgg agtgtcagcc ccagaatggc tcagtgacct gcttgggctc ggaagctgac |
| 1681 | cagtgtgtgg cctgtgccca ctacaaggac cctcctttct gtgtggctcg ctgccccagt |
| 1741 | ggggtgaaac ctgacctctc cttcatgccc atctggaagt tcgcagatga ggagggcacg |
| 1801 | tgccagccat gccccatcaa ctgcacccac tcctgtgcgg acctggacga gaagggctgc |
| 1861 | cccgccgagc agagagccag ccctgtgacg tccatcattg ctgctgtggt gggcattctg |
| 1921 | ctggtcgtgg ttgtggggct ggtccttggc atcctaatca agcgaaggcg gcagaagatc |
| 1981 | cggaagtaca cgatg |
| mbearHER2-Q119K, SEQ ID NO: 14 |
| 1 | acccaagtgt gcaccggcac agacatgaag ctgcggctcc ctgccagtcc cgagacccac |
| 61 | ctggatatgc tccgccacct ctaccaggcc tgtcaagtgg tacagggtaa cctggagctc |
| 121 | acctacctgc ccgccaatgc cagcctgtcc ttcctgcagg atatccagga ggtacagggc |
| 181 | tatgtgctca ttgctcacag ccaagtgaga caggtcccgc tgcagaggct ccgaatcgtg |
| 241 | cgaggcaccc agctctttga ggacaactac gccctggccg tgctggacaa tggagagccg |
| 301 | cccaaggggg acacctctgt ggcaggggct accccaggag ggctgcggga gctgaagctt |
| 361 | cgaagcctca cagagatcct gaagggaggg gtcttgattc agcggaaccc acagctctgc |
| 421 | caccaggaca cgattttgtg gaaggacatc ttccacaaga acaaccagct ggccctcacg |
| 481 | ctgatagaca ccaaccgctc tcgggcctgc caaccctgtt ctccagcctg taaagacccc |
| 541 | cactgctggg gagcaagttc cggggactgt cagagcttga cacgaaccgt ctgtgccggc |
| 601 | ggctgtgccc gctgcaaggg cccaaaaccc actgactgct gccatgagca gtgcgcggct |
| 661 | ggctgcacgg gccccaagca ctcggactgc ctggcctgcc ttcacttcaa ccacagtggc |
| 721 | atctgtgagc tgcactgccc agccctggtc acctacaaca cggacacgtt cgaatccatg |
| 781 | cccaaccctg agggccgata caccttcggt gccagctgtg tgaccgcctg tccctacaac |
| 841 | tacctgtcca cggacgtggg atcctgcacc ctggtctgtc ccctgaacaa ccaagaggtg |
| 901 | acggctgagg atggcaccca gcggtgtgag aaatgcagca gaccctgtgc ccgagtgtgc |
| 961 | tatggtctgg gcatggagca cctgcgggag gcgagggcgg tcaccagcgc caacatccaa |
| 1021 | gagttcgccg gctgcaagaa gatctttggg agcctggcgt ttctgccaga gagcttcgag |
| 1081 | ggagacccag cctccaacac tgcccccctg cagcctgaac agctcagagt gttcgaggcc |
| 1141 | ctggaggaga tcacaggtta cctgtatatc tcagcgtggc cggacagctt gcctaacctc |
| 1201 | agtgtcttcc agaacctgcg agtaatccgg ggacgagttc tgcatgatgg cgcctactcg |
| 1261 | ctgaccctgc aagggctggg catcagctgg ctggggctgc gctcgctgcg ggaactgggc |
| 1321 | agcgggctgg ccctcatcca ccgcaacgcc cgcctctgct tcatccacac ggtgccctgg |
| 1381 | gagcagctct tccggaaccc ccaccaagcc ctgctgcaca gtgccaaccg gccggaggcc |
| 1441 | gagtgcgtgg gcgagggcct ggcctgctac ccgctgtgcg cccatgggca ctgctggggt |
| 1501 | ccggggccca cccagtgcgt caactgcagc caattccttc ggggccagga gtgcgtggag |
| 1561 | gaatgccgag aactgcacgg gctaccccgg gaatatgtga aggacagata ctgtctgcca |
| 1621 | tgccaccccg agtgtcggcc ccagaatggc tcagtgacct gctttgggtc ggaggctgac |
| 1681 | cagtgtgtgg cctgcgccca ctacaaggac cctccctcct gcgtggctcg ctgccccagt |
| 1741 | ggtgtgaaac ccgacctctc tttcatgccc atttggaagt ttgcagatga ggagggcaca |
| 1801 | tgccagccgt gccccatcaa ctgcacccac tcctgtgggg acctggacga gaggggctgc |
| 1861 | cccgccgaac agagagccag ccctgtgaca tccatcattg ccgctgtggt gggcattctg |
| 1921 | ctggccgtgg tcatggggct ggtcctcggc atcctgatca agcgaaggcg acagaagatc |
| 1981 | cggaagtaca cgatg |
| mhumHER2-Q119K, SEQ ID NO: 15 |
| 1 | acccaagtgt gcaccggcac agacatgaag ctgcggctcc ctgccagtcc cgagacccac |
| 61 | ctggacatgc tccgccacct ctaccagggc tgccaggtgg tgcagggaaa cctggaactc |
| 121 | acctacctgc ccaccaatgc cagcctgtcc ttcctgcagg atatccagga ggtgcagggc |
| 181 | tacgtgctca tcgctcacaa ccaagtgagg caggtcccac tgcagaggct gcggattgtg |
| 241 | cgaggcaccc agctctttga ggacaactat gccctggccg tgctagacaa tggagacccg |
| 301 | ctgaacaata ccacccctgt cacaggggcc tccccaggag gcctgcggga gctgAagctt |
| 361 | cgaagcctca cagagatctt gaaaggaggg gtcttgatcc agcggaaccc ccagctctgc |
| 421 | taccaggaca cgattttgtg gaaggacatc ttccacaaga acaaccagct ggctctcaca |
| 481 | ctgatagaca ccaaccgctc tcgggcctgc cacccctgtt ctccgatgtg taagggctcc |
| 541 | cgctgctggg gagagagttc tgaggattgt cagagcctga cgcgcactgt ctgtgccggt |
| 601 | ggctgtgccc gctgcaaggg gccactgccc actgactgct gccatgagca gtgtgctgcc |
| 661 | ggctgcacgg gccccaagca ctctgactgc ctggcctgcc tccacttcaa ccacagtggc |
| 721 | atctgtgagc tgcactgccc agccctggtc acctacaaca cagacacgtt tgagtccatg |
| 781 | cccaatcccg agggccggta tacattcggc gccagctgtg tgactgcctg tccctacaac |
| 841 | tacctttcta cggacgtggg atcctgcacc ctcgtctgcc ccctgcacaa ccaagaggtg |
| 901 | acagcagagg atggaacaca gcggtgtgag aagtgcagca agccctgtgc ccgagtgtgc |
| 961 | tatggtctgg gcatggagca cttgcgagag gtgagggcag ttaccagtgc caatatccag |
| 1021 | gagtttgctg gctgcaagaa gatctttggg agcctggcat ttctgccgga gagctttgat |
| 1081 | ggggacccag cctccaacac tgccccgctc cagccagagc agctccaagt gtttgagact |
| 1141 | ctggaagaga tcacaggtta cctatacatc tcagcatggc cggacagcct gcctgacctc |
| 1201 | agcgtcttcc agaacctgca agtaatccgg ggacgaattc tgcacaatgg cgcctactcg |
| 1261 | ctgaccctgc aagggctggg catcagctgg ctggggctgc gctcactgag ggaactgggc |
| 1321 | agtggactgg ccctcatcca ccataacacc cacctctgct tcgtgcacac ggtgccctgg |
| 1381 | gaccagctct ttcggaaccc gcaccaagct ctgctccaca ctgccaaccg gccagaggac |
| 1441 | gagtgtgtgg gcgagggcct ggcctgccac cagctgtgcg cccgagggca ctgctggggt |
| 1501 | ccagggccca cccagtgtgt caactgcagc cagttccttc ggggccagga gtgcgtggag |
| 1561 | gaatgccgag tactgcaggg gctccccagg gagtatgtga atgccaggca ctgtttgccg |
| 1621 | tgccaccctg agtgtcagcc ccagaatggc tcagtgacct gttttggacc ggaggctgac |
| 1681 | cagtgtgtgg cctgtgccca ctataaggac cctcccttct gcgtggcccg ctgccccagc |
| 1741 | ggtgtgaaac ctgacctctc ctacatgccc atctggaagt ttccagatga ggagggcgca |
| 1801 | tgccagcctt gccccatcaa ctgcacccac tcctgtgtgg acctggatga caagggctgc |
| 1861 | cccgccgagc agagagccag ccctctgacg tccatcatct ctgcggtggt tggcattctg |
| 1921 | ctggtcgtgg tcttgggggt ggtctttggg atcctcatca agcgacggca gcagaagatc |
| 1981 | cggaagtaca cgatgtag |
| mmouseHER2-Q120K, SEQ ID NO: 16 |
| 1 | acccaagtgt gtaccggtac cgacatgaag ttgcgactcc ctgccagtcc tgagacccac |
| 61 | ctggacatgc ttcgccacct ctaccagggc tgtcaggtgg tgcagggcaa tttggagctt |
| 121 | acctacctgc ccgccaatgc cagcctctca ttcctgcagg acatccagga agtccaggga |
| 181 | tacatgctca tcgctcacaa ccgagtgaaa cacgtcccac tgcagaggtt gcgcatcgtg |
| 241 | agagggactc agctctttga ggacaagtat gccctggctg tgctagacaa ccgagaccct |
| 301 | ttggacaacg tcaccaccgc cgccccaggc agaaccccag aagggctgcg ggagctgaag |
| 361 | cttcgaagtc tcacagagat cttgaaggga ggagttttga tccgtgggaa ccctcagctc |
| 421 | tgctaccagg acatggtttt gtggaaggat gtcctccgta agaataacca gctggctcct |
| 481 | gtcgacatgg acaccaatcg ttcccgggcc tgtccacctt gtgccccaac ctgcaaagac |
| 541 | aatcactgtt ggggtgagag tcctgaagac tgtcagatct tgactggcac catctgtact |
| 601 | agtggctgtg cccggtgcaa gggccggctg cccactgact gttgccatga gcagtgtgct |
| 661 | gcaggctgca cgggtcccaa gcattctgac tgcctggcct gcctccactt caatcatagt |
| 721 | ggtatctgtg agctgcactg cccggccctc atcacctaca acacagacac cttcgagtcc |
| 781 | atgctcaacc ctgagggtcg ctacaccttt ggtgccagct gtgtgaccac ctgcccctac |
| 841 | aactacctct ccacggaagt gggatcctgc actctggtct gtcccccgaa caaccaagag |
| 901 | gtcacagctg aggacggaac acagcggtgt gagaaatgca gcaagccctg tgctggagta |
| 961 | tgctatggtc tgggcatgga gcacctccga ggggcgaggg ccatcaccag tgacaatatc |
| 1021 | caggagtttg ctggctgcaa gaagatcttt gggagcctgg catttttgcc ggagagcttt |
| 1081 | gatgggaacc cctcctccgg cgttgcccca ctgaagccag agcatctcca agtgttcgaa |
| 1141 | accctggagg agatcacagg ttacctatac atttcagcat ggccagagag cttccaagac |
| 1201 | ctcagtgtct tccagaacct tcgggtcatt cggggacgga ttctccatga tggtgcttac |
| 1261 | tcattgacgt tgcaaggcct ggggattcac tcactggggc tacgctcact gcgggagctg |
| 1321 | ggcagtggat tggctctcat tcaccgcaac acccatctct gctttgtaaa cactgtacct |
| 1381 | tgggaccagc tcttccggaa cccgcaccag gccctactcc acagtgggaa ccggccagaa |
| 1441 | gaggcatgtg gtcttgaggg cttggtctgt aactcactgt gtgcccgtgg gcactgctgg |
| 1501 | gggccagggc ccacccagtg tgtcaactgc agtcagttcc tccggggcca ggagtgtgtg |
| 1561 | gaggagtgcc gagtatggaa ggggctcccc agggagtatg tgaggggcaa gcactgtctg |
| 1621 | ccatgccacc ccgagtgtca gcctcaaaac agctcggaga cctgctatgg atcggaggct |
| 1681 | gaccagtgtg aggcttgtgc ccactacaag gactcatctt cctgtgtggc tcgctgcccc |
| 1741 | agtggtgtga agccagacct ctcctacatg cctatctgga agtacccgga tgaggagggc |
| 1801 | atatgtcagc catgccccat caactgcacc cactcatgtg tggacctgga cgaacgaggc |
| 1861 | tgcccagcag agcagagagc cagcccagtg acattcatca ttgcaactgt ggtgggcgtc |
| 1921 | ctgttgttcc tgatcatagt ggtggtcatt ggaatcctaa tcaaacgaag gcgacagaag |
| 1981 | atccggaagt ataccatg |
| mratHER2-Q120K, SEQ ID NO: 17 |
| 1 | acccaagtgt gtaccggcac agacatgaag ttgcggctcc ctgccagtcc tgagacccac |
| 61 | ctggacatgc tccgccacct gtaccagggc tgtcaggtag tgcagggcaa cttggagctt |
| 121 | acctacgtgc ctgccaatgc cagcctctca ttcctgcagg acatccagga agttcagggt |
| 181 | tacatgctca tcgctcacaa ccaggtgaag cgcgtcccac tgcaaaggct gcgcatcgtg |
| 241 | agagggaccc agctctttga ggacaagtat gccctggctg tgctagacaa ccgagatcct |
| 301 | caggacaatg tcgccgcctc caccccaggc agaaccccag aggggctgcg ggagctgaag |
| 361 | cttcgaagtc tcacagagat cctgaaggga ggagttttga tccgtgggaa ccctcagctc |
| 421 | tgctaccagg acatggtttt gtggaaggac gtcttccgca agaataacca actggctcct |
| 481 | gtcgatatag acaccaatcg ttcccgggcc tgtccacctt gtgcccccgc ctgcaaagac |
| 541 | aatcactgtt ggggtgagag tccggaagac tgtcagatct tgactggcac catctgtacc |
| 601 | agtggttgtg cccggtgcaa gggccggctg cccactgact gctgccatga gcagtgtgcc |
| 661 | gcaggctgca cgggccccaa gcattctgac tgcctggcct gcctccactt caatcatagt |
| 721 | ggtatctgtg agctgcactg cccagccctc gtcacctaca acacagacac ctttgagtcc |
| 781 | atgcacaacc ctgagggtcg ctacaccttt ggtgccagct gcgtgaccac ctgcccctac |
| 841 | aactacctgt ctacggaagt gggatcctgc actctggtgt gtcccccgaa taaccaagag |
| 901 | gtcacagctg aggacggaac acagcgttgt gagaaatgca gcaagccctg tgctcgagtg |
| 961 | tgctatggtc tgggcatgga gcaccttcga ggggcgaggg ccatcaccag tgacaatgtc |
| 1021 | caggagtttg atggctgcaa gaagatcttt gggagcctgg catttttgcc ggagagcttt |
| 1081 | gatggggacc cctcctccgg cattgctccg ctgaggcctg agcagctcca agtgttcgaa |
| 1141 | accctggagg agatcacagg ttacctgtac atctcagcat ggccagacag tctccgtgac |
| 1201 | ctcagtgtct tccagaacct tcgaatcatt cggggacgga ttctccacga tggcgcgtac |
| 1261 | tcattgacac tgcaaggcct ggggatccac tcgctggggc tgcgctcact gcgggagctg |
| 1321 | ggcagtggat tggctctgat tcaccgcaac gcccatctct gctttgtaca cactgtacct |
| 1381 | tgggaccagc tcttccggaa cccacatcag gccctgctcc acagtgggaa ccggccggaa |
| 1441 | gaggattgtg gtctcgaggg cttggtctgt aactcactgt gtgcccacgg gcactgctgg |
| 1501 | gggccagggc ccacccagtg tgtcaactgc agtcatttcc ttcggggcca ggagtgtgtg |
| 1561 | gaggagtgcc gagtatggaa ggggctcccc cgggagtatg tgagtgacaa gcgctgtctg |
| 1621 | ccgtgtcacc ccgagtgtca gcctcaaaac agctcagaga cctgctttgg atcggaggct |
| 1681 | gatcagtgtg cagcctgcgc ccactacaag gactcgtcct cctgtgtggc tcgctgcccc |
| 1741 | agtggtgtga aaccggacct ctcctacatg cccatctgga agtacccgga tgaggagggc |
| 1801 | atatgccagc cgtgccccat caactgcacc cactcctgtg tggatctgga tgaacgaggc |
| 1861 | tgcccagcag agcagagagc cagcccggtg acattcatca ttgcaactgt agtgggcgtc |
| 1921 | ctgctgttcc tgatcttagt ggtggtcgtt ggaatcctaa tcaaacgaag gagacagaag |
| 1981 | atccggaagt atacgatg |
| mE2Neu-Q119K, SEQ ID NO: 18 |
| 1 | acccaagtgt gcaccggcac agacatgaag ctgcggctcc ctgccagtcc cgagacccac |
| 61 | ctggacatgc tccgccacct ctaccagggc tgccaggtgg tgcagggaaa cctggaactc |
| 121 | acctacctgc ccaccaatgc cagcctgtcc ttcctgcagg atatccagga ggtgcagggc |
| 181 | tacgtgctca tcgctcacaa ccaagtgagg caggtcccac tgcagaggct gcggattgtg |
| 241 | cgaggcaccc agctctttga ggacaactat gccctggccg tgctagacaa tggagacccg |
| 301 | ctgaacaata ccacccctgt cacaggggcc tccccaggag gcctgcggga gctgaagctt |
| 361 | cgaagcctca cagagatctt gaaaggaggg gtcttgatcc agcggaaccc ccagctctgc |
| 421 | taccaggaca cgattttgtg gaaggacatc ttccacaaga acaaccagct ggctctcaca |
| 481 | ctgatagaca ccaaccgctc tcgggcctgc cacccctgtt ctccgatgtg taagggctcc |
| 541 | cgctgctggg gagagagttc tgaggattgt cagagcctga cgcgcactgt ctgtgccggt |
| 601 | ggctgtgccc gctgcaaggg gccactgccc actgactgct gccatgagca gtgtgctgcc |
| 661 | ggctgcacgg gccccaagca ctctgactgc ctggcctgcc tccacttcaa ccacagtggc |
| 721 | atctgtgagc tgcactgccc agccctggtc acctacaaca cagacacgtt tgagtccatg |
| 781 | cccaatcccg agggccggta tacattcggc gccagctgtg tgactgcctg tccctacaac |
| 841 | tacctttcta cggacgtggg atcctgcacc ctcgtctgcc ccctgcacaa ccaagaggtg |
| 901 | acagcagagg atggaacaca gcggtgtgag aagtgcagca agccctgtgc ccgagtgtgc |
| 961 | tatggtctgg gcatggagca cttgcgagag gtgagggcag ttaccagtgc caatatccag |
| 1021 | gagtttgctg gctgcaagaa gatctttggg agcctggcat ttctgccgga gagctttgat |
| 1081 | ggggacccag cctccaacac tgccgaattc gctccgctga ggcctgagca gctccaagtg |
| 1141 | ttcgaaaccc tggaggagat cacaggttac ctgtacatct cagcatggcc agacagtctc |
| 1201 | cgtgacctca gtgtcttcca gaaccttcga atcattcggg gacggattct ccacgatggc |
| 1261 | gcgtactcat tgacactgca aggcctgggg atccactcgc tggggctgcg ctcactgcgg |
| 1321 | gagctgggca gtggattggc tctgattcac cgcaacgccc atctctgctt tgtacacact |
| 1381 | gtaccttggg accagctctt ccggaaccca catcaggccc tgctccacag tgggaaccgg |
| 1441 | ccggaagagg attgtggtct cgagggcttg gtctgtaact cactgtgtgc ccacgggcac |
| 1501 | tgctgggggc cagggcccac ccagtgtgtc aactgcagtc atttccttcg gggccaggag |
| 1561 | tgtgtggagg agtgccgagt atggaagggg ctcccccggg agtatgtgag tgacaagcgc |
| 1621 | tgtctgccgt gtcaccccga gtgtcagcct caaaacagct cagagacctg ctttggatcg |
| 1681 | gaggctgatc agtgtgcagc ctgcgcccac tacaaggact cgtcctcctg tgtggctcgc |
| 1741 | tgccccagtg gtgtgaaacc ggacctctcc tacatgccca tctggaagta cccggatgag |
| 1801 | gagggcatat gccagccgtg ccccatcaac tgcacccact cctgtgtgga tctggatgaa |
| 1861 | cgaggctgcc cagcagagca gagagccagc ccggtgacat tcatcattgc aactgtagtg |
| 1921 | ggcgtcctgc tgttcctgat cttagtggtg gtcgttggaa tcctaatcaa acgaaggaga |
| 1981 | cagaagatcc ggaagtatac gatg |
| prefeHER2-Q141, SEQ ID NO: 19 |
| 1 | atggagctgg cggcctggtg ccgctggggg ctcctcctcg ccctcctgcc ctccggagcc |
| 61 | acgggcaccc aagtgtgcac cggcacagac atgaagctgc ggctcccagc cagtcccgag |
| 121 | acccacctgg acatgctccg ccacctctac cagggctgtc aagtggtaca gggcaacctg |
| 181 | gagctcacct acctgcatgc caatgccagc ctctccttcc tgcaggatat ccaggaggtg |
| 241 | caaggctatg tgctcattgc ccacaaccaa gtgaaacagg tcccactgca gaggctacga |
| 301 | atcgtgcgag gcacccagct ctttgaggac aactacgccc tggccgtgct ggacaacgga |
| 361 | gacccactgg acagtggcac ccctgctaca ggggctgccc taggagggct gcgggagctg |
| 421 | aagctccgaa gcctcacaga gatcctgaag ggaggggtcc tcattcagcg gaacccgcag |
| 481 | ctctgccacc aggacacgat tctgtggaag gacatcttcc acaagaacaa ccagctggcc |
| 541 | ctcatgctga tagacaccaa ccgctctcgg gcctgccaac cctgttctcc agcttgtaaa |
| 601 | gactcccact gctggggagc aagttccggg gactgtcaga gcttgactcg aactgtctgt |
| 661 | gctggcggct gtgcccgctg caagggcccg cagcccaccg actgctgcca cgagcaatgt |
| 721 | gctgctggct gcacgggccc caagcattct gactgcctgg cctgcctcca cttcaaccac |
| 781 | agtggcatct gtgagctgca ctgcccagcc ctggtcacct acaacacgga caccttcgaa |
| 841 | tccatgccca accctgaggg ccgttatacc ttcggtgcca gctgtgtgac tgcctgtccc |
| 901 | tacaactacc tgtctacgga cgtgggatcc tgcaccctgg tctgtcccct gaacaaccaa |
| 961 | gaggtgacag ctgaggatgg aacacagcgg tgtgagaaat gcagcaagcc ctgtgcccga |
| 1021 | gtgtgctacg gcctaggcat ggagcacctg cgggaggcga gggcagtcac cagtgccaac |
| 1081 | atccaagaat ttgtcggctg caagaagatc tttgggagcc tggcgtttct gccagagagc |
| 1141 | tttgaggggg acccagcctc caacactgcc cccctgcagc ctgagcagct cagagtgttt |
| 1201 | gaggctctgg aggagattac aggttacctg tacatctcag cgtggccaga cagcttgcct |
| 1261 | aacctcagtg tcttccagaa cctcagagtg atccggggcc gagttctgca tgacggtgct |
| 1321 | tactcgctga cccttcaagg gctgggcatc agctggctgg ggctgcgctc gctgcgggag |
| 1381 | ctgggcagtg ggctggccct catccaccgc aactcccgcc tctgcttcgt acacacggtg |
| 1441 | ccctgggacc agctcttccg gaacccccac caggccctgc tccacagcgc caaccggcca |
| 1501 | gaggacgagt gcgcgggtga gggcctggcc tgctatccgc tgtgtgccca cgggcactgc |
| 1561 | tggggtccgg gacccaccca gtgtgtcaac tgcagccagt tccttcgggg ccaggagtgc |
| 1621 | gtggaggaat gccgagtatt gcaggggctt ccccgggagt atgtgaagga taggttctgt |
| 1681 | ctgccatgcc acccggagtg tcagccccag aatggctcag tgacctgctt gggctcggaa |
| 1741 | gctgaccagt gtgtggcctg tgcccactac aaggaccctc ctttctgtgt ggctcgctgc |
| 1801 | cccagtgggg tgaaacctga cctctccttc atgcccatct ggaagttcgc agatgaggag |
| 1861 | ggcacgtgcc agccatgccc catcaactgc acccactcct gtgcggacct ggacgagaag |
| 1921 | ggctgccccg ccgagcagag agccagccct gtgacgtcca tcattgctgc tgtggtgggc |
| 1981 | attctgctgg tcgtggttgt ggggctggtc cttggcatcc taatcaagcg aaggcggcag |
| 2041 | aagatccgga agtacacgat g |
| prebearHER2-Q141K, SEQ ID NO: 20 |
| 1 | atggagctgg cggcctggtg ccgctggggg ctcctcctcg ccctcctgcc ctccggagcc |
| 61 | gcgggcaccc aagtgtgcac cggcacagac atgaagctgc ggctccctgc cagtcccgag |
| 121 | acccacctgg atatgctccg ccacctctac caggcctgtc aagtggtaca gggtaacctg |
| 181 | gagctcacct acctgcccgc caatgccagc ctgtccttcc tgcaggatat ccaggaggta |
| 241 | cagggctatg tgctcattgc tcacagccaa gtgagacagg tcccgctgca gaggctccga |
| 301 | atcgtgcgag gcacccagct ctttgaggac aactacgccc tggccgtgct ggacaatgga |
| 361 | gagccgccca agggggacac ctctgtggca ggggctaccc caggagggct gcgggagctg |
| 421 | aagcttcgaa gcctcacaga gatcctgaag ggaggggtct tgattcagcg gaacccacag |
| 481 | ctctgccacc aggacacgat tttgtggaag gacatcttcc acaagaacaa ccagctggcc |
| 541 | ctcacgctga tagacaccaa ccgctctcgg gcctgccaac cctgttctcc agcctgtaaa |
| 601 | gacccccact gctggggagc aagttccggg gactgtcaga gcttgacacg aaccgtctgt |
| 661 | gccggcggct gtgcccgctg caagggccca aaacccactg actgctgcca tgagcagtgc |
| 721 | gcggctggct gcacgggccc caagcactcg gactgcctgg cctgccttca cttcaaccac |
| 781 | agtggcatct gtgagctgca ctgcccagcc ctggtcacct acaacacgga cacgttcgaa |
| 841 | tccatgccca accctgaggg ccgatacacc ttcggtgcca gctgtgtgac cgcctgtccc |
| 901 | tacaactacc tgtccacgga cgtgggatcc tgcaccctgg tctgtcccct gaacaaccaa |
| 961 | gaggtgacgg ctgaggatgg cacccagcgg tgtgagaaat gcagcagacc ctgtgcccga |
| 1021 | gtgtgctatg gtctgggcat ggagcacctg cgggaggcga gggcggtcac cagcgccaac |
| 1081 | atccaagagt tcgccggctg caagaagatc tttgggagcc tggcgtttct gccagagagc |
| 1141 | ttcgagggag acccagcctc caacactgcc cccctgcagc ctgaacagct cagagtgttc |
| 1201 | gaggccctgg aggagatcac aggttacctg tatatctcag cgtggccgga cagcttgcct |
| 1261 | aacctcagtg tcttccagaa cctgcgagta atccggggac gagttctgca tgatggcgcc |
| 1321 | tactcgctga ccctgcaagg gctgggcatc agctggctgg ggctgcgctc gctgcgggaa |
| 1381 | ctgggcagcg ggctggccct catccaccgc aacgcccgcc tctgcttcat ccacacggtg |
| 1441 | ccctgggagc agctcttccg gaacccccac caagccctgc tgcacagtgc caaccggccg |
| 1501 | gaggccgagt gcgtgggcga gggcctggcc tgctacccgc tgtgcgccca tgggcactgc |
| 1561 | tggggtccgg ggcccaccca gtgcgtcaac tgcagccaat tccttcgggg ccaggagtgc |
| 1621 | gtggaggaat gccgagaact gcacgggcta ccccgggaat atgtgaagga cagatactgt |
| 1681 | ctgccatgcc accccgagtg tcggccccag aatggctcag tgacctgctt tgggtcggag |
| 1741 | gctgaccagt gtgtggcctg cgcccactac aaggaccctc cctcctgcgt ggctcgctgc |
| 1801 | cccagtggtg tgaaacccga cctctctttc atgcccattt ggaagtttgc agatgaggag |
| 1861 | ggcacatgcc agccgtgccc catcaactgc acccactcct gtggggacct ggacgagagg |
| 1921 | ggctgccccg ccgaacagag agccagccct gtgacatcca tcattgccgc tgtggtgggc |
| 1981 | attctgctgg ccgtggtcat ggggctggtc ctcggcatcc tgatcaagcg aaggcgacag |
| 2041 | aagatccgga agtacacgat g |
| prehumHER2-Q141K, SEQ ID NO: 21 |
| 1 | atggagctgg cggccttgtg ccgctggggg ctcctcctcg ccctcttgcc ccccggagcc |
| 61 | gcgagcaccc aagtgtgcac cggcacagac atgaagctgc ggctccctgc cagtcccgag |
| 121 | acccacctgg acatgctccg ccacctctac cagggctgcc aggtggtgca gggaaacctg |
| 181 | gaactcacct acctgcccac caatgccagc ctgtccttcc tgcaggatat ccaggaggtg |
| 241 | cagggctacg tgctcatcgc tcacaaccaa gtgaggcagg tcccactgca gaggctgcgg |
| 301 | attgtgcgag gcacccagct ctttgaggac aactatgccc tggccgtgct agacaatgga |
| 361 | gacccgctga acaataccac ccctgtcaca ggggcctccc caggaggcct gcgggagctg |
| 421 | Aagcttcgaa gcctcacaga gatcttgaaa ggaggggtct tgatccagcg gaacccccag |
| 481 | ctctgctacc aggacacgat tttgtggaag gacatcttcc acaagaacaa ccagctggct |
| 541 | ctcacactga tagacaccaa ccgctctcgg gcctgccacc cctgttctcc gatgtgtaag |
| 601 | ggctcccgct gctggggaga gagttctgag gattgtcaga gcctgacgcg cactgtctgt |
| 661 | gccggtggct gtgcccgctg caaggggcca ctgcccactg actgctgcca tgagcagtgt |
| 721 | gctgccggct gcacgggccc caagcactct gactgcctgg cctgcctcca cttcaaccac |
| 781 | agtggcatct gtgagctgca ctgcccagcc ctggtcacct acaacacaga cacgtttgag |
| 841 | tccatgccca atcccgaggg ccggtataca ttcggcgcca gctgtgtgac tgcctgtccc |
| 901 | tacaactacc tttctacgga cgtgggatcc tgcaccctcg tctgccccct gcacaaccaa |
| 961 | gaggtgacag cagaggatgg aacacagcgg tgtgagaagt gcagcaagcc ctgtgcccga |
| 1021 | gtgtgctatg gtctgggcat ggagcacttg cgagaggtga gggcagttac cagtgccaat |
| 1081 | atccaggagt ttgctggctg caagaagatc tttgggagcc tggcatttct gccggagagc |
| 1141 | tttgatgggg acccagcctc caacactgcc ccgctccagc cagagcagct ccaagtgttt |
| 1201 | gagactctgg aagagatcac aggttaccta tacatctcag catggccgga cagcctgcct |
| 1261 | gacctcagcg tcttccagaa cctgcaagta atccggggac gaattctgca caatggcgcc |
| 1321 | tactcgctga ccctgcaagg gctgggcatc agctggctgg ggctgcgctc actgagggaa |
| 1381 | ctgggcagtg gactggccct catccaccat aacacccacc tctgcttcgt gcacacggtg |
| 1441 | ccctgggacc agctctttcg gaacccgcac caagctctgc tccacactgc caaccggcca |
| 1501 | gaggacgagt gtgtgggcga gggcctggcc tgccaccagc tgtgcgcccg agggcactgc |
| 1561 | tggggtccag ggcccaccca gtgtgtcaac tgcagccagt tccttcgggg ccaggagtgc |
| 1621 | gtggaggaat gccgagtact gcaggggctc cccagggagt atgtgaatgc caggcactgt |
| 1681 | ttgccgtgcc accctgagtg tcagccccag aatggctcag tgacctgttt tggaccggag |
| 1741 | gctgaccagt gtgtggcctg tgcccactat aaggaccctc ccttctgcgt ggcccgctgc |
| 1801 | cccagcggtg tgaaacctga cctctcctac atgcccatct ggaagtttcc agatgaggag |
| 1861 | ggcgcatgcc agccttgccc catcaactgc acccactcct gtgtggacct ggatgacaag |
| 1921 | ggctgccccg ccgagcagag agccagccct ctgacgtcca tcatctctgc ggtggttggc |
| 1981 | attctgctgg tcgtggtctt gggggtggtc tttgggatcc tcatcaagcg acggcagcag |
| 2041 | aagatccgga agtacacgat gtag |
| premouseHER2-Q142K, SEQ ID NO: 22 |
| 1 | atggagctgg cggcctggtg ccgttggggg ttcctcctcg ccctcctgtc ccccggagcc |
| 61 | gcgggtaccc aagtgtgtac cggtaccgac atgaagttgc gactccctgc cagtcctgag |
| 121 | acccacctgg acatgcttcg ccacctctac cagggctgtc aggtggtgca gggcaatttg |
| 181 | gagcttacct acctgcccgc caatgccagc ctctcattcc tgcaggacat ccaggaagtc |
| 241 | cagggataca tgctcatcgc tcacaaccga gtgaaacacg tcccactgca gaggttgcgc |
| 301 | atcgtgagag ggactcagct ctttgaggac aagtatgccc tggctgtgct agacaaccga |
| 361 | gaccctttgg acaacgtcac caccgccgcc ccaggcagaa ccccagaagg gctgcgggag |
| 421 | ctgaagcttc gaagtctcac agagatcttg aagggaggag ttttgatccg tgggaaccct |
| 481 | cagctctgct accaggacat ggttttgtgg aaggatgtcc tccgtaagaa taaccagctg |
| 541 | gctcctgtcg acatggacac caatcgttcc cgggcctgtc caccttgtgc cccaacctgc |
| 601 | aaagacaatc actgttgggg tgagagtcct gaagactgtc agatcttgac tggcaccatc |
| 661 | tgtactagtg gctgtgcccg gtgcaagggc cggctgccca ctgactgttg ccatgagcag |
| 721 | tgtgctgcag gctgcacggg tcccaagcat tctgactgcc tggcctgcct ccacttcaat |
| 781 | catagtggta tctgtgagct gcactgcccg gccctcatca cctacaacac agacaccttc |
| 841 | gagtccatgc tcaaccctga gggtcgctac acctttggtg ccagctgtgt gaccacctgc |
| 901 | ccctacaact acctctccac ggaagtggga tcctgcactc tggtctgtcc cccgaacaac |
| 961 | caagaggtca cagctgagga cggaacacag cggtgtgaga aatgcagcaa gccctgtgct |
| 1021 | ggagtatgct atggtctggg catggagcac ctccgagggg cgagggccat caccagtgac |
| 1081 | aatatccagg agtttgctgg ctgcaagaag atctttggga gcctggcatt tttgccggag |
| 1141 | agctttgatg ggaacccctc ctccggcgtt gccccactga agccagagca tctccaagtg |
| 1201 | ttcgaaaccc tggaggagat cacaggttac ctatacattt cagcatggcc agagagcttc |
| 1261 | caagacctca gtgtcttcca gaaccttcgg gtcattcggg gacggattct ccatgatggt |
| 1321 | gcttactcat tgacgttgca aggcctgggg attcactcac tggggctacg ctcactgcgg |
| 1381 | gagctgggca gtggattggc tctcattcac cgcaacaccc atctctgctt tgtaaacact |
| 1441 | gtaccttggg accagctctt ccggaacccg caccaggccc tactccacag tgggaaccgg |
| 1501 | ccagaagagg catgtggtct tgagggcttg gtctgtaact cactgtgtgc ccgtgggcac |
| 1561 | tgctgggggc cagggcccac ccagtgtgtc aactgcagtc agttcctccg gggccaggag |
| 1621 | tgtgtggagg agtgccgagt atggaagggg ctccccaggg agtatgtgag gggcaagcac |
| 1681 | tgtctgccat gccaccccga gtgtcagcct caaaacagct cggagacctg ctatggatcg |
| 1741 | gaggctgacc agtgtgaggc ttgtgcccac tacaaggact catcttcctg tgtggctcgc |
| 1801 | tgccccagtg gtgtgaagcc agacctctcc tacatgccta tctggaagta cccggatgag |
| 1861 | gagggcatat gtcagccatg ccccatcaac tgcacccact catgtgtgga cctggacgaa |
| 1921 | cgaggctgcc cagcagagca gagagccagc ccagtgacat tcatcattgc aactgtggtg |
| 1981 | ggcgtcctgt tgttcctgat catagtggtg gtcattggaa tcctaatcaa acgaaggcga |
| 2041 | cagaagatcc ggaagtatac catg |
| preratHER2-Q145K, SEQ ID NO: 23 |
| 1 | atgatcatca tggagctggc ggcctggtgc cgctgggggt tcctcctcgc cctcctgccc |
| 61 | cccggaatcg cgggcaccca agtgtgtacc ggcacagaca tgaagttgcg gctccctgcc |
| 121 | agtcctgaga cccacctgga catgctccgc cacctgtacc agggctgtca ggtagtgcag |
| 181 | ggcaacttgg agcttaccta cgtgcctgcc aatgccagcc tctcattcct gcaggacatc |
| 241 | caggaagttc agggttacat gctcatcgct cacaaccagg tgaagcgcgt cccactgcaa |
| 301 | aggctgcgca tcgtgagagg gacccagctc tttgaggaca agtatgccct ggctgtgcta |
| 361 | gacaaccgag atcctcagga caatgtcgcc gcctccaccc caggcagaac cccagagggg |
| 421 | ctgcgggagc tgaagcttcg aagtctcaca gagatcctga agggaggagt tttgatccgt |
| 481 | gggaaccctc agctctgcta ccaggacatg gttttgtgga aggacgtctt ccgcaagaat |
| 541 | aaccaactgg ctcctgtcga tatagacacc aatcgttccc gggcctgtcc accttgtgcc |
| 601 | cccgcctgca aagacaatca ctgttggggt gagagtccgg aagactgtca gatcttgact |
| 661 | ggcaccatct gtaccagtgg ttgtgcccgg tgcaagggcc ggctgcccac tgactgctgc |
| 721 | catgagcagt gtgccgcagg ctgcacgggc cccaagcatt ctgactgcct ggcctgcctc |
| 781 | cacttcaatc atagtggtat ctgtgagctg cactgcccag ccctcgtcac ctacaacaca |
| 841 | gacacctttg agtccatgca caaccctgag ggtcgctaca cctttggtgc cagctgcgtg |
| 901 | accacctgcc cctacaacta cctgtctacg gaagtgggat cctgcactct ggtgtgtccc |
| 961 | ccgaataacc aagaggtcac agctgaggac ggaacacagc gttgtgagaa atgcagcaag |
| 1021 | ccctgtgctc gagtgtgcta tggtctgggc atggagcacc ttcgaggggc gagggccatc |
| 1081 | accagtgaca atgtccagga gtttgatggc tgcaagaaga tctttgggag cctggcattt |
| 1141 | ttgccggaga gctttgatgg ggacccctcc tccggcattg ctccgctgag gcctgagcag |
| 1201 | ctccaagtgt tcgaaaccct ggaggagatc acaggttacc tgtacatctc agcatggcca |
| 1261 | gacagtctcc gtgacctcag tgtcttccag aaccttcgaa tcattcgggg acggattctc |
| 1321 | cacgatggcg cgtactcatt gacactgcaa ggcctgggga tccactcgct ggggctgcgc |
| 1381 | tcactgcggg agctgggcag tggattggct ctgattcacc gcaacgccca tctctgcttt |
| 1441 | gtacacactg taccttggga ccagctcttc cggaacccac atcaggccct gctccacagt |
| 1501 | gggaaccggc cggaagagga ttgtggtctc gagggcttgg tctgtaactc actgtgtgcc |
| 1561 | cacgggcact gctgggggcc agggcccacc cagtgtgtca actgcagtca tttccttcgg |
| 1621 | ggccaggagt gtgtggagga gtgccgagta tggaaggggc tcccccggga gtatgtgagt |
| 1681 | gacaagcgct gtctgccgtg tcaccccgag tgtcagcctc aaaacagctc agagacctgc |
| 1741 | tttggatcgg aggctgatca gtgtgcagcc tgcgcccact acaaggactc gtcctcctgt |
| 1801 | gtggctcgct gccccagtgg tgtgaaaccg gacctctcct acatgcccat ctggaagtac |
| 1861 | ccggatgagg agggcatatg ccagccgtgc cccatcaact gcacccactc ctgtgtggat |
| 1921 | ctggatgaac gaggctgccc agcagagcag agagccagcc cggtgacatt catcattgca |
| 1981 | actgtagtgg gcgtcctgct gttcctgatc ttagtggtgg tcgttggaat cctaatcaaa |
| 2041 | cgaaggagac agaagatccg gaagtatacg atg |
| preE2Neu-Q141K, SEQ ID NO: 24 |
| 1 | atggagctgg cggccttgtg ccgctggggg ctcctcctcg ccctcttgcc ccccggagcc |
| 61 | gcgagcaccc aagtgtgcac cggcacagac atgaagctgc ggctccctgc cagtcccgag |
| 121 | acccacctgg acatgctccg ccacctctac cagggctgcc aggtggtgca gggaaacctg |
| 181 | gaactcacct acctgcccac caatgccagc ctgtccttcc tgcaggatat ccaggaggtg |
| 241 | cagggctacg tgctcatcgc tcacaaccaa gtgaggcagg tcccactgca gaggctgcgg |
| 301 | attgtgcgag gcacccagct ctttgaggac aactatgccc tggccgtgct agacaatgga |
| 361 | gacccgctga acaataccac ccctgtcaca ggggcctccc caggaggcct gcgggagctg |
| 421 | aagcttcgaa gcctcacaga gatcttgaaa ggaggggtct tgatccagcg gaacccccag |
| 481 | ctctgctacc aggacacgat tttgtggaag gacatcttcc acaagaacaa ccagctggct |
| 541 | ctcacactga tagacaccaa ccgctctcgg gcctgccacc cctgttctcc gatgtgtaag |
| 601 | ggctcccgct gctggggaga gagttctgag gattgtcaga gcctgacgcg cactgtctgt |
| 661 | gccggtggct gtgcccgctg caaggggcca ctgcccactg actgctgcca tgagcagtgt |
| 721 | gctgccggct gcacgggccc caagcactct gactgcctgg cctgcctcca cttcaaccac |
| 781 | agtggcatct gtgagctgca ctgcccagcc ctggtcacct acaacacaga cacgtttgag |
| 841 | tccatgccca atcccgaggg ccggtataca ttcggcgcca gctgtgtgac tgcctgtccc |
| 901 | tacaactacc tttctacgga cgtgggatcc tgcaccctcg tctgccccct gcacaaccaa |
| 961 | gaggtgacag cagaggatgg aacacagcgg tgtgagaagt gcagcaagcc ctgtgcccga |
| 1021 | gtgtgctatg gtctgggcat ggagcacttg cgagaggtga gggcagttac cagtgccaat |
| 1081 | atccaggagt ttgctggctg caagaagatc tttgggagcc tggcatttct gccggagagc |
| 1141 | tttgatgggg acccagcctc caacactgcc gaattcgctc cgctgaggcc tgagcagctc |
| 1201 | caagtgttcg aaaccctgga ggagatcaca ggttacctgt acatctcagc atggccagac |
| 1261 | agtctccgtg acctcagtgt cttccagaac cttcgaatca ttcggggacg gattctccac |
| 1321 | gatggcgcgt actcattgac actgcaaggc ctggggatcc actcgctggg gctgcgctca |
| 1381 | ctgcgggagc tgggcagtgg attggctctg attcaccgca acgcccatct ctgctttgta |
| 1441 | cacactgtac cttgggacca gctcttccgg aacccacatc aggccctgct ccacagtggg |
| 1501 | aaccggccgg aagaggattg tggtctcgag ggcttggtct gtaactcact gtgtgcccac |
| 1561 | gggcactgct gggggccagg gcccacccag tgtgtcaact gcagtcattt ccttcggggc |
| 1621 | caggagtgtg tggaggagtg ccgagtatgg aaggggctcc cccgggagta tgtgagtgac |
| 1681 | aagcgctgtc tgccgtgtca ccccgagtgt cagcctcaaa acagctcaga gacctgcttt |
| 1741 | ggatcggagg ctgatcagtg tgcagcctgc gcccactaca aggactcgtc ctcctgtgtg |
| 1801 | gctcgctgcc ccagtggtgt gaaaccggac ctctcctaca tgcccatctg gaagtacccg |
| 1861 | gatgaggagg gcatatgcca gccgtgcccc atcaactgca cccactcctg tgtggatctg |
| 1921 | gatgaacgag gctgcccagc agagcagaga gccagcccgg tgacattcat cattgcaact |
| 1981 | gtagtgggcg tcctgctgtt cctgatctta gtggtggtcg ttggaatcct aatcaaacga |
| 2041 | aggagacaga agatccggaa gtatacgatg |
| mhumHER2-Q307K, SEQ ID NO: 25 |
| 1 | tqvctgtdmk lrlpaspeth ldmlrhlyqg cqvvqgnlel tylptnasls flqdiqevqg |
| 61 | yvliahnqvr qvplqrlriv rgtqlfedny alavldngdp lnnttpvtga spgglrelql |
| 121 | rslteilkgg vliqrnpqlc yqdtilwkdi fhknnqlalt lidtnrsrac hpcspmckgs |
| 181 | rcwgessedc qsltrtvcag gcarckgplp tdccheqcaa gctgpkhsdc laclhfnhsg |
| 241 | icelhcpalv tyntdtfesm pnpegrytfg ascvtacpyn ylstdvgsct lvcplhnqev |
| 301 | taedgtKrce kcskpcarvc yglgmehlre vravtsaniq efagckkifg slaflpesfd |
| 361 | gdpasntapl qpeqlqvfet leeitgylyi sawpdslpdl svfqnlqvir grilhngays |
| 421 | ltlqglgisw lglrslrelg sglalihhnt hlcfvhtvpw dqlfrnphqa llhtanrped |
| 481 | ecvgeglach qlcarghcwg pgptqcvncs qflrgqecve ecrvlqglpr eyvnarhclp |
| 541 | chpecqpqng svtcfgpead qcvacahykd ppfcvarcps gvkpdlsymp iwkfpdeega |
| 601 | cqpcpincth scvdlddkgc paeqrasplt siisavvgil lvvvlgvvfg ilikrrqqki |
| 661 | rkytm |
| mhumHER2-Q407R, SEQ ID NO: 26 |
| 1 | tqvctgtdmk lrlpaspeth ldmlrhlyqg cqvvqgnlel tylptnasls flqdiqevqg |
| 61 | yvliahnqvr qvplqrlriv rgtqlfedny alavldngdp lnnttpvtga spgglrelql |
| 121 | rslteilkgg vliqrnpqlc yqdtilwkdi fhknnqlalt lidtnrsrac hpcspmckgs |
| 181 | rcwgessedc qsltrtvcag gcarckgplp tdccheqcaa gctgpkhsdc laclhfnhsg |
| 241 | icelhcpalv tyntdtfesm pnpegrytfg ascvtacpyn ylstdvgsct lvcplhnqev |
| 301 | taedgtqrce kcskpcarvc yglgmehlre vravtsaniq efagckkifg slaflpesfd |
| 361 | gdpasntapl qpeqlqvfet leeitgylyi sawpdslpdl svfqn1Rvir grilhngays |
| 421 | ltlqglgisw lglrslrelg sglalihhnt hlcfvhtvpw dqlfrnphqa llhtanrped |
| 481 | ecvgeglach qlcarghcwg pgptqcvncs qflrgqecve ecrvlqglpr eyvnarhclp |
| 541 | chpecqpqng svtcfgpead qcvacahykd ppfcvarcps gvkpdlsymp iwkfpdeega |
| 601 | cqpcpincth scvdlddkgc paeqrasplt siisavvgil lvvvlgvvfg ilikrrqqki |
| 661 | rkytm |
| mhumHER2-N416D SEQ ID NO: 27 |
| 1 | tqvctgtdmk lrlpaspeth ldmlrhlyqg cqvvqgnlel tylptnasls flqdiqevqg |
| 61 | yvliahnqvr qvplqrlriv rgtqlfedny alavldngdp lnnttpvtga spgglrelql |
| 121 | rslteilkgg vliqrnpqlc yqdtilwkdi fhknnqlalt lidtnrsrac hpcspmckgs |
| 181 | rcwgessedc qsltrtvcag gcarckgplp tdccheqcaa gctgpkhsdc laclhfnhsg |
| 241 | icelhcpalv tyntdtfesm pnpegrytfg ascvtacpyn ylstdvgsct lvcplhnqev |
| 301 | taedgtqrce kcskpcarvc yglgmehlre vravtsaniq efagckkifg slaflpesfd |
| 361 | gdpasntapl qpeqlqvfet leeitgylyi sawpdslpdl svfqnlqvir grilhDgays |
| 421 | ltlqglgisw lglrslrelg sglalihhnt hlcfvhtvpw dqlfrnphqa llhtanrped |
| 481 | ecvgeglach qlcarghcwg pgptqcvncs qflrgqecve ecrvlqglpr eyvnarhclp |
| 541 | chpecqpqng svtcfgpead qcvacahykd ppfcvarcps gvkpdlsymp iwkfpdeega |
| 601 | cqpcpincth scvdlddkgc paeqrasplt siisavvgil lvvvlgvvfg ilikrrqqki |
| 661 | rkytm |
| prehumHER2-Q329K, SEQ ID NO: 28 |
| 1 | melaalcrwg lllallppga astqvctgtd mklrlpaspe thldmlrhly qgcqvvqgnl |
| 61 | eltylptnas lsflgdigev qgyvliahnq vrqvplqrlr ivrgtqlfed nyalavldng |
| 121 | dpinnttpvt gaspgglrel qlrslteilk ggvliqrnpq lcyqdtilwk difhknnqla |
| 181 | ltlidtnrsr achpcspmck gsrcwgesse dcqsltrtvc aggcarckgp 1ptdccheqc |
| 241 | aagctgpkhs dclaclhfnh sgicelhcpa lvtyntdtfe smpnpegryt fgascvtacp |
| 301 | ynylstdvgs ctlvcplhnq evtaedgtKr cekcskpcar vcyglgmehl revravtsan |
| 361 | igefagokki fgslaflpes fdgdpasnta plqpeqlqvf etleeitgyl yisawpdslp |
| 421 | dlsvfqnlqv irgrilhnga ysltlqglgi swlglrslre lgsglalihh nthlcfvhtv |
| 481 | pwdqlfrnph qallhtanrp edecvgegla chqlcarghc wgpgptqcvn csqflrggec |
| 541 | veecrvlqgl preyvnarhc lpchpecqpq ngsvtcfgpe adqcvacahy kdppfcvarc |
| 601 | psgvkpdlsy mpiwkfpdee gacqpcpinc thscvdlddk gcpaegrasp ltsiisavvg |
| 661 | illvvvlgvv fgilikrrqq kirkytm |
| prehumHER2-Q429R, SEQ ID NO: 29 |
| 1 | melaalcrwg lllallppga astqvctgtd mklrlpaspe thldmlrhly qgcqvvqgnl |
| 61 | eltylptnas lsflgdigev qgyvliahnq vrqvplqrlr ivrgtqlfed nyalavldng |
| 121 | dpinnttpvt gaspgglrel qlrslteilk ggvliqrnpq lcyqdtilwk difhknnqla |
| 181 | ltlidtnrsr achpcspmck gsrcwgesse dcqsltrtvc aggcarckgp 1ptdccheqc |
| 241 | aagctgpkhs dclaclhfnh sgicelhcpa lvtyntdtfe smpnpegryt fgascvtacp |
| 301 | ynylstdvgs ctlvcplhnq evtaedgtqr cekcskpcar vcyglgmehl revravtsan |
| 361 | igefagokki fgslaflpes fdgdpasnta plqpeqlqvf etleeitgyl yisawpdslp |
| 421 | dlsvfqn1Rv irgrilhnga ysltlqglgi swlglrslre lgsglalihh nthlcfvhtv |
| 481 | pwdqlfrnph qallhtanrp edecvgegla chqlcarghc wgpgptqcvn csqflrggec |
| 541 | veecrvlqgl preyvnarhc lpchpecqpq ngsvtcfgpe adqcvacahy kdppfcvarc |
| 601 | psgvkpdlsy mpiwkfpdee gacqpcpinc thscvdlddk gcpaegrasp ltsiisavvg |
| 661 | illvvvlgvv fgilikrrqq kirkytm |
| prehumHER2-N438D, SEQ ID NO: 30 |
| 1 | melaalcrwg lllallppga astqvctgtd mklrlpaspe thldmlrhly qgcqvvqgnl |
| 61 | eltylptnas lsflgdigev qgyvliahnq vrqvplqrlr ivrgtqlfed nyalavldng |
| 121 | dpinnttpvt gaspgglrel qlrslteilk ggvliqrnpq lcyqdtilwk difhknnqla |
| 181 | ltlidtnrsr achpcspmck gsrcwgesse dcqsltrtvc aggcarckgp 1ptdccheqc |
| 241 | aagctgpkhs dclaclhfnh sgicelhcpa lvtyntdtfe smpnpegryt fgascvtacp |
| 301 | ynylstdvgs ctlvcplhnq evtaedgtqr cekcskpcar vcyglgmehl revravtsan |
| 361 | igefagokki fgslaflpes fdgdpasnta plqpeqlqvf etleeitgyl yisawpdslp |
| 421 | dlsvfqnlqv irgrilhDga ysltlqglgi swlglrslre lgsglalihh nthlcfvhtv |
| 481 | pwdqlfrnph qallhtanrp edecvgegla chqlcarghc wgpgptqcvn csqflrggec |
| 541 | veecrvlqgl preyvnarhc lpchpecqpq ngsvtcfgpe adqcvacahy kdppfcvarc |
| 601 | psgvkpdlsy mpiwkfpdee gacqpcpinc thscvdlddk gcpaegrasp ltsiisavvg |
| 661 | illvvvlgvv fgilikrrqq kirkytm |
| mhumHER2-Q307K, SEQ ID NO: 31 |
| 1 | acccaagtgt gcaccggcac agacatgaag ctgcggctcc ctgccagtcc cgagacccac |
| 61 | ctggacatgc tccgccacct ctaccagggc tgccaggtgg tgcagggaaa cctggaactc |
| 121 | acctacctgc ccaccaatgc cagcctgtcc ttcctgcagg atatccagga ggtgcagggc |
| 181 | tacgtgctca tcgctcacaa ccaagtgagg caggtcccac tgcagaggct gcggattgtg |
| 241 | cgaggcaccc agctctttga ggacaactat gccctggccg tgctagacaa tggagacccg |
| 301 | ctgaacaata ccacccctgt cacaggggcc tccccaggag gcctgcggga gctgcagctt |
| 361 | cgaagcctca cagagatctt gaaaggaggg gtcttgatcc agcggaaccc ccagctctgc |
| 421 | taccaggaca cgattttgtg gaaggacatc ttccacaaga acaaccagct ggctctcaca |
| 481 | ctgatagaca ccaaccgctc tcgggcctgc cacccctgtt ctccgatgtg taagggctcc |
| 541 | cgctgctggg gagagagttc tgaggattgt cagagcctga cgcgcactgt ctgtgccggt |
| 601 | ggctgtgccc gctgcaaggg gccactgccc actgactgct gccatgagca gtgtgctgcc |
| 661 | ggctgcacgg gccccaagca ctctgactgc ctggcctgcc tccacttcaa ccacagtggc |
| 721 | atctgtgagc tgcactgccc agccctggtc acctacaaca cagacacgtt tgagtccatg |
| 781 | cccaatcccg agggccggta tacattcggc gccagctgtg tgactgcctg tccctacaac |
| 841 | tacctttcta cggacgtggg atcctgcacc ctcgtctgcc ccctgcacaa ccaagaggtg |
| 901 | acagcagagg atggaacaAa gcggtgtgag aagtgcagca agccctgtgc ccgagtgtgc |
| 961 | tatggtctgg gcatggagca cttgcgagag gtgagggcag ttaccagtgc caatatccag |
| 1021 | gagtttgctg gctgcaagaa gatctttggg agcctggcat ttctgccgga gagctttgat |
| 1081 | ggggacccag cctccaacac tgccccgctc cagccagagc agctccaagt gtttgagact |
| 1141 | ctggaagaga tcacaggtta cctatacatc tcagcatggc cggacagcct gcctgacctc |
| 1201 | agcgtcttcc agaacctgca agtaatccgg ggacgaattc tgcacaatgg cgcctactcg |
| 1261 | ctgaccctgc aagggctggg catcagctgg ctggggctgc gctcactgag ggaactgggc |
| 1321 | agtggactgg ccctcatcca ccataacacc cacctctgct tcgtgcacac ggtgccctgg |
| 1381 | gaccagctct ttcggaaccc gcaccaagct ctgctccaca ctgccaaccg gccagaggac |
| 1441 | gagtgtgtgg gcgagggcct ggcctgccac cagctgtgcg cccgagggca ctgctggggt |
| 1501 | ccagggccca cccagtgtgt caactgcagc cagttccttc ggggccagga gtgcgtggag |
| 1561 | gaatgccgag tactgcaggg gctccccagg gagtatgtga atgccaggca ctgtttgccg |
| 1621 | tgccaccctg agtgtcagcc ccagaatggc tcagtgacct gttttggacc ggaggctgac |
| 1681 | cagtgtgtgg cctgtgccca ctataaggac cctcccttct gcgtggcccg ctgccccagc |
| 1741 | ggtgtgaaac ctgacctctc ctacatgccc atctggaagt ttccagatga ggagggcgca |
| 1801 | tgccagcctt gccccatcaa ctgcacccac tcctgtgtgg acctggatga caagggctgc |
| 1861 | cccgccgagc agagagccag ccctctgacg tccatcatct ctgcggtggt tggcattctg |
| 1921 | ctggtcgtgg tcttgggggt ggtctttggg atcctcatca agcgacggca gcagaagatc |
| 1981 | cggaagtaca cgatgtga |
| mhumHER2-Q407R, SEQ ID NO: 32 |
| 1 | acccaagtgt gcaccggcac agacatgaag ctgcggctcc ctgccagtcc cgagacccac |
| 61 | ctggacatgc tccgccacct ctaccagggc tgccaggtgg tgcagggaaa cctggaactc |
| 121 | acctacctgc ccaccaatgc cagcctgtcc ttcctgcagg atatccagga ggtgcagggc |
| 181 | tacgtgctca tcgctcacaa ccaagtgagg caggtcccac tgcagaggct gcggattgtg |
| 241 | cgaggcaccc agctctttga ggacaactat gccctggccg tgctagacaa tggagacccg |
| 301 | ctgaacaata ccacccctgt cacaggggcc tccccaggag gcctgcggga gctgcagctt |
| 361 | cgaagcctca cagagatctt gaaaggaggg gtcttgatcc agcggaaccc ccagctctgc |
| 421 | taccaggaca cgattttgtg gaaggacatc ttccacaaga acaaccagct ggctctcaca |
| 481 | ctgatagaca ccaaccgctc tcgggcctgc cacccctgtt ctccgatgtg taagggctcc |
| 541 | cgctgctggg gagagagttc tgaggattgt cagagcctga cgcgcactgt ctgtgccggt |
| 601 | ggctgtgccc gctgcaaggg gccactgccc actgactgct gccatgagca gtgtgctgcc |
| 661 | ggctgcacgg gccccaagca ctctgactgc ctggcctgcc tccacttcaa ccacagtggc |
| 721 | atctgtgagc tgcactgccc agccctggtc acctacaaca cagacacgtt tgagtccatg |
| 781 | cccaatcccg agggccggta tacattcggc gccagctgtg tgactgcctg tccctacaac |
| 841 | tacctttcta cggacgtggg atcctgcacc ctcgtctgcc ccctgcacaa ccaagaggtg |
| 901 | acagcagagg atggaacaca gcggtgtgag aagtgcagca agccctgtgc ccgagtgtgc |
| 961 | tatggtctgg gcatggagca cttgcgagag gtgagggcag ttaccagtgc caatatccag |
| 1021 | gagtttgctg gctgcaagaa gatctttggg agcctggcat ttctgccgga gagctttgat |
| 1081 | ggggacccag cctccaacac tgccccgctc cagccagagc agctccaagt gtttgagact |
| 1141 | ctggaagaga tcacaggtta cctatacatc tcagcatggc cggacagcct gcctgacctc |
| 1201 | agcgtcttcc agaacctgAG agtaatccgg ggacgaattc tgcacaatgg cgcctactcg |
| 1261 | ctgaccctgc aagggctggg catcagctgg ctggggctgc gctcactgag ggaactgggc |
| 1321 | agtggactgg ccctcatcca ccataacacc cacctctgct tcgtgcacac ggtgccctgg |
| 1381 | gaccagctct ttcggaaccc gcaccaagct ctgctccaca ctgccaaccg gccagaggac |
| 1441 | gagtgtgtgg gcgagggcct ggcctgccac cagctgtgcg cccgagggca ctgctggggt |
| 1501 | ccagggccca cccagtgtgt caactgcagc cagttccttc ggggccagga gtgcgtggag |
| 1561 | gaatgccgag tactgcaggg gctccccagg gagtatgtga atgccaggca ctgtttgccg |
| 1621 | tgccaccctg agtgtcagcc ccagaatggc tcagtgacct gttttggacc ggaggctgac |
| 1681 | cagtgtgtgg cctgtgccca ctataaggac cctcccttct gcgtggcccg ctgccccagc |
| 1741 | ggtgtgaaac ctgacctctc ctacatgccc atctggaagt ttccagatga ggagggcgca |
| 1801 | tgccagcctt gccccatcaa ctgcacccac tcctgtgtgg acctggatga caagggctgc |
| 1861 | cccgccgagc agagagccag ccctctgacg tccatcatct ctgcggtggt tggcattctg |
| 1921 | ctggtcgtgg tcttgggggt ggtctttggg atcctcatca agcgacggca gcagaagatc |
| 1981 | cggaagtaca cgatgtga |
| mhumHER2-N416D, SEQ ID NO: 33 |
| 1 | acccaagtgt gcaccggcac agacatgaag ctgcggctcc ctgccagtcc cgagacccac |
| 61 | ctggacatgc tccgccacct ctaccagggc tgccaggtgg tgcagggaaa cctggaactc |
| 121 | acctacctgc ccaccaatgc cagcctgtcc ttcctgcagg atatccagga ggtgcagggc |
| 181 | tacgtgctca tcgctcacaa ccaagtgagg caggtcccac tgcagaggct gcggattgtg |
| 241 | cgaggcaccc agctctttga ggacaactat gccctggccg tgctagacaa tggagacccg |
| 301 | ctgaacaata ccacccctgt cacaggggcc tccccaggag gcctgcggga gctgcagctt |
| 361 | cgaagcctca cagagatctt gaaaggaggg gtcttgatcc agcggaaccc ccagctctgc |
| 421 | taccaggaca cgattttgtg gaaggacatc ttccacaaga acaaccagct ggctctcaca |
| 481 | ctgatagaca ccaaccgctc tcgggcctgc cacccctgtt ctccgatgtg taagggctcc |
| 541 | cgctgctggg gagagagttc tgaggattgt cagagcctga cgcgcactgt ctgtgccggt |
| 601 | ggctgtgccc gctgcaaggg gccactgccc actgactgct gccatgagca gtgtgctgcc |
| 661 | ggctgcacgg gccccaagca ctctgactgc ctggcctgcc tccacttcaa ccacagtggc |
| 721 | atctgtgagc tgcactgccc agccctggtc acctacaaca cagacacgtt tgagtccatg |
| 781 | cccaatcccg agggccggta tacattcggc gccagctgtg tgactgcctg tccctacaac |
| 841 | tacctttcta cggacgtggg atcctgcacc ctcgtctgcc ccctgcacaa ccaagaggtg |
| 901 | acagcagagg atggaacaca gcggtgtgag aagtgcagca agccctgtgc ccgagtgtgc |
| 961 | tatggtctgg gcatggagca cttgcgagag gtgagggcag ttaccagtgc caatatccag |
| 1021 | gagtttgctg gctgcaagaa gatctttggg agcctggcat ttctgccgga gagctttgat |
| 1081 | ggggacccag cctccaacac tgccccgctc cagccagagc agctccaagt gtttgagact |
| 1141 | ctggaagaga tcacaggtta cctatacatc tcagcatggc cggacagcct gcctgacctc |
| 1201 | agcgtcttcc agaacctgca agtaatccgg ggacgaattc tgcacGatgg cgcctactcg |
| 1261 | ctgaccctgc aagggctggg catcagctgg ctggggctgc gctcactgag ggaactgggc |
| 1321 | agtggactgg ccctcatcca ccataacacc cacctctgct tcgtgcacac ggtgccctgg |
| 1381 | gaccagctct ttcggaaccc gcaccaagct ctgctccaca ctgccaaccg gccagaggac |
| 1441 | gagtgtgtgg gcgagggcct ggcctgccac cagctgtgcg cccgagggca ctgctggggt |
| 1501 | ccagggccca cccagtgtgt caactgcagc cagttccttc ggggccagga gtgcgtggag |
| 1561 | gaatgccgag tactgcaggg gctccccagg gagtatgtga atgccaggca ctgtttgccg |
| 1621 | tgccaccctg agtgtcagcc ccagaatggc tcagtgacct gttttggacc ggaggctgac |
| 1681 | cagtgtgtgg cctgtgccca ctataaggac cctcccttct gcgtggcccg ctgccccagc |
| 1741 | ggtgtgaaac ctgacctctc ctacatgccc atctggaagt ttccagatga ggagggcgca |
| 1801 | tgccagcctt gccccatcaa ctgcacccac tcctgtgtgg acctggatga caagggctgc |
| 1861 | cccgccgagc agagagccag ccctctgacg tccatcatct ctgcggtggt tggcattctg |
| 1921 | ctggtcgtgg tcttgggggt ggtctttggg atcctcatca agcgacggca gcagaagatc |
| 1981 | cggaagtaca cgatgtga |
| prehumHER2-Q329K, SEQ ID NO: 34 |
| 1 | atggagctgg cggccttgtg ccgctggggg ctcctcctcg ccctcttgcc ccccggagcc |
| 61 | gcgagcaccc aagtgtgcac cggcacagac atgaagctgc ggctccctgc cagtcccgag |
| 121 | acccacctgg acatgctccg ccacctctac cagggctgcc aggtggtgca gggaaacctg |
| 181 | gaactcacct acctgcccac caatgccagc ctgtccttcc tgcaggatat ccaggaggtg |
| 241 | cagggctacg tgctcatcgc tcacaaccaa gtgaggcagg tcccactgca gaggctgcgg |
| 301 | attgtgcgag gcacccagct ctttgaggac aactatgccc tggccgtgct agacaatgga |
| 361 | gacccgctga acaataccac ccctgtcaca ggggcctccc caggaggcct gcgggagctg |
| 421 | cagcttcgaa gcctcacaga gatcttgaaa ggaggggtct tgatccagcg gaacccccag |
| 481 | ctctgctacc aggacacgat tttgtggaag gacatcttcc acaagaacaa ccagctggct |
| 541 | ctcacactga tagacaccaa ccgctctcgg gcctgccacc cctgttctcc gatgtgtaag |
| 601 | ggctcccgct gctggggaga gagttctgag gattgtcaga gcctgacgcg cactgtctgt |
| 661 | gccggtggct gtgcccgctg caaggggcca ctgcccactg actgctgcca tgagcagtgt |
| 721 | gctgccggct gcacgggccc caagcactct gactgcctgg cctgcctcca cttcaaccac |
| 781 | agtggcatct gtgagctgca ctgcccagcc ctggtcacct acaacacaga cacgtttgag |
| 841 | tccatgccca atcccgaggg ccggtataca ttcggcgcca gctgtgtgac tgcctgtccc |
| 901 | tacaactacc tttctacgga cgtgggatcc tgcaccctcg tctgccccct gcacaaccaa |
| 961 | gaggtgacag cagaggatgg aacaAagcgg tgtgagaagt gcagcaagcc ctgtgcccga |
| 1021 | gtgtgctatg gtctgggcat ggagcacttg cgagaggtga gggcagttac cagtgccaat |
| 1081 | atccaggagt ttgctggctg caagaagatc tttgggagcc tggcatttct gccggagagc |
| 1141 | tttgatgggg acccagcctc caacactgcc ccgctccagc cagagcagct ccaagtgttt |
| 1201 | gagactctgg aagagatcac aggttaccta tacatctcag catggccgga cagcctgcct |
| 1261 | gacctcagcg tcttccagaa cctgcaagta atccggggac gaattctgca caatggcgcc |
| 1321 | tactcgctga ccctgcaagg gctgggcatc agctggctgg ggctgcgctc actgagggaa |
| 1381 | ctgggcagtg gactggccct catccaccat aacacccacc tctgcttcgt gcacacggtg |
| 1441 | ccctgggacc agctctttcg gaacccgcac caagctctgc tccacactgc caaccggcca |
| 1501 | gaggacgagt gtgtgggcga gggcctggcc tgccaccagc tgtgcgcccg agggcactgc |
| 1561 | tggggtccag ggcccaccca gtgtgtcaac tgcagccagt tccttcgggg ccaggagtgc |
| 1621 | gtggaggaat gccgagtact gcaggggctc cccagggagt atgtgaatgc caggcactgt |
| 1681 | ttgccgtgcc accctgagtg tcagccccag aatggctcag tgacctgttt tggaccggag |
| 1741 | gctgaccagt gtgtggcctg tgcccactat aaggaccctc ccttctgcgt ggcccgctgc |
| 1801 | cccagcggtg tgaaacctga cctctcctac atgcccatct ggaagtttcc agatgaggag |
| 1861 | ggcgcatgcc agccttgccc catcaactgc acccactcct gtgtggacct ggatgacaag |
| 1921 | ggctgccccg ccgagcagag agccagccct ctgacgtcca tcatctctgc ggtggttggc |
| 1981 | attctgctgg tcgtggtctt gggggtggtc tttgggatcc tcatcaagcg acggcagcag |
| 2041 | aagatccgga agtacacgat gtga |
| prehumHER2-Q429R, SEQ ID NO: 35 |
| 1 | atggagctgg cggccttgtg ccgctggggg ctcctcctcg ccctcttgcc ccccggagcc |
| 61 | gcgagcaccc aagtgtgcac cggcacagac atgaagctgc ggctccctgc cagtcccgag |
| 121 | acccacctgg acatgctccg ccacctctac cagggctgcc aggtggtgca gggaaacctg |
| 181 | gaactcacct acctgcccac caatgccagc ctgtccttcc tgcaggatat ccaggaggtg |
| 241 | cagggctacg tgctcatcgc tcacaaccaa gtgaggcagg tcccactgca gaggctgcgg |
| 301 | attgtgcgag gcacccagct ctttgaggac aactatgccc tggccgtgct agacaatgga |
| 361 | gacccgctga acaataccac ccctgtcaca ggggcctccc caggaggcct gcgggagctg |
| 421 | cagcttcgaa gcctcacaga gatcttgaaa ggaggggtct tgatccagcg gaacccccag |
| 481 | ctctgctacc aggacacgat tttgtggaag gacatcttcc acaagaacaa ccagctggct |
| 541 | ctcacactga tagacaccaa ccgctctcgg gcctgccacc cctgttctcc gatgtgtaag |
| 601 | ggctcccgct gctggggaga gagttctgag gattgtcaga gcctgacgcg cactgtctgt |
| 661 | gccggtggct gtgcccgctg caaggggcca ctgcccactg actgctgcca tgagcagtgt |
| 721 | gctgccggct gcacgggccc caagcactct gactgcctgg cctgcctcca cttcaaccac |
| 781 | agtggcatct gtgagctgca ctgcccagcc ctggtcacct acaacacaga cacgtttgag |
| 841 | tccatgccca atcccgaggg ccggtataca ttcggcgcca gctgtgtgac tgcctgtccc |
| 901 | tacaactacc tttctacgga cgtgggatcc tgcaccctcg tctgccccct gcacaaccaa |
| 961 | gaggtgacag cagaggatgg aacacagcgg tgtgagaagt gcagcaagcc ctgtgcccga |
| 1021 | gtgtgctatg gtctgggcat ggagcacttg cgagaggtga gggcagttac cagtgccaat |
| 1081 | atccaggagt ttgctggctg caagaagatc tttgggagcc tggcatttct gccggagagc |
| 1141 | tttgatgggg acccagcctc caacactgcc ccgctccagc cagagcagct ccaagtgttt |
| 1201 | gagactctgg aagagatcac aggttaccta tacatctcag catggccgga cagcctgcct |
| 1261 | gacctcagcg tcttccagaa cctgAGagta atccggggac gaattctgca caatggcgcc |
| 1321 | tactcgctga ccctgcaagg gctgggcatc agctggctgg ggctgcgctc actgagggaa |
| 1381 | ctgggcagtg gactggccct catccaccat aacacccacc tctgcttcgt gcacacggtg |
| 1441 | ccctgggacc agctctttcg gaacccgcac caagctctgc tccacactgc caaccggcca |
| 1501 | gaggacgagt gtgtgggcga gggcctggcc tgccaccagc tgtgcgcccg agggcactgc |
| 1561 | tggggtccag ggcccaccca gtgtgtcaac tgcagccagt tccttcgggg ccaggagtgc |
| 1621 | gtggaggaat gccgagtact gcaggggctc cccagggagt atgtgaatgc caggcactgt |
| 1681 | ttgccgtgcc accctgagtg tcagccccag aatggctcag tgacctgttt tggaccggag |
| 1741 | gctgaccagt gtgtggcctg tgcccactat aaggaccctc ccttctgcgt ggcccgctgc |
| 1801 | cccagcggtg tgaaacctga cctctcctac atgcccatct ggaagtttcc agatgaggag |
| 1861 | ggcgcatgcc agccttgccc catcaactgc acccactcct gtgtggacct ggatgacaag |
| 1921 | ggctgccccg ccgagcagag agccagccct ctgacgtcca tcatctctgc ggtggttggc |
| 1981 | attctgctgg tcgtggtctt gggggtggtc tttgggatcc tcatcaagcg acggcagcag |
| 2041 | aagatccgga agtacacgat gtga |
| prehumHER2-N438D SEQ ID NO: 36 |
| 1 | atggagctgg cggccttgtg ccgctggggg ctcctcctcg ccctcttgcc ccccggagcc |
| 61 | gcgagcaccc aagtgtgcac cggcacagac atgaagctgc ggctccctgc cagtcccgag |
| 121 | acccacctgg acatgctccg ccacctctac cagggctgcc aggtggtgca gggaaacctg |
| 181 | gaactcacct acctgcccac caatgccagc ctgtccttcc tgcaggatat ccaggaggtg |
| 241 | cagggctacg tgctcatcgc tcacaaccaa gtgaggcagg tcccactgca gaggctgcgg |
| 301 | attgtgcgag gcacccagct ctttgaggac aactatgccc tggccgtgct agacaatgga |
| 361 | gacccgctga acaataccac ccctgtcaca ggggcctccc caggaggcct gcgggagctg |
| 421 | cagcttcgaa gcctcacaga gatcttgaaa ggaggggtct tgatccagcg gaacccccag |
| 481 | ctctgctacc aggacacgat tttgtggaag gacatcttcc acaagaacaa ccagctggct |
| 541 | ctcacactga tagacaccaa ccgctctcgg gcctgccacc cctgttctcc gatgtgtaag |
| 601 | ggctcccgct gctggggaga gagttctgag gattgtcaga gcctgacgcg cactgtctgt |
| 661 | gccggtggct gtgcccgctg caaggggcca ctgcccactg actgctgcca tgagcagtgt |
| 721 | gctgccggct gcacgggccc caagcactct gactgcctgg cctgcctcca cttcaaccac |
| 781 | agtggcatct gtgagctgca ctgcccagcc ctggtcacct acaacacaga cacgtttgag |
| 841 | tccatgccca atcccgaggg ccggtataca ttcggcgcca gctgtgtgac tgcctgtccc |
| 901 | tacaactacc tttctacgga cgtgggatcc tgcaccctcg tctgccccct gcacaaccaa |
| 961 | gaggtgacag cagaggatgg aacacagcgg tgtgagaagt gcagcaagcc ctgtgcccga |
| 1021 | gtgtgctatg gtctgggcat ggagcacttg cgagaggtga gggcagttac cagtgccaat |
| 1081 | atccaggagt ttgctggctg caagaagatc tttgggagcc tggcatttct gccggagagc |
| 1141 | tttgatgggg acccagcctc caacactgcc ccgctccagc cagagcagct ccaagtgttt |
| 1201 | gagactctgg aagagatcac aggttaccta tacatctcag catggccgga cagcctgcct |
| 1261 | gacctcagcg tcttccagaa cctgcaagta atccggggac gaattctgca cGatggcgcc |
| 1321 | tactcgctga ccctgcaagg gctgggcatc agctggctgg ggctgcgctc actgagggaa |
| 1381 | ctgggcagtg gactggccct catccaccat aacacccacc tctgcttcgt gcacacggtg |
| 1441 | ccctgggacc agctctttcg gaacccgcac caagctctgc tccacactgc caaccggcca |
| 1501 | gaggacgagt gtgtgggcga gggcctggcc tgccaccagc tgtgcgcccg agggcactgc |
| 1561 | tggggtccag ggcccaccca gtgtgtcaac tgcagccagt tccttcgggg ccaggagtgc |
| 1621 | gtggaggaat gccgagtact gcaggggctc cccagggagt atgtgaatgc caggcactgt |
| 1681 | ttgccgtgcc accctgagtg tcagccccag aatggctcag tgacctgttt tggaccggag |
| 1741 | gctgaccagt gtgtggcctg tgcccactat aaggaccctc ccttctgcgt ggcccgctgc |
| 1801 | cccagcggtg tgaaacctga cctctcctac atgcccatct ggaagtttcc agatgaggag |
| 1861 | ggcgcatgcc agccttgccc catcaactgc acccactcct gtgtggacct ggatgacaag |
| 1921 | ggctgccccg ccgagcagag agccagccct ctgacgtcca tcatctctgc ggtggttggc |
| 1981 | attctgctgg tcgtggtctt gggggtggtc tttgggatcc tcatcaagcg acggcagcag |
| 2041 | aagatccgga agtacacgat gtga |
| prebearHER2, SEQ ID NO: 37 |
| 1 | melaawcrwg lllallpsga agtqvctgtd mklrlpaspe thldmlrhly qacqvvqgnl |
| 61 | eltylpanas lsflqdiqev qgyvliahsq vrqvplqrlr ivrgtqlfed nyalavldng |
| 121 | eppkgdtsva gatpgglrel qlrslteilk ggvliqrnpq lchqdtilwk difhknnqla |
| 181 | ltlidtnrsr acqpcspack dphcwgassg dcqsltrtvc aggcarckgp kptdccheqc |
| 241 | aagctgpkhs dclaclhfnh sgicelhcpa lvtyntdtfe smpnpegryt fgascvtacp |
| 301 | ynylstdvgs ctlvcpinnq evtaedgtqr cekcsrpcar vcyglgmehl rearavtsan |
| 361 | iqefagckki fgslaflpes fegdpasnta plq8peqlrvf ealeeitgyl yisawpdslp |
| 421 | nlsvfqnlrv irgrvlhdga ysltlqglgi swlglrslre lgsglalihr narlcfihtv |
| 481 | pweqlfrnph qallhsanrp eaecvgegla cyplcahghc wgpgptqcvn csqflrgqec |
| 541 | veecrelhgl preyvkdryc lpchpecrpq ngsvtcfgse adqcvacahy kdppscvarc |
| 601 | psgvkpdlsf mpiwkfadee gtcqpcpinc thscgdlder gcpaeqrasp vtsiiaavvg |
| 661 | illavvmglv lgilikrrrq kirkytm |
| mbearHER2, SEQ ID NO: 38 |
| 1 | tqvctgtdmk lrlpaspeth ldmlrhlyqa cqvvqgnlel tylpanasls flqdiqevqg |
| 61 | yvliahsqvr qvplqrlriv rgtqlfedny alavldngep pkgdtsvaga tpgglrelql |
| 121 | rslteilkgg vliqrnpqlc hqdtilwkdi fhknnqlalt lidtnrsrac qpcspackdp |
| 181 | hcwgassgdc qsltrtvcag gcarckgpkp tdccheqcaa gctgpkhsdc laclhfnhsg |
| 241 | icelhcpalv tyntdtfesm pnpegrytfg ascvtacpyn ylstdvgsct lvcpinnqev |
| 301 | taedgtqrce kcsrpcarvc yglgmehlre aravtsaniq efagckkifg slaflpesfe |
| 361 | gdpasntapl qpeqlrvfea leeitgylyi sawpdslpnl svfqnlrvir grvlhdgays |
| 421 | ltlqglgisw lglrslrelg sglalihrna rlcfihtvpw eqlfrnphqa llhsanrpea |
| 481 | ecvgeglacy plcahghcwg pgptqcvncs qflrgqecve ecrelhglpr eyvkdryclp |
| 541 | chpecrpqng svtcfgsead qcvacahykd ppscvarcps gvkpdlsfmp iwkfadeegt |
| 601 | cqpcpincth scgdldergc paeqraspvt siiaavvgil lavvmglvlg ilikrrrqki |
| 661 | rkytm |
| prefeHER2, SEQ ID NO: 39 |
| 1 | melaawcrwg lllallpsga tgtqvctgtd mklrlpaspe thldmlrhly qgcqvvqgnl |
| 61 | eltylhanas lsflqdiqev qgyvliahnq vkqvplqrlr ivrgtqlfed nyalavldng |
| 121 | dpldsgtpat gaalgglrel qlrslteilk ggvliqrnpq lchqdtilwk difhknnqla |
| 181 | lmlidtnrsr acqpcspack dshcwgassg dcqsltrtvc aggcarckgp qptdccheqc |
| 241 | aagctgpkhs dclaclhfnh sgicelhcpa lvtyntdtfe smpnpegryt fgascvtacp |
| 301 | ynylstdvgs ctlvcpinnq evtaedgtqr cekcskpcar vcyglgmehl rearavtsan |
| 361 | iqefvgckki fgslaflpes fegdpasnta plqpeqlrvf ealeeitgyl yisawpdslp |
| 421 | nlsvfqnlrv irgrvlhdga ysltlqglgi swlglrslre lgsglalihr nsrlcfvhtv |
| 481 | pwdqlfrnph qallhsanrp edecagegla cyplcahghc wgpgptqcvn csqflrgqec |
| 541 | veecrvlqgl preyvkdrfc lpchpecqpq ngsvtclgse adqcvacahy kdppfcvarc |
| 601 | psgvkpdlsf mpiwkfadee gtcqpcpinc thscadldek gcpaeqrasp vtsiiaavvg |
| 661 | illvvvvglv lgilikrrrq kirkytm |
| mfeHER2 SEQ ID NO: 40 |
| 1 | tqvctgtdmk lrlpaspeth ldmlrhlyqg cqvvqgnlel tylhanasls flqdiqevqg |
| 61 | yvliahnqvk qvplqrlriv rgtqlfedny alavldngdp ldsgtpatga algglrelql |
| 121 | rslteilkgg vliqrnpqlc hqdtilwkdi fhknnqlalm lidtnrsrac qpcspackds |
| 181 | hcwgassgdc qsltrtvcag gcarckgpqp tdccheqcaa gctgpkhsdc laclhfnhsg |
| 241 | icelhcpalv tyntdtfesm pnpegrytfg ascvtacpyn ylstdvgsct lvcpinnqev |
| 301 | taedgtqrce kcskpcarvc yglgmehlre aravtsaniq efvgckkifg slaflpesfe |
| 361 | gdpasntapl qpeqlrvfea leeitgylyi sawpdslpnl svfqnlrvir grvlhdgays |
| 421 | ltlqglgisw lglrslrelg sglalihrns rlcfvhtvpw dqlfrnphqa llhsanrped |
| 481 | ecageglacy plcahghcwg pgptqcvncs qflrgqecve ecrvlqglpr eyvkdrfclp |
| 541 | chpecqpqng svtclgsead qcvacahykd ppfcvarcps gvkpdlsfmp iwkfadeegt |
| 601 | cqpcpincth scadldekgc paeqraspvt siiaavvgil lvvvvglvlg ilikrrrqki |
| 661 | rkytm |
| prebearHER2, SEQ ID NO: 41 |
| 1 | atggagctgg cggcctggtg ccgctggggg ctcctcctcg ccctcctgcc ctccggagcc |
| 61 | gcgggcaccc aagtgtgcac cggcacagac atgaagctgc ggctccctgc cagtcccgag |
| 121 | acccacctgg atatgctccg ccacctctac caggcctgtc aagtggtaca gggtaacctg |
| 181 | gagctcacct acctgcccgc caatgccagc ctgtccttcc tgcaggatat ccaggaggta |
| 241 | cagggctatg tgctcattgc tcacagccaa gtgagacagg tcccgctgca gaggctccga |
| 301 | atcgtgcgag gcacccagct ctttgaggac aactacgccc tggccgtgct ggacaatgga |
| 361 | gagccgccca agggggacac ctctgtggca ggggctaccc caggagggct gcgggagctg |
| 421 | cagcttcgaa gcctcacaga gatcctgaag ggaggggtct tgattcagcg gaacccacag |
| 481 | ctctgccacc aggacacgat tttgtggaag gacatcttcc acaagaacaa ccagctggcc |
| 541 | ctcacgctga tagacaccaa ccgctctcgg gcctgccaac cctgttctcc agcctgtaaa |
| 601 | gacccccact gctggggagc aagttccggg gactgtcaga gcttgacacg aaccgtctgt |
| 661 | gccggcggct gtgcccgctg caagggccca aaacccactg actgctgcca tgagcagtgc |
| 721 | gcggctggct gcacgggccc caagcactcg gactgcctgg cctgccttca cttcaaccac |
| 781 | agtggcatct gtgagctgca ctgcccagcc ctggtcacct acaacacgga cacgttcgaa |
| 841 | tccatgccca accctgaggg ccgatacacc ttcggtgcca gctgtgtgac cgcctgtccc |
| 901 | tacaactacc tgtccacgga cgtgggatcc tgcaccctgg tctgtcccct gaacaaccaa |
| 961 | gaggtgacgg ctgaggatgg cacccagcgg tgtgagaaat gcagcagacc ctgtgcccga |
| 1021 | gtgtgctatg gtctgggcat ggagcacctg cgggaggcga gggcggtcac cagcgccaac |
| 1081 | atccaagagt tcgccggctg caagaagatc tttgggagcc tggcgtttct gccagagagc |
| 1141 | ttcgagggag acccagcctc caacactgcc cccctgcagc ctgaacagct cagagtgttc |
| 1201 | gaggccctgg aggagatcac aggttacctg tatatctcag cgtggccgga cagcttgcct |
| 1261 | aacctcagtg tcttccagaa cctgcgagta atccggggac gagttctgca tgatggcgcc |
| 1321 | tactcgctga ccctgcaagg gctgggcatc agctggctgg ggctgcgctc gctgcgggaa |
| 1381 | ctgggcagcg ggctggccct catccaccgc aacgcccgcc tctgcttcat ccacacggtg |
| 1441 | ccctgggagc agctcttccg gaacccccac caagccctgc tgcacagtgc caaccggccg |
| 1501 | gaggccgagt gcgtgggcga gggcctggcc tgctacccgc tgtgcgccca tgggcactgc |
| 1561 | tggggtccgg ggcccaccca gtgcgtcaac tgcagccaat tccttcgggg ccaggagtgc |
| 1621 | gtggaggaat gccgagaact gcacgggcta ccccgggaat atgtgaagga cagatactgt |
| 1681 | ctgccatgcc accccgagtg tcggccccag aatggctcag tgacctgctt tgggtcggag |
| 1741 | gctgaccagt gtgtggcctg cgcccactac aaggaccctc cctcctgcgt ggctcgctgc |
| 1801 | cccagtggtg tgaaacccga cctctctttc atgcccattt ggaagtttgc agatgaggag |
| 1861 | ggcacatgcc agccgtgccc catcaactgc acccactcct gtggggacct ggacgagagg |
| 1921 | ggctgccccg ccgaacagag agccagccct gtgacatcca tcattgccgc tgtggtgggc |
| 1981 | attctgctgg ccgtggtcat ggggctggtc ctcggcatcc tgatcaagcg aaggcgacag |
| 2041 | aagatccgga agtacacgat g |
| mbearHER2. SEQ ID NO: 42 |
| 1 | acccaagtgt gcaccggcac agacatgaag ctgcggctcc ctgccagtcc cgagacccac |
| 61 | ctggatatgc tccgccacct ctaccaggcc tgtcaagtgg tacagggtaa cctggagctc |
| 121 | acctacctgc ccgccaatgc cagcctgtcc ttcctgcagg atatccagga ggtacagggc |
| 181 | tatgtgctca ttgctcacag ccaagtgaga caggtcccgc tgcagaggct ccgaatcgtg |
| 241 | cgaggcaccc agctctttga ggacaactac gccctggccg tgctggacaa tggagagccg |
| 301 | cccaaggggg acacctctgt ggcaggggct accccaggag ggctgcggga gctgcagctt |
| 361 | cgaagcctca cagagatcct gaagggaggg gtcttgattc agcggaaccc acagctctgc |
| 421 | caccaggaca cgattttgtg gaaggacatc ttccacaaga acaaccagct ggccctcacg |
| 481 | ctgatagaca ccaaccgctc tcgggcctgc caaccctgtt ctccagcctg taaagacccc |
| 541 | cactgctggg gagcaagttc cggggactgt cagagcttga cacgaaccgt ctgtgccggc |
| 601 | ggctgtgccc gctgcaaggg cccaaaaccc actgactgct gccatgagca gtgcgcggct |
| 661 | ggctgcacgg gccccaagca ctcggactgc ctggcctgcc ttcacttcaa ccacagtggc |
| 721 | atctgtgagc tgcactgccc agccctggtc acctacaaca cggacacgtt cgaatccatg |
| 781 | cccaaccctg agggccgata caccttcggt gccagctgtg tgaccgcctg tccctacaac |
| 841 | tacctgtcca cggacgtggg atcctgcacc ctggtctgtc ccctgaacaa ccaagaggtg |
| 901 | acggctgagg atggcaccca gcggtgtgag aaatgcagca gaccctgtgc ccgagtgtgc |
| 961 | tatggtctgg gcatggagca cctgcgggag gcgagggcgg tcaccagcgc caacatccaa |
| 1021 | gagttcgccg gctgcaagaa gatctttggg agcctggcgt ttctgccaga gagcttcgag |
| 1081 | ggagacccag cctccaacac tgcccccctg cagcctgaac agctcagagt gttcgaggcc |
| 1141 | ctggaggaga tcacaggtta cctgtatatc tcagcgtggc cggacagctt gcctaacctc |
| 1201 | agtgtcttcc agaacctgcg agtaatccgg ggacgagttc tgcatgatgg cgcctactcg |
| 1261 | ctgaccctgc aagggctggg catcagctgg ctggggctgc gctcgctgcg ggaactgggc |
| 1321 | agcgggctgg ccctcatcca ccgcaacgcc cgcctctgct tcatccacac ggtgccctgg |
| 1381 | gagcagctct tccggaaccc ccaccaagcc ctgctgcaca gtgccaaccg gccggaggcc |
| 1441 | gagtgcgtgg gcgagggcct ggcctgctac ccgctgtgcg cccatgggca ctgctggggt |
| 1501 | ccggggccca cccagtgcgt caactgcagc caattccttc ggggccagga gtgcgtggag |
| 1561 | gaatgccgag aactgcacgg gctaccccgg gaatatgtga aggacagata ctgtctgcca |
| 1621 | tgccaccccg agtgtcggcc ccagaatggc tcagtgacct gctttgggtc ggaggctgac |
| 1681 | cagtgtgtgg cctgcgccca ctacaaggac cctccctcct gcgtggctcg ctgccccagt |
| 1741 | ggtgtgaaac ccgacctctc tttcatgccc atttggaagt ttgcagatga ggagggcaca |
| 1801 | tgccagccgt gccccatcaa ctgcacccac tcctgtgggg acctggacga gaggggctgc |
| 1861 | cccgccgaac agagagccag ccctgtgaca tccatcattg ccgctgtggt gggcattctg |
| 1921 | ctggccgtgg tcatggggct ggtcctcggc atcctgatca agcgaaggcg acagaagatc |
| 1981 | cggaagtaca cgatg |
| prefeHER2, SEQ ID NO: 43 |
| 1 | atggagctgg cggcctggtg ccgctggggg ctcctcctcg ccctcctgcc ctccggagcc |
| 61 | acgggcaccc aagtgtgcac cggcacagac atgaagctgc ggctcccagc cagtcccgag |
| 121 | acccacctgg acatgctccg ccacctctac cagggctgtc aagtggtaca gggcaacctg |
| 181 | gagctcacct acctgcatgc caatgccagc ctctccttcc tgcaggatat ccaggaggtg |
| 241 | caaggctatg tgctcattgc ccacaaccaa gtgaaacagg tcccactgca gaggctacga |
| 301 | atcgtgcgag gcacccagct ctttgaggac aactacgccc tggccgtgct ggacaacgga |
| 361 | gacccactgg acagtggcac ccctgctaca ggggctgccc taggagggct gcgggagctg |
| 421 | cagctccgaa gcctcacaga gatcctgaag ggaggggtcc tcattcagcg gaacccgcag |
| 481 | ctctgccacc aggacacgat tctgtggaag gacatcttcc acaagaacaa ccagctggcc |
| 541 | ctcatgctga tagacaccaa ccgctctcgg gcctgccaac cctgttctcc agcttgtaaa |
| 601 | gactcccact gctggggagc aagttccggg gactgtcaga gcttgactcg aactgtctgt |
| 661 | gctggcggct gtgcccgctg caagggcccg cagcccaccg actgctgcca cgagcaatgt |
| 721 | gctgctggct gcacgggccc caagcattct gactgcctgg cctgcctcca cttcaaccac |
| 781 | agtggcatct gtgagctgca ctgcccagcc ctggtcacct acaacacgga caccttcgaa |
| 841 | tccatgccca accctgaggg ccgttatacc ttcggtgcca gctgtgtgac tgcctgtccc |
| 901 | tacaactacc tgtctacgga cgtgggatcc tgcaccctgg tctgtcccct gaacaaccaa |
| 961 | gaggtgacag ctgaggatgg aacacagcgg tgtgagaaat gcagcaagcc ctgtgcccga |
| 1021 | gtgtgctacg gcctaggcat ggagcacctg cgggaggcga gggcagtcac cagtgccaac |
| 1081 | atccaagaat ttgtcggctg caagaagatc tttgggagcc tggcgtttct gccagagagc |
| 1141 | tttgaggggg acccagcctc caacactgcc cccctgcagc ctgagcagct cagagtgttt |
| 1201 | gaggctctgg aggagattac aggttacctg tacatctcag cgtggccaga cagcttgcct |
| 1261 | aacctcagtg tcttccagaa cctcagagtg atccggggcc gagttctgca tgacggtgct |
| 1321 | tactcgctga cccttcaagg gctgggcatc agctggctgg ggctgcgctc gctgcgggag |
| 1381 | ctgggcagtg ggctggccct catccaccgc aactcccgcc tctgcttcgt acacacggtg |
| 1441 | ccctgggacc agctcttccg gaacccccac caggccctgc tccacagcgc caaccggcca |
| 1501 | gaggacgagt gcgcgggtga gggcctggcc tgctatccgc tgtgtgccca cgggcactgc |
| 1561 | tggggtccgg gacccaccca gtgtgtcaac tgcagccagt tccttcgggg ccaggagtgc |
| 1621 | gtggaggaat gccgagtatt gcaggggctt ccccgggagt atgtgaagga taggttctgt |
| 1681 | ctgccatgcc acccggagtg tcagccccag aatggctcag tgacctgctt gggctcggaa |
| 1741 | gctgaccagt gtgtggcctg tgcccactac aaggaccctc ctttctgtgt ggctcgctgc |
| 1801 | cccagtgggg tgaaacctga cctctccttc atgcccatct ggaagttcgc agatgaggag |
| 1861 | ggcacgtgcc agccatgccc catcaactgc acccactcct gtgcggacct ggacgagaag |
| 1921 | ggctgccccg ccgagcagag agccagccct gtgacgtcca tcattgctgc tgtggtgggc |
| 1981 | attctgctgg tcgtggttgt ggggctggtc cttggcatcc taatcaagcg aaggcggcag |
| 2041 | aagatccgga agtacacgat g |
| mfeHER2, SEQ ID NO: 44 |
| 1 | acccaagtgt gcaccggcac agacatgaag ctgcggctcc cagccagtcc cgagacccac |
| 61 | ctggacatgc tccgccacct ctaccagggc tgtcaagtgg tacagggcaa cctggagctc |
| 121 | acctacctgc atgccaatgc cagcctctcc ttcctgcagg atatccagga ggtgcaaggc |
| 181 | tatgtgctca ttgcccacaa ccaagtgaaa caggtcccac tgcagaggct acgaatcgtg |
| 241 | cgaggcaccc agctctttga ggacaactac gccctggccg tgctggacaa cggagaccca |
| 301 | ctggacagtg gcacccctgc tacaggggct gccctaggag ggctgcggga gctgcagctc |
| 361 | cgaagcctca cagagatcct gaagggaggg gtcctcattc agcggaaccc gcagctctgc |
| 421 | caccaggaca cgattctgtg gaaggacatc ttccacaaga acaaccagct ggccctcatg |
| 481 | ctgatagaca ccaaccgctc tcgggcctgc caaccctgtt ctccagcttg taaagactcc |
| 541 | cactgctggg gagcaagttc cggggactgt cagagcttga ctcgaactgt ctgtgctggc |
| 601 | ggctgtgccc gctgcaaggg cccgcagccc accgactgct gccacgagca atgtgctgct |
| 661 | ggctgcacgg gccccaagca ttctgactgc ctggcctgcc tccacttcaa ccacagtggc |
| 721 | atctgtgagc tgcactgccc agccctggtc acctacaaca cggacacctt cgaatccatg |
| 781 | cccaaccctg agggccgtta taccttcggt gccagctgtg tgactgcctg tccctacaac |
| 841 | tacctgtcta cggacgtggg atcctgcacc ctggtctgtc ccctgaacaa ccaagaggtg |
| 901 | acagctgagg atggaacaca gcggtgtgag aaatgcagca agccctgtgc ccgagtgtgc |
| 961 | tacggcctag gcatggagca cctgcgggag gcgagggcag tcaccagtgc caacatccaa |
| 1021 | gaatttgtcg gctgcaagaa gatctttggg agcctggcgt ttctgccaga gagctttgag |
| 1081 | ggggacccag cctccaacac tgcccccctg cagcctgagc agctcagagt gtttgaggct |
| 1141 | ctggaggaga ttacaggtta cctgtacatc tcagcgtggc cagacagctt gcctaacctc |
| 1201 | agtgtcttcc agaacctcag agtgatccgg ggccgagttc tgcatgacgg tgcttactcg |
| 1261 | ctgacccttc aagggctggg catcagctgg ctggggctgc gctcgctgcg ggagctgggc |
| 1321 | agtgggctgg ccctcatcca ccgcaactcc cgcctctgct tcgtacacac ggtgccctgg |
| 1381 | gaccagctct tccggaaccc ccaccaggcc ctgctccaca gcgccaaccg gccagaggac |
| 1441 | gagtgcgcgg gtgagggcct ggcctgctat ccgctgtgtg cccacgggca ctgctggggt |
| 1501 | ccgggaccca cccagtgtgt caactgcagc cagttccttc ggggccagga gtgcgtggag |
| 1561 | gaatgccgag tattgcaggg gcttccccgg gagtatgtga aggataggtt ctgtctgcca |
| 1621 | tgccacccgg agtgtcagcc ccagaatggc tcagtgacct gcttgggctc ggaagctgac |
| 1681 | cagtgtgtgg cctgtgccca ctacaaggac cctcctttct gtgtggctcg ctgccccagt |
| 1741 | ggggtgaaac ctgacctctc cttcatgccc atctggaagt tcgcagatga ggagggcacg |
| 1801 | tgccagccat gccccatcaa ctgcacccac tcctgtgcgg acctggacga gaagggctgc |
| 1861 | cccgccgagc agagagccag ccctgtgacg tccatcattg ctgctgtggt gggcattctg |
| 1921 | ctggtcgtgg ttgtggggct ggtccttggc atcctaatca agcgaaggcg gcagaagatc |
| 1981 | cggaagtaca cgatg |
| prehumHER2, SEQ ID NO: 45 |
| 1 | melaalcrwg lllallppga astqvctgtd mklrlpaspe thldmlrhly qgcqvvqgnl |
| 61 | eltylptnas lsflqdiqev qgyvliahnq vrqvplqrlr ivrgtqlfed nyalavldng |
| 121 | dpinnttpvt gaspgglrel qlrslteilk ggvliqrnpq lcyqdtilwk difhknnqla |
| 181 | ltlidtnrsr achpcspmck gsrcwgesse dcqsltrtvc aggcarckgp 1ptdccheqc |
| 241 | aagctgpkhs dclaclhfnh sgicelhcpa lvtyntdtfe smpnpegryt fgascvtacp |
| 301 | ynylstdvgs ctivcplhnq evtaedgtqr cekcskpcar vcyglgmehl revravtsan |
| 361 | igefagckki fgslaflpes fdgdpasnta plqpeqlqvf etleeitgyl yisawpdslp |
| 421 | dlsvfqnlqv irgrilhnga ysltlqglgi swlglrslre lgsglalihh nthlcfvhtv |
| 481 | pwdqlfrnph qallhtanrp edecvgegla chqlcarghc wgpgptqcvn csqflrgqec |
| 541 | veecrvlqgl preyvnarhc lpchpecqpq ngsvtcfgpe adqcvacahy kdppfcvarc |
| 601 | psgvkpdlsy mpiwkfpdee gacqpcpinc thscvdlddk gcpaeqrasp ltsiisavvg |
| 661 | illvvvlgvv fgilikrrqq kirkytm |
| mhumHER2, SEQ ID NO: 46 |
| 1 | tqvctgtdmk lrlpaspeth ldmlrhlyqg cqvvqgnlel tylptnasls flqdiqevqg |
| 61 | yvliahnqvr qvplqrlriv rgtqlfedny alavldngdp lnnttpvtga spgglrelql |
| 121 | rslteilkgg vliqrnpqlc yqdtilwkdi fhknnqlalt lidtnrsrac hpcspmckgs |
| 181 | rcwgessedc qsltrtvcag gcarckgplp tdccheqcaa gctgpkhsdc laclhfnhsg |
| 241 | icelhcpalv tyntdtfesm pnpegrytfg ascvtacpyn ylstdvgsct lvcplhnqev |
| 301 | taedgtqrce kcskpcarvc yglgmehlre vravtsaniq efagckkifg slaflpesfd |
| 361 | gdpasntapl qpeqlqvfet leeitgylyi sawpdslpdl svfqnlqvir grilhngays |
| 421 | ltlqglgisw lglrslrelg sglalihhnt hlcfvhtvpw dqlfrnphqa llhtanrped |
| 481 | ecvgeglach qlcarghcwg pgptqcvncs qflrgqecve ecrvlqglpr eyvnarhclp |
| 541 | chpecqpqng svtcfgpead qcvacahykd ppfcvarcps gvkpdlsymp iwkfpdeega |
| 601 | cqpcpincth scvdlddkgc paeqrasplt siisavvgil lvvvlgvvfg ilikrrqqki |
| 661 | rkytm |
| premouseHER2, SEQ ID NO: 47 |
| 1 | melaawcrwg fllallspga agtqvctgtd mklrlpaspe thldmlrhly qgcqvvqgnl |
| 61 | eltylpanas lsflqdiqev qgymliahnr vkhvplqrlr ivrgtqlfed kyalavldnr |
| 121 | dpldnvttaa pgrtpeglre lqlrslteil kggvlirgnp qlcyqdmvlw kdvlrknnql |
| 181 | apvdmdtnrs racppcaptc kdnhcwgesp edcqiltgti ctsgcarckg rlptdccheq |
| 241 | caagctgpkh sdclaclhfn hsgicelhcp alityntdtf esmlnpegry tfgascvttc |
| 301 | pynylstevg sctivcppnn qevtaedgtq rcekcskpca gvcyglgmeh lrgaraitsd |
| 361 | niqefagckk ifgslaflpe sfdgnpssgv aplkpehlqv fetleeitgy lyisawpesf |
| 421 | qdlsvfqnlr virgrilhdg aysltlqglg ihslglrslr elgsglalih rnthlcfvnt |
| 481 | vpwdqlfrnp hqallhsgnr peeacglegl vcnslcargh cwgpgptqcv ncsqflrgqe |
| 541 | cveecrvwkg 1preyvrgkh clpchpecqp qnssetcygs eadqceacah ykdssscvar |
| 601 | cpsgvkpdls ympiwkypde egicqpcpin cthscvdlde rgcpaeqras pvtfiiatvv |
| 661 | gvllfliivv vigilikrrr qkirkytm |
| mmouseHER2, SEQ ID NO: 48 |
| 1 | tqvctgtdmk lrlpaspeth ldmlrhlyqg cqvvqgnlel tylpanasls flqdiqevqg |
| 61 | ymliahnrvk hvplqrlriv rgtqlfedky alavldnrdp ldnvttaapg rtpeglrelq |
| 121 | lrslteilkg gvlirgnpql cyqdmvlwkd vlrknnqlap vdmdtnrsra cppcaptckd |
| 181 | nhcwgesped cqiltgtict sgcarckgrl ptdccheqca agctgpkhsd claclhfnhs |
| 241 | gicelhcpal ityntdtfes mlnpegrytf gascvttcpy nylstevgsc tivcppnnqe |
| 301 | vtaedgtqrc ekcskpcagv cyglgmehlr garaitsdni qefagokkif gslaflpesf |
| 361 | dgnpssgvap lkpehlqvfe tleeitgyly isawpesfqd lsvfqnlrvi rgrilhdgay |
| 421 | sltlqglgih slglrslrel gsglalihrn thlcfvntvp wdqlfrnphq allhsgnrpe |
| 481 | eacgleglvc nslcarghcw gpgptqcvnc sqflrgqecv eecrvwkglp reyvrgkhcl |
| 541 | pchpecqpqn ssetcygsea dqceacahyk dssscvarcp sgvkpdlsym piwkypdeeg |
| 601 | icqpcpinct hscvdlderg cpaeqraspv tfiiatvvgv llfliivvvi gilikrrrqk |
| 661 | irkytm |
| preratHER2, SEQ ID NO: 49 |
| 1 | miimelaawc rwgfllallp pgiagtqvct gtdmklrlpa spethldmlr hlyqgcqvvq |
| 61 | gnleltyvpa naslsflqdi qevqgymlia hnqvkrvplq rlrivrgtql fedkyalavl |
| 121 | dnrdpqdnva astpgrtpeg lrelqlrslt eilkggvlir gnpqlcyqdm vlwkdvfrkn |
| 181 | nqlapvdidt nrsracppca packdnhcwg espedcqilt gtictsgcar ckgrlptdcc |
| 241 | heqcaagctg pkhsdclacl hfnhsgicel hcpalvtynt dtfesmhnpe grytfgascv |
| 301 | ttcpynylst evgsctivcp pnnqevtaed gtqrcekcsk pcarvcyglg mehlrgarai |
| 361 | tsdnvqefdg ckkifgslaf lpesfdgdps sgiaplrpeq lqvfetleei tgylyisawp |
| 421 | dslrdlsvfq nlriirgril hdgaysltlq glgihslglr slrelgsgla lihrnahlcf |
| 481 | vhtvpwdqlf rnphqallhs gnrpeedcgl eglvcnslca hghcwgpgpt qcvncshflr |
| 541 | gqecveecry wkglpreyvs dkrclpchpe cqpqnssetc fgseadqcaa cahykdsssc |
| 601 | varcpsgvkp dlsympiwky pdeegicqpc pincthscvd ldergcpaeq raspvtfiia |
| 661 | tvvgvllfli lvvvvgilik rrrqkirkyt m |
| mratHER2, SEQ ID NO: 50 |
| 1 | tqvctgtdmk lrlpaspeth ldmlrhlyqg cqvvqgnlel tyvpanasls flqdiqevqg |
| 61 | ymliahnqvk rvplqrlriv rgtqlfedky alavldnrdp qdnvaastpg rtpeglrelq |
| 121 | lrslteilkg gvlirgnpql cyqdmvlwkd vfrknnqlap vdidtnrsra cppcapackd |
| 181 | nhcwgesped cqiltgtict sgcarckgrl ptdccheqca agctgpkhsd claclhfnhs |
| 241 | gicelhcpal vtyntdtfes mhnpegrytf gascvttcpy nylstevgsc tivcppnnqe |
| 301 | vtaedgtqrc ekcskpcary cyglgmehlr garaitsdnv qefdgckkif gslaflpesf |
| 361 | dgdpssgiap lrpeqlqvfe tleeitgyly isawpdslrd lsvfqnlrii rgrilhdgay |
| 421 | sltlqglgih slglrslrel gsglalihrn ahlcfvhtvp wdqlfrnphq allhsgnrpe |
| 481 | edcgleglvc nslcahghcw gpgptqcvnc shflrgqecv eecrvwkglp reyvsdkrcl |
| 541 | pchpecqpqn ssetcfgsea dqcaacahyk dssscvarcp sgvkpdlsym piwkypdeeg |
| 601 | icqpcpinct hscvdlderg cpaeqraspv tfiiatvvgv llflilvvvv gilikrrrqk |
| 661 | irkytm |
| Precursor: preE2Neu SEQ ID NO: 51 |
| 1 | melaalcrwg lllallppga astqvctgtd mklrlpaspe thldmlrhly qgcqvvqgnl |
| 61 | eltylptnas lsflqdiqev qgyvliahnq vrqvplqrlr ivrgtqlfed nyalavldng |
| 121 | dpinnttpvt gaspgglrel qlrslteilk ggvliqrnpq lcyqdtilwk difhknnqla |
| 181 | ltlidtnrsr achpcspmck gsrcwgesse dcqsltrtvc aggcarckgp 1ptdccheqc |
| 241 | aagctgpkhs dclaclhfnh sgicelhcpa lvtyntdtfe smpnpegryt fgascvtacp |
| 301 | ynylstdvgs ctivcplhnq evtaedgtqr cekcskpcar vcyglgmehl revravtsan |
| 361 | igefagckki fgslaflpes fdgdpasnta efaplrpeql qvfetleeit gylyisawpd |
| 421 | slrdlsvfqn lriirgrilh dgaysltlqg lgihslglrs lrelgsglal ihrnahlcfv |
| 481 | htvpwdqlfr nphqallhsg nrpeedcgle glvcnslcah ghcwgpgptq cvncshflrg |
| 541 | qecveecrvw kglpreyvsd krclpchpec qpqnssetcf gseadqcaac ahykdssscv |
| 601 | arcpsgvkpd lsympiwkyp deegicqpcp incthscvdl dergcpaeqr aspvtfiiat |
| 661 | vvgvllflil vvvvgilikr rrqkirkytm |
| mE2Neu, SEQ ID NO: 52 |
| 1 | tqvctgtdmk lrlpaspeth ldmlrhlyqg cqvvqgnlel tylptnasls flqdiqevqg |
| 61 | yvliahnqvr qvplqrlriv rgtqlfedny alavldngdp lnnttpvtga spgglrelql |
| 121 | rslteilkgg vliqrnpqlc yqdtilwkdi fhknnqlalt lidtnrsrac hpcspmckgs |
| 181 | rcwgessedc qsltrtvcag gcarckgplp tdccheqcaa gctgpkhsdc laclhfnhsg |
| 241 | icelhcpalv tyntdtfesm pnpegrytfg ascvtacpyn ylstdvgsct lvcplhnqev |
| 301 | taedgtqrce kcskpcarvc yglgmehlre vravtsaniq efagckkifg slaflpesfd |
| 361 | gdpasntaef aplrpeqlqv fetleeitgy lyisawpdsl rdlsvfqnlr iirgrilhdg |
| 421 | aysltlqglg ihslglrslr elgsglalih rnahlcfvht vpwdqlfrnp hqallhsgnr |
| 481 | peedcglegl vcnslcahgh cwgpgptqcv ncshflrgqe cveecrvwkg lpreyvsdkr |
| 541 | clpchpecqp qnssetcfgs eadqcaacah ykdssscvar cpsgvkpdls ympiwkypde |
| 601 | egicqpcpin cthscvdlde rgcpaeqras pvtfiiatvv gvllflilvv vvgilikrrr |
| 661 | qkirkytm |
| prehumHER2, SEQ ID NO: 53 |
| 1 | atggagctgg cggccttgtg ccgctggggg ctcctcctcg ccctcttgcc ccccggagcc |
| 61 | gcgagcaccc aagtgtgcac cggcacagac atgaagctgc ggctccctgc cagtcccgag |
| 121 | acccacctgg acatgctccg ccacctctac cagggctgcc aggtggtgca gggaaacctg |
| 181 | gaactcacct acctgcccac caatgccagc ctgtccttcc tgcaggatat ccaggaggtg |
| 241 | cagggctacg tgctcatcgc tcacaaccaa gtgaggcagg tcccactgca gaggctgcgg |
| 301 | attgtgcgag gcacccagct ctttgaggac aactatgccc tggccgtgct agacaatgga |
| 361 | gacccgctga acaataccac ccctgtcaca ggggcctccc caggaggcct gcgggagctg |
| 421 | cagcttcgaa gcctcacaga gatcttgaaa ggaggggtct tgatccagcg gaacccccag |
| 481 | ctctgctacc aggacacgat tttgtggaag gacatcttcc acaagaacaa ccagctggct |
| 541 | ctcacactga tagacaccaa ccgctctcgg gcctgccacc cctgttctcc gatgtgtaag |
| 601 | ggctcccgct gctggggaga gagttctgag gattgtcaga gcctgacgcg cactgtctgt |
| 661 | gccggtggct gtgcccgctg caaggggcca ctgcccactg actgctgcca tgagcagtgt |
| 721 | gctgccggct gcacgggccc caagcactct gactgcctgg cctgcctcca cttcaaccac |
| 781 | agtggcatct gtgagctgca ctgcccagcc ctggtcacct acaacacaga cacgtttgag |
| 841 | tccatgccca atcccgaggg ccggtataca ttcggcgcca gctgtgtgac tgcctgtccc |
| 901 | tacaactacc tttctacgga cgtgggatcc tgcaccctcg tctgccccct gcacaaccaa |
| 961 | gaggtgacag cagaggatgg aacacagcgg tgtgagaagt gcagcaagcc ctgtgcccga |
| 1021 | gtgtgctatg gtctgggcat ggagcacttg cgagaggtga gggcagttac cagtgccaat |
| 1081 | atccaggagt ttgctggctg caagaagatc tttgggagcc tggcatttct gccggagagc |
| 1141 | tttgatgggg acccagcctc caacactgcc ccgctccagc cagagcagct ccaagtgttt |
| 1201 | gagactctgg aagagatcac aggttaccta tacatctcag catggccgga cagcctgcct |
| 1261 | gacctcagcg tcttccagaa cctgcaagta atccggggac gaattctgca caatggcgcc |
| 1321 | tactcgctga ccctgcaagg gctgggcatc agctggctgg ggctgcgctc actgagggaa |
| 1381 | ctgggcagtg gactggccct catccaccat aacacccacc tctgcttcgt gcacacggtg |
| 1441 | ccctgggacc agctctttcg gaacccgcac caagctctgc tccacactgc caaccggcca |
| 1501 | gaggacgagt gtgtgggcga gggcctggcc tgccaccagc tgtgcgcccg agggcactgc |
| 1561 | tggggtccag ggcccaccca gtgtgtcaac tgcagccagt tccttcgggg ccaggagtgc |
| 1621 | gtggaggaat gccgagtact gcaggggctc cccagggagt atgtgaatgc caggcactgt |
| 1681 | ttgccgtgcc accctgagtg tcagccccag aatggctcag tgacctgttt tggaccggag |
| 1741 | gctgaccagt gtgtggcctg tgcccactat aaggaccctc ccttctgcgt ggcccgctgc |
| 1801 | cccagcggtg tgaaacctga cctctcctac atgcccatct ggaagtttcc agatgaggag |
| 1861 | ggcgcatgcc agccttgccc catcaactgc acccactcct gtgtggacct ggatgacaag |
| 1921 | ggctgccccg ccgagcagag agccagccct ctgacgtcca tcatctctgc ggtggttggc |
| 1981 | attctgctgg tcgtggtctt gggggtggtc tttgggatcc tcatcaagcg acggcagcag |
| 2041 | aagatccgga agtacacgat gtga |
| mhumHER2, SEQ ID NO: 54 |
| 1 | acccaagtgt gcaccggcac agacatgaag ctgcggctcc ctgccagtcc cgagacccac |
| 61 | ctggacatgc tccgccacct ctaccagggc tgccaggtgg tgcagggaaa cctggaactc |
| 121 | acctacctgc ccaccaatgc cagcctgtcc ttcctgcagg atatccagga ggtgcagggc |
| 181 | tacgtgctca tcgctcacaa ccaagtgagg caggtcccac tgcagaggct gcggattgtg |
| 241 | cgaggcaccc agctctttga ggacaactat gccctggccg tgctagacaa tggagacccg |
| 301 | ctgaacaata ccacccctgt cacaggggcc tccccaggag gcctgcggga gctgcagctt |
| 361 | cgaagcctca cagagatctt gaaaggaggg gtcttgatcc agcggaaccc ccagctctgc |
| 421 | taccaggaca cgattttgtg gaaggacatc ttccacaaga acaaccagct ggctctcaca |
| 481 | ctgatagaca ccaaccgctc tcgggcctgc cacccctgtt ctccgatgtg taagggctcc |
| 541 | cgctgctggg gagagagttc tgaggattgt cagagcctga cgcgcactgt ctgtgccggt |
| 601 | ggctgtgccc gctgcaaggg gccactgccc actgactgct gccatgagca gtgtgctgcc |
| 661 | ggctgcacgg gccccaagca ctctgactgc ctggcctgcc tccacttcaa ccacagtggc |
| 721 | atctgtgagc tgcactgccc agccctggtc acctacaaca cagacacgtt tgagtccatg |
| 781 | cccaatcccg agggccggta tacattcggc gccagctgtg tgactgcctg tccctacaac |
| 841 | tacctttcta cggacgtggg atcctgcacc ctcgtctgcc ccctgcacaa ccaagaggtg |
| 901 | acagcagagg atggaacaca gcggtgtgag aagtgcagca agccctgtgc ccgagtgtgc |
| 961 | tatggtctgg gcatggagca cttgcgagag gtgagggcag ttaccagtgc caatatccag |
| 1021 | gagtttgctg gctgcaagaa gatctttggg agcctggcat ttctgccgga gagctttgat |
| 1081 | ggggacccag cctccaacac tgccccgctc cagccagagc agctccaagt gtttgagact |
| 1141 | ctggaagaga tcacaggtta cctatacatc tcagcatggc cggacagcct gcctgacctc |
| 1201 | agcgtcttcc agaacctgca agtaatccgg ggacgaattc tgcacaatgg cgcctactcg |
| 1261 | ctgaccctgc aagggctggg catcagctgg ctggggctgc gctcactgag ggaactgggc |
| 1321 | agtggactgg ccctcatcca ccataacacc cacctctgct tcgtgcacac ggtgccctgg |
| 1381 | gaccagctct ttcggaaccc gcaccaagct ctgctccaca ctgccaaccg gccagaggac |
| 1441 | gagtgtgtgg gcgagggcct ggcctgccac cagctgtgcg cccgagggca ctgctggggt |
| 1501 | ccagggccca cccagtgtgt caactgcagc cagttccttc ggggccagga gtgcgtggag |
| 1561 | gaatgccgag tactgcaggg gctccccagg gagtatgtga atgccaggca ctgtttgccg |
| 1621 | tgccaccctg agtgtcagcc ccagaatggc tcagtgacct gttttggacc ggaggctgac |
| 1681 | cagtgtgtgg cctgtgccca ctataaggac cctcccttct gcgtggcccg ctgccccagc |
| 1741 | ggtgtgaaac ctgacctctc ctacatgccc atctggaagt ttccagatga ggagggcgca |
| 1801 | tgccagcctt gccccatcaa ctgcacccac tcctgtgtgg acctggatga caagggctgc |
| 1861 | cccgccgagc agagagccag ccctctgacg tccatcatct ctgcggtggt tggcattctg |
| 1921 | ctggtcgtgg tcttgggggt ggtctttggg atcctcatca agcgacggca gcagaagatc |
| 1981 | cggaagtaca cgatgtga |
| premouseHER2, SEQ ID NO: 55 |
| 1 | atggagctgg cggcctggtg ccgttggggg ttcctcctcg ccctcctgtc ccccggagcc |
| 61 | gcgggtaccc aagtgtgtac cggtaccgac atgaagttgc gactccctgc cagtcctgag |
| 121 | acccacctgg acatgcttcg ccacctctac cagggctgtc aggtggtgca gggcaatttg |
| 181 | gagcttacct acctgcccgc caatgccagc ctctcattcc tgcaggacat ccaggaagtc |
| 241 | cagggataca tgctcatcgc tcacaaccga gtgaaacacg tcccactgca gaggttgcgc |
| 301 | atcgtgagag ggactcagct ctttgaggac aagtatgccc tggctgtgct agacaaccga |
| 361 | gaccctttgg acaacgtcac caccgccgcc ccaggcagaa ccccagaagg gctgcgggag |
| 421 | ctgcagcttc gaagtctcac agagatcttg aagggaggag ttttgatccg tgggaaccct |
| 481 | cagctctgct accaggacat ggttttgtgg aaggatgtcc tccgtaagaa taaccagctg |
| 541 | gctcctgtcg acatggacac caatcgttcc cgggcctgtc caccttgtgc cccaacctgc |
| 601 | aaagacaatc actgttgggg tgagagtcct gaagactgtc agatcttgac tggcaccatc |
| 661 | tgtactagtg gctgtgcccg gtgcaagggc cggctgccca ctgactgttg ccatgagcag |
| 721 | tgtgctgcag gctgcacggg tcccaagcat tctgactgcc tggcctgcct ccacttcaat |
| 781 | catagtggta tctgtgagct gcactgcccg gccctcatca cctacaacac agacaccttc |
| 841 | gagtccatgc tcaaccctga gggtcgctac acctttggtg ccagctgtgt gaccacctgc |
| 901 | ccctacaact acctctccac ggaagtggga tcctgcactc tggtctgtcc cccgaacaac |
| 961 | caagaggtca cagctgagga cggaacacag cggtgtgaga aatgcagcaa gccctgtgct |
| 1021 | ggagtatgct atggtctggg catggagcac ctccgagggg cgagggccat caccagtgac |
| 1081 | aatatccagg agtttgctgg ctgcaagaag atctttggga gcctggcatt tttgccggag |
| 1141 | agctttgatg ggaacccctc ctccggcgtt gccccactga agccagagca tctccaagtg |
| 1201 | ttcgaaaccc tggaggagat cacaggttac ctatacattt cagcatggcc agagagcttc |
| 1261 | caagacctca gtgtcttcca gaaccttcgg gtcattcggg gacggattct ccatgatggt |
| 1321 | gcttactcat tgacgttgca aggcctgggg attcactcac tggggctacg ctcactgcgg |
| 1381 | gagctgggca gtggattggc tctcattcac cgcaacaccc atctctgctt tgtaaacact |
| 1441 | gtaccttggg accagctctt ccggaacccg caccaggccc tactccacag tgggaaccgg |
| 1501 | ccagaagagg catgtggtct tgagggcttg gtctgtaact cactgtgtgc ccgtgggcac |
| 1561 | tgctgggggc cagggcccac ccagtgtgtc aactgcagtc agttcctccg gggccaggag |
| 1621 | tgtgtggagg agtgccgagt atggaagggg ctccccaggg agtatgtgag gggcaagcac |
| 1681 | tgtctgccat gccaccccga gtgtcagcct caaaacagct cggagacctg ctatggatcg |
| 1741 | gaggctgacc agtgtgaggc ttgtgcccac tacaaggact catcttcctg tgtggctcgc |
| 1801 | tgccccagtg gtgtgaagcc agacctctcc tacatgccta tctggaagta cccggatgag |
| 1861 | gagggcatat gtcagccatg ccccatcaac tgcacccact catgtgtgga cctggacgaa |
| 1921 | cgaggctgcc cagcagagca gagagccagc ccagtgacat tcatcattgc aactgtggtg |
| 1981 | ggcgtcctgt tgttcctgat catagtggtg gtcattggaa tcctaatcaa acgaaggcga |
| 2041 | cagaagatcc ggaagtatac catg |
| mmouseHER2, SEQ ID NO: 56 |
| 1 | acccaagtgt gtaccggtac cgacatgaag ttgcgactcc ctgccagtcc tgagacccac |
| 61 | ctggacatgc ttcgccacct ctaccagggc tgtcaggtgg tgcagggcaa tttggagctt |
| 121 | acctacctgc ccgccaatgc cagcctctca ttcctgcagg acatccagga agtccaggga |
| 181 | tacatgctca tcgctcacaa ccgagtgaaa cacgtcccac tgcagaggtt gcgcatcgtg |
| 241 | agagggactc agctctttga ggacaagtat gccctggctg tgctagacaa ccgagaccct |
| 301 | ttggacaacg tcaccaccgc cgccccaggc agaaccccag aagggctgcg ggagctgcag |
| 361 | cttcgaagtc tcacagagat cttgaaggga ggagttttga tccgtgggaa ccctcagctc |
| 421 | tgctaccagg acatggtttt gtggaaggat gtcctccgta agaataacca gctggctcct |
| 481 | gtcgacatgg acaccaatcg ttcccgggcc tgtccacctt gtgccccaac ctgcaaagac |
| 541 | aatcactgtt ggggtgagag tcctgaagac tgtcagatct tgactggcac catctgtact |
| 601 | agtggctgtg cccggtgcaa gggccggctg cccactgact gttgccatga gcagtgtgct |
| 661 | gcaggctgca cgggtcccaa gcattctgac tgcctggcct gcctccactt caatcatagt |
| 721 | ggtatctgtg agctgcactg cccggccctc atcacctaca acacagacac cttcgagtcc |
| 781 | atgctcaacc ctgagggtcg ctacaccttt ggtgccagct gtgtgaccac ctgcccctac |
| 841 | aactacctct ccacggaagt gggatcctgc actctggtct gtcccccgaa caaccaagag |
| 901 | gtcacagctg aggacggaac acagcggtgt gagaaatgca gcaagccctg tgctggagta |
| 961 | tgctatggtc tgggcatgga gcacctccga ggggcgaggg ccatcaccag tgacaatatc |
| 1021 | caggagtttg ctggctgcaa gaagatcttt gggagcctgg catttttgcc ggagagcttt |
| 1081 | gatgggaacc cctcctccgg cgttgcccca ctgaagccag agcatctcca agtgttcgaa |
| 1141 | accctggagg agatcacagg ttacctatac atttcagcat ggccagagag cttccaagac |
| 1201 | ctcagtgtct tccagaacct tcgggtcatt cggggacgga ttctccatga tggtgcttac |
| 1261 | tcattgacgt tgcaaggcct ggggattcac tcactggggc tacgctcact gcgggagctg |
| 1321 | ggcagtggat tggctctcat tcaccgcaac acccatctct gctttgtaaa cactgtacct |
| 1381 | tgggaccagc tcttccggaa cccgcaccag gccctactcc acagtgggaa ccggccagaa |
| 1441 | gaggcatgtg gtcttgaggg cttggtctgt aactcactgt gtgcccgtgg gcactgctgg |
| 1501 | gggccagggc ccacccagtg tgtcaactgc agtcagttcc tccggggcca ggagtgtgtg |
| 1561 | gaggagtgcc gagtatggaa ggggctcccc agggagtatg tgaggggcaa gcactgtctg |
| 1621 | ccatgccacc ccgagtgtca gcctcaaaac agctcggaga cctgctatgg atcggaggct |
| 1681 | gaccagtgtg aggcttgtgc ccactacaag gactcatctt cctgtgtggc tcgctgcccc |
| 1741 | agtggtgtga agccagacct ctcctacatg cctatctgga agtacccgga tgaggagggc |
| 1801 | atatgtcagc catgccccat caactgcacc cactcatgtg tggacctgga cgaacgaggc |
| 1861 | tgcccagcag agcagagagc cagcccagtg acattcatca ttgcaactgt ggtgggcgtc |
| 1921 | ctgttgttcc tgatcatagt ggtggtcatt ggaatcctaa tcaaacgaag gcgacagaag |
| 1981 | atccggaagt ataccatg |
| preratHER2, SEQ ID NO: 57 |
| 1 | atgatcatca tggagctggc ggcctggtgc cgctgggggt tcctcctcgc cctcctgccc |
| 61 | cccggaatcg cgggcaccca agtgtgtacc ggcacagaca tgaagttgcg gctccctgcc |
| 121 | agtcctgaga cccacctgga catgctccgc cacctgtacc agggctgtca ggtagtgcag |
| 181 | ggcaacttgg agcttaccta cgtgcctgcc aatgccagcc tctcattcct gcaggacatc |
| 241 | caggaagttc agggttacat gctcatcgct cacaaccagg tgaagcgcgt cccactgcaa |
| 301 | aggctgcgca tcgtgagagg gacccagctc tttgaggaca agtatgccct ggctgtgcta |
| 361 | gacaaccgag atcctcagga caatgtcgcc gcctccaccc caggcagaac cccagagggg |
| 421 | ctgcgggagc tgcagcttcg aagtctcaca gagatcctga agggaggagt tttgatccgt |
| 481 | gggaaccctc agctctgcta ccaggacatg gttttgtgga aggacgtctt ccgcaagaat |
| 541 | aaccaactgg ctcctgtcga tatagacacc aatcgttccc gggcctgtcc accttgtgcc |
| 601 | cccgcctgca aagacaatca ctgttggggt gagagtccgg aagactgtca gatcttgact |
| 661 | ggcaccatct gtaccagtgg ttgtgcccgg tgcaagggcc ggctgcccac tgactgctgc |
| 721 | catgagcagt gtgccgcagg ctgcacgggc cccaagcatt ctgactgcct ggcctgcctc |
| 781 | cacttcaatc atagtggtat ctgtgagctg cactgcccag ccctcgtcac ctacaacaca |
| 841 | gacacctttg agtccatgca caaccctgag ggtcgctaca cctttggtgc cagctgcgtg |
| 901 | accacctgcc cctacaacta cctgtctacg gaagtgggat cctgcactct ggtgtgtccc |
| 961 | ccgaataacc aagaggtcac agctgaggac ggaacacagc gttgtgagaa atgcagcaag |
| 1021 | ccctgtgctc gagtgtgcta tggtctgggc atggagcacc ttcgaggggc gagggccatc |
| 1081 | accagtgaca atgtccagga gtttgatggc tgcaagaaga tctttgggag cctggcattt |
| 1141 | ttgccggaga gctttgatgg ggacccctcc tccggcattg ctccgctgag gcctgagcag |
| 1201 | ctccaagtgt tcgaaaccct ggaggagatc acaggttacc tgtacatctc agcatggcca |
| 1261 | gacagtctcc gtgacctcag tgtcttccag aaccttcgaa tcattcgggg acggattctc |
| 1321 | cacgatggcg cgtactcatt gacactgcaa ggcctgggga tccactcgct ggggctgcgc |
| 1381 | tcactgcggg agctgggcag tggattggct ctgattcacc gcaacgccca tctctgcttt |
| 1441 | gtacacactg taccttggga ccagctcttc cggaacccac atcaggccct gctccacagt |
| 1501 | gggaaccggc cggaagagga ttgtggtctc gagggcttgg tctgtaactc actgtgtgcc |
| 1561 | cacgggcact gctgggggcc agggcccacc cagtgtgtca actgcagtca tttccttcgg |
| 1621 | ggccaggagt gtgtggagga gtgccgagta tggaaggggc tcccccggga gtatgtgagt |
| 1681 | gacaagcgct gtctgccgtg tcaccccgag tgtcagcctc aaaacagctc agagacctgc |
| 1741 | tttggatcgg aggctgatca gtgtgcagcc tgcgcccact acaaggactc gtcctcctgt |
| 1801 | gtggctcgct gccccagtgg tgtgaaaccg gacctctcct acatgcccat ctggaagtac |
| 1861 | ccggatgagg agggcatatg ccagccgtgc cccatcaact gcacccactc ctgtgtggat |
| 1921 | ctggatgaac gaggctgccc agcagagcag agagccagcc cggtgacatt catcattgca |
| 1981 | actgtagtgg gcgtcctgct gttcctgatc ttagtggtgg tcgttggaat cctaatcaaa |
| 2041 | cgaaggagac agaagatccg gaagtatacg atg |
| mratHER2, SEQ ID NO: 58 |
| 1 | acccaagtgt gtaccggcac agacatgaag ttgcggctcc ctgccagtcc tgagacccac |
| 61 | ctggacatgc tccgccacct gtaccagggc tgtcaggtag tgcagggcaa cttggagctt |
| 121 | acctacgtgc ctgccaatgc cagcctctca ttcctgcagg acatccagga agttcagggt |
| 181 | tacatgctca tcgctcacaa ccaggtgaag cgcgtcccac tgcaaaggct gcgcatcgtg |
| 241 | agagggaccc agctctttga ggacaagtat gccctggctg tgctagacaa ccgagatcct |
| 301 | caggacaatg tcgccgcctc caccccaggc agaaccccag aggggctgcg ggagctgcag |
| 361 | cttcgaagtc tcacagagat cctgaaggga ggagttttga tccgtgggaa ccctcagctc |
| 421 | tgctaccagg acatggtttt gtggaaggac gtcttccgca agaataacca actggctcct |
| 481 | gtcgatatag acaccaatcg ttcccgggcc tgtccacctt gtgcccccgc ctgcaaagac |
| 541 | aatcactgtt ggggtgagag tccggaagac tgtcagatct tgactggcac catctgtacc |
| 601 | agtggttgtg cccggtgcaa gggccggctg cccactgact gctgccatga gcagtgtgcc |
| 661 | gcaggctgca cgggccccaa gcattctgac tgcctggcct gcctccactt caatcatagt |
| 721 | ggtatctgtg agctgcactg cccagccctc gtcacctaca acacagacac ctttgagtcc |
| 781 | atgcacaacc ctgagggtcg ctacaccttt ggtgccagct gcgtgaccac ctgcccctac |
| 841 | aactacctgt ctacggaagt gggatcctgc actctggtgt gtcccccgaa taaccaagag |
| 901 | gtcacagctg aggacggaac acagcgttgt gagaaatgca gcaagccctg tgctcgagtg |
| 961 | tgctatggtc tgggcatgga gcaccttcga ggggcgaggg ccatcaccag tgacaatgtc |
| 1021 | caggagtttg atggctgcaa gaagatcttt gggagcctgg catttttgcc ggagagcttt |
| 1081 | gatggggacc cctcctccgg cattgctccg ctgaggcctg agcagctcca agtgttcgaa |
| 1141 | accctggagg agatcacagg ttacctgtac atctcagcat ggccagacag tctccgtgac |
| 1201 | ctcagtgtct tccagaacct tcgaatcatt cggggacgga ttctccacga tggcgcgtac |
| 1261 | tcattgacac tgcaaggcct ggggatccac tcgctggggc tgcgctcact gcgggagctg |
| 1321 | ggcagtggat tggctctgat tcaccgcaac gcccatctct gctttgtaca cactgtacct |
| 1381 | tgggaccagc tcttccggaa cccacatcag gccctgctcc acagtgggaa ccggccggaa |
| 1441 | gaggattgtg gtctcgaggg cttggtctgt aactcactgt gtgcccacgg gcactgctgg |
| 1501 | gggccagggc ccacccagtg tgtcaactgc agtcatttcc ttcggggcca ggagtgtgtg |
| 1561 | gaggagtgcc gagtatggaa ggggctcccc cgggagtatg tgagtgacaa gcgctgtctg |
| 1621 | ccgtgtcacc ccgagtgtca gcctcaaaac agctcagaga cctgctttgg atcggaggct |
| 1681 | gatcagtgtg cagcctgcgc ccactacaag gactcgtcct cctgtgtggc tcgctgcccc |
| 1741 | agtggtgtga aaccggacct ctcctacatg cccatctgga agtacccgga tgaggagggc |
| 1801 | atatgccagc cgtgccccat caactgcacc cactcctgtg tggatctgga tgaacgaggc |
| 1861 | tgcccagcag agcagagagc cagcccggtg acattcatca ttgcaactgt agtgggcgtc |
| 1921 | ctgctgttcc tgatcttagt ggtggtcgtt ggaatcctaa tcaaacgaag gagacagaag |
| 1981 | atccggaagt atacgatg |
| preE2Neu, SEQ ID NO: 59 |
| 1 | atggagctgg cggccttgtg ccgctggggg ctcctcctcg ccctcttgcc ccccggagcc |
| 61 | gcgagcaccc aagtgtgcac cggcacagac atgaagctgc ggctccctgc cagtcccgag |
| 121 | acccacctgg acatgctccg ccacctctac cagggctgcc aggtggtgca gggaaacctg |
| 181 | gaactcacct acctgcccac caatgccagc ctgtccttcc tgcaggatat ccaggaggtg |
| 241 | cagggctacg tgctcatcgc tcacaaccaa gtgaggcagg tcccactgca gaggctgcgg |
| 301 | attgtgcgag gcacccagct ctttgaggac aactatgccc tggccgtgct agacaatgga |
| 361 | gacccgctga acaataccac ccctgtcaca ggggcctccc caggaggcct gcgggagctg |
| 421 | cagcttcgaa gcctcacaga gatcttgaaa ggaggggtct tgatccagcg gaacccccag |
| 481 | ctctgctacc aggacacgat tttgtggaag gacatcttcc acaagaacaa ccagctggct |
| 541 | ctcacactga tagacaccaa ccgctctcgg gcctgccacc cctgttctcc gatgtgtaag |
| 601 | ggctcccgct gctggggaga gagttctgag gattgtcaga gcctgacgcg cactgtctgt |
| 661 | gccggtggct gtgcccgctg caaggggcca ctgcccactg actgctgcca tgagcagtgt |
| 721 | gctgccggct gcacgggccc caagcactct gactgcctgg cctgcctcca cttcaaccac |
| 781 | agtggcatct gtgagctgca ctgcccagcc ctggtcacct acaacacaga cacgtttgag |
| 841 | tccatgccca atcccgaggg ccggtataca ttcggcgcca gctgtgtgac tgcctgtccc |
| 901 | tacaactacc tttctacgga cgtgggatcc tgcaccctcg tctgccccct gcacaaccaa |
| 961 | gaggtgacag cagaggatgg aacacagcgg tgtgagaagt gcagcaagcc ctgtgcccga |
| 1021 | gtgtgctatg gtctgggcat ggagcacttg cgagaggtga gggcagttac cagtgccaat |
| 1081 | atccaggagt ttgctggctg caagaagatc tttgggagcc tggcatttct gccggagagc |
| 1141 | tttgatgggg acccagcctc caacactgcc gaattcgctc cgctgaggcc tgagcagctc |
| 1201 | caagtgttcg aaaccctgga ggagatcaca ggttacctgt acatctcagc atggccagac |
| 1261 | agtctccgtg acctcagtgt cttccagaac cttcgaatca ttcggggacg gattctccac |
| 1321 | gatggcgcgt actcattgac actgcaaggc ctggggatcc actcgctggg gctgcgctca |
| 1381 | ctgcgggagc tgggcagtgg attggctctg attcaccgca acgcccatct ctgctttgta |
| 1441 | cacactgtac cttgggacca gctcttccgg aacccacatc aggccctgct ccacagtggg |
| 1501 | aaccggccgg aagaggattg tggtctcgag ggcttggtct gtaactcact gtgtgcccac |
| 1561 | gggcactgct gggggccagg gcccacccag tgtgtcaact gcagtcattt ccttcggggc |
| 1621 | caggagtgtg tggaggagtg ccgagtatgg aaggggctcc cccgggagta tgtgagtgac |
| 1681 | aagcgctgtc tgccgtgtca ccccgagtgt cagcctcaaa acagctcaga gacctgcttt |
| 1741 | ggatcggagg ctgatcagtg tgcagcctgc gcccactaca aggactcgtc ctcctgtgtg |
| 1801 | gctcgctgcc ccagtggtgt gaaaccggac ctctcctaca tgcccatctg gaagtacccg |
| 1861 | gatgaggagg gcatatgcca gccgtgcccc atcaactgca cccactcctg tgtggatctg |
| 1921 | gatgaacgag gctgcccagc agagcagaga gccagcccgg tgacattcat cattgcaact |
| 1981 | gtagtgggcg tcctgctgtt cctgatctta gtggtggtcg ttggaatcct aatcaaacga |
| 2041 | aggagacaga agatccggaa gtatacgatg |
| mE2Neu, SEQ ID NO: 60 |
| 1 | acccaagtgt gcaccggcac agacatgaag ctgcggctcc ctgccagtcc cgagacccac |
| 61 | ctggacatgc tccgccacct ctaccagggc tgccaggtgg tgcagggaaa cctggaactc |
| 121 | acctacctgc ccaccaatgc cagcctgtcc ttcctgcagg atatccagga ggtgcagggc |
| 181 | tacgtgctca tcgctcacaa ccaagtgagg caggtcccac tgcagaggct gcggattgtg |
| 241 | cgaggcaccc agctctttga ggacaactat gccctggccg tgctagacaa tggagacccg |
| 301 | ctgaacaata ccacccctgt cacaggggcc tccccaggag gcctgcggga gctgcagctt |
| 361 | cgaagcctca cagagatctt gaaaggaggg gtcttgatcc agcggaaccc ccagctctgc |
| 421 | taccaggaca cgattttgtg gaaggacatc ttccacaaga acaaccagct ggctctcaca |
| 481 | ctgatagaca ccaaccgctc tcgggcctgc cacccctgtt ctccgatgtg taagggctcc |
| 541 | cgctgctggg gagagagttc tgaggattgt cagagcctga cgcgcactgt ctgtgccggt |
| 601 | ggctgtgccc gctgcaaggg gccactgccc actgactgct gccatgagca gtgtgctgcc |
| 661 | ggctgcacgg gccccaagca ctctgactgc ctggcctgcc tccacttcaa ccacagtggc |
| 721 | atctgtgagc tgcactgccc agccctggtc acctacaaca cagacacgtt tgagtccatg |
| 781 | cccaatcccg agggccggta tacattcggc gccagctgtg tgactgcctg tccctacaac |
| 841 | tacctttcta cggacgtggg atcctgcacc ctcgtctgcc ccctgcacaa ccaagaggtg |
| 901 | acagcagagg atggaacaca gcggtgtgag aagtgcagca agccctgtgc ccgagtgtgc |
| 961 | tatggtctgg gcatggagca cttgcgagag gtgagggcag ttaccagtgc caatatccag |
| 1021 | gagtttgctg gctgcaagaa gatctttggg agcctggcat ttctgccgga gagctttgat |
| 1081 | ggggacccag cctccaacac tgccgaattc gctccgctga ggcctgagca gctccaagtg |
| 1141 | ttcgaaaccc tggaggagat cacaggttac ctgtacatct cagcatggcc agacagtctc |
| 1201 | cgtgacctca gtgtcttcca gaaccttcga atcattcggg gacggattct ccacgatggc |
| 1261 | gcgtactcat tgacactgca aggcctgggg atccactcgc tggggctgcg ctcactgcgg |
| 1321 | gagctgggca gtggattggc tctgattcac cgcaacgccc atctctgctt tgtacacact |
| 1381 | gtaccttggg accagctctt ccggaaccca catcaggccc tgctccacag tgggaaccgg |
| 1441 | ccggaagagg attgtggtct cgagggcttg gtctgtaact cactgtgtgc ccacgggcac |
| 1501 | tgctgggggc cagggcccac ccagtgtgtc aactgcagtc atttccttcg gggccaggag |
| 1561 | tgtgtggagg agtgccgagt atggaagggg ctcccccggg agtatgtgag tgacaagcgc |
| 1621 | tgtctgccgt gtcaccccga gtgtcagcct caaaacagct cagagacctg ctttggatcg |
| 1681 | gaggctgatc agtgtgcagc ctgcgcccac tacaaggact cgtcctcctg tgtggctcgc |
| 1741 | tgccccagtg gtgtgaaacc ggacctctcc tacatgccca tctggaagta cccggatgag |
| 1801 | gagggcatat gccagccgtg ccccatcaac tgcacccact cctgtgtgga tctggatgaa |
| 1861 | cgaggctgcc cagcagagca gagagccagc ccggtgacat tcatcattgc aactgtagtg |
| 1921 | ggcgtcctgc tgttcctgat cttagtggtg gtcgttggaa tcctaatcaa acgaaggaga |
| 1981 | cagaagatcc ggaagtatac gatg |
| pprehumHER2-Q213K, SEQ ID NO: 84 |
| 1 | melaalcrwg lllallppga astqvctgtd mklrlpaspe thldmlrhly qgcqvvqgnl |
| 61 | eltylptnas lsflqdiqev qgyvliahnq vrqvplqrlr ivrgtqlfed nyalavldng |
| 121 | dpinnttpvt gaspgglrel qlrslteilk ggvliqrnpq lcyqdtilwk difhknnqla |
| 181 | ltlidtnrsr achpcspmck gsrcwgesse dcKsltrtvc aggcarckgp 1ptdccheqc |
| 241 | aagctgpkhs dclaclhfnh sgicelhcpa lvtyntdtfe smpnpegryt fgascvtacp |
| 301 | ynylstdvgs ctlvcplhnq evtaedgtqr cekcskpcar vcyglgmehl revravtsan |
| 361 | igefagckki fgslaflpes fdgdpasnta plqpeqlqvf etleeitgyl yisawpdslp |
| 421 | dlsvfqnlqv irgrilhnga ysltlqglgi swlglrslre lgsglalihh nthlcfvhtv |
| 481 | pwdqlfrnph qallhtanrp edecvgegla chqlcarghc wgpgptqcvn csqflrgqec |
| 541 | veecrvlqgl preyvnarhc 1pchpecqpq ngsvtcfgpe adqcvacahy kdppfcvarc |
| 601 | psgvkpdlsy mpiwkfpdee gacqpcpinc thscvdlddk gcpaeqrasp ltsiisavvg |
| 661 | illvvvlgvv fgilikrrqq kirkytm |
| pprehumHER2-Q239K, SEQ ID NO: 85 |
| 1 | melaalcrwg lllallppga astqvctgtd mklrlpaspe thldmlrhly qgcqvvqgnl |
| 61 | eltylptnas lsflqdiqev qgyvliahnq vrqvplqrlr ivrgtqlfed nyalavldng |
| 121 | dpinnttpvt gaspgglrel qlrslteilk ggvliqrnpq lcyqdtilwk difhknnqla |
| 181 | ltlidtnrsr achpcspmck gsrcwgesse dcqsltrtvc aggcarckgp 1ptdccheKc |
| 241 | aagctgpkhs dclaclhfnh sgicelhcpa lvtyntdtfe smpnpegryt fgascvtacp |
| 301 | ynylstdvgs ctlvcplhnq evtaedgtqr cekcskpcar vcyglgmehl revravtsan |
| 361 | igefagckki fgslaflpes fdgdpasnta plqpeqlqvf etleeitgyl yisawpdslp |
| 421 | dlsvfqnlqv irgrilhnga ysltlqglgi swlglrslre lgsglalihh nthlcfvhtv |
| 481 | pwdqlfrnph qallhtanrp edecvgegla chqlcarghc wgpgptqcvn csqflrgqec |
| 541 | veecrvlqgl preyvnarhc lpchpecqpq ngsvtcfgpe adqcvacahy kdppfcvarc |
| 601 | psgvkpdlsy mpiwkfpdee gacqpcpinc thscvdlddk gcpaeqrasp ltsiisavvg |
| 661 | illvvvlgvv fgilikrrqq kirkytm |
| pprehumHER2-NNT 124-126 DSG, SEQ ID NO: 86 |
| 1 | melaalcrwg lllallppga astqvctgtd mklrlpaspe thldmlrhly qgcqvvqgnl |
| 61 | eltylptnas lsflqdiqev qgyvliahnq vrqvplqrlr ivrgtqlfed nyalavldng |
| 121 | dplDSGtpvt gaspgglrel qlrslteilk ggvliqrnpq lcyqdtilwk difhknnqla |
| 181 | ltlidtnrsr achpcspmck gsrcwgesse dcqsltrtvc aggcarckgp lptdccheqc |
| 241 | aagctgpkhs dclaclhfnh sgicelhcpa lvtyntdtfe smpnpegryt fgascvtacp |
| 301 | ynylstdvgs ctlvcplhnq evtaedgtqr cekcskpcar vcyglgmehl revravtsan |
| 361 | igefagckki fgslaflpes fdgdpasnta plqpeqlqvf etleeitgyl yisawpdslp |
| 421 | dlsvfqnlqv irgrilhnga ysltlqglgi swlglrslre lgsglalihh nthlcfvhtv |
| 481 | pwdqlfrnph qallhtanrp edecvgegla chqlcarghc wgpgptqcvn csqflrgqec |
| 541 | veecrvlqgl preyvnarhc lpchpecqpq ngsvtcfgpe adqcvacahy kdppfcvarc |
| 601 | psgvkpdlsy mpiwkfpdee gacqpcpinc thscvdlddk gcpaeqrasp ltsiisavvg |
| 661 | illvvvlgvv fgilikrrqq kirkytm |
1. Antigenic polypeptides of HER2, for breaking tolerance to the self HER2 of an animal subject, said antigenic polypeptides including at least one point mutation in the extracellular domain of HER2.
2. The antigenic peptides according to claim 1, wherein said point mutation induces the substitution of glutamine with lysine with (Q-K) in the amino acid sequence QLRSLTEILKGGVLI (SEQ ID NO: 109) of HER2 domain I, rendering said amino acid sequence KLRSLTEILKGGVLI (SEQ ID NO: 110).
3. Isolated antigenic polypeptides for inducing immune response against HER2 in a subject of a mammalian species, said polypeptides comprising at least the extracellular domain of the HER2 of an animal species, said extracellular domain including an amino acid substitution of glutamine with lysine (Q-K), or with a conservative amino acid of lysine, said substitution being at position 119 of mature feline HER2, or at a homologous position of the mature HER2 of another animal species.
4. The antigenic polypeptides according to claim 3, selected from the group consisting of mature feline HER2 having a Q-K substitution at position 119 (mfeHER2-Q119K); mature bear HER2 having a Q-K substitution at position 119 (mbearHER2-Q119K); mature human HER2 having a Q-K substitution at position 119 (mhumHER2-Q119K); mature mouse HER-2 having a Q-K substitution at position 120 (mmouseHER2-Q120K); mature rat HER2 having a Q-K substitution at position 120 (mratHER2-Q120K); and mature human rat chimeric HER2 having a Q-K substitution at position 119 (mE2Neu-Q119K).
5. The antigenic polypeptides according to claim 3 wherein said antigenic polypeptides comprise the signal peptide and extracellular and transmembrane domains of HER2 (precursor HER2) and said amino acid substitution of glutamine with lysine (Q-K) or a conservative amino acid of lysine, is at position 141 of precursor feline HER2, or at a homologous position of the precursor HER2 of another animal species.
6. The antigenic polypeptides according to claim 5, selected from the group consisting of precursor feline HER-2 having a Q-K substitution at position 141 (prefeHER2-Q141K); precursor bear HER-2 having a Q-K substitution at position 141 (prebearHER2-Q141K); precursor human HER-2 having a Q-K substitution at position 141 (prehumHER2-Q141K); precursor mouse HER-2 having a Q-K substitution at position 142 (premouseHER2-Q142K); precursor rat HER-2 having a Q-K substitution at position 145 (preratHER2-Q145K); and precursor human rat chimeric HER2 having a Q-K substitution at position 141 (preE2Neu-Q141K).
7. The antigenic polypeptides according to claim 4, wherein said mfeHER2-Q119K includes SEQ ID NO: 1, said mbearHER2-Q119K includes SEQ ID NO: 2, said mhumHER2-Q119K includes SEQ ID NO: 3, said mmouseHER2-Q120K includes SEQ ID NO: 4, said mratHER2-Q120K includes SEQ ID NO: 5, and said mE2Neu-Q119K includes SEQ ID NO: 6.
8. The antigenic polypeptides according to claim 6, wherein said prefeHER2-Q141K includes SEQ ID NO: 7, said prebearHER2-Q141K includes SEQ ID NO: 8, said prehumHER2-Q141K includes SEQ ID NO: 9, said premouseHER2-Q142K includes SEQ ID NO: 10, said preratHER2-Q145K includes SEQ ID NO: 11, and said preE2Neu-Q141K) includes SEQ ID NO: 12.
9. A method for inducing immune response to HER2 in a mammalian subject, comprising the steps of:
administering an effective amount of the vaccine composition including an effective amount of a gene expression construct including a nucleic acid sequence encoding an antigenic polypeptide of the HER2 of an animal species, said antigenic polypeptide comprising at least the extracellular domain of HER2, including an amino acid substitution of glutamine for lysine (Q-K) or for a conservative amino acid of K, said gene construct additionally including at least one promoter operatively linked to said nucleic acid sequence encoding a HER2 polypeptide, for expression of said antigenic peptide in a living cell, wherein said nucleic acid sequence additionally encodes the signal peptide of HER2 (precursor HER2), and said amino acid substitution of glutamine for lysine (Q-K) or for a conservative amino acid of K, is encoded at amino acid 141 of precursor feline HER2, wherein said nucleic acid sequence encoding an antigenic polypeptide is selected from the group consisting of nucleic acid sequences encoding precursor feline HER2, and wherein said amino acid substitution is encoded at amino acid 141 (prefeHER2-Q141K); precursor bear HER2, wherein said substitution is encoded at amino acid 141 (prebearHER2-Q141K); precursor human HER2, wherein said substitution is encoded at amino acid 141 (prehumHER2-Q141K); precursor mouse HER2, wherein said substitution is encoded at amino acid 142 (premouseHER2-Q142K); precursor rat HER2, wherein said substitution is encoded at amino acid 145 (preratHER2-Q145K); and precursor human rat chimeric HER2, wherein said substitution is encoded at amino acid 141 (mE2Neu-Q141K), wherein said nucleotide sequence encoding prefeHER2-Q141K includes SEQ ID NO: 19; said nucleotide sequence encoding prebearHER2-Q141K includes SEQ ID NO: 20; said nucleotide sequence encoding prehumHER2-Q141K includes SEQ ID NO: 21; said nucleotide sequence encoding premouseHER2-Q142K includes SEQ ID NO: 22; said nucleotide sequence encoding preratHER2-Q145K includes SEQ ID NO: 23; and said nucleotide sequence encoding mE2Neu-Q141K includes SEQ ID NO: 24, and an effective amount of an adjuvant; and
inducing an immune response to HER2.
10. A method for inducing immune response to HER2 in a mammalian subject, including the steps of:
administering, to a mammalian subject, an effective amount of a gene construct comprising a nucleic acid sequence encoding a heterologous antigenic polypeptide selected from the group consisting of precursor unsubstituted bear HER2 (prebearHER2); mature unsubstituted bear HER2 (mbearHER2); precursor unsubstituted feline HER2 (prefeHER2); and mature unsubstituted feline HER2 (mfeHER2);
the gene construct additionally including at least one promoter for expression of said antigenic peptide in a living cell;
administering an effective amount of an immunological adjuvant;
expressing said gene construct in cells of the mammalian subject; and
inducing an immune response against HER2 in the mammalian subject.
11. The method according to claim 10, wherein the prebearHER2 includes SEQ ID NO: 37; the mbearHER2 includes SEQ ID NO: 38; the prefeHER2 includes SEQ ID NO: 39; and the mfeHER2 includes SEQ ID NO: 40.
12. The method according to claim 10, wherein the nucleic acid sequence encoding prebearHER2 includes SEQ ID NO: 41; the nucleic acid sequence encoding mbearHER2 includes SEQ ID NO: 42; the nucleic acid sequence encoding prefeHER2 includes SEQ ID NO: 43; and the nucleic acid sequence encoding mfeHER2 includes SEQ ID NO: 44.
13. The method according to claim 10, wherein the step of administering an effective amount of an immunological adjuvant is further defined as administering an effective amount of GM-CSF.
14. The method according to claim 10, wherein the mammalian subject is further defined as a subject hosting a population of HER2-expressing pathological cells, additionally including the step of eliminating or reducing the population of HER2-expressing pathological cells.
15. The method according to claim 14, wherein the HER2 expressing pathological cells are further defined as mammary carcinoma cells.
16. A method for inducing immune response to HER2 in a cat, including the steps of:
administering, to a cat, an effective amount of a gene expression construct encoding an antigenic polypeptide selected from the group consisting of: precursor unsubstituted bear HER2 (prebearHER2); mature unsubstituted bear HER2 (mbearHER2); precursor unsubstituted feline HER2 (prefeHER2); mature unsubstituted feline HER2 (mfeHER2); precursor unsubstituted human HER2 (prehumHER2); mature unsubstituted human HER2 (mhumHER2); precursor unsubstituted mouse HER2 (premouseHER2); mature unsubstituted mouse HER2 (mmouseHER2); precursor unsubstituted rat HER2 (preratHER2); mature unsubstituted rat HER2 (mratHER2); precursor human rat chimeric HER2 (preE2Neu); and mature human rat chimeric HER2 (mE2Neu); the gene expression construct additionally including at least one promoter for expression of the antigenic peptide in a living cell;
administering an effective amount of an immunological adjuvant;
expressing the gene construct in cells of the cat; and
inducing an immune response against HER2 in the cat.
17. The method according to claim 16, wherein the prebearHER2 includes SEQ ID NO: 37; the mbearHER2 includes SEQ ID NO: 38; the prefeHER2 includes SEQ ID NO: 39; the mfeHER2 includes SEQ ID NO: 40; the prehumHER includes SEQ ID NO: 45; the mhumHER2 includes SEQ ID NO: 46; the premouseHER2 includes SEQ ID NO: 47; the mmouseHER2 includes SEQ ID NO: 48; the preratHER2 includes SEQ ID NO: 49; the mratHER2 includes SEQ ID NO: 50; the preE2Neu includes SEQ ID NO: 51; and the mE2Neu includes SEQ ID NO: 52.
18. The method according to claim 16, wherein the nucleic acid sequence encoding prebearHER2 includes SEQ ID NO: 41; the nucleic acid sequence encoding mbearHER2 includes SEQ ID NO: 42; the nucleic acid sequence encoding prefeHER2 includes SEQ ID NO: 43; the nucleic acid sequence encoding mfeHER2 includes SEQ ID NO: 44; the nucleic acid sequence encoding prehumHER includes SEQ ID NO: 53; the nucleic acid sequence encoding mhumHER2 includes SEQ ID NO: 54; said nucleic acid sequence encoding premouseHER2 includes SEQ ID NO: 55; the nucleic acid sequence encoding mmouseHER2 includes SEQ ID NO: 56; the nucleic acid sequence encoding preratHER2 includes SEQ ID NO: 57; the nucleic acid sequence encoding mratHER2 includes SEQ ID NO: 58; the nucleic acid sequence encoding preE2Neu includes SEQ ID NO: 59; and the nucleic acid sequence encoding mE2Neu includes SEQ ID NO: 60.
19. The method according to claim 16, wherein the cat is further defined as a cat hosting a population of HER2-expressing pathological cells, additionally including the step of eliminating or reducing the population of HER2-expressing pathological cells.
20. The method according to claim 19, wherein the HER2 expressing pathological cells are further defined as mammary carcinoma cells.
21. Antigenic polypeptides for inducing immune response against HER2 in a mammalian subject, said polypeptides comprising at least the extracellular and transmembrane domains of human HER2, said extracellular domain including an amino acid substitution selected from the following amino acid substitutions:
glutamine with lysine (Q-K) or a conservative amino acid of lysine, at position 141 of precursor humanHER2 (prehumHER2-Q141K);
glutamine with lysine (Q-K) or a conservative amino acid of lysine, at position 119 of mature human HER2 (mhumHER2-Q119K);
glutamine with lysine (Q-K) or a conservative amino acid of lysine, at position 329 of precursor humanHER2 (prehumHER2-Q329K);
glutamine with lysine (Q-K) or a conservative amino acid of lysine, at position 307 of mature humanHER2 (mhumHER2-Q307K);
glutamine with arginine (Q-R) or a conservative amino acid of arginine, said substitution being at position 429 of precursor human HER2 (prehumHER2-Q429R);
glutamine with arginine (Q-R) or a conservative amino acid of R, at position 407 of mature human HER2 mhumHER2-Q407R;
asparagine with aspartic acid (N-D) or a conservative amino acid of aspartic acid, at position 438 of precursor human HER2 (prehumHER2-N438D); and
asparagine with aspartic acid (N-D), or a conservative amino acid of aspartic acid, at position 416 of mature human HER2 mhumHER2-N416D.
22. The antigenic polypeptides according to claim 21, wherein said prehumHER2-Q141K includes SEQ ID NO: 9; said mhumHER2-Q119K includes SEQ ID NO: 3; said prehumHER2-Q329K includes SEQ ID NO: 28; said mhumHER2-Q307K includes SEQ ID NO: 25; said prehumHER2-Q429R includes SEQ ID NO: 29; said mhumHER2-Q407R includes SEQ ID NO: 26; said prehumHER2-N438D includes SEQ ID NO: 30; and said mhumHER2-N416D includes SEQ ID NO: 27.
23. A gene expression construct comprising a nucleic acid sequence encoding an antigenic polypeptide of HER2, said nucleic acid sequence encoding a substituted HER2 polypeptide selected from the group including: prehumHER2-Q141K, mhumHER2-Q119K, prehumHER2-Q329K mhumHER2-Q307K, prehumHER2-Q429R, mhumHER2-Q407R, prehumHER2-N438D, and mhumHER2-N416D, said gene construct additionally including at least one promoter operatively linked to said nucleic acid sequence encoding a HER2 polypeptide, for expression of said antigenic polypeptide in a living cell.
24. The gene expression construct according to claim 23, wherein said nucleic acid sequence is selected from the group consisting of: SEQ ID NO: 21, encoding said prehumHER2-Q141K; SEQ ID NO: 34, encoding said prehumHER2-Q329K; SEQ ID NO: 35, encoding prehumHER2-Q429R; SEQ ID NO: 36, encoding prehumHER2-N438D; SEQ ID NO: 15, encoding said mhumHER2-Q119K SEQ ID NO: 31, encoding said mhumHER2-Q307K; SEQ ID NO: 32, encoding mhumHER2-Q407R; and SEQ ID NO: 33, encoding mhumHER2-N416D.
25. A vaccine composition for inducing immunity to HER2 in a mammalian subject, comprising an effective amount of the gene expression construct according to claim 23, and an effective amount of an adjuvant.
26. The vaccine composition according to claim 25, wherein said adjuvant is granulocyte macrophage colony stimulating factor (GM-CSF)
27. The vaccine composition according to claim 26, wherein said GM-CSF is delivered to the mammalian subject as an expression vector comprising a polynucleotide encoding GM-CSF, for expression of said polynucleotide in the mammalian subject.
28. The vaccine composition according to claim 26, wherein said GM-CSF is delivered to the mammalian subject as GM-CSF protein.
29. Monoclonal antibodies selective for substituted HER2 polypeptides, the substituted HER2 polypeptides being selected from the group consisting of: prefeHER2-Q141K, mfeHER2-Q119K, prebearHER2-Q141K, mbearHER2-Q119K, prehumHER2-Q141K, mhumHER2-Q119K, premouseHER2-Q142K, mmouseHER2-Q120K, preratHER2-Q145K, mratHER2-Q120K, preE2Neu-Q141K, mE2Neu-Q119K, prehumHER2-Q329K, mhumHER2-Q307K, prehumHER2-Q429R, mhumHER2-Q407R; prehumHER2-N438D, and mhumHER2-N416D.
30. A diagnostic method of determining whether a mammalian subject is sufficiently immunocompetent to respond to immunotherapy directed at self HER2, including the steps of:
administering to the mammalian subject an effective amount of a vaccine known to induce immune response to self HER2 of the species of the mammalian subject;
determining that an immune response to the HER2 antigen is induced in the mammalian subject by the vaccine; and
recognizing the mammalian subject as being sufficiently immunocompetent to respond to immunotherapy directed at self HER2.
31. The diagnostic method of claim 30, wherein the vaccine is selected from the group consisting of the vaccine according to claim 14 and the vaccine according to claim 34.
32. The diagnostic method according to claim 30, wherein the step of determining that an immune response is induced is further defined as the step of determining whether there a T cell response has been induced, a B cell response has been induced, or a mixed T and B cell response has been induced.