US20200190565A1
2020-06-18
16/790,283
2020-02-13
The current teachings relate to methods for reducing adapter-dimer formation, particularly when preparing nucleic acids of interest for subsequent amplification and/or sequencing. Also described are kits for use in performing certain disclosed methods.
Get notified when new applications in this technology area are published.
C12Q1/6855 » CPC main
Measuring or testing processes involving enzymes, nucleic acids or microorganisms ; Compositions therefor; Processes of preparing such compositions involving nucleic acids; Nucleic acid amplification reactions using modified primers or templates Ligating adaptors
C12Q1/6874 » CPC further
Measuring or testing processes involving enzymes, nucleic acids or microorganisms ; Compositions therefor; Processes of preparing such compositions involving nucleic acids; Methods for sequencing involving nucleic acid arrays, e.g. sequencing by hybridisation
This application is a divisional of U.S. patent application Ser. No. 15/354,491, filed Nov. 17, 2016, which claims priority from U.S. Provisional Application Ser. No. 62/256,662, filed Nov. 17, 2015, the entire content of both of which is incorporated herein by reference.
This work was performed in part with government support under NSF Phase II Grant No. 1431020. The Government may have certain rights in the claimed inventions.
The current teachings relate generally to the field of nucleic acid sequencing, particularly to reducing adapter dimer formation. More particularly, the current teachings are directed to improving the creation of sequencing libraries comprising small RNA molecules.
Small RNA sequencing using next generation sequencing technologies (sRNA-seq) is invaluable for small RNA profiling and discovery in fields such as cancer, stem cell biology, and epigenetic gene regulation. sRNA-seq library preparation has historically suffered from three major drawbacks; severe bias, the need for gel-based purification, and the lack of low-input protocols. Reducing the formation of adapter-dimer products is a key aspect in the successful creation of these libraries.
The need to purify final small RNA sequencing libraries by gel, typically by PAGE gel, is due to the small difference in the size of adapter-dimer molecules versus insert-containing molecules following the PCR step of library preparation. In typical DNA or RNA library prep, insert-containing molecules are at least 100 bp larger than adapter-dimer molecules, and thus can be removed using Solid Phase Reversible Immobilization (SPRI) magnetic beads. However, since insert-containing molecules are only Ë20 bp larger than adapter-dimer molecules in small RNA libraries, SPRI size selection is not feasible, and gel-based selection must be performed. The need for gel-based size selection greatly limits both throughput and automation potential of small RNA library preparation, as only a limited number of libraries can be run on a single gel and it is a labor-intensive process that is not amenable to automation.
The lack of low-input protocols for sRNA-seq is also related to adapter-dimer formation. Small RNA sequencing is somewhat unique in that additional PCR cycles result in negligible bias; thus it should theoretically be possible to create low-input small RNA libraries by using a high number of PCR cycles. However, adapter-dimer present in the libraries will also be greatly amplified, which eventually leads to a library where adapter-dimer products are extremely abundant, making it difficult to isolate insert-containing products and leading to sequencing data where very few of the reads are useful. A number of methods have been developed to reduce adapter-dimer formation in small RNA library preparation, but unfortunately none are effective at reducing adapter-dimer formation to such an extent that gel-free or low-input small RNA library preparation is possible
There are currently multiple methods for reduction of adapter-dimer products. In one of these methods, a complementary oligonucleotide is annealed to the 3Ⲡadapter following the first ligation step, which converts excess 3Ⲡadapter from single-stranded DNA to double-stranded DNA. The double-stranded DNA is a poor substrate for the T4 RNA ligase 1 enzyme used in the subsequent reaction, resulting in reduced formation of adapter-dimer products.
Traditional methods of construction of sRNA libraries have been shown to suffer from severe bias, resulting in final sequencing results that do not accurately represent relative abundances of small RNAs in the starting material. This bias can be greatly reduced through the use of oligonucleotide adapters with randomized bases at the ligation junctions. However, the strategy of hybridization of a complementary oligonucleotide does not work well to reduce adapter-dimer formation when using adapters with randomized ends. Thus, purification of intermediary ligation products by polyacrylamide gel electrophoresis (PAGE) was often used in sRNA library preparation protocols utilizing adapters with randomized ends. Purification of products by PAGE has many disadvantages, so a gel-free adapter-dimer reduction strategy was developed. This strategy requires the use of a proprietary reagent combined with isopropanol and SPRI beads to deplete excess 3Ⲡadapter following the first ligation step, thus reducing formation of adapter-dimer in the final library. However, it should be noted that neither this strategy nor strategies using conventional (non-randomized end containing) adapters are typically effective at reducing adapter-dimer formation to such a level that final purification by PAGE can be replaced by a SPRI-based method.
Thus, there is a need for methods for reducing the formation of adapter-dimer products in certain molecular biology techniques, including creating nucleic acid sequencing libraries. For example but not limited to, RNA libraries for use in next generation sequencing of RNA, including small RNA.
The disclosed teachings provide a dual approach to adapter-dimer reduction, thereby allowing gel-free or low-input small RNA library preparation. The dual approach to adapter-dimer reduction involves first depleting excess unligated 3Ⲡadapter through a magnetic-bead based method, and then inactivating any residual 3Ⲡunligated adapter with an enzymatic method. This combination of depletion and inactivation of excess unligated 3Ⲡadapter results in significant reduction of adapter-dimer formation, allowing gel-free or low input library preparation.
Certain method embodiments for reducing adapter-dimer formation comprise: combining a nucleic acid sample, at least one 3Ⲡadapter and at least one first ligase to form a first reaction composition; incubating the first reaction composition under conditions suitable for first ligation products to be generated, to form a second reaction composition comprising first ligation products and at least some un-ligated 3Ⲡadapters; combining at least one oligonucleotide comprising a reverse transcription priming site with the second reaction composition to form a third reaction composition; incubating the third reaction composition under conditions suitable for at least some of the oligonucleotides to anneal with at least some of the first reaction products and at least some of the un-ligated 3Ⲡadapters to form 3Ⲡadapter-oligonucleotide duplexes comprising single-stranded 5Ⲡoverhang portions; combining at least one DNA polymerase with the third reaction composition and incubating under conditions suitable for the polymerase to convert at least some of the 3Ⲡadapter-oligonucleotide duplexes comprising single-stranded 5Ⲡoverhang portions to double-stranded adapter-oligonucleotide duplexes; adding at least one second ligase and at least one 5Ⲡadapter to the third reaction composition comprising double-stranded adapter-oligonucleotide duplexes and first ligation products and incubating under conditions suitable for forming at least some second ligation products, thereby reducing at least some 5Ⲡadapter-3Ⲡadapter dimer formation.
Certain method embodiments for reducing adapter-dimer formation comprise: combining a sample comprising target nucleic acids, at least one 3Ⲡadapter annealed to an oligonucleotide comprising a reverse transcription primer binding site, and at least one first ligase to form a first reaction composition, wherein the 3Ⲡadapter annealed with the oligonucleotide comprises a single-stranded 5Ⲡoverhang portion; incubating the first reaction composition under conditions suitable for first ligation products to be generated, to form a second reaction composition comprising first ligation products and at least some un-ligated 3Ⲡadapters annealed to oligonucleotides; combining at least one DNA polymerase with the second reaction composition and incubating under conditions suitable for the polymerase to convert at least some of the single-stranded 5Ⲡoverhang portions of the 3Ⲡadapters annealed to the oligonucleotides to double-stranded adapter-oligonucleotide duplexes lacking overhang portions; and combining at least one second ligase and at least one 5Ⲡadapter to the second reaction composition comprising double-stranded adapter-oligonucleotide duplexes and first ligation products and incubating under conditions suitable for forming at least some second ligation products, thereby reducing adapter-dimer formation.
These and other features and advantages of the current teachings will become better understood with regard to the following description, appended claims, and accompanying figures. The skilled artisan will understand that the figures, described below, are for illustration purposes only. The figures are not intended to limit the scope of the disclosed teachings in any way.
FIG. 1 schematically depicts certain exemplary methods for reducing adapter dimer formation;
FIG. 2 schematically depicts an exemplary end-filling embodiment for converting excess 3Ⲡadapter into blunt-ended dsDNA;
FIG. 3 schematically depicts on overview of an exemplary sRNA-seq library construction protocol of the current teachings comprising adapters with randomized ends;
FIGS. 4A-4B depicts exemplary PAGE images of samples that could be size selected with Gel-Free Size Selection Cleanup (FIG. 4A) or PAGE Size Selection and Cleanup (FIG. 4B), as described in Certain Exemplary Techniques;
FIG. 5 depicts various reaction compositions generated using exemplary methods analyzed on a 6% TBE-PAGE gel, stained with SYBRÂŽ Gold. Lanes 1 and 2 are technical duplicates of small RNA libraries created using an exemplary end-fill method (âWith end-fillâ) and lanes 3 and 4 are technical duplicates of small RNA libraries created without using an end-fill method of the current teachings (âNo end-fillâ); lane M contains a base pair ladder standard;
FIG. 6 depicts technical duplicates of various reaction compositions generated using exemplary methods analyzed on a 6% TBE-PAGE gel, stained with SYBRÂŽ Gold. Lanes 1-4 depict small RNA libraries prepared with annealing of the RT primer to the 3Ⲡadapter prior to the 3Ⲡligation step, and lanes 5-8 depict small RNA libraries prepared with annealing of the RT primer to the 3Ⲡadapter after to the 3Ⲡligation step. Lanes 1,2,5, and 6 depict libraries where an exemplary end-fill method was used; lanes 3,4,7, and 8 depict libraries where no end-fill method was not used; lanes marked M contain a base pair ladder standard. (+EF: an illustrative end-fill method of the current teachings was used in generating these samples; âEF: no end-fill technique was employed with these samples; Pre-anneal: oligonucleotide/RT primer annealed with 3Ⲡadapter prior to use; Post-anneal: oligonucleotide added to reaction composition after 3Ⲡadapter ligation); and
FIG. 7 depicts technical duplicates of various reaction compositions generated using exemplary methods analyzed on a 6% TBE-PAGE gel, stained with SYBR Gold. Lanes 1 and 2 depict libraries created using an exemplary end-fill method comprising the an embodiment of disclosed excess 3Ⲡadapter removal technique. Lanes 3 and 4 depict libraries created using an embodiment of the disclosed end-fill method but not an excess 3Ⲡadapter removal technique; lane M contains a base pair ladder standard. All libraries shown in this figure were constructed with adapters and primers that are compatible with Ion Torrent-based sequencing.
It is to be understood that both the foregoing general description and the following detailed descriptions are illustrative and exemplary only and are not intended to limit the scope of the disclosed teachings. The section headings used herein are for organizational purposes only and are not to be construed as limiting the subject matter of the disclosed teachings.
In the Summary above, the Detailed Description, the accompanying figures, and the claims below, reference is made to particular features (including method steps) of the current teachings. It is to be understood that the disclosure in this specification includes possible combinations of such particular features. For example, where a particular feature is disclosed in the context of a particular embodiment of the current teachings, or a particular claim, that feature can also be used, to the extent possible, in combination with and/or in the context of other particular embodiments, and in the current teachings in general.
Where reference is made to a method comprising two or more combined steps, the defined steps can be performed in any order or simultaneously (except where the context excludes that possibility), and the method include one or more other steps which are carried out before any of the defined steps, between two of the defined steps, or after all of the defined steps (except where the context excludes that possibility).
In this specification, certain U.S. patents, U.S. patent applications, and other documents may have been incorporated by reference. The text of such U.S. patents, U.S. patent applications, and other materials is, however, only incorporated by reference to the extent that no conflict exists between such text and the description and drawings set forth in this specification. In the event of such conflict, then any conflicting material in any incorporated by reference U.S. patents, U.S. patent applications, and other materials is specifically not incorporated by reference in this specification.
As used herein, the term âcomprisingâ, which is synonymous with âincludingâ, and cognates of each (such as comprise, comprises, include, and includes), is inclusive or open-ended and does not exclude additional unrecited components, elements, or method steps, that is other components, steps, etc., are optionally present. For example but not limited to, an article âcomprisingâ components A, B, and C may consist of (that is, contain only) components A, B, and C; or the article may contain not only components A, B, and C, but also one or more additional components.
An âoligonucleotideâ of the current teachings means a nucleic acid molecule that may serve as a binding site for a reverse transcription primer (RT primer) or the complement of an RT primer binding site. The oligonucleotides of the current teachings may have differing lengths.
Terms such as ârandomized basesâ, ârandomized nucleotidesâ random basesâ and ârandom nucleotidesâ refer to a nucleic acid sequence that is created with a random sequence, in contrast to a sequence that is designed to specifically hybridize to a target or desired nucleotide sequence. In certain embodiments, a plurality of different oligonucleotides comprise the same core sequence (i.e., the complement of a sequence of interest) but differing randomized ends. For example but not limited to, a series of 3Ⲡadapters with a core sequence that is the complement of at least a portion of the sequence of the oligonucleotide of the current teachings, but different 5Ⲡrandomized ends of between 1 and 25 nucleotides. In certain embodiments, randomized bases are present at the 5Ⲡend of 3Ⲡadapters, the 3Ⲡend of 5Ⲡadapters, or both.
The term âsmall RNAâ as used herein, refers to various species of RNA known in the art, typically 15-45 nucleotides long. Examples of small RNAs include microRNA (miRNA), small interfering RNA (siRNA), small nuclear RNA (snRNA), small nucleolar RNAs (snoRNAs), Piwi-interacting RNA (piRNA), and bacterial small RNA.
FIG. 1 provides a schematic overview of certain exemplary methods of the current teachings. Target nucleic acids 1 are combined with suitable 3Ⲡadapters 2 comprising random nucleotides (indicated by NNNN) at the 5Ⲡend (FIG. 1, 3Ⲡadapter ligation). In the presence of a suitable ligase and under appropriate conditions, first ligation products, also known as 3Ⲡligation products, are formed (each comprising a 3Ⲡadapter comprising random 5Ⲡnucleotides 2 ligated to target nucleic acids 1). Oligonucleotides comprising a sequence suitable for binding a reverse transcription primer 3 are added to the reaction composition comprising the first ligation products and un-ligated 3Ⲡadapters 2 and incubated under conditions suitable for the oligonucleotides 3 to anneal with the first ligation products (FIG. 1, RT primer hybridization). Duplexes are formed comprising: first ligation product-primer duplexes, comprising single and double-stranded portions 5; and adapter-oligonucleotide duplexes, a primarily double-stranded complex comprising a single-stranded 5Ⲡoverhang 4. In the presence of at least one suitable polymerase and under appropriate conditions, end-filling occurs, resulting in the formation of a double-stranded complex 6 that is generated when the polymerase âend fillsâ the 5Ⲡoverhang of the primarily double-stranded complex comprising a single-stranded 5Ⲡoverhang 4 (FIG. 1, End-fill; FIG. 2). Next, 5Ⲡadapters comprising random nucleotides (shown as NNNN) on their 3Ⲡends 7 are combined with the reaction composition comprising first ligation products which have been end-filled 5a and the double-stranded and end-filled adapter-oligonucleotide duplexes 6 and in the presence of a suitable ligase and under suitable conditions for second ligation products 8 (each comprising a 5Ⲡadapter, a target nucleic acid, and a 3Ⲡadapter with an annealed oligonucleotide) to be formed (FIG. 1, 5Ⲡadapter ligation).
In certain embodiments, total RNA in nuclease-free water is used for preparing sRNA-library using certain disclosed methods and kits. This RNA is combined with at least one pool of pre-adenylated ssDNA 3Ⲡadapters comprising random nucleotides at the 5Ⲡend, reaction buffer, and truncated T4 RNA ligase 2 enzyme, and incubated under conditions suitable for ligation of the adapter to the 3Ⲡand of small RNA molecules. The nucleic acid in the reaction composition is obtained using a combination of SPRI magnetic beads and isopropanol, and the products eluted in nuclease-free water. Next, at least one pool of ssDNA oligonucleotides that comprise an RT primer binding site are annealed to both excess 3Ⲡadapters (that which was not ligated to a small RNA molecule) and 3Ⲡadapter that has been ligated to a small RNA molecule. The annealing of this oligonucleotide to excess 3Ⲡadapter results in the formation of a double stranded DNA molecule with a 5Ⲡoverhang (see 4 in FIG. 1; FIG. 2). Buffer, dNTPs, and a suitable DNA polymerase, such as T4 DNA polymerase, are added and the reaction mixture is incubated under conditions suitable for polymerization, resulting in DNA polymerization on the 3Ⲡend of the oligonucleotide using the random bases of the 3Ⲡadapter as a template (depicted schematically in FIG. 1 End-fill; FIG. 2). The reaction mixture is then incubated under conditions suitable to inactivate the T4 DNA polymerase enzyme. The typical components of a 5Ⲡligation reaction, including the ssRNA 5Ⲡadapter, buffer, ATP, and T4 RNA ligase 1, are then added and the reaction mixture is incubated under conditions suitable for RNA ligation, resulting in ligation of 5Ⲡadapter to the 5Ⲡend of small RNA molecules. However, excess 3Ⲡadapter that was converted into blunt-ended dsDNA by the end-filling process (e.g., 6 in FIG. 1) is a poor substrate for the at least one second ligase, for example T4 RNA ligase 1, resulting in significant reduction in adapter-dimer formation compared to results obtained not using the methods of the current teachings. The library preparation process may be completed according to various sRNA-seq library preparation protocols, including for example reverse transcription, PCR amplification and gel purification or other size selection protocol, including the schematic depiction in FIG. 3.
According to certain disclosed methods, an end-filling technique is combined with a technique for removing excess 3Ⲡadapter, for example as provided in the NEXTFLEX Small RNA Sequencing Kit (Bioo Scientific), to further reduce formation of adapter-dimer products.
In some embodiments, the oligonucleotide is annealed to the 3Ⲡadapter prior to, during, or after the 3Ⲡligation reaction.
In some embodiments, the length of the randomized portion of the 3Ⲡadapter (shown schematically in FIG. 1 as NNNN) may be between 1-25 nucleotides; the length of the randomized portion of the 5Ⲡadapter (shown schematically in FIG. 1 as NNNN) may be between 1-25 nucleotides; or the randomized portions of the 3Ⲡadapters and the 5Ⲡadapters may be between 1-25 nucleotides.
In some embodiments, the oligonucleotide may not be the same length as the non-randomized portion of the 3Ⲡadapter. In certain embodiments, a 3Ⲡadapter comprises an activated adenylation (rApp) at its 5Ⲡend, a dideoxynucleotide at its 3Ⲡend, or an activated adenylation (rApp) at its 5Ⲡend and a dideoxynucleotide at its 3Ⲡend. In certain embodiments, a 3Ⲡadapter comprises four random nucleotides immediately internal to the activated adenylation (rApp) at its 5Ⲡend (5â˛rAppNNNN-) and the 5Ⲡadapter comprises four random nucleotides at its 3Ⲡend. In certain embodiments, the 5Ⲡadapter comprises RNA. In certain embodiments, the RT primer comprises a barcode sequence. In certain embodiments, a multiplicity of different RT primers are employed, wherein the RT primers comprise different barcodes sequences to facilitate multiplexed sequencing, for example but not limited to low-level multiplexing.
In some embodiments, the oligonucleotide may contain a 5Ⲡoverhang region.
Certain methods and kits of the current teachings comprise at least one DNA polymerase. Those in the art will appreciate that a wide variety of prokaryotic and eukaryotic DNA polymerases, both thermo-labile and thermostable, as well as many viral DNA polymerases are suitable for use in the disclosed methods and kits. Exemplary DNA polymerases include T4 DNA Polymerase, Taq polymerase, human DNA polymerase alpha, Moloney Murine Leukemia Virus Reverse Transcriptase (M-MLV RT), and E. coli DNA Pol I (including Klenow fragment).
Certain methods and kits of the current teachings comprise at least one first ligase and at least one second ligase. In certain embodiments, the first ligase and the second ligase are the same, for example, two aliquots of T4 RNA ligase 1 added to separate steps of certain method embodiments. Those in the art will appreciate that a wide variety of prokaryotic and eukaryotic ligases, both thermo-labile and thermostable, as well as many viral DNA ligases are suitable for use in the disclosed methods and kits. Exemplary ligases for use in certain disclosed methods and kits include T4 RNA ligase 1, Methanobacterium thermoautotrophicum thermostable RNA ligase, CircLigase⢠RNA Ligase (Epicentre, Madison, Wis.), T4 RNA ligase 2 (including truncation mutants and point mutants thereof), eukaryotic tRNA ligase, E. coli RNA ligase RtcB, and T4 DNA ligase.
According to certain embodiments, at least some oligonucleotides and at least some 3Ⲡadapters are annealed prior to 3Ⲡligation. In certain embodiments, such pre-annealed complexes are stored for later use.
Best results are obtained with high quality starting material. The use of degraded RNA may result in poor yields or lack of sequencing output data. The inventors recommend running total RNA on a 1-2% agarose gel or examining its integrity using an Agilent Bioanalyzer. High quality total RNA preparations should have a 28S band that is twice as intense as the 18S band of ribosomal RNA. At low concentrations, small RNA is difficult to detect on a gel; however, it can be detected using an Agilent Bioanalyzer Small RNA assay. For low input library preparation, the inventors recommend diluting the NEXTFLEX⢠3Ⲡ4N Adenylated Adapter and the NEXTFLEX⢠5Ⲡ4N adapter ½ to Ÿ with nuclease-free water.
| TABLE 1 |
| According to certain embodiments of the current teachings, |
| the following information may be helpful. |
| Gel-Free Size | |||
| Sample Input | Adapter dilution | PCR cycles | Selection |
| ââ2 Îźg-200 ng | None | 12-18 | + |
| 200 ng-50 ng | ½-Âź | 16-22 | +/â |
| 50 ng-5 ng | Âź-â | 22-25 | â |
For illustration purposes, the following exemplary techniques may be performed using the NEXTFLEX⢠Small RNA-Seq Kit v3. Those in the art will appreciate that the principals of these exemplary techniques are broadly applicable and that suitable reagents and components for performing these methods are available from various commercial sources.
Allow 50% PEG to come up to room temperature before use. For each sample, combine the following reagents on ice in a nuclease-free 96-well PCR plate: _ ΟL RNA+_ ΟL Nuclease-free Water=10.5 ΟL. Heat at 70° C. for 2 minutes then immediately place on ice. Incubate on ice for 2-5 minutes. For each sample, combine the following reagents on ice in a nuclease-free 96-well PCR plate: 10.5 ΟL RNA (in Nuclease-free Water), 5 ΟL 50% PEG, 1 ΟL 3ⲠNEXTFLEX 4N Adenylated Adapter (up to Ÿ dilution may be used), 2 ΟL AIR Ligase buffer, 0.5 RNase Inhibitor, and 1 ΟL AIR Ligase. Mix thoroughly by pipetting until homogenous. Incubate at 22° C. for 2 hours in a thermocycler. For ligations to 2ⲠO-methylated small RNAs, such as those found in plants, incubate at 16° C. overnight. Proceed immediately to next Excess 3ⲠAdapter Removal technique.
To each sample, add 20 ÎźL of Adapter Depletion Solution and mix well by pipette. Add 40 ÎźL of NEXTFLEX⢠Cleanup Beads and mix well by pipette. Add 60 ÎźL of isopropanol and mix well by pipette. Incubate for five minutes. Place the reaction composition near a magnetic field for 5 minutes or until the composition appears clear. Remove and discard supernatant. Add 180 ÎźL of freshly prepared 80% ethanol, incubate for 30 seconds, and remove all of the supernatant. Repeat this step for a total of 2 ethanol washes. IMPORTANT: Always use freshly prepared 80% ethanol and do not incubate the bead pellet with 80% ethanol for extended periods. Incubate sample for 3 minutes. After one minute, remove all residual liquid that may have collected at the bottom of the well. Remove the composition from the magnetic field and resuspend bead pellet in 22 ÎźL of Resuspension Buffer by pipetting volume up and down. Ensure that beads are completely resuspended. Incubate for two minutes. Place the reaction composition near a magnetic field for 3 minutes or until the composition appears clear. Transfer 20 ÎźL of supernatant to a new well. Add 20 ÎźL of Adapter Depletion Solution and mix well by pipette. Add 40 ÎźL of NEXTFLEX Cleanup Beads and mix well by pipette. Add 60 ÎźL of isopropanol and mix well by pipette. Incubate for 5 minutes. Place the reaction composition near a magnetic field for 5 minutes or until the composition appears clear. Remove and discard supernatant. Add 180 ÎźL of freshly prepared 80% ethanol, incubate for 30 seconds, and remove all of the supernatant. Repeat this step for a total of 2 ethanol washes. Always use freshly prepared 80% ethanol and do not incubate the bead pellet with 80% ethanol for extended periods. Incubate sample for 3 minutes. After one minute, remove any residual liquid that may have collected at the bottom of the well. Remove composition from the magnetic field and resuspend bead pellet in 13 ÎźL of Nuclease-free Water by pipetting. Ensure that beads are completely resuspended. Incubate for two minutes. Place the reaction composition near a magnetic field for 3 minutes or until the composition appears clear. Transfer 11.5 ÎźL of supernatant to a new well. Either proceed to the end-filling technique or store the compositions overnight at â20° C., then thaw compositions on ice before proceeding. Throughout the application reference is made to placing a reaction composition near a magnetic field or removing a reaction composition from the magnetic field and similar terminology. It is to be understood that the composition may be transported to or from the vicinity of the magnetic field or the magnetic field may be transported to and or removed from the vicinity of the composition.
For each sample, combine the following reagents on ice in a nuclease-free 96 well PCR plate: 11.5 ΟL Purified 3ⲠNEXTFLEX⢠4N Adenylated Adapter Ligated RNA (from previous Excess 3ⲠAdapter Removal technique), 1.5 ΟL Adapter Inactivation Reagent 1, 0.5 ΟL Adapter Inactivation Reagent 2, and 0.5 ΟL Adapter Inactivation Enzyme (total volume 14 ΟL). Mix thoroughly by pipetting, then incubate for 15 minutes at 12° C., 20 minutes at 50° C., the place at 4° C.
Heat 1.5 ÎźL of 5ⲠNEXTFLEX 4N adapter per reaction at 70° C. for 2 minutes, then immediately place on ice. For each sample, combine the following reagents on ice in a nuclease-free 96 well PCR plate: 14 ÎźL Purified 3ⲠNEXTFLEX⢠4N Adenylated Adapter Ligated RNA (from previous step), 4.5 ÎźL 50% PEG, 1.5 ÎźL 5ⲠNEXTFLEX⢠4N Adapter (Up to Âź dilution may be used, 1.5 ÎźL AIR Ligase Buffer, 1.54 ATP, 0.5 ÎźL RNA Inhibitor, 1.5 ÎźL RNA Ligase 1 (total volume 25 ÎźL). Mix thoroughly by pipetting, incubate at 20° C. in a thermocycler, then proceed with next step. Alternatively, the samples may be stored overnight at â20° C.
For each sample, combine the following reagents on ice in a nuclease-free 96 well PCR plate: 25 ΟL 5Ⲡand 3ⲠNEXTFLEX⢠Adapter Ligated RNA, 5 ΟL Nuclease-free Water, 4 ΟL 10à M-MuLV Buffer (vortex prior to use to dissolve precipitate), 4 ΟL dNTPs, and 2 ΟL M-MuLV Reverse Transcriptase (total volume 40 ΟL). Mix thoroughly by pipetting. Incubate 30 minutes at 42° C., 10 minutes at 90° C., then proceed to next step.
To each sample, add 20 ÎźL of NEXTFLEX⢠Cleanup Beads and mix well by pipette. Add 22 ÎźL isopropanol and mix well by pipette. Incubate for 5 minutes. Place the reaction composition near a magnetic field for 5 minutes or until the composition appears clear. Transfer 75 ÎźL of supernatant to a new well. The supernatant solution contains the cDNA product. Take care to not transfer beads along with clear supernatant. Remove the composition from the magnetic field add 10 ÎźL Adapter Depletion Solution and mix well by pipette. Add 20 ÎźL of NEXTFLEX⢠Cleanup Beads and mix well by pipette. Place the solution near a magnetic field for 5 minutes or until the solution appears clear. Remove and discard supernatant. Add 180 ÎźL of freshly prepared 80% ethanol, incubate for 30 seconds, then remove all of the supernatant. Repeat this step for a total of 2 ethanol washes. Incubate sample for 3 minutes. After one minute, remove all residual liquid that may have collected at the bottom of the well. Remove the plate from magnetic field and resuspend bead pellet in 20 ÎźL Nuclease-free Water by pipetting volume up and down. Ensure that beads are completely resuspended. Incubate for 2 minutes. Place the plate near a magnetic field for 3 minutes or until the composition appears clear. Transfer 18 ÎźL of supernatant to a new well and proceed to PCR amplification. Alternatively, the samples can be stored overnight at â20° C. Frozen samples should be thawed on ice before proceeding.
For each sample, combine the following reagents on ice in a nuclease-free 96 well PCR plate: 18 ÎźL Purified First Strand Synthesis Product, 1 ÎźL NEXTFLEX⢠universal primer, 1 ÎźL NEXTFLEX⢠barcoded primer, and 5 ÎźL NEXTFLEX⢠Small RNA PCR Master Mix. The plate is placed in a thermocycler heated to over 80° C. and heated to 95° C. for two minutes, cycled 12-25 cycles of 95° C. for twenty secondsâ60° C. for thirty secondsâ72° C. for fifteen seconds, then two minutes at 72° C. The PCR amplified product is then size selected.
| 3â˛âNEXTFLEX | 5ârApp-NNNNTGGAATTCTCGGGTGCCAAGG- |
| 4NâAdenylated | â3ddCâ(SEQâIDâNO:â1) |
| Adapter | |
| 5â˛âNEXTFLEXâ4N | 5â˛âGUUCAGAGUUCUACAGUCCGACGAUCNNNN |
| Adapter | (SEQâIDâNO:â2) |
| NEXTFLEXâRT | 5â˛âGCCTTGGCACCCGAGAATTCCA |
| Primer | (SEQâIDâNO:â3) |
| NEXTFLEX | 5â˛âCAAGCAGAAGACGGCATACGAGATXXXXXX |
| Barcode | GTGACTGGAGTTCCTTGGCACCCGAGAATTCCA |
| Primer | (SEQâIDâNO:â4;âwhereâXXXXXXâ= |
| barcodeâindexâregion-seeâbelow) | |
| NEXTFLEX | 5â˛âAATGATACGGCGACCACCGAGATCTA |
| Universal | CACGTTCAGAGTTCTACAGTCCGA |
| Primer | (SEQâIDâNO:â5) |
| microRNA | 5â˛âPhos-CUCAGGAUGGCGGAGCGGUCUâ3Ⲡ|
| Control | (SEQâIDâNO:â6) |
Exemplary Barcode Index Region Sequences: CGTGAT, ACATCG, GCCTAA, TGGTCA, CAGTGT, ATTGGC, GATCTG, TCAAGT, CTGATC, AAGCTA, GTAGCC, TACAAG, TTGACT, GGAACT, TGACAT, GGACGG, CTCTAC, GCGGAC, TTTCAC, GGCCAC, GGAAAC, CGTACG, CCACTC, GCTACC, ATCAGT, GCTCAT, AGGAAT, CTTTTG, TAGTTG, CCGGTG, ATCGTG, TGAGTG, CGCCTG, GCCATG, AAAATG, TGTTGG, ATTCCG, AGCTAG, GTATAG, TCTGAG, GTCGTC, CGATTA, GCTGTA, ATTATA, GAATGA, TCGGGA, CTTCGA, and TGCCGA.
Typically, gel-free library preparation can be achieved with 200 ng-2 Îźg of total RNA starting material and 18 or fewer cycles of PCR. PAGE-based size selection will be necessary when using less than 200 ng of total RNA starting material and up to 25 cycles of PCR. However, the small RNA fraction of total RNA can vary greatly depending on the cell/tissue type and the extraction method used, so it is the user's responsibility to determine optimal input amounts and PCR cycle numbers. Following PCR, products may be analyzed by TBE-PAGE gel, Agilent Bioanalyzer HS DNA Assay, or similar technique. For analysis by PAGE gel, we recommend mixing 5 ÎźL of PCR product with 1 ÎźL of NEXTFLEX Loading Dye and running on a 6% TBE-PAGE gel alongside 5 ÎźL of Ready to Load Low Molecular Weight Ladder, and staining with SYBR Gold or ethidium bromide. For analysis by Bioanalyzer, we recommend running 1 ÎźL of PCR product diluted Âź with nuclease-free water. The Bioanalyzer software may not correctly identify the peak sizes, so it is recommended to also run a library created with miRNA Control to help identify the Ë150 bp peak. Presence of a strong Ë150 bp band indicates a successful library preparation, and absence of a band Ë130 bp indicates that gel-free size selection may be used. See Table 2.
| TABLE 2 | |||
| ~150 bp band | ~130 bp band | Size Selection Method | |
| Strong | Absent or | Gel-free size selection | |
| very weak | |||
| Strong | Weak | PAGE size selection or | |
| repeat experiment with | |||
| fewer PCR cycles | |||
| Strong | Strong | PAGE size selection | |
| Absent/Weak | Absent | Additional PCR cycles | |
| Absent/Weak | Strong | Repeat experiment with | |
| adapter dilution (½-Ÿ) | |||
| and with additional PCR | |||
| cycles | |||
Ensure the volume of all samples is 25 ΟL. If less, add Nuclease-free Water to bring the entire volume up to 25 ΟL. Add 32.5 ΟL of NEXTFLEX⢠Cleanup Beads and mix well by pipetting. Incubate for 5 minutes. Place the samples near a magnetic field for 5 minutes or until the solution appears clear. Transfer 52.5 ΟL of supernatant to a new well. The supernatant contains the amplified product. Take care to not transfer beads along with clear supernatant. Remove the samples from the magnetic field. Add 30 ΟL of NEXTFLEX⢠Cleanup Beads to each sample and mix well by pipette. Incubate five minutes. Place the samples near a magnetic field for 5 minutes or until the solution appears clear. Remove and discard supernatant. Add 180 ΟL of freshly prepared 80% ethanol, incubate for 30 seconds, and remove all of the supernatant. Repeat this step for a total of 2 ethanol washes. Incubate sample for 3 minutes. After one minute, remove all residual liquid that may have collected at the bottom of the well. Remove plate from magnetic field and resuspend bead pellet in 13.5 ΟL of Resuspension Buffer by pipetting volume up and down. Ensure that beads are completely resuspended. Incubate for two minutes. Place the samples near a magnetic field for 3 minutes or until the solution appears clear. Transfer 12 ΟL of supernatant to a new well or a clean microcentrifuge tube. This is your sequencing library. Check the size distribution of the final library by Bioanalyzer High Sensitivity DNA Assay (Agilent) and the concentration by Qubit dsDNA HS Assay (Life Technologies).
Add 5 ÎźL of NEXTFLEX⢠6Ă Gel Loading Dye to each PCR product and mix well. Load purified PCR products onto a 6% TBE-PAGE gel. The inventors recommend leaving 1-2 lanes between samples prepared with the same barcode primer to avoid cross contamination. Samples prepared with different barcodes and that will be sequenced together may be run in adjacent lanes. In an adjacent lane, load 10 ÎźL of Ready to Load Low MW Ladder. Run the gel with 1ĂTBE buffer at 200 V until the lower dye band is near the bottom of the gel (0.5-1 cm). The gel should run for approximately 30 minutes. Run times may vary depending on individual equipment. Carefully remove the gel from the glass plates and stain with a nucleic acid stain such as SYBRÂŽ Gold (Invitrogen) per manufacturer instructions. Visualize gel bands on a UV transilluminator or other gel documentation instrument. Using a clean razor, cut out the Ë150 bp band and place into clean 1.7 mL tube. Do not cut out the Ë130 bp band; this is adapter dimer product (see FIG. 4). The ladder band at 200 bp is twice as intense as the other bands and can be used for orientation. Briefly centrifuge the microcentrifuge tube containing the gel slice to collect the gel slice at the bottom of the tube. Crush the gel slice thoroughly with a disposable pestle. Leave the pestle in the tube. Add 300 ÎźL of Elution Buffer to each tube and then remove the pestle, ensuring that as much gel as possible has been washed from the pestle. Let gel pieces soak at least 2 hours or overnight at room temperature with agitation. Do not incubate longer than overnight. Pulse spin tubes to collect all eluate from wall and lid. Carefully transfer the eluate (including crushed gel) to the top of a Spin-X Centrifuge tube (Sigma). Cutting the end off of a P1000 tip can help for transfers of larger gel pieces. Centrifuge the Spin-X tube at 16,000Ăg for 2 minutes. Dispose of the spin filter. Add 50 ÎźL NEXTFLEX Cleanup Beads and 350 ÎźL isopropanol to each tube and mix well. Incubate at room temperature for 10 minutes. Agitation during this incubation may increase efficiency of recovery. Pulse spin tubes to collect solution from walls and lid of tube and to pellet beads. Place the samples near a magnetic field for 2 minutes or until the solution appears clear. Carefully remove and discard fluid. Add 950 ÎźL 80% ethanol, incubate for 30 seconds, then remove all of the supernatant. Repeat this step for a total of two ethanol washes. Dry samples for 3 minutes. After one minute, remove all residual liquid that may have collected at the bottom of the tube. Remove the plate from the magnetic field and resuspend bead pellet in 13 ÎźL of Resuspension Buffer by pipetting volume up and down. Ensure that beads are completely resuspended and rehydrated. Incubate for 2 minutes. Place the samples near a magnetic field for 3 minutes or until the solution appears clear. Transfer 12 ÎźL it of supernatant to a clean 1.7 mL tube. This is your sequencing library. Check the size distribution of the final library by Bioanalyzer High Sensitivity DNA Assay (Agilent) and the concentration by Qubit dsDNA HS Assay (Life Technologies).
In an exemplary method embodiment, sRNA-seq libraries were prepared from human brain total RNA (Ambion, cat. # AM7962) using the NEXTFLEX⢠Small RNA Sequencing Kit v2 according to manufacturer's instructions, except as indicated. For sRNA-seq libraries prepared according to certain disclosed methods, following Excess 3ⲠAdapter Removal using NEXTFLEX⢠beads, 11.5 ΟL supernatant of nuclease free water containing 3Ⲡligation products was recovered. To each supernatant 1.5 ΟL of NEBuffer 2.1 (500mM NaCl, 100 mM Tris-HCl, 100 mM MgCl2, 1 ng/ml BSA, pH 7.9), 0.5 uL of 6.25 uM dNTPs, and 0.5 uL of T4 DNA Polymerase (Enzymatics, Cat. # P7080L) were added and incubated at 12° C. for 15 minutes followed by 50 ° C. for 20 minutes. The following modifications were then made to the NEXTFLEX⢠Small RNA sequencing kit v2 protocol: 1) in the 5Ⲡadapter ligation step, samples were not heated at 70° C. for 2 minutes. Instead, the 5Ⲡ4N adapter was heated separately at 70° C. for 2 minutes and then added to the reaction. 2) In the 5Ⲡadapter ligation step, 4.5 ΟL of 50% PEG was added instead of 3.5 ΟL 3) In the reverse transcription step, 5 ΟL of nuclease-free water was added instead of 8. 4) In order to compare yields and adapter-dimer content of different conditions, 5 ΟL of a the 25 ΟL PCR reaction was run on a 6% TBE-PAGE gel, stained with SYBRŽ Gold, and visualized an a UV transilluminator.
To show the effectiveness of the disclosed end-filling method, sRNA-seq libraries were prepared from 100 ng human brain total RNA, as described in Example 1, either with or without the described end-filling method and analyzed by TBE-PAGE (FIG. 5). Lanes 1 and 2 are technical duplicates of small RNA libraries created with the proposed end-fill method and lanes 3 and 4 are technical duplicates of small RNA libraries created without the end-fill method; lane M contains a base pair ladder standard. The results demonstrate that the method is not only effective in reducing adapter-dimer but surprisingly also increases yield of insert-containing product.
3Ⲡadapter was pre-annealed to oligonucleotide and libraries were prepared from 100 ng human brain total RNA, as described in Example 1, using either the pre-annealed oligonucleotide-3Ⲡadapter duplexes or with the oligonucleotide annealed after 3Ⲡligation. Referring to FIG. 6, lanes 1-4 depict small RNA libraries prepared with annealing of the oligonucleotide to the 3Ⲡadapter prior to the 3Ⲡligation step (âPre-annealâ); and lanes 5-8 depict small RNA libraries prepared by annealing the oligonucleotide to the 3Ⲡadapter after to the 3Ⲡligation step (âPost-annealâ). Lanes 1,2,5, and 6 depict libraries prepared according to the current teachings; while the libraries depicted in lanes 3,4,7, and 8 depict libraries were prepared without the end-filling technique of the current teachings; lanes marked M contain a base pair ladder standard. The results demonstrate that pre-annealing the 3Ⲡadapter and the oligonucleotide does not significantly affect either efficiency of 3Ⲡadapter annealing to small RNA molecules or the effectiveness of the described method in reducing adapter-dimer formation.
To evaluate whether certain disclosed methods are even more effective in reducing adapter-dimer when combined with an excess adapter removal technique, we tested an exemplary method embodiment comprising an adapter-dimer reduction technique, Adapter Depletion Cleanup (ADC; also referred to as Excess 3ⲠAdapter Removal, described above and also used in the NEXTFLEX⢠Small RNA Sequencing Kit (Bioo Scientific)). The ADC protocol involves mixing the sample with isopropanol, SPRI beads, and a depletion solution. This process allows depletion of unligated adapter while retaining larger ligation products, and is typically performed twice in succession. FIG. 7 shows the results obtained with libraries prepared from 500 ng of human brain total RNA using the ADC method alone, according to the NEXTFLEX⢠Kit protocol [ADC (â) end-fill] or the ADC method combined with an exemplary end-fill method of the current teachings [ADC (+) end-fill].
All libraries shown in FIG. 7 were constructed using adapters and primers that are compatible with Ion Torrent-based sequencing platforms. These results show that combination of certain disclosed methods comprising end filling and ADC techniques depleted adapter-dimer product more effectively than methods comprising the ADC technique but not end filling. It should be noted that this experiment was performed with different 3Ⲡand 5Ⲡadapters and RT and PCR primers that result in desired products and adapter-dimer products of a different size than those in FIGS. 5 and 6.
The described methods should work regardless of the sequence of the âstaticâ portion of the 3Ⲡadapter, so to test this the inventors used this method in sRNA-seq library construction using adapters that are compatible with either Illumina sequencing platforms or Life Technologies Ion Torrent platforms. FIG. 7 illustrates, among other things, that in certain exemplary method embodiments, the combination of end-filling with the ADC technique greatly reduces adapter-dimer formation in sRNA-seq libraries regardless of the adapter sequences used. All libraries shown in FIG. 7 were constructed with adapters and primers that are compatible with Ion Torrent-based sequencing. Lanes 1 and 2 of FIG. 7 depict libraries created using method embodiments comprising the end-fill technique combined with the ADC technique (ADC (+) end-fill). Lanes 3 and 4 of FIG. 7 depict libraries created using method embodiments comprising the end-fill technique but not the ADC technique (ADC (â) end-fill); lane M contains a base pair ladder standard. Thus, if the required adapter sequences change as sequencing technology advances, the current teachings may still be used to reduce adapter-dimer formation.
In certain embodiments, kits are provided to expedite the performance of various disclosed methods. Kits serve to expedite the performance of certain method embodiments by assembling two or more reagents and/or components used in carrying out certain methods. Kits may contain reagents in pre-measured unit amounts to minimize the need for measurements by end-users. Kit may also include instructions for performing one or more of the disclosed methods. In certain embodiments, at least some of the kit components are optimized to perform in conjunction with each other. Typically, kit reagents may be provided in solid, liquid, or gel form.
Certain kit embodiments comprise: at least one 3Ⲡadapter comprising 1-25 random bases on the 5Ⲡend, at least one oligonucleotide complementary to at least a portion of the 3Ⲡadapter, and at least one 5Ⲡadapter with 1-25 random bases on the 3Ⲡend, T4 RNA ligase 2, and T4 RNA ligase 1. Certain kit embodiments further comprise DNA polymerase, T4 ligase 1, T4 ligase 2 or DNA polymerase, T4 ligase 1, and T4 ligase 2. In certain kit embodiments, the DNA polymerase comprises T4 DNA polymerase.
Although the disclosed teachings have been described with reference to various applications, methods, and kits, it will be appreciated that various changes and modifications may be made without departing from the teachings herein. The foregoing examples are provided to better illustrate the present teachings and are not intended to limit the scope of the teachings herein. Furthermore, various presently unforeseen or unanticipated alternatives, modifications, variations or improvements therein may be subsequently made by those skilled in the art which are also intended to be encompassed by the following claims. Certain aspects of the present teachings may be further understood in light of the following claims.
1. A kit comprising at least one 3Ⲡadapter comprising 1-25 randomized bases on the 5Ⲡend, at least one oligonucleotide complementary to at least a portion of the 3Ⲡadapter, and at least one 5Ⲡadapter with 1-25 randomized bases on the 3Ⲡend.
2. The kit of claim 1 further comprising a DNA polymerase, at least one ligase, or a DNA polymerase and at least one ligase.
3. The kit of claim 2, wherein the at least one ligase comprises at least one of: T4 RNA ligase 2, T4 RNA ligase 1, or Methanobacterium thermoautotrophicum RNA ligase.