Patent application title:

DNA BARCODING-BASED METHOD FOR RAPID IDENTIFICATION OF LYCIUM CHINENSIS

Publication number:

US20210207226A1

Publication date:
Application number:

17/136,208

Filed date:

2020-12-29

Abstract:

Disclosed in the present invention is a trnL-trnF barcode and a DNA barcoding-based method for rapid identification of Lycium chinensis, relating to the technical field of identification of Lycium chinensis varieties. A Lycium chinensis phylogenetic tree is constructed based on the present DNA barcodes, and used in the study of the intraspecific and interspecific phylogeny of Lycium chinensis. The present invention further provides trnL-trnF barcode database of Lycium chinensis samples. By performing sequence alignment of trnL-trnF sequence of the sample to be identified and the trnL-trnF barcode database of Lycium chinensis samples, the Lycium chinensis varieties can be effectively identified and their interspecific relationship can be determined, providing an effective basis for the classification and identification of Lycium chinensis varieties.

Inventors:

Interested in similar patents?

Get notified when new applications in this technology area are published.

Classification:

C12Q1/6895 »  CPC main

Measuring or testing processes involving enzymes, nucleic acids or microorganisms ; Compositions therefor; Processes of preparing such compositions involving nucleic acids; Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae

Description

REFERENCE TO AN ELECTRONIC SEQUENCE LISTING

The contents of the electronic sequence listing (Sequence-List-NXGQUSN-202008061.txt; Size: 53,000 bytes; and Date of Creation: Mar. 14, 2021) is herein incorporated by reference in its entirety.

CROSS REFERENCE TO RELATED APPLICATION

The present application is based upon and claims priority to Chinese Application No. 2020103478862, filed on Apr. 28, 2020, and entitled “method for rapid identification of Lycium Chinensis based on DNA barcode”, the entire contents of which are incorporated herein by reference

REFERENCE

Technical Field

The present invention generally relates to the technical field of variety identification for Lycium chinensis, and specifically relates to a method for rapid identification of Lycium Chinensis based on DNA barcode.

Background Art

Lycium Chinensis (Wolfberry) is rich in LBP (lycium barbarum polysaccharide), betaine, carotenoids, and a variety of unsaturated fatty acids, etc. It has the functions of anti-oxidation, anti-tumor, delaying aging, strengthening immunity, softening blood vessels and lowering blood lipid, etc. It is an important medicinal and edible plant resource in China.

Compared with breeding of other crops, the breeding of Lycium chinensis has the following shortcomings and drawbacks: firstly, there are relatively few practical production varieties, only four new varieties (Ningqi-1, Ningqi-4, Ningqi-5 and Ningqi-7) are widely used in the production; in addition, they have relatively single uses and cannot adapt to the diversified development of Lycium chinensis industry; secondly, the breeding methods are relatively very few, with long breeding cycle. In recent years, with the rapid development of molecular marker technology, it can provide more effective judgment basis for in-depth understanding of plant gene polymorphism, targeted selection of parents, and early identification of hybrid offspring, etc., thereby improving the breeding efficiency. Through population selection, hybrid breeding, and cell fusion technologies, diversified breeding theoretical system and technical system can be established and new multi-purpose varieties of Lycium chinensis can be cultivated, which is of great significance to the improvement of the research level and sustainable development of Lycium chinensis industry.

DNA barcoding (DNA barcode) can be used to recognize and identify target varieties using one or a few DNA fragments. It is characterized by simple operation, high accuracy, and rapid identification, etc. Presently, it has become a new research area and hotspot of interest in modern biological taxonomy. In recent years, researchers at home and abroad have carried out active exploration and studies on DNA barcode gene sequences suitable for plant identification.

Chinese patent application CN110229927A titled “a DNA barcoding-based method for identifying Heiguo Lycium chinensis and uses thereof” provides a method for identifying Heiguo Lycium chinensis based on DNA barcoding. The DNA barcode gene sequence for identifying Heiguo Lycium chinensis is LRITS2 (the second internal transcribed spacer of ribosomal RNA)/LRpsbA-trnH (a non-coding region between the chloroplast genes psbA and trnH). The DNA barcode sequence LRITS2/LRpsbA-trnH for identifying Heiguo Lycium chinensis can be used simultaneously or one of them can be selected. The invention can identify Heiguo Lycium chinensis raw materials efficiently and accurately, to prevent similar confusing or counterfeit products, in addition, it can be used for the identification of fruit powder, fruit shreds, etc. It has important application value and great social benefits to guarantee food safety and consumer rights and interests.

The article titled “Identification of Lycium Germplasm Resources Based on the matK Barcode Sequence” discloses the identification and analysis of 10 test materials of Lycium germplasm resources using the matK gene as the barcode coding sequence through DNA barcode technology, so as to obtain the theoretical basis of identifying Lycium plants at the molecular level. According to the method, sequence alignment is performed using the ClustalX software, the sequence information is obtained by Mega7.0 and the difference between sequences is compared, finally a phylogenetic tree is constructed based on the K2P model. The matK sequence has a total length of 936 bp, with 933 conserved sites and 3 variable sites. The average GC content is 33.3%, and the base transition transversion value is 1.8. Its phylogenetic tree is divided into two branches. Heiguo, Huangguobian and Changji Lycium chinensis are clustered into a branch, and other varieties are clustered into a branch, and each branch has a high Bootstrap value.

SUMMARY OF THE INVENTION

One object of the present invention is to provide a method for rapid identification of Lycium chinensis based on DNA barcode. The inventors of this present application found, there exist problems of unclear genetic background of Lycium germplasm resources and lagging in excavation and utilization of excellent resources for the variety identification of Lycium chinensis. The present invention provides a DNA barcode—the trnL-trnF barcode and a method based on it for rapid identification of Lycium chinensis. The present invention provides a chloroplast-based spacer sequence, and also provides a rapid molecular marker identification method of Lycium chinensis with representative germplasm sources such as Heiguo Lycium chinensis, Huangguo Lycium chinensis, Yuanguo Lycium chinensis, Hongzhi Lycium chinensis, local varieties of Lycium barbarum, local varieties of Beifang, Xinjiang, Yunnan, Hebei, as well as hybrid populations, space-mutated populations and ploidy populations, etc, which can be used for the identification of Lycium chinensis varieties.

The present invention provides a method for identifying Lycium chinensis varieties and determining interspecific relationship based on DNA barcoding. In addition, a trnL-trnF barcode database is provided, which can be used to effectively identify the Lycium chinensis varieties and determine the interspecific relationship of Lycium chinensis, providing effective basis for Lycium chinensis varieties.

The present invention provides a trnL-trnF barcode and a DNA barcoding-based method for rapid identification of Lycium chinensis.

The identifiable Lycium chinensis varieties include Ningqi-1 (L. barbarum Linn), Ningqi-2, Ningqi-3, Ningqi-4, Ningqi-5, Ningqi-6, Ningqi-7, Ningnongqi-9, Huangguobian Lycium chinensis (L. barbarum Linn. var. auranticarpum K. F. Ching var. nov.), Heiguo Lycium chinensis (Lycium ruthenicum Murr.), Ningnongqi-5 (L. barbarum Linn), Beifang Lycium chinensis (Lycium chinense MilL. var. potaninii (Pojark.) A. M. Lu), Damaye Lycium chinensis (Damaye (L. barbarum Linn), Baihua Lycium chinensis (Baihua (L. barbarum)) Zhongguo Lycium chinensis (L. Chinense Mill. var.), Yunnan Lycium chinensis (Lycium yunnanense Kuang et A. M. Lu), Mansheng Lycium chinensis (Manshenggouqi (L. barbarum)), Zibing Lycium chinensis (Ziguogouqi (L. barbarum)), Hongzhi Lycium chinensis (Lycium dasystemum), Xiaomaye Lycium chinensis (Xiaomaye (L. barbarum Linn)), Xinjiang Lycium chinensis (Lycium dasystemum Pojark), Mengqi-1, Ningqicai-1, black hybrid space-mutated Lycium chinensis, space-mutated Lycium chinensis, Yuanguo Lycium chinensis, Lycium chinensis-9001, Ninggxia Huangguo Lycium chinensis, Changji Lycium chinensis, Hebei Lycium chinensis, etc.

Preferably, the DNA barcoding-based method for rapid identification of Lycium chinensis, comprising the following steps:

1) extracting genomic DNA from Lycium chinensis samples;

2) amplifying trnL-trnF barcode sequence fragments using the extracted genomic DNA as a template and the primers with nucleotide sequences shown in SEQ ID NO. 35 and SEQ ID NO. 36 to obtain a PCR product;

3) sequencing the PCR product; and

4) constructing a phylogenetic tree and identifying Lycium chinensis.

Further, in step 1), the genomic DNA is extracted using a kit.

Preferably, a DNA secure Plant Kit is used to extract genomic DNA in the step 1).

Further, the DNA extraction using the kit includes the following steps:

(1A) Extraction of DNA

The fresh and tender leaves of Lycium chinensis samples to be tested are taken as samples, and put into a 5 ml cryotube and marked, then put them into liquid nitrogen immediately, and stored at −80° C. The total DNA is extracted using a new plant genomic DNA extraction kit (DNA secure Plant Kit).

The extraction method is as follows:

i) Taking 100 g sample and grinding in a multifunctional high-efficiency biological sample preparation apparatus with a speed of 22 times/s for 2 minutes. Immediately adding 400 ul of buffer LP1 and 6 ul RNase A (10 mg/ml), oscillating for 1 min and placing at room temperature for 10 min.

ii) Adding 130 ul of buffer LP2, mix well, and oscillating for 1 min.

iii) Centrifuging at 12000 rpm for 5 min, and transferring the supernatant to a new centrifuge tube.

iv) Adding 1.5 times the volume of buffer LP3 (make sure that absolute ethanol has been added before use), shaking immediately and mixing thoroughly for 15 sec. At this time, flocculent precipitation may occur.

v) Adding the solution and flocculent precipitate obtained in the previous step into an adsorption column CB3 (the adsorption column is put into the collection tube), centrifuging at 12000 rpm for 30 s, discarding the waste liquid, and putting the adsorption column CB3 into the collection tube.

vi) Adding 600 ul of rinse solution PW to the adsorption column CB3 (check if absolute ethanol has been added before use), centrifuging at 12000 rpm for 30 s, discarding the waste liquid, and then putting the adsorption column CB3 into the collection tube. (Note: If the adsorption column membrane is green, add 500 ul of absolute ethanol to the adsorption column CB3, centrifuge at 12000 rpm for 30 seconds, discard the waste liquid, and put the adsorption column CB3 into the collection tube).

vii) Repeating the step vi).

viii) Putting the adsorption column CB3 back into the collection tube, centrifuging at 12000 rpm for 2 minutes, and discarding the waste liquid; placing the adsorption column CB3 at room temperature for 15 min to thoroughly remove the remaining rinse solution in the adsorption material.

ix) Transferring the adsorption column CB3 to a clean centrifuge tube, and adding 100 ul of elution buffer TE into the middle of the adsorption membrane, leaving it at room temperature for 2 minutes, centrifuging at 12000 rpm for 2 minutes, and collecting the solution into the centrifuge tube.

x) Repeating step ix). The DNA product is stored at −80° C. to prevent DNA degradation.

(1B) Detection of DNA Concentration and Purity

i) Detection by Agarose Gel Electrophoresis

1.2% agarose gel is prepared with 1.2 g agarose and 100 ml 1*TAE buffer. 4 ul ddH2O+1 ul DNA sample (undiluted)+1 ul 6*loading buffer are added to a PCR tube to perform agarose gel electrophoresis, and the test results are observed under a UV gel imaging system.

ii) Detection by UV Spectrophotometer

The UV spectrophotometer is preheated in advance, and 99 ul ddH2O+1 ul DNA sample (undiluted) are added to the PCR tube for detection. The test results show the sample concentration and the ratio of OD260/OD280, and the value of OD260/OD280 should be 1.7-1.9. If ddH2O instead of elution buffer is used for elution, the ratio will be lower because the pH value and the presence of ions will affect the light absorption value, but it does not indicate low purity.

Preferably, in the step 2), the PCR amplification reaction system is: i) pre-denaturizing at 94 reaction sys ii) denaturizing at 94t 94 reaction system is: 55° C. for 30 s (the annealing temperature can be adjusted within the range of 58-60° C.), extending at 72° C. for 2 min, 35 cycles; iii) keeping warm at 72° C. for 10 min; and iv) storing at 4° C.; performing detection of PCR product by 1.0% agarose gel electrophoresis, and observing the amplification results under a UV gel imaging system.

Further, in the DNA barcoding-based method for rapid identification of the present invention, step 3) is sequencing the PCR product obtained in step 2). The sequencing method in the step 3) is as follows:

(3A) PCR Product Cloning:

Recovering target band(s) with AxyPrep DNA gel recovery kit, and detecting by 1.2% agarose gel electrophoresis. The purified target DNA is used as a sequencing template. The recovered product is ligated to the T vector (pGEM-T) using pLB zero background rapid cloning kit, then transferred to E. coli DH5a for culture. The blue-white spot screening method is used to screen positive colonies and PCR detection of colonies is carried out. The amplification results are observed under a UV gel imaging system.

(3B) Sequencing and Analysis:

Sequencing the DNA sequence of the colony of positive clone, and performing homology sequences alignment with the published sequence in NCBI, to analyze the sequence. The operations are as follows:

In the present invention, after performing PCR detection on positive colonies, the colonies containing target fragments (positive colony) are cultured in LB liquid medium, and 3 colonies are selected for each material and sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing by Sanger method, to obtain trnL-trnF sequence.

The obtained DNA barcode gene sequence is aligned with the published sequence in the NCBI database for homology. The Clustal X program is used to align the Lycium chinensis DNA barcode gene sequence respectively. The base composition of the target sequence, the frequency of base variation between sequences and the frequency of transition and transversion between sequences and their ratios are calculated by the phylogenetic analysis software MEGA7.0, and a phylogenetic tree is constructed to establish a trnL-trnF barcode database for identification of varieties of Lycium chinensis.

Another object of the present invention is to provide a trnL-trnF barcode database of Lycium chinensis samples constructed by the above method, comprising 34 trnL-trnF barcodes, and the nucleotide sequence thereof is shown in SEQ ID NO. 1-34.

Another object of the present invention is to provide uses of the trnL-trnF barcode database of Lycium chinensis samples in identifying Lycium chinensis varieties.

Preferably, uses of the trnL-trnF barcode database of Lycium chinensis samples in identifying Lycium chinensis varieties comprise the following step:

performing sequence alignment of trnL-trnF sequence of the sample to be identified and the trnL-trnF barcode database of Lycium chinensis samples to identify the Lycium chinensis varieties.

Preferably, the method for obtaining the trnL-trnF sequence of the sample to be identified involves genomic DNA extraction, PCR amplification, and sequencing of PCR products, to obtain the corresponding sequence, and the operation steps are the same as steps 1), 2) and 3) in the DNA barcoding-based identification method of Lycium chinensis varieties.

The present invention can achieve the following beneficial effects:

(1) A method for identification of Lycium chinensis varieties based on trnL-trnF gene is established for the first time. It can be used to identify Lycium barbarum, Huangguobian Lycium chinensis, Heiguo Lycium chinensis, Beifang Lycium chinensis, Damaye Lycium chinensis, Zhongguo Lycium chinensis, Yunnan Lycium chinensis, Mansheng Lycium chinensis, Zibing Lycium chinensis, Hongzhi Lycium chinensis, etc.

(2) The genetic diversity and genetic relationship of Lycium are revealed based on trnL-trnF gene, to provide an effective basis for the identification, classification and phylogenic study of Lycium chinensis varieties.

(3) It can identify Lycium chinensis varieties accurately based on trnL-trnF gene.

(4) The present invention further provides trnL-trnF barcode database of Lycium chinensis samples, covering Heiguo Lycium chinensis, Huangguo Lycium chinensis, Yuanguo Lycium chinensis, Hongzhi Lycium chinensis, local varieties of Lycium barbarum, local varieties of Beifang, Xinjiang, Yunnan, Hebei, as well as hybrid populations, space mutation populations and ploidy populations, etc, all of them are representative germplasms of Lycium chinensis nationwide; Therefore, it can provide an effective basis for the classification and identification of Lycium chinensis varieties.

By performing sequence alignment of trnL-trnF sequence of the sample to be identified and the trnL-trnF barcode database of Lycium chinensis samples, the Lycium chinensis varieties can be effectively identified and their interspecific relationship can be determined. By identifying the interspecific relationship between Lycium chinensis to be tested and Lycium chinensis in the barcode database, it provides an effective basis for the classification and identification of Lycium chinensis varieties.

BRIEF DESCRIPTION OF THE DRAWINGS

FIG. 1 shows the DNA extraction and detection result of the Lycium chinensis samples in Example 1 of the present invention, of which, lane M: marker (DL2000 DNA molecular marker); (a) DNA detection results of lanes 1 to 24 corresponding to sample numbers 1 to 24; (b) DNA detection results of lanes 25 to 34 corresponding to sample numbers 25 to 34.

FIG. 2 shows the PCR amplification result of trnL-trnF sequence of some Lycium chinensis samples in Example 1 of the present invention, of which, lane M: marker (DL2000 DNA molecular marker); lanes 1-2: PCR products of Mansheng Lycium chinensis; lanes 4-5: PCR products of Yuanguo Lycium chinensis; lanes 7-8: PCR products of Zibing. Lanes 1-2, 4-5 and 7-8 show twice PCR results of different samples.

FIG. 3 shows the trnL-trnF sequence cloning result of Lycium chinensis sample No. 32 in Example 1 of the present invention. Of which, M: marker (DL2000 DNA molecular marker), lane 1: negative clone; lanes 2 to 6: positive clones (results of multiple repeated tests).

FIG. 4 shows the NJ phylogenetic tree constructed from the trnL-trnF barcodes in the trnL-trnF barcode database of Lycium chinensis samples in Example 1 of the present invention.

FIG. 5 shows the NJ phylogenetic tree of Lycium chinensis samples to be identified and part of the trnL-trnF barcodes in the database in Example 1 of the present invention.

FIG. 6 shows the NJ phylogenetic tree of Lycium chinensis samples to be identified and part of the trnL-trnF barcodes in the database in Example 2 of the present invention.

DETAILED DESCRIPTION OF THE EMBODIMENTS

The present invention is described below through specific embodiments. Unless otherwise specified, the technical means used in the present invention are all methods known to those skilled in the art. In addition, the embodiments should be understood as illustrative rather than limiting the scope of the invention, and the essence and scope of the present invention are only defined by the appended claims. For those skilled in the art, without departing from the essence and scope of the present invention, various changes or modifications to the material components and amount in these embodiments shall also fall into the scope of protection of the present invention. The present invention will be further described below in conjunction with specific embodiments.

Example 1 Identification of Lycium chinensis Samples and Construction of trnL-trnF Barcode Database of Lycium chinensis Samples

The invention will be further described in conjunction with specific embodiments.

1. Samples from trnL-trnF Barcode Database of Lycium chinensis Samples

In order to construct a trnL-trnF barcode database of Lycium chinensis samples, a total of 34 samples with partial similar morphology from different regions are collected, as shown in Table 1.

TABLE 1
Lycium plant samples (trnL-trnF barcode database of Lycium chinensis samples)
Germplasm Resource
No. Latin name name Code type SEQ ID NO
1 Ningqi No. 1 (L. barbarum Ningqi-1 Ningqi1 Bred variety 1
Linn)
2 Ningqi No. 2 (L. barbarum Ningqi-2 Ningqi2 Bred variety 2
Linn)
3 Ningqi No. 3 (L. barbarum Ningqi-3 Ningqi3 Bred variety 3
Linn)
4 Ningqi No. 4 (L. barbarum Ningqi-4 Ningqi4 Bred variety 4
Linn)
5 Ningqi No. 5 (L. barbarum Ningqi-5 Ningqi5 Bred variety 5
Linn)
6 Ningqi No. 6 (L. barbarum Ningqi-6 Ningqi6 Bred variety 6
Linn)
7 Ningqi No. 7 (L. barbarum Ningqi-7 Ningqi7 Bred variety 7
Linn)
8 L. barbarum Linn Ningnongqi-9 Ningnongqi9 Bred variety 8
9 L. barbarum Linn. Huangguobian Huangguobian Bred variety 9
var. auranticarpum K. F. Ching
var. nov.
10 Mengqi 1(L. barbarum) Mengqi-1 Mengqi1 Bred variety 10
From printed publication 5
11 Lycium ruthenicum Murr. Heiguo Heiguo Bred variety 11
Lycium
chinensis
12 From printed publication 2 Ningqicai-1 Ningqicai1 Bred variety 12
13 L. barbarum Linn Ningnongqi-5 W-12-30 Space mutant 13
14 From printed publication 1 HZ-13-01 HZ-13-01 Black hybrid 14
space mutant
15 From printed publication 1 ZH-13-08 ZH-13-08 Space mutant 15
16 From printed publication 1 W-12-27 W-12-27 Black hybrid 16
space mutant
17 From printed publication 1 W-11-15 W-11-15 Black hybrid 17
space mutant
18 From printed publication 1 W-13-26 W-13-26 Black hybrid 18
space mutant
19 From printed publication 1 W-12-26 W-12-26 Black hybrid 19
space mutant
20 Lycium chinenseMilL. var. Beifang Beifang Introduced 20
potaninii (Pojark.) A. M. Lu Lycium variety
chinensis
21 From printed publication 1 Yuanguo Yuanguo Bred variety 21
Lycium
chinensis
22 From printed publication 4 9001 9001 Bred variety 22
Ninggxia
23 From printed publication 3 Huangguo Huangguo Bred variety 23
24 Damaye (L. barbarum Linn) Damaye Damaye Bred variety 24
25 Baihua(L. barbarum) Baihua Baihua Introduced 25
variety
26 L. chinenseMill. var. Zhongguo Zhongguo Introduced 26
Lycium variety
chinensis
27 Lycium yunnanenseKuang et Yunnan Yunnan Introduced 27
A. M. Lu Lycium variety
chinensis
28 Manshenggouqi (L. bararum) Mansheng Mansheng Introduced 28
Lycium variety
chinensis
29 Ziguogouqi (L. barbarum) Zibing Zibing Introduced 29
variety
30 Lycium dasystemum Hongzhi Hongzhi Introduced 30
variety
31 From printed publication 1 Hebei Hebei Introduced 31
Lycium variety
chinensis
32 Xiaomaye (L. barbarum Linn) Xiaomaye Xiaomaye Bred variety 32
33 From printed publication 1 Changji Changji Introduced 33
Lycium variety
chinensis
34 Lycium dasystemumPojark Xinjiang Xinjiang Introduced 34
Lycium variety
chinensis
Note:
(Variety numbers 14-19, 21, 31, and 33 are varieties disclosed in the printed publication 1: “Wan Ru, Wang Yajun, An Wei, et al. Identification of 21 Lycium plants based on psbA-trnH sequence barcodes [J]. Jiangsu Agricultural Sciences, 2019, 47(01): 64-67.”; variety number 12 is from Table 1 in the printed publication 2: “a new method of identifying vegetable Lycium chinensis -nrDNA ITS sequencing method (English)[J]. Agricultural Science & Technology(2): 64-65 + 111”; Variety number 23 is from Table 1 in the printed publication 3: “Shi Zhigang. Genetic diversity of 18 Ningxia wolfberry resources based on nrDNA ITS sequence [J]. Anhui Agricultural Sciences (24): 10379-10380”; variety number 22 is from Table 1 in the publication 4: “Shi Zhigang. Genetic diversity of 18 Ningxia wolfberry resources based on nrDNA ITS sequence [J]. Anhui Agricultural Sciences (24): 10379-10380”; variety number 10 is from the publication 5: “Yin Yue, An Wei, Zhao Jianhua, et al. Transcriptome SSR information analysis and molecular marker development Heiguo Lycium chinensis [J]. Journal of Zhejiang Agriculture and Forestry University, 2019, 36(02): 215-221.”).
2. Identification of Lycium chinensis samples and construction of the trnL-trnF barcode database of Lycium chinensis samples

1) Extraction of DNA

In the Lycium chinensis germplasm resource nursery of Lycium Engineering Center, Ningxia Academy of Agricultural and Forestry Sciences, 34 parts of fresh and tender leaves of Lycium plants are taken as samples, and put into a 5 ml cryotube and marked, then put them into liquid nitrogen immediately, and stored at −80° C. Sampling time: June 2018, sampling location: National Lycium Chinensis Germplasm Resource Bank in Yinchuan City, Ningxia.

The total DNA is extracted using a new plant genomic DNA extraction kit (DNA secure Plant Kit). The extraction method is as follows:

i) 100 g sample was taken and grinded in a multifunctional high-efficiency biological sample preparation apparatus at 22 times/s for 2 minutes. Immediately 400 ul of buffer LP1 and 6 ul RNase A (10 mg/ml) was added. The mixture was oscillate for 1 min and placed at room temperature for 10 min.

ii) 130 ul of buffer LP2 was added, mixed well, and subjected to oscillate for 1 min. iii) Centrifugation at 12000 rpm for 5 min was performed. The supernatant was transferred to a new centrifuge tube.

iv) 1.5 times the volume of buffer LP3 (check if absolute ethanol has been added before use) was added. The mixture was immediately shaken and mixed thoroughly for 15 s. At this time, flocculent precipitate may occur.

v) The solution and flocculent precipitate obtained in the previous step iv) were added into an adsorption column CB3 (the adsorption column is put into the collection tube). After centrifugation at 12000 rpm for 30 s, the waste liquid was discarded, and the adsorption column CB3 was putted into the collection tube.

vi) 600 ul of rinse solution PW was added to the adsorption column CB3 (check if absolute ethanol has been added before use). After centrifugation at 12000 rpm for 30 s, the waste liquid was discarded, and the adsorption column CB3 was putted into the collection tube. (Note: If the adsorption column membrane was green, added 500 ul of absolute ethanol to the adsorption column CB3, centrifuged at 12000 rpm for 30 seconds, discarded the waste liquid, and putted the adsorption column CB3 into the collection tube).

vii) Repeated the step vi).

viii) Putted the adsorption column CB3 back into the collection tube, centrifuged at 12000 rpm for 2 minutes, and discarded the waste liquid. The adsorption column CB3 was placed at room temperature for 15 min to thoroughly remove the remaining rinse solution in the adsorption material.

ix) Transferred the adsorption column CB3 to a clean centrifuge tube, and added 100 ul of elution buffer TE into the middle of the adsorption membrane, left it at room temperature for 2 minutes, centrifuged at 12000 rpm for 2 minutes, and collected the solution into the centrifuge tube.

x) Repeated step ix). The DNA product was stored at −80° C. to prevent DNA degradation.

2) Detection of DNA Concentration and Purity

i) Detection by Agarose Gel Electrophoresis

1.2% agarose gel is prepared with 1.2 g agarose and 100 ml 1*TAE buffer. 4 ul ddH2O+1 ul DNA sample (undiluted)+1 ul 6*loading buffer were added to a PCR tube to perform agarose gel electrophoresis, and the test results were observed under a UV gel imaging system, as shown in FIG. 1.

ii) Detection by UV Spectrophotometer

The UV spectrophotometer was preheated in advance, and 99 ul ddH2O+1 ul DNA sample (undiluted) were added to the PCR tube for detection. The test results showed the sample concentration and the ratio of OD260/OD280, and the value of OD260/OD280 should be 1.7-1.9. If ddH2O instead of elution buffer was used for elution, the ratio will be lower because the pH value and the presence of ions will affect the light absorption value, but it did not indicate low purity.

3) PCR Amplification

The DNA obtained in the step 1) was used as a template, and primers and other reagents required for amplification were added to perform PCR amplification. Refer to Table 2 and Table 3 for specific primers and amplification systems.

(1) Primer Design

The designed primer was as follows:

TABLE 2
Universal primers
for DNA barcode gene trnL-trnF
Primer SEQ Primer sequence
name ID NO (5′ to 3′)
trnL-trnF-F 35 ATCGGTATCTAATGAATTCAATG
trnL-trnF-R 36 CCCATACAAATTAATCATGTGCC

(2) PCR Reaction System

The genomic DNAs of the test material were amplified by PCR with the above primers. The amplification system was shown in Table 3.

TABLE 3
DNA barcode reaction system
Amplification system 50 ul system
PCR-Grade Water 15.0 ul
2X Ex taq Buffer (takara) 25.0 μl
dNTP Mix (10 mM) 1.0 μl
Ex taq (takara) 1.0 μl
DNA 5.0 μl
primer F (10X) 1.5 μl
primer R (10X) 1.5 μl

The PCR reaction procedure: i) pre-denaturizing at 94° C. for 2 minutes; ii) denaturizing at 94° C. for 30 s, annealing at 55° C. for 30 s (the annealing temperature can be adjusted within the range of 58-60° C.), extending at 72° C. for 2 min, 35 cycles of denaturizing, annealing and extending; iii) preservation at 72° C. for 2 min; iv) storing at 4° C. Performed detection of PCR product by 1.0% agarose gel electrophoresis, and observed the amplification results under a UV gel imaging system. Taking the PCR products of Mansheng Lycium chinensis, Dahuangguo and Zibing as examples, results are shown in FIG. 2. According to the position of DNA Marker corresponding to the trnL-trnF sequence, the total length of the trnL-trnF sequence is about 1200 bp.

4) PCR Product Cloning:

The target band was recovered with AxyPrep DNA gel recovery kit, and detected by 1.2% agarose gel electrophoresis. The purified target DNA was used as a sequencing template. The recovered product was ligated to the T vector (pGEM-T) using Lethal Based Simple Fast Cloning Kit, then transferred to E. coli DH5a for culture. The blue-white spot screening method was used to screen positive colonies and PCR detection of colonies was carried out. The amplification results were observed under a UV gel imaging system. Taken Xiaomaye Lycium chinensis (No. 32) as an example, as shown in FIG. 3, the trnL-trnF gene had good amplification results, with clear bands and obvious cloning results.

5) Sequencing and Analysis:

The DNA sequencing of the screened bacteria liquid with positive colonies was performed, and the homology sequences alignment was performed with the published sequence in NCBI (National Center for Biotechnology Information) database. The Clustal X program was used to align the Lycium chinensis DNA barcode gene sequence, respectively. The operations were as follows:

after performing PCR detection on positive colonies, the colonies containing target fragments were cultured in LB liquid medium, and 3 colonies were selected for each material and sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing, to obtain 34 parts of trnL-trnF sequence.

The obtained DNA barcode gene sequence was aligned with the published sequence in the NCBI database for homology. The Clustal X program was used to align the Lycium chinensis DNA barcode gene sequence respectively, and the primer area was removed. The phylogenetic analysis software MEGA7.0 was used to conduct analysis, the obtained trnL-trnF sequence had a total length of 1156 bp, 1138 conservative sites, accounting for 98.4%, and 18 variation sites, accounting for 1.6%, including 9 information sites and 9 singleton sites. The base transition and transversion value is 1.2 and the average GC content is 35.7%.

After sequence alignment analysis, for 12 samples (Huangguobian, Heiguo Lycium chinensis, Ningnongqi-5, HZ-13-01, ZH-13-08, W-12-27, W-11-15, W-13-26, W-12-26, Zhongguo Lycium chinensis, Yunnan Lycium chinensis, Changji Lycium chinensis), a sequence segment with the length of 40 bp is inserted at 61 bp, namely, TGACATCACAACGAGATCCTAATCTCAAAACAAAAAGAAA, and a base A is deleted at 791 bp. Except for Zhongguo Lycium chinensis and Yunnan Lycium chinensis, base transitions happen at 38 bp, 44 bp, 49 bp, 50 bp, 323 bp, 569 bp, and 731 bp, and base transversions happen at 762 bp for the remaining 10 samples. In addition, 3 bases (TCT) are inserted at 45 bp for the 10 samples. Except for 4 samples of Huangguobian, Zhongguo Lycium chinensis, Yunnan Lycium chinensis, and Changji Lycium chinensis, the other 8 samples have a 24 bp sequence inserted at 487 bp, namely, GAATTGGTGTGAATCGATTCTACA. The base transitions happen at 1025 bp for Heiguo Lycium chinensis, and base transitions happen at 236 bp and 263 bp for Beifang Lycium chinensis. The base transitions happen at 253 bp and 1131 bp for Mansheng Lycium chinensis, transition from T to C. Ningqi-4 and Yuananguo Lycium chinensis have sequence deletion of 6 bp (AAGGAA) at 55 bp, and sequence deletion of 10 bp (CCGACCCCCT) at 732 bp. Xinjiang Lycium chinensis has transition from A to G at 605 bp. Ningqicai-1 has transversion of 3 bases from TAT to ATA at 1151 bp.

Through sequence alignment and clustering analysis, the phylogenetic tree is constructed as shown in FIG. 4. The clustering graph of trnL-trnF barcode sequence is divided into two branches, Zhongguo Lycium chinensis, Yunnan Lycium chinensis, space mutant of Heiguo hybrids, Huangguobian, Heiguo Lycium chinensis and Changji Lycium chinensis and Changji Lycium chinensis are clustered into one branch, among which, Zhongguo Lycium chinensis, Yunnan Lycium chinensis are separate groups, which have far genetic relationship with the other varieties. The remaining 22 germplasms are clustered together, among which Ningqi-4 and Yuanguo are clustered together, with the closest genetic relationship. According to the trnL-trnF sequence, 34 germplasm materials can be basically identified (shown in FIG. 4), and each branch obtains a bootstrap value greater than 50%. This result is consistent with the actual genetic relationship of 34 samples, indicating that trnL-trnF sequence can be used to identify Lycium chinensis varieties.

This proves that the DNA barcode provided by the present invention can be used to construct a Lycium chinensis phylogenetic tree, and then used in the study of the intraspecific and interspecific phylogeny of Lycium chinensis. It further proves the effectiveness and feasibility of the DNA barcode provided by the present invention in identification, classification and phylogenetic study of Lycium chinensis varieties. In addition, in the embodiments of the present invention, trnL-trnF barcode database is constructed based on the barcode trnL-trnF sequences. The database covers Heiguo Lycium chinensis, Huangguo Lycium chinensis, Yuanguo Lycium chinensis, Hongzhi Lycium chinensis, local varieties of Lycium barbarum, local varieties of Beifang, Xinjiang, Yunnan, Hebei, as well as hybrid populations, space mutation populations and ploidy populations, etc, all of them are representative germplasms of Lycium chinensis nationwide; Therefore, it can provide an effective basis for the classification and identification of Lycium chinensis varieties.

By performing sequence alignment of trnL-trnF sequence of the sample to be identified and the trnL-trnF barcode database of Lycium chinensis samples, the Lycium chinensis varieties can be effectively identified and their interspecific relationship can be determined. By identifying the interspecific relationship between Lycium chinensis to be tested and Lycium chinensis in the barcode database, it provides an effective basis for the classification and identification of Lycium chinensis varieties.

Experimental Example 1 Identification of Lycium chinensis Varieties Using Barcode Database

1. Sampling

Three samples of Lycium chinensis to be tested (Nos. Tianjing-3, Zhutong, Baitiao) were selected, and sequence alignment was performed with barcodes of part of Lycium chinensis samples trnL-trnF barcode database in Example 1 for identification. The Lycium chinensis variety cannot be identified by morphological methods. In this experimental example, DNA barcode based method of the present invention was used for identification.

TABLE 4
Number and origin of Lycium chinensis samples to be tested
Type of sample Origin
Tianjing-3 Hebei
Zhutong Ningxia Zhongning
(Xinyang)
Baitiao Ningxia

2. The procedures for DNA extraction and concentration detection, PCR amplification, PCR product cloning, sequence sequencing and analysis are the same as those in Example 1.

3. Analysis of Sequence Results

The sequence alignment and clustering analysis were performed by MEGA7.0 software. The phylogenetic tree was constructed using NJ method. The cluster graph of trnL-trnF barcode sequence was divided into two branches. The sample to be tested Baitiao and Yuananguo Lycium chinensis (barcode database, No. 21) were clustered together, with the closest genetic relationship, indicating that Baitiao has a closer genetic relationship with Yuananguo Lycium chinensis and Ningqi-4 (barcode database, No. 4) in the 34 trnL-trnF barcode databases, and has close genetic relationship with Ningqi-1 (barcode database, No. 1). The samples to be tested Zhutong and Tianjing-3 are separate groups. Zhutong and Ningqi-1 have close genetic relationship; Tianjing-3 and Huangguobian (barcode database, No. 9) and Heiguo (barcode database, No. 11) have close genetic relationship. The Bootstrap value of each branch is greater than 60, which has a high credibility, indicating that the barcode database constructed based on trnL-trnF barcode sequence and the method of the present invention can be used to perform classification and identification of varieties for samples from different regions.

The genetic distance calculation using MEGA7.0 and K2P model (Kimura 2-parameter model) is shown in Table 5. The minimum genetic distance between Ningqi-1 and Yuananguo Lycium chinensis is 0.00093, and the maximum genetic distance between Baitiao and Heiguo Lycium chinensis is 0.0110186.

TABLE 5
The genetic distance analysis of Lycium chinensis varieties identified by trnL-trnF
Yuanguo Heiguo
Lycium Lycium
Ningqi-1 chinensis Huangguobian chinensis Tianjing-3 Zhutong Baitiao
Ningqi-1
Yuanguo 0.000933
Lycium
chinensis
Huangguobian 0.007390 0.008446
Heiguo 0.008321 0.009392 0.000885
Lycium
chinensis
Tianjing-3 0.001842 0.002806 0.008922 0.009822
Zhutong 0.001839 0.002802 0.009250 0.010183 0.003687
Baitiao 0.001840 0.001867 0.009253 0.010186 0.003690 0.003684

Experimental Example 2 Identification of Heiguo Lycium chinensis Varieties Using Barcode Database

1. Sampling

Three samples of Lycium chinensis to be tested (Nos. B2, B3, H-13-08-05) are selected. The DNA barcode technology is used for identification in this exoerimental example, and sequence alignment is performed with barcodes of part of Lycium chinensis samples trnL-trnF barcode database in Example 1. The Lycium chinensis varieties cannot be identified by morphological methods.

TABLE 6
Number and origin of Lycium chinensis samples to be tested
Sample type Origin
B2 Qinghai
B3 Qinghai
H-13-08-05 Ningxia

2. The procedures for DNA extraction and concentration detection, PCR amplification, PCR product cloning, sequence sequencing and analysis are the same as those in Example 1.

3. Analysis of Sequence Results

The sequence alignment and clustering analysis are performed by MEGA7.0 software. The phylogenetic tree is constructed using NJ method as shown in FIG. 6. The cluster graph of trnL-trnF barcode sequence is divided into two branches. The Hongguo Lycium chinensis and Heiguo Lycium chinensis are clearly identified. Ningqi-1 and Zhongguo Lycium chinensis are clustered together, with the closest genetic relationship, belonging to Hongguo Lycium chinensis, and their bootstrap value with other six Heiguo Lycium chinensis is 100, with high degree of credibility.

Among the 6 Heiguo Lycium chinensis samples, the test samples B2 and H-13-08-05 are clustered together, with the closest genetic relationship, and their bootstrap value with Heiguo Lycium chinensis (barcode database, No. 11) is 60, with credibility. Heiguo Lycium chinensis, W-12-27 (barcode database, No. 16), test sample B3 are separate groups. The bootstrap value between the test sample B3 and W-12-27 is 63, with credibility, and the bootstrap value with Heiguo Lycium chinensis is 39, indicating that Heiguo Lycium chinensis samples that cannot be morphologically identified in different regions can be classified and identified based on the trnL-trnF barcode sequence and the barcode database constructed by the method of the present invention, but the samples have high similarity, so it is only used as preliminary identification.

The genetic distance calculation using MEGA7.0 and K2P model (Kimura 2-parameter model) is shown in Table 7. The minimum genetic distance between Ningqi-1 and Zhongguo Lycium chinensis is 0.00000, and the maximum genetic distance between Ningqi-1 and H-13-08-05 is 0.011122.

TABLE 7
Genetic distance analysis of Heiguo Lycium chinensis identified by trnL-trnF
Zhongguo Heiguo
Lycium Lycium
Ningqi-1 chinensis chinensis W-12-27 B3 B2 H-13-08-05
Ningqi-1
Zhongguo 0.000000
Lycium
chinensis
Heiguo 0.008321 0.008024
Lycium
chinensis
W-12-27 0.007390 0.007127 0.000885
B3 0.008321 0.008024 0.001771 0.000885
B2 0.009250 0.008920 0.002658 0.001771 0.002658
H-13-08-05 0.011122 0.010724 0.004441 0.003549 0.004441 0.005329

Claims

1. A DNA barcoding-based method for rapid identification of Lycium chinensis, wherein the DNA barcoding is trnL-trnF barcoding.

2. The DNA barcoding-based method for rapid identification of Lycium chinensis according to claim 1, wherein, a trnL-trnF barcode database of Lycium chinensis samples is constructed comprising 34 groups of trnL-trnF barcode, the nucleotide sequence thereof is shown in SEQ ID NO. 1-34.

3. The DNA barcoding-based method for rapid identification of Lycium chinensis according to claim 1, comprising the following steps:

1) extracting genomic DNA from Lycium chinensis samples;

2) amplifying trnL-trnF barcode sequence fragments using the genomic DNA as a template and the primers with nucleotide sequence shown in SEQ ID NO. 35 and SEQ ID NO. 36 to obtain a PCR product;

3) sequencing the PCR product; and

4) constructing a phylogenetic tree and identifying Lycium chinensis.

4. The DNA barcoding-based method for rapid identification of Lycium chinensis according to claim 3, wherein the genomic DNA is extracted using a kit in the step 1).

5. The DNA barcoding-based method for rapid identification of Lycium chinensis according to claim 3, wherein in the step 2), the PCR amplification reaction system is: i) pre-denaturizing at 94° C. for 2 min; ii) denaturizing at 94° C. for 30 s, annealing at 55° C. for 30 s, extending at 72° C. for 2 min, 35 cycles; iii) preservation at 72° C. for 2 min; and iv) storing at 4° C.; performing detection of PCR product by 1.0% agarose gel electrophoresis, and observing the amplification results under a UV gel imaging system.

6. The DNA barcoding-based method for rapid identification of Lycium chinensis according to claim 3, wherein, a trnL-trnF barcode database of Lycium chinensis samples is constructed comprising 34 groups of trnL-trnF barcode, the nucleotide sequence thereof is shown in SEQ ID NO. 1-34.

7. The DNA barcoding-based method for rapid identification of Lycium chinensis according to claim 2, wherein, a trnL-trnF barcode database of Lycium chinensis samples is constructed by the followings: analyzing the base composition of a DNA barcoding gene sequence; constructing the barcode database based on the parameters including the frequency of base variation between sequences and the frequency of transition and transversion between sequences and their ratios.

8. The DNA barcoding-based method for rapid identification of Lycium chinensis according to claim 2, wherein, obtaining the trnL-trnF sequence of the sample to be identified through genomic DNA extraction, PCR amplification and sequencing of PCR products; comparing sequence alignment of trnL-trnF sequence of the sample to be identified and the trnL-trnF barcode database of Lycium chinensis samples.

9. The DNA barcoding-based method for rapid identification of Lycium chinensis according to claim 6, wherein, obtaining the trnL-trnF sequence of the sample to be identified through genomic DNA extraction, PCR amplification and sequencing of PCR products; comparing sequence alignment of trnL-trnF sequence of the sample to be identified and the trnL-trnF barcode database of Lycium chinensis samples.