Patent application title:

PREDICTION DEVICE BASED ON INTER-ORGAN CROSS TALK SYSTEM

Publication number:

US20220076832A1

Publication date:
Application number:

17/396,165

Filed date:

2021-08-06

Abstract:

An apparatus 1 comprises a subject data obtaining unit 11 for obtaining subject data M4 of an inter-organ cross talk indicator in each organ other than a specific organ, a pattern similarity calculation unit 12 for calculating, by comparing the subject data M4 with standard data 1 of the inter-organ cross talk indicator, similarity of patterns of the inter-organ cross talk indicators, and a prediction unit 13 for predicting the presence of a specific disease and/or the stage of the specific disease by using the similarity as a measure.

Inventors:

Assignee:

Interested in similar patents?

Get notified when new applications in this technology area are published.

Classification:

A61B5/4088 »  CPC further

Measuring for diagnostic purposes ; Identification of persons; Detecting, measuring or recording for evaluating the nervous system; Diagnosing or monitoring particular conditions of the nervous system Diagnosing of monitoring cognitive diseases, e.g. Alzheimer, prion diseases or dementia

G16B25/00 »  CPC further

ICT specially adapted for hybridisation; ICT specially adapted for gene or protein expression

Y02A90/10 »  CPC further

Technologies having an indirect contribution to adaptation to climate change Information and communication technologies [ICT] supporting adaptation to climate change, e.g. for weather forecasting or climate simulation

G16H50/20 »  CPC main

ICT specially adapted for medical diagnosis, medical simulation or medical data mining; ICT specially adapted for detecting, monitoring or modelling epidemics or pandemics for computer-aided diagnosis, e.g. based on medical expert systems

A61B5/02 »  CPC further

Measuring for diagnostic purposes ; Identification of persons Detecting, measuring or recording pulse, heart rate, blood pressure or blood flow; Combined pulse/heart-rate/blood pressure determination; Evaluating a cardiovascular condition not otherwise provided for, e.g. using combinations of techniques provided for in this group with electrocardiography or electroauscultation; Heart catheters for measuring blood pressure

A61B5/00 IPC

Measuring for diagnostic purposes ; Identification of persons

C12Q1/6883 »  CPC further

Measuring or testing processes involving enzymes, nucleic acids or microorganisms ; Compositions therefor; Processes of preparing such compositions involving nucleic acids; Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material

C12Q1/6886 »  CPC further

Measuring or testing processes involving enzymes, nucleic acids or microorganisms ; Compositions therefor; Processes of preparing such compositions involving nucleic acids; Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer

G01N33/48 »  CPC further

Investigating or analysing materials by specific methods not covered by groups - Biological material, e.g. blood, urine ; Haemocytometers

G16B20/00 »  CPC further

ICT specially adapted for functional genomics or proteomics, e.g. genotype-phenotype associations

G16H50/30 »  CPC further

ICT specially adapted for medical diagnosis, medical simulation or medical data mining; ICT specially adapted for detecting, monitoring or modelling epidemics or pandemics for calculating health indices; for individual health risk assessment

G16H50/70 »  CPC further

ICT specially adapted for medical diagnosis, medical simulation or medical data mining; ICT specially adapted for detecting, monitoring or modelling epidemics or pandemics for mining of medical data, e.g. analysing previous cases of other patients

G01N33/50 »  CPC further

Investigating or analysing materials by specific methods not covered by groups -; Biological material, e.g. blood, urine ; Haemocytometers Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing

Description

TECHNICAL FIELD

The present invention relates to an apparatus and a program for predicting the presence of a disease in a specific organ and/or the stage of the disease in a subject. The present invention also relates to an apparatus and a program for predicting the presence of a disease and/or the stage of the disease in each organ other than a specific organ in a subject affected with a disease in the specific organ.

BACKGROUND ART

Diseases include those in a state that can be reversibly treated and those in a state that cannot, i.e., those in an irreversible state. Early detection and treatment of abnormalities during a reversible state, or preventing such a state from occurring, is essential for health maintenance. Even in a reversible state, early detection of disease directly leads to milder treatment, a shorter treatment period, and better prognostic health. As in heart disease, brain disease, cancer, and diabetes, it is well known that abnormalities in one organ or tissue lead to a disease state in other organs (commonly called “complication”). In such diseases, it is essential to prevent abnormalities in one organ or tissue from causing disease in other organs or tissue at the earliest possible time.

In all animals, including humans, each organ and tissue form a functional network, rather than serving as separate parts, and quality control at the individual level is achieved. Transport of endocrine factors, such as hormones, by the vascular network throughout the whole body and coordinated adjustment of organ functions by the neural network are typical examples of an “inter-organ cross talk system,” and systematized as physiology or endocrinology.

In the field of pharmaceuticals, the probability that a drug will be approved through the phase III clinical trial from the new drug discovery phase is currently about 1.6%. In other words, 98.4% of drugs developed as candidates in the discovery phase do not see the light of day. This is mainly because of, for example, the following: cases in which no effect is observed in a living organism (animal model) when a drug confirmed to be effective at the cellular level is administered to the living organism; cases in which the effect of a drug is observed in cells and an animal model, but the drug exhibits no notable effect in humans; and cases in which a test drug cannot be used because of a strong side effect (or side effects), although the effect of the test drug is observed in a living organism (animal model and human). Thus, “drug revival” or “discovering other new uses” (commonly called “drug repositioning”) of a large number of drugs that drop out during the period from research and development to practical use is believed to greatly contribute to medical and economic development.

More than half of the drugs selected in the discovery phase exhibit effects in cells. One of the causes of dropout of drugs in more advanced phases is the “inter-organ cross talk system network,” which is uniquely present in living organisms. Each organ constructed with cells having a variety of functions forms the inter-organ cross talk system in vivo, thereby establishing homeostasis and physiological functions in the whole individual. Accordingly, if an abnormality occurs in one organ (disease), the abnormal signal is propagated to other organs via the inter-organ cross talk system, and the entire network of the inter-organ cross talk system changes; even if only a kind of cells in the organ that first showed an abnormality are targeted with a drug (PTL 1 to 8), the entire network of the inter-organ cross talk system cannot be returned to its original state.

CITATION LIST

Patent Literature

PTL 1: JP2005-508505A

PTL 2: JP2008-518626A

PTL 3: JP2002-516107A

PTL 4: JP2005-518810A

PTL 5: JP2007-521799A

PTL 6: JP2013-538565A

PTL 7: JP2013-541323A

PTL 8: WO2003/085548

SUMMARY OF INVENTION

Technical Problem

An object of the present invention is to provide an apparatus and a program for detecting, from cells or tissue of one organ, a disease in another organ at the earliest possible time. More specifically, an object of the present invention is to predict the presence of a disease in a specific organ and/or the stage of the disease from an inter-organ cross talk indicator derived from one or more organs other than the specific organ. Another object of the present invention is to predict the presence of a disease and/or the stage of the disease in each of one or more organs other than a specific organ from the disease state of the specific organ.

Further, another object of the present invention is to predict the effect of a test substance from an inter-organ cross talk indicator.

Solution to Problem

The present inventor focused on the inter-organ cross talk system to achieve the above objects. The inventor conducted extensive research and found that it is possible to provide an apparatus and a program for diagnosing, from measurement of the state of an organ, the current state of one or more other organs and for predicting a future state by using the inter-organ cross talk system.

Further, the inventor found that the efficacy and side effect (or side effects) of a test substance can be predicted comprehensively and quantitatively by measuring and evaluating an inter-organ cross talk indicator in an individual to which the test substance has been administered.

The present invention has been accomplished based on these findings and includes the following embodiments.

Item 1

An apparatus for predicting the presence of a disease in a specific organ (hereinafter referred to as “specific disease”) and/or the stage of the specific disease in a subject, the apparatus comprising the following computation means:

a means for obtaining data of the subject regarding an inter-organ cross talk indicator in each of one or more organs other than the specific organ, the inter-organ cross talk indicator being derived from cells or tissue originating from each of the one or more organs;

a means for calculating, by comparing the data of the subject obtained by the subject data obtaining means with predetermined standard data 1 of the corresponding inter-organ cross talk indicator, similarity of patterns of the inter-organ cross talk indicators between the data of the subject and the standard data 1; and

a means for predicting the presence of the specific disease and/or the stage of the specific disease by using, as a measure, the similarity of patterns of the inter-organ cross talk indicators calculated by the pattern similarity calculation means,

wherein the data of the subject is a pattern of the inter-organ cross talk indicator representing a relationship between an amount of the inter-organ cross talk indicator in the organ other than the specific organ of the subject (hereinafter referred to as “subject amount”) and an amount of the corresponding inter-organ cross talk indicator in the same organ as the organ other than the specific organ in a negative control (or negative controls) without the specific disease (hereinafter referred to as “negative control amount”), and

the standard data 1 includes patterns of inter-organ cross talk indicators, each of the patterns being derived from a predetermined relationship between an amount of an inter-organ cross talk indicator in the organ other than the specific organ in a positive control (or positive controls) affected with the specific disease (hereinafter referred to as “positive control amount 1”) and an amount of the corresponding inter-organ cross talk indicator in the same organ as the organ other than the specific organ in the negative control (or negative controls) without the specific disease (hereinafter referred to as “negative control amount 1”).

Item 1-1

An apparatus for predicting the presence of a disease in a specific organ (hereinafter referred to as “specific disease”) and/or the stage of the specific disease in a subject, the apparatus comprising the following computation means:

a means for obtaining data A of the subject regarding an inter-organ cross talk indicator in each of one or more organs other than the specific organ, the inter-organ cross talk indicator being derived from cells or tissue originating from each of the one or more organs;

a means for calculating, by comparing the data A of the subject obtained by the subject data obtaining means with predetermined standard data 1a of the corresponding inter-organ cross talk indicator, similarity of patterns of the inter-organ cross talk indicators between the data A of the subject and the standard data 1a; and

a means for predicting the presence of the specific disease and/or the stage of the specific disease by using, as a measure, the similarity of patterns of the inter-organ cross talk indicators calculated by the pattern similarity calculation means,

wherein the inter-organ cross talk indicator comprises RNA,

the data A of the subject is a pattern of expression of the RNA indicated by a ratio between an expression level of the RNA in the organ other than the specific organ of the subject and an expression level of the corresponding RNA in the same organ as the organ other than the specific organ in a negative control (or negative controls) without the specific disease, and

the standard data 1a includes patterns of expression of the RNA, each of the patterns being derived from a predetermined ratio between an expression level of the RNA in the organ other than the specific organ in a positive control (or positive controls) affected with the specific disease and an expression level of the corresponding RNA in the same organ as the organ other than the specific organ in the negative control (or negative controls) without the specific disease.

Item 1-2

An apparatus for predicting the presence of a disease in a specific organ (hereinafter referred to as “specific disease”) and/or the stage of the specific disease in a subject, the apparatus comprising the following computation means:

a means for obtaining data B of the subject regarding an inter-organ cross talk indicator in each of one or more organs other than the specific organ, the inter-organ cross talk indicator being derived from cells or tissue originating from each of the one or more organs;

a means for calculating, by comparing the data B of the subject obtained by the subject data obtaining means with predetermined standard data 1b of the corresponding inter-organ cross talk indicator, similarity of patterns of the inter-organ cross talk indicators between the data B of the subject and the standard data 1b; and

a means for predicting the presence of the specific disease and/or the stage of the specific disease by using, as a measure, the similarity of patterns of the inter-organ cross talk indicators calculated by the pattern similarity calculation means,

wherein the inter-organ cross talk indicator comprises metabolites,

the data B of the subject is a pattern of presence of the metabolites indicated by ratios between amounts of the metabolites in the organ other than the specific organ of the subject and amounts of the corresponding metabolites in the same organ as the organ other than the specific organ in a negative control (or negative controls) without the specific disease, and the standard data 1b includes patterns of presence of the metabolites, each of the patterns being derived from predetermined ratios between amounts of the metabolites in the organ other than the specific organ in a positive control (or positive controls) affected with the specific disease and amounts of the corresponding metabolites in the same organ as the organ other than the specific organ in the negative control (or negative controls) without the specific disease.

Item 1-3

The apparatus according to any one of Items 1, 1-1, and 1-2, wherein the one or more organs other than the specific organ are one or more organs other than blood.

Item 2

The apparatus according to Item 1, wherein the inter-organ cross talk indicator comprises RNA.

Item 3

The apparatus according to Item 1 or 2, wherein the inter-organ cross talk indicator comprises metabolites.

Item 4

The apparatus according to any one of Items 1, 2, and 3, wherein the relationship between the positive control (or positive controls) amount 1 and the negative control amount 1 in the standard data 1 set forth in Item 1 is a ratio between the positive control amount 1 and the negative control amount 1.

Item 4-1

The apparatus according to any one of Items 1, 2, 3, and 4, wherein the relationship between the subject amount and the negative control amount in the data of the subject set forth in Item 1 is a ratio between the subject amount and the negative control amount.

Item 5

The apparatus according to any one of Items 1, 1-1, 1-2, 2 to 4, and 4-1, wherein the specific organ is the heart, and the specific disease is myocardial infarction.

Item 5-1

The apparatus according to Item 5, wherein, when the inter-organ cross talk indicator comprises RNA, the RNA is expressed from genes described in FIG. 25 or 26.

Item 5-2

The apparatus according to Item 5, wherein, when the inter-organ cross talk indicator comprises metabolites, the metabolites are listed in FIG. 27.

Item 6

The apparatus according to any one of Items 1, 1-1, 1-2, 2 to 4, and 4-1, wherein the specific organ is the brain, and the specific disease is dementia.

Item 6-1

The apparatus according to Item 6, wherein, when the inter-organ cross talk indicator comprises RNA, the RNA is expressed from genes listed in FIG. 25 or 26.

Item 6-2

The apparatus according to Item 6, wherein, when the inter-organ cross talk indicator comprises metabolites, the metabolites are listed in FIG. 27.

Item 7

The apparatus according to any one of Items 1, 1-1, 1-2, 2 to 4, and 4-1, wherein the specific disease is a tumor.

Item 7-1

The apparatus according to Item 7, wherein, when the inter-organ cross talk indicator comprises RNA, the RNA is expressed from genes listed in FIG. 25 or 26.

Item 7-2

The apparatus according to Item 7, wherein, when the inter-organ cross talk indicator comprises metabolites, the metabolites are listed in FIG. 27.

Item 8

A program that, when executed by a computer, causes the computer to carry out the following processing to predict the presence of a disease in a specific organ (hereinafter referred to as “specific disease”) and/or the stage of the specific disease in a subject:

processing of obtaining data of the subject regarding an inter-organ cross talk indicator in each of one or more organs other than the specific organ, the inter-organ cross talk indicator being derived from cells or tissue originating from each of the one or more organs;

processing of calculating, by comparing the data of the subject obtained by the subject data obtaining processing with predetermined standard data 1 of the corresponding inter-organ cross talk indicator, similarity of patterns of the inter-organ cross talk indicators between the data of the subject and the standard data 1; and

processing of predicting the presence of the specific disease and/or the stage of the specific disease by using, as a measure, the similarity of patterns of the inter-organ cross talk indicators calculated by the pattern similarity calculation processing,

wherein the data of the subject is a pattern of the inter-organ cross talk indicator representing a relationship between an amount of the inter-organ cross talk indicator in the organ other than the specific organ of the subject (hereinafter referred to as “subject amount”) and an amount of the corresponding inter-organ cross talk indicator in the same organ as the organ other than the specific organ in a negative control (or negative controls) without the specific disease (hereinafter referred to as “negative control amount”), and

the standard data 1 includes patterns of inter-organ cross talk indicators, each of the patterns being derived from a predetermined relationship between an amount of an inter-organ cross talk indicator in the organ other than the specific organ in a positive control (or positive controls) affected with the specific disease (hereinafter referred to as “positive control amount 1”) and an amount of the corresponding inter-organ cross talk indicator in the same organ as the organ other than the specific organ in the negative control (or negative controls) without the specific disease (hereinafter referred to as “negative control amount 1”).

Item 8-1

A program that, when executed by a computer, causes the computer to carry out the following processing to predict the presence of a disease in a specific organ (hereinafter referred to as “specific disease”) and/or the stage of the specific disease in a subject:

processing of obtaining data A of the subject regarding an inter-organ cross talk indicator in each of one or more organs other than the specific organ, the inter-organ cross talk indicator being derived from cells or tissue originating from each of the one or more organs;

processing of calculating, by comparing the data A of the subject obtained by the subject data obtaining processing with predetermined standard data 1a of the corresponding inter-organ cross talk indicator, similarity of patterns of the inter-organ cross talk indicators between the data A of the subject and the standard data 1a; and

processing of predicting the presence of the specific disease and/or the stage of the specific disease by using, as a measure, the similarity of patterns of the inter-organ cross talk indicators calculated by the pattern similarity calculation processing,

wherein the inter-organ cross talk indicator comprises RNA,

the data A of the subject is a pattern of expression of the RNA indicated by a ratio between an expression level of the RNA in the organ other than the specific organ of the subject and an expression level of the corresponding RNA in the same organ as the organ other than the specific organ in a negative control (or negative controls) without the specific disease, and

the standard data 1a includes patterns of expression of the RNA, each of the patterns being derived from a predetermined ratio between an expression level of the RNA in the organ other than the specific organ in a positive control (or positive controls) affected with the specific disease and an expression level of the corresponding RNA in the same organ as the organ other than the specific organ in the negative control (or negative controls) without the specific disease.

Item 8-2

A program that, when executed by a computer, causes the computer to carry out the following processing to predict the presence of a disease in a specific organ (hereinafter referred to as “specific disease”) and/or the stage of the specific disease in a subject:

processing of obtaining data B of the subject regarding an inter-organ cross talk indicator in each of one or more organs other than the specific organ, the inter-organ cross talk indicator being derived from cells or tissue originating from each of the one or more organs;

processing of calculating, by comparing the data B of the subject obtained by the subject data obtaining processing with predetermined standard data 1b of the corresponding inter-organ cross talk indicator, similarity of patterns of the inter-organ cross talk indicators between the data B of the subject and the standard data 1b; and

processing of predicting the presence of the specific disease and/or the stage of the specific disease by using, as a measure, the similarity of patterns of the inter-organ cross talk indicators calculated by the pattern similarity calculation processing,

wherein the inter-organ cross talk indicator comprises metabolites,

the data B of the subject is a pattern of presence of the metabolites indicated by ratios between amounts of the metabolites in the organ other than the specific organ of the subject and amounts of the corresponding metabolites in the same organ as the organ other than the specific organ in a negative control (or negative controls) without the specific disease, and

the standard data 1b includes patterns of presence of the metabolites, each of the patterns being derived from predetermined ratios between amounts of the metabolites in the organ other than the specific organ in a positive control (or positive controls) affected with the specific disease and amounts of the corresponding metabolites in the same organ as the organ other than the specific organ in the negative control (or negative controls) without the specific disease.

Item 8-3

A program for causing a computer to function as the subject data obtaining means, the pattern similarity calculation means, and the prediction means according to any one of Items 1 to 4 and 4-1.

Item 8-4

The program according to any one of Items 8, 8-1, 8-2, and 8-3, wherein the one or more organs other than the specific organ are one or more organs other than blood.

Item 9

The program according to Item 8, wherein the inter-organ cross talk indicator comprises RNA.

Item 10

The program according to Item 8 or 9, wherein the inter-organ cross talk indicator comprises metabolites.

Item 11

The program according to any one of Items 8, 9, and 10, wherein the relationship between the positive control amount 1 and the negative control amount 1 in the standard data 1 set forth in Item 8 is a ratio between the positive control amount and the negative control amount.

Item 11-1

The program according to any one of Items 8, 9, 10, and 11, wherein the relationship between the subject amount and the negative control amount in the data of the subject set forth in Item 8 is a ratio between the subject amount and the negative control amount.

Item 12

The program according to any one of Items 8, 8-1, 8-2, 9 to 11, and 11-1, wherein the specific organ is the heart, and the specific disease is myocardial infarction.

Item 12-1

The program according to Item 12, wherein, when the inter-organ cross talk indicator comprises RNA, the RNA is RNA expressed from genes listed in FIG. 25 or 26.

Item 12-2

The program according to Item 12, wherein, when the inter-organ cross talk indicator comprises metabolites, the metabolites are listed in FIG. 27.

Item 13

The program according to any one of Items 8, 8-1, 8-2, 9 to 11, and 11-1, wherein the specific organ is the brain, and the specific disease is dementia.

Item 13-1

The program according to Item 13, wherein, when the inter-organ cross talk indicator comprises RNA, the RNA is expressed from genes listed in FIG. 25 or 26.

Item 13-2

The program according to Item 13, wherein, when the inter-organ cross talk indicator comprises metabolites, the metabolites are listed in FIG. 27.

Item 14

The program according to any one of Items 8, 8-1, 8-2, 9 to 11, and 11-1, wherein the specific disease is a tumor.

Item 14-1

The program according to Item 14, wherein, when the inter-organ cross talk indicator comprises RNA, the RNA is RNA expressed from genes listed in FIG. 25 or 26.

Item 14-2

The program according to Item 14, wherein, when the inter-organ cross talk indicator comprises metabolites, the metabolites are listed in FIG. 27.

Item 15

A method for predicting the presence of a disease in a specific organ (hereinafter referred to as “specific disease”) and/or the stage of the specific disease in a subject, the method comprising the steps of:

(1) calculating, by comparing data of the subject regarding an inter-organ cross talk indicator in each of one or more organs other than the specific organ derived from cells or tissue originating from each of the one or more organs with predetermined standard data 1 of the corresponding inter-organ cross talk indicator, similarity of patterns of the inter-organ cross talk indicators between the data of the subject and the standard data 1; and

(2) determining that the subject has a specific disease corresponding to the standard data 1 when it is determined from the similarity of patterns of the inter-organ cross talk indicators calculated in step (1) that both patterns are similar, and/or

determining that the subject is in a stage of a specific disease corresponding to the standard data 1 when it is determined from the similarity of patterns of the inter-organ cross talk indicators calculated in step (1) that both patterns are similar,

wherein the data of the subject is a pattern of the inter-organ cross talk indicator representing a relationship between an amount of the inter-organ cross talk indicator in the organ other than the specific organ of the subject (hereinafter referred to as “subject amount”) and an amount of the corresponding inter-organ cross talk indicator in the same organ as the organ other than the specific organ in a negative control (or negative controls) without the specific disease (hereinafter referred to as “negative control amount”), and

the standard data 1 includes patterns of inter-organ cross talk indicators, each of the patterns being derived from a predetermined relationship between an amount of an inter-organ cross talk indicator in the organ other than the specific organ in a positive control (or positive controls) affected with the specific disease (hereinafter referred to as “positive control amount 1”) and an amount of the corresponding inter-organ cross talk indicator in the same organ as the organ other than the specific organ in the negative control (or negative controls) without the specific disease (hereinafter referred to as “negative control amount 1”).

Item 15-1

A method for predicting the presence of a disease in a specific organ (hereinafter referred to as “specific disease”) and/or the stage of the specific disease in a subject, the method comprising the steps of:

(a) calculating, by comparing data A of the subject regarding an inter-organ cross talk indicator in each of one or more organs other than the specific organ derived from cells or tissue originating from each of the one or more organs with predetermined standard data 1a of the corresponding inter-organ cross talk indicator, similarity of patterns of the inter-organ cross talk indicators between the data A of the subject and the standard data 1a; and

(b) determining that the subject has a specific disease corresponding to the standard data 1a when it is determined from the similarity of patterns of the inter-organ cross talk indicators calculated in step (a) that both patterns are similar, and/or

determining that the subject is in a stage of a specific disease corresponding to the standard data 1a when it is determined from the similarity of patterns of the inter-organ cross talk indicators calculated in step (a) that both patterns are similar,

wherein the inter-organ cross talk indicator comprises RNA,

the data A of the subject is a pattern of expression of the RNA indicated by a ratio between an expression level of the RNA in the organ other than the specific organ of the subject and an expression level of the corresponding RNA in the same organ as the organ other than the specific organ in a negative control (or negative controls) without the specific disease, and

the standard data 1a includes patterns of expression of the RNA, each of the patterns being derived from a predetermined ratio between an expression level of the RNA in the organ other than the specific organ in a positive control (or positive controls) affected with the specific disease and an expression level of the corresponding RNA in the same organ as the organ other than the specific organ in the negative control (or negative controls) without the specific disease.

Item 15-2

A method for predicting the presence of a disease in a specific organ (hereinafter referred to as “specific disease”) and/or the stage of the specific disease in a subject, the method comprising the steps of:

(a) calculating, by comparing data B of the subject regarding an inter-organ cross talk indicator in each of one or more organs other than the specific organ derived from cells or tissue originating from each of the one or more organs with predetermined standard data 1b of the corresponding inter-organ cross talk indicator, similarity of patterns of the inter-organ cross talk indicators between the data B of the subject and the standard data 1b; and

(b) determining that the subject has a specific disease corresponding to the standard data 1b when it is determined from the similarity of patterns of the inter-organ cross talk indicators calculated in step (a) that both patterns are similar, and/or

determining that the subject is in a stage of a specific disease corresponding to the standard data 1b when it is determined from the similarity of patterns of the inter-organ cross talk indicators calculated in step (a) that both patterns are similar,

wherein the inter-organ cross talk indicator comprises metabolites,

the data B of the subject is a pattern of presence of the metabolites indicated by ratios between amounts of the metabolites in the organ other than the specific organ of the subject and amounts of the corresponding metabolites in the same organ as the organ other than the specific organ in a negative control (or negative controls) without the specific disease, and

the standard data 1b includes patterns of presence of the metabolites, each of the patterns being derived from predetermined ratios between amounts of the metabolites in the organ other than the specific organ in a positive control (or positive controls) affected with the specific disease and amounts of the corresponding metabolites in the same organ as the organ other than the specific organ in the negative control (or negative controls) without the specific disease.

Item 15-3

The method according to any one of Items 15, 15-1, and 15-2, wherein the one or more organs other than the specific organ are one or more organs other than blood.

Item 16 The method according to Item 15, further comprising, before step (1), the steps of:

(i) extracting the inter-organ cross talk indicator from the cells or tissue originating from each of the one or more organs other than the specific organ of the subject;

(ii) identifying and quantifying the inter-organ cross talk indicator extracted in step (i); and

(iii) determining the data of the subject regarding the inter-organ cross talk indicator from the amount of the inter-organ cross talk indicator quantified in step (ii).

Item 16-1

The method according to Item 15-1, further comprising, before step (1), the steps of:

(i) extracting the RNA from the cells or tissue originating from each of the one or more organs other than the specific organ of the subject;

(ii) identifying expressed genes and quantifying expression levels of the genes from expression of the RNA extracted in step (i); and

(iii) determining the data A of the subject regarding the genes from the expression level of the RNA quantified in step (ii).

Item 16-2

The method according to Item 15-2, further comprising, before step (1), the steps of:

(i) extracting the metabolites from the cells or tissue originating from each of the one or more organs other than the specific organ of the subject;

(ii) identifying the metabolites extracted in step (i) and quantifying amounts of the metabolites extracted in step (i); and

(iii) determining the data B of the subject regarding the metabolites from the amounts of the metabolites quantified in step (ii).

Item 17

The method according to Item 15 or 16, wherein the inter-organ cross talk indicator comprises RNA.

Item 18

The method according to any one of Items 15, 16, and 17, wherein the inter-organ cross talk indicator comprises metabolites.

Item 19

The method according to any one of Items 15, 16, 17, and 18, wherein the relationship between the positive control amount 1 and the negative control amount 1 in the standard data 1 set forth in Item 15 is a ratio between the positive control amount 1 and the negative control amount 1.

Item 19-1

The method according to any one of Items 15, 16, 17, 18, and 19, wherein the relationship between the subject amount and the negative control amount in the data of the subject set forth in Item 15 is a ratio between the subject amount and the negative control amount.

Item 20

The method according to any one of Items 15, 15-1, 15-2, 16 to 19, and 19-1, wherein the specific organ is the heart, and the specific disease is myocardial infarction.

Item 20-1

The method according to Item 20, wherein, when the inter-organ cross talk indicator comprises RNA, the RNA is expressed from genes listed in FIG. 25 or 26.

Item 20-2

The method according to Item 20, wherein, when the inter-organ cross talk indicator comprises metabolites, the metabolites are listed in FIG. 27.

Item 21

The method according to any one of Items 15, 15-1, 15-2, 16 to 19, and 19-1, wherein the specific organ is the brain, and the specific disease is dementia.

Item 21-1 The method according to Item 21, wherein, when the inter-organ cross talk indicator comprises RNA, the RNA is expressed from genes listed in FIG. 25 or 26.

Item 21-2

The method according to Item 21, wherein, when the inter-organ cross talk indicator comprises metabolites, the metabolites are metabolites listed in FIG. 27.

Item 22

The method according to any one of Items 15, 15-1, 15-2, 16 to 19, and 19-1, wherein the specific disease is a tumor.

Item 22-1

The method according to Item 22, wherein, when the inter-organ cross talk indicator comprises RNA, the RNA is expressed from genes listed in FIG. 25 or 26.

Item 22-2 The method according to Item 22, wherein, when the inter-organ cross talk indicator comprises metabolites, the metabolites are listed in FIG. 27.

Item 23

A method for generating standard data 1 of patterns of inter-organ cross talk indicators for use in prediction of the presence of a disease in a specific organ (hereinafter referred to as “specific disease”) and/or the stage of the specific disease in a subject, the method comprising the steps of:

(A) obtaining information about an amount of an inter-organ cross talk indicator in cells or tissue originating from each of one or more organs other than the specific organ of a positive control (or positive controls) as a gold standard for each stage of the specific disease;

(B) obtaining information about an amount of the inter-organ cross talk indicator in cells or tissue originating from each of the one or more organs other than the specific organ of a negative control (or negative controls) as a gold standard;

(C) determining patterns of inter-organ cross talk indicators, each of the patterns being determined from a relationship (preferably a ratio) between the amount of the inter-organ cross talk indicator in the organ other than the specific organ of the positive control (or positive controls) affected with the specific disease obtained in step (A) and the amount of the corresponding inter-organ cross talk indicator in the same organ as the organ other than the specific organ in the negative control (or negative controls) without the specific disease obtained in step (B); and

(D) associating the patterns of the inter-organ cross talk indicators with the corresponding stages of the specific disease.

Item 23-1

The method according to Item 23, wherein step (A) comprises the steps of:

extracting an inter-organ cross talk indicator from cells or tissue originating from each of one or more organs other than the specific organ of a positive control (or positive controls) as a gold standard for each stage of the specific disease; and

identifying and quantifying the inter-organ cross talk indicator, and

step (B) comprises the steps of:

extracting the inter-organ cross talk indicator from cells or tissue originating from each of the one or more organs other than the specific organ of a negative control (or negative controls) as a gold standard; and

identifying and quantifying the inter-organ cross talk indicator.

Item 23-2

The method according to Item 23 or 23-1, wherein the inter-organ cross talk indicator comprises RNA.

Item 23-3

The method according to Item 23 or 23-1, wherein the inter-organ cross talk indicator comprises metabolites.

Item 23-4

The method according to any one of Items 23, 23-1, 23-2, and 23-3, wherein the specific organ is the heart, and the specific disease is myocardial infarction.

Item 23-4-1

The method according to Item 23-4, wherein, when the inter-organ cross talk indicator comprises RNA, the RNA is expressed from genes listed in FIG. 25 or 26.

Item 23-4-2

The method according to Item 23-4, wherein, when the inter-organ cross talk indicator comprises metabolites, the metabolites are listed in FIG. 27.

Item 23-5

The method according to any one of Items 23, 23-1, 23-2, and 23-3, wherein the specific organ is the brain, and the specific disease is dementia.

Item 23-5-1

The method according to Item 23-5, wherein, when the inter-organ cross talk indicator comprises RNA, the RNA is expressed from genes listed in FIG. 25 or 26.

Item 23-5-2

The method according to Item 23-5, wherein, when the inter-organ cross talk indicator comprises metabolites, the metabolites are listed in FIG. 27.

Item 23-6

The method according to any one of Items 23, 23-1, 23-2, and 23-3, wherein the specific disease is a tumor.

Item 23-6-1

The method according to Item 23-6, wherein, when the inter-organ cross talk indicator comprises RNA, the RNA is expressed from genes listed in FIG. 25 or 26.

Item 23-6-2

The method according to Item 23-6, wherein, when the inter-organ cross talk indicator comprises metabolites, the metabolites are listed in FIG. 27.

Item 24

Standard data 1 of patterns of inter-organ cross talk indicators generated by the method according to any one of Items 23, 23-1, 23-2, and 23-3, for use in prediction of the presence of a disease in a specific organ and/or the stage of the disease in a subject.

Item 25

An apparatus for predicting the presence of a disease and/or the stage of the disease in each of one or more organs other than a specific organ in a subject affected with a disease in the specific organ, the apparatus comprising the following computation means:

a means for obtaining information about a stage of the disease in the specific organ (hereinafter referred to as “specific disease”) in the subject;

a means for checking the information about the stage obtained by the stage information obtaining means against standard data 2;

a means for extracting a pattern of an inter-organ cross talk indicator in each of one or more organs other than the specific organ in the subject based on the results obtained by the stage information checking means; and

a means for predicting the presence of a disease and/or the stage of the disease in each of the one or more organs other than the specific organ by using, as a measure, the pattern of the inter-organ cross talk indicator obtained by the pattern extraction means;

wherein the standard data 2 includes patterns of inter-organ cross talk indicators predetermined for each stage of the specific disease, each of the patterns being derived from a predetermined relationship between an amount of an inter-organ cross talk indicator in the organ other than the specific organ in a positive control (or positive controls) affected with the specific disease (hereinafter referred to as “positive control amount 2”) and an amount of the corresponding inter-organ cross talk indicator in the same organ as the organ other than the specific organ in a negative control (or negative controls) without the specific disease (hereinafter referred to as “negative control amount 2”).

Item 25-1

An apparatus for predicting the presence of a disease and/or the stage of the disease in each of one or more organs other than a specific organ in a subject affected with a disease in the specific organ, the apparatus comprising the following computation means:

a means for obtaining information about a stage of the disease in the specific organ (hereinafter referred to as “specific disease”) in the subject;

a means for checking the information about the stage obtained by the stage information obtaining means against standard data 2a;

a means for extracting a pattern of an inter-organ cross talk indicator in each of one or more organs other than the specific organ in the subject based on the results obtained by the stage information checking means; and

a means for predicting the presence of a disease and/or the stage of the disease in each of the one or more organs other than the specific organ by using, as a measure, the pattern of the inter-organ cross talk indicator obtained by the pattern extraction means;

wherein the inter-organ cross talk indicator comprises RNA, and

the standard data 2a includes patterns of expression of the RNA predetermined for each stage of the specific disease, each of the patterns being derived from a predetermined ratio between an expression level of the RNA in the organ other than the specific organ in a positive control (or positive controls) affected with the specific disease and an expression level of the corresponding RNA in the same organ as the organ other than the specific organ in a negative control (or negative controls) without the specific disease.

Item 25-2

An apparatus for predicting the presence of a disease and/or the stage of the disease in each of one or more organs other than a specific organ in a subject affected with a disease in the specific organ, the apparatus comprising the following computation means:

a means for obtaining information about a stage of the disease in the specific organ (hereinafter referred to as “specific disease”) in the subject;

a means for checking the information about the stage obtained by the stage information obtaining means against standard data 2b;

a means for extracting a pattern of an inter-organ cross talk indicator in each of one or more organs other than the specific organ in the subject based on the results obtained by the stage information checking means; and

a means for predicting the presence of a disease and/or the stage of the disease in each of the one or more organs other than the specific organ by using, as a measure, the pattern of the inter-organ cross talk indicator obtained by the pattern extraction means;

wherein the inter-organ cross talk indicator comprises metabolites, and

the standard data 2b includes patterns of presence of the metabolites predetermined for each stage of the specific disease, each of the patterns being derived from predetermined ratios between amounts of the metabolites in the organ other than the specific organ in a positive control (or positive controls) affected with the specific disease and amounts of the corresponding metabolites in the same organ as the organ other than the specific organ in a negative control (or negative controls) without the specific disease.

Item 26

The apparatus according to Item 25, wherein the inter-organ cross talk indicator comprises RNA.

Item 27

The apparatus according to Item 25 or 26, wherein the inter-organ cross talk indicator comprises metabolites.

Item 28

The apparatus according to any one of Items 25 to 27, wherein the relationship between the positive control amount 2 and the negative control amount 2 in the standard data 2 set forth in Item 25 is a ratio between the positive control amount 2 and the negative control amount 2.

Item 29

The apparatus according to any one of Items 25, 25-1, 25-2, and 26 to 28, wherein the specific organ is the heart, and the specific disease is myocardial infarction.

Item 29-1

The apparatus according to Item 29, wherein, when the inter-organ cross talk indicator comprises RNA, the RNA is expressed from genes listed in FIG. 25 or 26.

Item 29-2

The apparatus according to Item 29, wherein, when the inter-organ cross talk indicator comprises metabolites, the metabolites are listed in FIG. 27.

Item 30

The apparatus according to any one of Items 25, 25-1, 25-2, and 26 to 28, wherein the specific organ is the brain, and the specific disease is dementia.

Item 30-1

The apparatus according to Item 30, wherein, when the inter-organ cross talk indicator comprises RNA, the RNA is expressed from genes listed in FIG. 25 or 26.

Item 30-2

The apparatus according to Item 30, wherein, when the inter-organ cross talk indicator comprises metabolites, the metabolites are listed in FIG. 27.

Item 31

The apparatus according to any one of Items 25, 25-1, 25-2, and 26 to 28, wherein the specific disease is a tumor.

Item 31-1

The apparatus according to Item 31, wherein, when the inter-organ cross talk indicator comprises RNA, the RNA is expressed from genes listed in FIG. 25 or 26.

Item 31-2

The apparatus according to Item 31, wherein, when the inter-organ cross talk indicator comprises metabolites, the metabolites are listed in FIG. 27.

Item 32

A program that, when executed by a computer, causes the computer to carry out the following processing to predict the presence of a disease and/or the stage of the disease in each of one or more organs other than a specific organ in a subject affected with a disease in the specific organ:

processing of obtaining information about a stage of the disease in the specific organ (hereinafter referred to as “specific disease”) in the subject;

processing of checking the information about the stage obtained by the stage information obtaining processing against standard data 2;

processing of extracting a pattern of an inter-organ cross talk indicator in each of one or more organs other than the specific organ in the subject based on the results obtained by the stage information checking processing; and

processing of predicting the presence of a disease and/or the stage of the disease in each of the one or more organs other than the specific organ by using, as a measure, the pattern of the inter-organ cross talk indicator obtained by the pattern extraction processing,

wherein the standard data 2 includes patterns of inter-organ cross talk indicators predetermined for each stage of the specific disease, each of the patterns being derived from a predetermined relationship between an amount of an inter-organ cross talk indicator in the organ other than the specific organ in a positive control (or positive controls) affected with the specific disease (hereinafter referred to as “positive control amount 2”) and an amount of the corresponding inter-organ cross talk indicator in the same organ as the organ other than the specific organ in a negative control (or negative controls) without the specific disease (hereinafter referred to as “negative control amount 2”).

Item 32-1

A program that, when executed by a computer, causes the computer to carry out the following computation processing to predict the presence of a disease and/or the stage of the disease in each of one or more organs other than a specific organ in a subject affected with a disease in the specific organ:

processing of obtaining information about a stage of the disease in the specific organ (hereinafter referred to as “specific disease”) in the subject;

processing of checking the information about the stage obtained by the stage information obtaining processing against standard data 2a;

processing of extracting a pattern of an inter-organ cross talk indicator in each of one or more organs other than the specific organ in the subject based on the results obtained by the stage information checking processing; and

processing of predicting the presence of a disease and/or the stage of the disease in each of the one or more organs other than the specific organ by using, as a measure, the pattern of the inter-organ cross talk indicator obtained by the pattern extraction processing,

wherein the inter-organ cross talk indicator comprises RNA, and

the standard data 2a includes patterns of expression of the RNA predetermined for each stage of the specific disease, each of the patterns being derived from a predetermined ratio between an expression level of the RNA in the organ other than the specific organ in a positive control (or positive controls) affected with the specific disease and an expression level of the corresponding RNA in the same organ as the organ other than the specific organ in a negative control (or negative controls) without the specific disease.

Item 32-2

A program that, when executed by a computer, causes the computer to carry out the following computation processing to predict the presence of a disease and/or the stage of the disease in each of one or more organs other than a specific organ in a subject affected with a disease in the specific organ:

processing of obtaining information about a stage of the disease in the specific organ (hereinafter referred to as “specific disease”) in the subject;

processing of checking the information about the stage obtained by the stage information obtaining processing against standard data 2b;

processing of extracting a pattern of an inter-organ cross talk indicator in each of one or more organs other than the specific organ in the subject based on the results obtained by the stage information checking processing; and

processing of predicting the presence of a disease and/or the stage of the disease in each of the one or more organs other than the specific organ by using, as a measure, the pattern of the inter-organ cross talk indicator obtained by the pattern extraction processing,

wherein the inter-organ cross talk indicator comprises metabolites, and

the standard data 2b includes patterns of presence of the metabolites predetermined for each stage of the specific disease, each of the patterns being derived from predetermined ratios between amounts of the metabolites in the organ other than the specific organ in a positive control (or positive controls) affected with the specific disease and amounts of the corresponding metabolites in the same organ as the organ other than the specific organ in a negative control (or negative controls) without the specific disease.

Item 32-3

A program for causing a computer to function as the stage information obtaining means, the stage information checking means, the pattern extraction means, and the prediction means according to any one of Items 25 to 28.

Item 33

The program according to Item 32, wherein the inter-organ cross talk indicator comprises RNA.

Item 34

The program according to Item 32 or 33, wherein the inter-organ cross talk indicator comprises metabolites.

Item 35

The program according to any one of Items 32, 33, and 34, wherein the relationship between the positive control amount 2 and the negative control amount 2 in the standard data 2 set forth in Item 32 is a ratio between the positive control amount 2 and the negative control amount 2.

Item 36

The program according to any one of Items 32, 32-1, 32-2, and 33 to 35, wherein the specific organ is the heart, and the specific disease is myocardial infarction.

Item 36-1

The program according to Item 36, wherein, when the inter-organ cross talk indicator comprises RNA, the RNA is expressed from genes listed in FIG. 25 or 26.

Item 36-2

The program according to Item 36, wherein, when the inter-organ cross talk indicator comprises metabolites, the metabolites are listed in FIG. 27.

Item 37

The program according to any one of Items 32, 32-1, 32-2, and 33 to 35, wherein the specific organ is the brain, and the specific disease is dementia.

Item 37-1

The program according to Item 37, wherein, when the inter-organ cross talk indicator comprises RNA, the RNA is expressed from genes listed in FIG. 25 or 26.

Item 37-2

The program according to Item 37, wherein, when the inter-organ cross talk indicator comprises metabolites, the metabolites are listed in FIG. 27.

Item 38

The program according to any one of Items 32, 32-1, 32-2, and 33 to 35, wherein the specific disease is a tumor.

Item 38-1

The program according to Item 38, wherein, when the inter-organ cross talk indicator comprises RNA, the RNA is expressed from genes listed in FIG. 25 or 26.

Item 38-2

The program according to Item 38, wherein, when the inter-organ cross talk indicator comprises metabolites, the metabolites are listed in FIG. 27.

Item 39

A method for predicting the presence of a disease and/or the stage of the disease in each of one or more organs other than a specific organ in a subject affected with a disease in the specific organ, the method comprising the steps of:

(i) obtaining information about a stage of the disease in the specific organ (hereinafter referred to as “specific disease”) in the subject from diagnostic results of the subject;

(ii) checking the information about the stage obtained in step (i) against standard data 2;

(iii) determining, from the standard data 2, standard data α at a stage of the specific disease corresponding to the information about the stage, based on the checking results obtained in step (ii), and extracting, from the standard data α, a pattern of an inter-organ cross talk indicator corresponding to the stage in the subject in each of one or more organs other than the specific organ in the subject;

(iv) checking the pattern of the inter-organ cross talk indicator extracted in step (iii) against known information about inter-organ cross talk indicators in diseases and/or stages of the diseases, and determining the presence of a disease and/or the stage of the disease in each of the one or more organs other than the specific organ corresponding to the pattern of the inter-organ cross talk indicator in each of the one or more organs other than the specific organ in the subject; and

(v) further determining that the disease in each of the one or more organs other than the specific organ determined in step (iv) is a disease from which the subject may be suffering, and/or

further determining that the stage of the disease in each of the one or more organs other than the specific organ determined in step (iv) is a stage of a disease from which the subject is suffering,

wherein the standard data 2 includes patterns of inter-organ cross talk indicators predetermined for each stage of the specific disease, each of the patterns being derived from a predetermined relationship between an amount of an inter-organ cross talk indicator in the organ other than the specific organ in a positive control (or positive controls) affected with the specific disease (hereinafter referred to as “positive control amount 2”) and an amount of the corresponding inter-organ cross talk indicator in the same organ as the organ other than the specific organ in a negative control (or negative controls) without the specific disease (hereinafter referred to as “negative control amount 2”).

Item 39-1

A method for predicting the presence of a disease and/or the stage of the disease in each of one or more organs other than a specific organ in a subject affected with a disease in the specific organ, the method comprising the steps of:

(a) obtaining information about a stage of the specific disease in the subject from diagnostic results of the subject;

(b) checking the information about the stage obtained in step (a) against standard data 2a;

(c) determining, from the standard data 2a, standard data α1 at a stage of the specific disease corresponding to the information about the stage, based on the checking results obtained in step (b), and extracting, from the standard data α1, a pattern of an inter-organ cross talk indicator corresponding to the stage in the subject in each of one or more organs other than the specific organ in the subject;

(d) checking the pattern of the inter-organ cross talk indicator extracted in step (c) against known information about inter-organ cross talk indicators in diseases and/or stages of the diseases, and determining the presence of a disease and/or the stage of the disease in each of the one or more organs other than the specific organ corresponding to the pattern of the inter-organ cross talk indicator in each of the one or more organs other than the specific organ in the subject; and

(e) further determining that the disease in each of the one or more organs other than the specific organ determined in step (d) is a disease from which the subject may be suffering, and/or

further determining that the stage of the disease in each of the one or more organs other than the specific organ determined in step (d) is a stage of a disease from which the subject is suffering,

wherein the inter-organ cross talk indicator comprises RNA, and

the standard data 2a includes patterns of expression of the RNA predetermined for each stage of the specific disease, each of the patterns being derived from a predetermined ratio between an expression level of the RNA in the organ other than the specific organ in a positive control (or positive controls) affected with the specific disease and an expression level of the corresponding RNA in the same organ as the organ other than the specific organ in a negative control (or negative controls) without the specific disease.

Item 39-2

A method for predicting the presence of a disease and/or the stage of the disease in each of one or more organs other than a specific organ in a subject affected with a disease in the specific organ, the method comprising the steps of:

(a) obtaining information about a stage of the disease in the specific organ (hereinafter referred to as “specific disease”) in the subject from diagnostic results of the subject;

(b) checking the information about the stage obtained in step (a) against standard data 2b;

(c) determining, from the standard data 2b, standard data α2 at a stage of the specific disease corresponding to the information about the stage, based on the checking results obtained in step (b), and extracting, from the standard data α2, a pattern of an inter-organ cross talk indicator corresponding to the stage in the subject in each of one or more organs other than the specific organ in the subject;

(d) checking the pattern of the inter-organ cross talk indicator extracted in step (c) against known information about inter-organ cross talk indicators in diseases and/or stages of the diseases, and determining the presence of a disease and/or the stage of the disease in each of the one or more organs other than the specific organ corresponding to the pattern of the inter-organ cross talk indicator in each of the one or more organs other than the specific organ in the subject; and

(e) further determining that the disease in each of the one or more organs other than the specific organ determined in step (d) is a disease from which the subject may be suffering, and/or

further determining that the stage of the disease in each of the one or more organs other than the specific organ determined in step (d) is a stage of a disease from which the subject is suffering,

wherein the inter-organ cross talk indicator comprises metabolites, and

the standard data 2b includes patterns of presence of the metabolites predetermined for each stage of the specific disease, each of the patterns being derived from predetermined ratios between amounts of the metabolites in the organ other than the specific organ in a positive control (or positive controls) affected with the specific disease and amounts of the corresponding metabolites in the same organ as the organ other than the specific organ in a negative control (or negative controls) without the specific disease.

Item 40

The method according to Item 39, wherein the inter-organ cross talk indicator comprises RNA.

Item 41

The method according to Item 39 or 40, wherein the inter-organ cross talk indicator comprises metabolites.

Item 42

The method according to any one of Items 39, 40, and 41, wherein the relationship between the positive control amount 2 and the negative control amount 2 in the standard data 2 set forth in Item 39 is a ratio between the positive control amount 2 and the negative control amount 2.

Item 43

The method according to any one of Items 39, 39-1, 39-2, and 40 to 42, wherein the specific organ is the heart, and the specific disease is myocardial infarction.

Item 43-1

The method according to Item 43, wherein, when the inter-organ cross talk indicator comprises RNA, the RNA is expressed from genes listed in FIG. 25 or 26.

Item 43-2

The method according to Item 43, wherein, when the inter-organ cross talk indicator comprises metabolites, the metabolites are listed in FIG. 27.

Item 44 The method according to any one of Items 39, 39-1, 39-2, and 40 to 42, wherein the specific organ is the brain, and the specific disease is dementia.

Item 44-1

The method according to Item 44, wherein, when the inter-organ cross talk indicator comprises RNA, the RNA is expressed from genes listed in FIG. 25 or 26.

Item 44-2

The method according to Item 44, wherein, when the inter-organ cross talk indicator comprises metabolites, the metabolites are listed in FIG. 27.

Item 45

The method according to any one of Items 39, 39-1, 39-2, and 40 to 42, wherein the specific disease is a tumor.

Item 45-1 The method according to Item 45, wherein, when the inter-organ cross talk indicator comprises RNA, the RNA is expressed from genes listed in FIG. 25 or 26.

Item 45-2

The method according to Item 45, wherein, when the inter-organ cross talk indicator comprises metabolites, the metabolites are listed in FIG. 27.

Item 46

A method for generating standard data 2 of patterns of inter-organ cross talk indicators for use in prediction of the presence of a disease and/or the stage of the disease in each of one or more organs other than a specific organ in a subject affected with a disease in the specific organ, the method comprising the steps of:

(A′) obtaining information about an amount of an inter-organ cross talk indicator in cells or tissue originating from each of one or more organs other than the specific organ of a positive control (or positive controls) as a gold standard for each stage of the disease in the specific organ (hereinafter referred to as “specific disease”);

(B′) obtaining information about an amount of the inter-organ cross talk indicator in cells or tissue originating from each of the one or more organs other than the specific organ of a negative control (or negative controls) as a gold standard;

(C′) determining patterns of inter-organ cross talk indicators, each of the patterns being determined from a relationship (preferably a ratio) between the amount of the inter-organ cross talk indicator in the organ other than the specific organ of the positive control (or positive controls) affected with the specific disease obtained in step (A′) and the amount of the corresponding inter-organ cross talk indicator in the same organ as the organ other than the specific organ in the negative control (or negative controls) without the specific disease obtained in step (B′); and

(D′) associating the patterns of the inter-organ cross talk indicators with the corresponding stages of the specific disease.

Item 46-1

The method according to Item 46, wherein step (A′) comprises the steps of:

extracting an inter-organ cross talk indicator from cells or tissue originating from each of one or more organs other than the specific organ of a positive control (or positive controls) as a gold standard for each stage of the specific disease; and

identifying and quantifying the inter-organ cross talk indicator, and

step (B′) comprises the steps of:

extracting the inter-organ cross talk indicator from cells or tissue originating from each of the one or more organs other than the specific organ of a negative control (or negative controls) as a gold standard; and

identifying and quantifying the inter-organ cross talk indicator.

Item 46-2 The method according to Item 46 or 46-1, wherein the inter-organ cross talk indicator comprises RNA.

Item 46-3

The method according to Item 46 or 46-1, wherein the inter-organ cross talk indicator comprises metabolites.

Item 46-4

The method according to any one of Items 46, 46-1, 46-2, and 46-3, wherein the specific organ is the heart, and the specific disease is myocardial infarction.

Item 46-4-1

The method according to Item 46-4, wherein, when the inter-organ cross talk indicator comprises RNA, the RNA is expressed from genes listed in FIG. 25 or 26.

Item 46-4-2

The method according to Item 46-4, wherein, when the inter-organ cross talk indicator comprises metabolites, the metabolites are listed in FIG. 27.

Item 46-5

The method according to any one of Items 46, 46-1, 46-2, and 46-3, wherein the specific organ is the brain, and the specific disease is dementia.

Item 46-5-1

The method according to Item 46-5, wherein, when the inter-organ cross talk indicator comprises RNA, the RNA is expressed from genes listed in FIG. 25 or 26.

Item 46-5-2

The method according to Item 46-5, wherein, when the inter-organ cross talk indicator comprises metabolites, the metabolites are listed in FIG. 27.

Item 46-6 The method according to any one of Items 46, 46-1, 46-2, and 46-3, wherein the specific disease is a tumor.

Item 46-6-1

The method according to Item 46-6, wherein, when the inter-organ cross talk indicator comprises RNA, the RNA is expressed from genes listed in FIG. 25 or 26.

Item 46-6-2

The method according to Item 46-6, wherein, when the inter-organ cross talk indicator comprises metabolites, the metabolites are listed in FIG. 27.

Item 47

Standard data 2 of patterns of inter-organ cross talk indicators generated by the method according to any one of Items 46, 46-1, 46-2, and 46-3, for use in prediction of the presence of a disease and/or the stage of the disease in each of one or more organs other than a specific organ in a subject affected with a disease in the specific organ.

Item 48

An apparatus for predicting efficacy or a side effect (or side effects) of a test substance, the apparatus comprising the following computation means:

a means for calculating, by comparing subject data X regarding an inter-organ cross talk indicator in each of one or more organs of an individual to which the test substance has been administered with predetermined standard data Y of the corresponding inter-organ cross talk indicator, similarity of patterns of the inter-organ cross talk indicators between the subject data X and the standard data Y, the subject data X being derived from cells or tissue originating from each of the one or more organs; and

a means for predicting efficacy or a side effect (or side effects) of the test substance in each of the one or more organs and/or each of one or more organs other than the one or more organs by using, as a measure, the similarity of patterns of the inter-organ cross talk indicators calculated by the pattern similarity calculation means.

Item 49

The apparatus according to Item 48, wherein the subject data X is a pattern of the inter-organ cross talk indicator representing a relationship between an amount of the inter-organ cross talk indicator in the organ of the individual to which the test substance has been administered and an amount of the corresponding inter-organ cross talk indicator in the same organ in a negative control (or negative controls).

Item 50

The apparatus according to Item 48 or 49, wherein the standard data Y is Y1: standard data of patterns of inter-organ cross talk indicators predetermined from amounts of inter-organ cross talk indicators whose functions are already known.

Item 51

The apparatus according to Item 48 or 49, wherein the standard data Y is Y2: patterns of inter-organ cross talk indicators, each of the patterns being derived from a predetermined relationship between an amount of an inter-organ cross talk indicator in an organ of an individual to which an existing substance has been administered and an amount of the corresponding inter-organ cross talk indicator in the same organ in the negative control (or negative controls).

Item 52

The apparatus according to Item 48 or 49, wherein the standard data Y is Y3: patterns of inter-organ cross talk indicators, each of the patterns being derived from a predetermined relationship between an amount of an inter-organ cross talk indicator in an organ of a positive control individual (or positive control individuals) affected with a disease and an amount of the corresponding inter-organ cross talk indicator in the same organ in the negative control (or negative controls).

Item 53

The apparatus according to any one of Items 48 to 52, wherein the inter-organ cross talk indicator comprises RNA.

Item 54

The apparatus according to any one of Items 48 to 52, wherein the inter-organ cross talk indicator comprises metabolites.

Item 55

A program that, when executed by a computer, causes the computer to carry out the following processing to predict efficacy or a side effect (or side effects) of a test substance:

processing of calculating, by comparing subject data X regarding an inter-organ cross talk indicator in each of one or more organs of an individual to which the test substance has been administered with predetermined standard data Y of the corresponding inter-organ cross talk indicator, similarity of patterns of the inter-organ cross talk indicators between the subject data X and the standard data Y, the subject data X being derived from cells or tissue originating from each of the one or more organs; and

processing of predicting efficacy or a side effect (or side effects) of the test substance in each of the one or more organs and/or each of one or more organs other than the one or more organs by using, as a measure, the similarity of patterns of the inter-organ cross talk indicators calculated by the pattern similarity calculation processing.

Item 56

The program according to Item 55, wherein the subject data X is a pattern of the inter-organ cross talk indicator representing a relationship between an amount of the inter-organ cross talk indicator in the organ of the individual to which the test substance has been administered and an amount of the corresponding inter-organ cross talk indicator in the same organ in a negative control (or negative controls).

Item 57

The program according to Item 55 or 56, wherein the standard data Y is Y1: patterns predetermined from amounts of inter-organ cross talk indicators whose functions are already known.

Item 58

The program according to Item 55 or 56, wherein the standard data Y is Y2: patterns of inter-organ cross talk indicators, each of the patterns being derived from a predetermined relationship between an amount of an inter-organ cross talk indicator in an organ of an individual to which an existing substance has been administered and an amount of the corresponding inter-organ cross talk indicator in the same organ in the negative control (or negative controls).

Item 59

The program according to Item 55 or 56, wherein the standard data Y is Y3: patterns of inter-organ cross talk indicators, each of the patterns being derived from a predetermined relationship between an amount of an inter-organ cross talk indicator in an organ of a positive control individual (or positive control individuals) affected with a disease and an amount of the corresponding inter-organ cross talk indicator in the same organ in the negative control (or negative controls).

Item 60

The program according to any one of Items 55 to 59, wherein the inter-organ cross talk indicator comprises RNA.

Item 61

The program according to any one of Items 55 to 59, wherein the inter-organ cross talk indicator comprises metabolites.

Item 62

A program for causing a computer to function as the pattern similarity calculation means and the prediction means according to any one of Items 48 to 54.

Item 63

A method for predicting efficacy or a side effect (or side effects) of a test substance, the method comprising the steps of:

(1) calculating, by comparing subject data X regarding an inter-organ cross talk indicator in each of one or more organs of an individual to which the test substance has been administered with predetermined standard data Y of the corresponding inter-organ cross talk indicator, similarity of patterns of the inter-organ cross talk indicators between the subject data X and the standard data Y, the subject data X being derived from cells or tissue originating from each of the one or more organs; and

(2) predicting efficacy or a side effect (or side effects) of the test substance in each of the one or more organs and/or each of one or more organs other than the one or more organs by using, as a measure, the similarity of patterns of the inter-organ cross talk indicators calculated in step (1).

Item 64

The method according to Item 63, wherein the subject data X is a pattern of the inter-organ cross talk indicator representing a relationship between an amount of the inter-organ cross talk indicator in the organ of the individual to which the test substance has been administered and an amount of the corresponding inter-organ cross talk indicator in the same organ in a negative control (or negative controls).

Item 65

The method according to Item 63 or 64, wherein the standard data Y is Y1: patterns predetermined from amounts of inter-organ cross talk indicators whose functions are already known.

Item 66

The method according to Item 63 or 64, wherein the standard data Y is Y2: patterns of inter-organ cross talk indicators, each of the patterns being derived from a predetermined relationship between an amount of an inter-organ cross talk indicator in an organ of an individual to which an existing substance has been administered and an amount of the corresponding inter-organ cross talk indicator in the same organ in the negative control (or negative controls).

Item 67

The method according to Item 63 or 64, wherein the standard data Y is Y3: patterns of inter-organ cross talk indicators, each of the patterns being derived from a predetermined relationship between an amount of an inter-organ cross talk indicator in an organ of a positive control individual (or positive control individuals) affected with a disease and an amount of the corresponding inter-organ cross talk indicator in the same organ in the negative control (or negative controls).

Item 68

The method according to Items 63 to 67, further comprising, before step (1), (i) obtaining information about the subject data X regarding the inter-organ cross talk indicator in each of the one or more organs in the individual to which the test substance has been administered, the inter-organ cross talk indicator being derived from the cells or tissue originating from each of the one or more organs.

Item 69

The method according to Item 68, wherein step (i) comprises determining the subject data X regarding the inter-organ cross talk indicator from an amount of the inter-organ cross talk indicator in each of the one or more organs of the individual to which the test substance has been administered, the inter-organ cross talk indicator being derived from the cells or tissue originating from each of the one or more organs.

Item 70

The method according to Item 69, wherein step (i) comprises identifying or quantifying the inter-organ cross talk indicator extracted from the cells or tissue originating from each of the one or more organs of the individual to which the test substance has been administered.

Item 71

The method according to any one of Items 68 to 70, further comprising, before step (i), the steps of:

(ii) providing the test substance;

(iii) providing the individual;

(iv) administering the test substance provided in step (ii) to the individual provided in step (iii);

(v) collecting the one or more organs from the individual administered the test substance in step (iv); and

(vi) collecting the cells or tissue from the one or more organs collected in step (v).

Item 72

The method according to any one of Items 68 to 71, wherein the inter-organ cross talk indicator comprises RNA.

Item 73

The method according to any one of Items 68 to 71, wherein the inter-organ cross talk indicator comprises metabolites.

Item 74

A method for generating standard data Y of patterns of inter-organ cross talk indicators for use in prediction of efficacy or a side effect (or side effects) of a test substance, the method comprising the steps of:

(1) extracting inter-organ cross talk indicators from cells or tissue originating from one or more organs of an individual or individuals to which existing substances have been individually administered, and/or cells or tissue originating from the one or more organs of a negative control (or negative controls), and/or cells or tissue originating from the one or more organs of a positive control individual or positive control individuals affected with individual diseases;

(2) identifying and quantifying the inter-organ cross talk indicators extracted in step (1); and

(3) determining standard data Y of the inter-organ cross talk indicators from the amounts of the inter-organ cross talk indicators quantified in step (2).

Item 75

A microarray comprising probes capable of searching for at least one group selected from the group consisting of groups 1 to 8 described herein in the “1. Explanation of terms” section and “8. Microarray and kit” section, for use in obtaining data of a subject regarding an inter-organ cross talk indicator in each of one or more organs other than a specific organ, derived from cells or tissue originating from each of the one or more organs, in a method for predicting the presence of a disease in the specific organ and/or the stage of the disease in the subject, and/or a method for predicting efficacy or a side effect (or side effects) of a test substance.

Item 76

The microarray according to Item 75, which is to be incorporated in the apparatus according to any one of Items 1-1, 2, 4, 4-1, 5, 5-1, 6, 6-1, 7, 7-1, 25-1, 26, 28, 29, 29-1, 30, 30-1, 31, and 31-1.

Item 77

A kit comprising a microarray comprising probes capable of searching for at least one group selected from the group consisting of groups 1 to 8 described herein in the “1. Explanation of terms” section and “8. Microarray and kit” section, for use in obtaining data of a subject regarding an inter-organ cross talk indicator in each of one or more organs other than a specific organ, derived from cells or tissue originating from each of the one or more organs, in a method for predicting the presence of a disease in the specific organ and/or the stage of the disease in the subject, and/or a method for predicting efficacy or a side effect (or side effects) of a test substance.

Advantageous Effects of Invention

According to the present invention (Reverse iOrgans), subtle changes in the state of one organ are correlated with subtle changes in other organs to capture subtle changes in one organ or tissue, and the present invention can detect an abnormality in other organs or tissue earlier than usual diagnostic methods. Furthermore, use of an apparatus or a program for evaluating such a correlation in multiple organs or tissues makes it possible to diagnose the multiple organs or tissues by diagnosing one organ or tissue, thus dramatically improving diagnostic efficiency. According to the present invention (Forward iOrgans), the state of an organ that cannot yet be diagnosed as having an abnormality by using a usual test is inferred from the state of an organ already confirmed to have an abnormality by using a usual diagnostic method; therefore, an abnormality in other organs or tissue caused by heart disease, brain disease, cancer, etc., can be detected early, and secondary and tertiary diseases (such as renal failure, hepatopathy, and cancer metastasis) can be prevented or treated. Further, the efficacy and side effect (or side effects) of a test substance can be predicted.

BRIEF DESCRIPTION OF DRAWINGS

FIG. 1 schematically illustrates an outline of Reverse iOrgans according to the present invention.

FIG. 2 schematically illustrates an outline of Reverse iOrgans according to the present invention. FIG. 2(a) is an example of standard data 1 at the stages of myocardial infarction. FIG. 2(b) is an example of data of adipose tissue of a subject.

FIG. 3 schematically illustrates an outline of Forward iOrgans according to the present invention.

FIG. 4 schematically illustrates an outline of Forward iOrgans according to the present invention. FIG. 4(a) is an example of standard data 2. FIG. 4(b) is an example of data regarding an inter-organ cross talk indicator in the early stage of myocardial infarction extracted from the standard data 2. FIG. 4(c) is an example of data (standard data α) regarding an inter-organ cross talk indicator in the kidney extracted from the data regarding the inter-organ cross talk indicator in the early stage of myocardial infarction.

FIG. 5 schematically illustrates an outline of Drug iOrgans according to the present invention. FIG. 5(a) illustrates a model of D-iOrgans for predicting the side effect (or side effects) of a test substance. FIG. 5(b) illustrates a model of D-iOrgans for predicting the efficacy of a test substance.

FIG. 6 schematically illustrates an outline of Drug iOrgans according to the present invention.

FIG. 7 schematically illustrates an outline of Drug iOrgans according to the present invention.

FIG. 8 is an overview of a system 100 according to a first embodiment of the present invention.

FIG. 9 is a block diagram illustrating a hardware configuration of the system 100 according to the first embodiment of the present invention.

FIG. 10 is a block diagram to illustrate a function of a prediction apparatus 1 according to the first embodiment of the present invention.

FIG. 11 is a flow chart illustrating a flow of data processing performed by the prediction apparatus 1 according to the first embodiment of the present invention to carry out a prediction method.

FIG. 12 is an overview of a system 110 according to a second embodiment of the present invention.

FIG. 13 is a block diagram illustrating a hardware configuration of the system 110 according to the second embodiment of the present invention.

FIG. 14 is a block diagram to illustrate a function of a prediction apparatus 2 according to the second embodiment of the present invention.

FIG. 15 is a flow chart illustrating a flow of data processing performed by the prediction apparatus 2 according to the second embodiment of the present invention to carry out a prediction method.

FIG. 16 illustrates an outline of D-iOrgans using standard data 1. FIG. 16(a) illustrates standard data 1. FIG. 16(b) illustrates the pattern of subject data X of organ A after administration of a test substance. FIG. 16(c) illustrates subject data X of organ B after administration of the test substance. FIG. 16(d) illustrates subject data X of organ B after administration of a test substance. Hatching indicates patterns of inter-organ cross talk indicators.

FIG. 17 illustrates an outline of D-iOrgans using standard data 1. FIG. 17(a) illustrates standard data 1. FIG. 17(b) illustrates the pattern of subject data X of organ A after administration of a test substance. FIG. 17(c) illustrates subject data X of organ B after administration of the test substance. Hatching indicates patterns of inter-organ cross talk indicators.

FIG. 18 illustrates an outline of D-iOrgans using standard data Y3-MAPs (an example of human clinical study). Hatching indicates patterns of inter-organ cross talk indicators, and each 16 hatched blocks (including white blocks) indicate a correlation map.

FIG. 19 illustrates an outline of D-iOrgans using standard data Y3-MAPs (an example of prediction of effect in a preclinical study). Hatching indicates patterns of inter-organ cross talk indicators, and each 16 hatched blocks (including white blocks) indicate a correlation map.

FIG. 20 illustrates an outline of D-iOrgans using standard data Y3-MAPs (an example of prediction of effect in a preclinical study). Hatching indicates patterns of inter-organ cross talk indicators, and each 16 hatched blocks (including white blocks) indicate a correlation map.

FIG. 21 is an overview of a system 120 according to a third embodiment of the present invention.

FIG. 22 is a block diagram illustrating a hardware configuration of the system 120 according to the third embodiment of the present invention.

FIG. 23 is a block diagram to illustrate a function of a prediction apparatus 3 according to the third embodiment of the present invention.

FIG. 24 is a flow chart illustrating a flow of data processing performed by the prediction apparatus 3 according to the third embodiment of the present invention to carry out a prediction method.

FIG. 25 is a list of RNAs in mice that can be detected by, for example, RNA-Seq. FIG. 25 is divided into FIGS. 25-1 to 25-176. In FIG. 25, “Line No.” indicates a line number in the list, “Gene Name” indicates a gene name registered with the U.S. National Center for Biotechnology Information (NCBI), and “Reference Seq. ID” indicates a reference sequence ID number registered with the NCBI. “Chromosome Locus” indicates a chromosome locus registered in mm9.

FIG. 26 is a list of RNAs in mice that can be detected by, for example, RNA-Seq. FIG. 26 is divided into FIGS. 26-1 to 26-127. In FIG. 26, “Line No.” indicates a line number in the list, “Gene Name” indicates a gene name registered with the U.S. National Center for Biotechnology Information (NCBI), and “Reference Seq. ID” indicates a reference sequence ID number registered with the NCBI. “Chromosome Locus” indicates a chromosome locus registered in mm10.

FIG. 27 is a list of metabolites of group B. FIG. 27 is divided into FIGS. 27-1 to 27-7.

FIG. 28 is a list of metabolites of group C. FIG. 28 is divided into FIGS. 28-1 to 28-3.

FIG. 29 shows time-course changes of metabolites in which the MI/Sham value obtained by GCMS analysis is more than 1 or less than 1 in each kind of tissue. FIG. 29 is divided into FIGS. 29-1 to 29-4. The symbols in FIG. 29 are as follows: 1 d: 1 day after coronary artery ligation, 1 w: 1 week after coronary artery ligation, and 8 w: 8 weeks after coronary artery ligation.

FIG. 30: RNAs examined for their expression levels were classified as follows. FIG. 30 is divided into FIGS. 30-1 to 30-126. RNAs in which MI/Sham is more than 1 or less than 1 were classified as group 4, RNAs in which MI/Sham is more than 1.5 or less than 0.67 were classified as group 5, RNAs in which MI/Sham is more than 2 or less than 0.5 were classified as group 6, and RNAs in which MI/Sham is more than 5 or less than 0.2 were classified as group 7. The RNAs of group 8, which were also examined using real-time PCR, are particularly useful in the present invention. In FIG. 30, “Line No.” indicates a line number in the list, “Groups” indicates a group number of each of the groups classified based on the MI/Sham values, “Gene Name” indicates a gene name registered with NCBI, “Human Gene ID” indicates a human gene number registered with the NCBI that corresponds to the gene name, and “Updated” indicates the date of update to the Human Gene ID in NCBI. In “Sub-Group,” “VIII” indicates group 8, “VII-1” indicates RNAs, among the RNAs of group 7, in which MI/Sham is more than 5 and that are not included in group 8, and “VII-2” indicates RNAs, among the RNAs of group 7, in which MI/Sham is less than 0.2 and that are not included in group 8. “VI-1” indicates RNAs, among the RNAs of group 6, in which MI/Sham is more than 2 and that are not included in group 7 or group 8, and “VI-2” indicates RNAs, among the RNAs of group 6, in which MI/Sham is less than 0.5 and that are not included in group 7 or group 8. “V-1” indicates RNAs, among the RNAs of group 5, in which MI/Sham is more than 1.5 and that are not included in any of groups 6 to 8, and “V-2” indicates RNAs, among the RNAs of group 5, in which MI/Sham is less than 0.67 and that are not included in any of groups 6 to 8. “IV-1” indicates RNAs, among the RNAs of group 4, in which MI/Sham is more than 1 and that are not included in any of groups 5 to 8, and “IV-2” indicates RNAs, among the RNAs of group 4, in which MI/Sham is less than 1 and that are not included in any of groups 5 to 8. The RNAs of group 3 are observed to be expressed in the organs tested within 8 weeks after left coronary artery ligation in a myocardial infarction mouse model; i.e., they are RNAs in which the FPKM value is 1 or more.

FIG. 31 shows time-course changes of expression of RNAs shown in FIG. 30 in which MI/Sham is more than 5 or less than 0.2, in each organ. FIG. 31 is divided into FIGS. 31-1 to 31-112. The symbols in FIG. 31 are as follows: 1 d: 1 day after coronary artery ligation, 1 w: 1 week after coronary artery ligation, and 8 w: 8 weeks after coronary artery ligation.

FIG. 32 shows the results of real-time PCR analysis. FIG. 32 is divided into FIGS. 32-1 to 32-5. The symbols in FIG. 32 are as follows: 1 h: 1 hour after coronary artery ligation, 6 h: 6 hours after coronary artery ligation, 1 d: 1 day after coronary artery ligation, 1 w: 1 week after coronary artery ligation, and 8 w: 8 weeks after coronary artery ligation. “Gene Name” indicates a gene name registered with NCBI.

FIG. 33 shows time-course changes of metabolites in which the SAMP8/Control value obtained by CEMS analysis is more than 1 or less than 1, in each kind of tissue. FIG. 33 is divided into FIGS. 33-1 to 33-6. The symbols in FIG. 33 are as follows: E: early stage of young-onset dementia, and M: middle stage of young-onset dementia.

FIG. 34: RNAs examined for their expression levels were classified as follows. FIG. 34 is divided into FIGS. 34-1 to 34-125. RNAs in which SAMP8/Control is more than 1 or less than 1 were classified as group 4, RNAs in which SAMP8/Control is more than 1.5 or less than 0.67 were classified as group 5, RNAs in which SAMP8/Control is more than 2 or less than 0.5 were classified as group 6, and RNAs in which SAMP8/Control is more than 5 or less than 0.2 were classified as group 7. In “Sub-Group,” “VII-1” indicates RNAs, among the RNAs of group 7, in which SAMP8/Control is more than 5, and “VII-2” indicates RNAs, among the RNAs of group 7, in which SAMP8/Control is less than 0.2. “VI-1” indicates RNAs, among the RNAs of group 6, in which SAMP8/Control is more than 2 and that are not included in group 7, and “VI-2” indicates RNAs, among the RNAs of group 6, in which SAMP8/Control is less than 0.5 and that are not included in group 7. “V-1” indicates RNAs, among the RNAs of group 5, in which SAMP8/Control is more than 1.5 and are not included in group 6 or group 7, and “V-2” indicates RNAs, among the RNAs of group 5, in which SAMP8/Control is less than 0.67 and that are not included in group 6 or group 7. “IV-1” indicates RNAs, among the RNAs of group 4, in which SAMP8/Control is more than 1 and that are not included in any of groups 5 to 7, and “IV-2” indicates RNAs, among the RNAs of group 4, in which SAMP8/Control is less than 1 and that are not included in any of groups 5 to 7. The RNAs of group 3 are observed to be expressed in the organs tested by the late stage in a young-onset dementia mouse model; i.e., they are RNAs in which the FPKM value is 1 or more. The symbols in FIG. 34 are as follows: E: early stage of young-onset dementia, M: middle stage of young-onset dementia, and L: late stage of young-onset dementia.

FIG. 35 shows time-course changes of expression of the RNAs of group 7 shown in FIG. 34 in each organ. FIG. 35 is divided into FIGS. 35-1 to 35-292. The symbols in FIG. 35 are as follows: E: early stage of young-onset dementia, M: middle stage of young-onset dementia, and L: late stage of young-onset dementia.

FIG. 36: RNAs examined for their expression levels were classified as follows. FIG. 36 is divided into FIGS. 36-1 to 36-125. RNAs in which Glioma/Control is more than 1 or less than 1 were classified as group 4, RNAs in which Glioma/Control is more than 1.5 or less than 0.67 were classified as group 5, RNAs in which Glioma/Control is more than 2 or less than 0.5 were classified as group 6, and RNAs in which Glioma/Control is more than 5 or less than 0.2 were classified as group 7. In FIG. 36, “Line No.” indicates a line number in the list, “Groups” indicates a group number of each of groups classified based on the Glioma/Control values, and “Gene Name” indicates a gene name registered with NCBI. In “Sub-Group,” “VII-1” indicates RNAs, among the RNAs of group 7, in which Glioma/Control is more than 5, and “VII-2” indicates RNAs, among the RNAs of group 7, in which Glioma/Control is less than 0.2. “VI-1” indicates RNAs, among the RNAs of group 6, in which Glioma/Control is more than 2 and that are not included in group 7, and “VI-2” indicates RNAs, among the RNAs of group 6, in which Glioma/Control is less than 0.5 and that are not included in group 7. “V-1” indicates RNAs, among the RNAs of group 5, in which Glioma/Control is more than 1.5 and that are not included in group 6 or group 7, and “V-2” indicates RNAs, among the RNAs of group 5, in which Glioma/Control is less than 0.67 and that are not included in group 6 or group 7. “IV-1” indicates RNAs, among the RNAs of group 4, in which Glioma/Control is more than 1 and that are not included in any of groups 5 to 7, and “IV-2” indicates RNAs, among the RNAs of group 4, in which Glioma/Control is less than 1 and that are not included in any of groups 5 to 7. The RNAs of group 3 are observed to be expressed in the organs tested by day 7 after glioma implantation; i.e., they are RNAs in which the FPKM value is 1 or more.

FIG. 37 shows time-course changes of expression of the RNAs of group 7 shown in FIG. 36 in each organ. FIG. 37 is divided into FIGS. 37-1 to 37-54. The symbols in FIG. 37 are as follows: 3 d: day 3 after tumor implantation, and 7 d: day 7 after tumor implantation.

FIG. 38 shows RNA expression in the skin of human breast cancer patients. FIG. 38 is divided into FIGS. 38-1 to 38-88. RNAs examined for their expression levels were classified as follows. RNAs in which BC/Control is more than 1 or less than 1 were classified as group 4, RNAs in which BC/Control is more than 1.5 or less than 0.67 were classified as group 5, RNAs in which BC/Control is more than 2 or less than 0.5 were classified as group 6, and RNAs in which BC/Control is more than 5 or less than 0.2 were classified as group 7. In FIG. 38, “Line No.” indicates a line number in the list, “Groups” indicates a group number of each of the groups classified based on the BC/Control values, and “Gene Name” indicates a gene name registered with NCBI. In “Sub-Group,” “VII-1” indicates RNAs, among the RNAs of group 7, in which BC/Control is more than 5, and “VII-2” indicates RNAs, among the RNAs of group 7, in which BC/Control is less than 0.2. “VI-1” indicates RNAs, among the RNAs of group 6, in which BC/Control is more than 2 and that are not included in group 7, and “VI-2” indicates RNAs, among the RNAs of group 6, in which BC/Control is less than 0.5 and that are not included in group 7. “V-1” indicates RNAs, among the RNAs of group 5, in which BC/Control is more than 1.5 and that are not included in group 6 or group 7, and “V-2” indicates RNAs, among the RNAs of group 5, in which BC/Control is less than 0.67 and that are not included in group 6 or group 7. “IV-1” indicates RNAs, among the RNAs of group 4, in which BC/Control is more than 1 and that are not included in any of groups 5 to 7, and “IV-2” indicates RNAs, among the RNAs of group 4, in which BC/Control is less than 1 and that are not included in any of groups 5 to 7. The RNAs of group 3 are observed to be expressed in the organ tested; i.e., they are RNAs in which the FPKM value is 1 or more.

FIG. 39 shows RNA expression in the skin of a human lung cancer patient. FIG. 39 is divided into FIGS. 39-1 to 39-88. RNAs examined for their expression levels were classified as follows. RNAs in which LC/Control is more than 1 or less than 1 were classified as group 4, RNAs in which LC/Control is more than 1.5 or less than 0.67 were classified as group 5, RNAs in which LC/Control is more than 2 or less than 0.5 were classified as group 6, and RNAs in which LC/Control is more than 5 or less than 0.2 were classified as group 7. In FIG. 39, “Line No.” indicates a line number in the list, “Groups” indicates a group number of each of the groups classified based on the LC/Control values, and “Gene Name” indicates a gene name registered with NCBI. In “Sub-Group,” “VII-1” indicates RNAs, among the RNAs of group 7, in which LC/Control is more than 5, and “VII-2” indicates RNAs, among the RNAs of group 7, in which LC/Control is less than 0.2. “VI-1” indicates RNAs, among the RNAs of group 6, in which LC/Control is more than 2 and that are not included in group 7, and “VI-2” indicates RNAs, among the RNAs of group 6, in which LC/Control is less than 0.5 and that are not included in group 7. “V-1” indicates RNAs, among the RNAs of group 5, in which LC/Control is more than 1.5 and that are not included in group 6 or group 7, and “V-2” indicates RNAs, among the RNAs of group 5, in which LC/Control is less than 0.67 and that are not included in group 6 or group 7. “IV-1” indicates RNAs, among the RNAs of group 4, in which LC/Control is more than 1 and that are not included in any of groups 5 to 7, and “IV-2” indicates RNAs, among the RNAs of group 4, in which LC/Control is less than 1 and that are not included in any of groups 5 to 7. The RNAs of group 3 are observed to be expressed in the organ tested; i.e., they are RNAs in which the FPKM value is 1 or more.

FIG. 40 shows RNA expression in the blood of a human breast cancer patient. FIG. 40 is divided into FIGS. 40-1 to 40-109. RNAs examined for their expression levels were classified as follows. RNAs in which BC/Control is more than 1 or less than 1 were classified as group 4, RNAs in which BC/Control is more than 1.5 or less than 0.67 were classified as group 5, RNAs in which BC/Control is more than 2 or less than 0.5 were classified as group 6, and RNAs in which BC/Control is more than 5 or less than 0.2 were classified as group 7. In FIG. 40, “Line No.” indicates a line number in the list, “Groups” indicates a group number of each of the groups classified based on the BC/Control values, and “Gene Name” indicates a gene name registered with NCBI. In “Sub-Group,” “VII-1” indicates RNAs, among the RNAs of group 7, in which BC/Control is more than 5, and “VII-2” indicates RNAs, among the RNAs of group 7, in which BC/Control is less than 0.2. “VI-1” indicates RNAs, among the RNAs of group 6, in which BC/Control is more than 2 and that are not included in group 7, and “VI-2” indicates RNAs, among the RNAs of group 6, in which BC/Control is less than 0.5 and that are not included in group 7. “V-1” indicates RNAs, among the RNAs of group 5, in which BC/Control is more than 1.5 and that are not included in group 6 or group 7, and “V-2” indicates RNAs, among the RNAs of group 5, in which BC/Control is less than 0.67 and that are not included in group 6 or group 7. “IV-1” indicates RNAs, among the RNAs of group 4, in which BC/Control is more than 1 and that are not included in any of groups 5 to 7, and “IV-2” indicates RNAs, among the RNAs of group 4, in which BC/Control is less than 1 and that are not included in any of groups 5 to 7. The RNAs of group 3 are observed to be expressed in the organ tested; i.e., they are RNAs in which the FPKM value is 1 or more.

FIG. 41 shows RNA expression in the blood of a human lung cancer patient. FIG. 41 is divided into FIGS. 41-1 to 41-109. RNAs examined for their expression levels were classified as follows. RNAs in which LC/Control is more than 1 or less than 1 were classified as group 4, RNAs in which LC/Control is more than 1.5 or less than 0.67 were classified as group 5, RNAs in which LC/Control is more than 2 or less than 0.5 were classified as group 6, and RNAs in which LC/Control is more than 5 or less than 0.2 were classified as group 7. In FIG. 41, “Line No.” indicates a line number in the list, “Groups” indicates a group number of each of the groups classified based on the LC/Control values, and “Gene Name” indicates a gene name registered with NCBI. In “Sub-Group,” “VII-1” indicates RNAs, among the RNAs of group 7, in which LC/Control is more than 5, and “VII-2” indicates RNAs, among the RNAs of group 7, in which LC/Control is less than 0.2. “VI-1” indicates RNAs, among the RNAs of group 6, in which LC/Control is more than 2 and that are not included in group 7, and “VI-2” indicates RNAs, among the RNAs of group 6, in which LC/Control is less than 0.5 and that are not included in group 7. “V-1” indicates RNAs, among the RNAs of group 5, in which LC/Control is more than 1.5 and that are not included in group 6 or group 7, and “V-2” indicates RNAs, among the RNAs of group 5, in which LC/Control is less than 0.67 and that are not included in group 6 or group 7. “IV-1” indicates RNAs, among the RNAs of group 4, in which LC/Control is more than 1 and that are not included in any of groups 5 to 7, and “IV-2” indicates RNAs, among the RNAs of group 4, in which LC/Control is less than 1 and that are not included in any of groups 5 to 7. The RNAs of group 3 are observed to be expressed in the organ tested; i.e., they are RNAs in which the FPKM value is 1 or more.

FIG. 42 shows time-course changes of metabolites in which the STZ/Control value obtained by CEMS analysis is more than 1 or less than 1, in each kind of tissue. FIG. 42 is divided into FIGS. 42-1 to 42-4.

FIG. 43: RNAs examined for their expression levels in D-iOrgans were classified as follows. FIG. 43 is divided into FIGS. 43-1 to 43-142. RNAs in which STZ/Control is more than 1 or less than 1 were classified as group 4, RNAs in which STZ/Control is more than 1.5 or less than 0.67 were classified as group 5, RNAs in which STZ/Control is more than 2 or less than 0.5 were classified as group 6, and RNAs in which STZ/Control is more than 5 or less than 0.2 were classified as group 7. The RNAs of group 8, which were also examined using real-time PCR, are particularly useful in the present invention. In FIG. 43, “Line No.” indicates a line number in the list, “Groups” indicates a group number of each of the groups classified based on the STZ/Control values, and “Gene Name” indicates a gene name registered with NCBI. In “Sub-Group,” “VIII” indicates group 8, “VII-1” indicates RNAs, among the RNAs of group 7, in which STZ/Control is more than 5 and that are not included in group 8, and “VII-2” indicates RNAs, among the RNAs of group 7, in which STZ/Control is less than 0.2 and that are not included in group 8. “VI-1” indicates RNAs, among the RNAs of group 6, in which STZ/Control is more than 2 and that are not included in group 7 or group 8, and “VI-2” indicates RNAs, among the RNAs of group 6, in which STZ/Control is less than 0.5 and that are not included in group 7 or group 8. “V-1” indicates RNAs, among the RNAs of group 5, in which STZ/Control is more than 1.5 and that are not included in any of groups 6 to 8, and “V-2” indicates RNAs, among the RNAs of group 5, in which STZ/Control is less than 0.67 and are not included in any of groups 6 to 8. “IV-1” indicates RNAs, among the RNAs of group 4, in which STZ/Control is more than 1 and that are not included in any of groups 5 to 8, and “IV-2” indicates RNAs, among the RNAs of group 4, in which STZ/Control is less than 1 and that are not included in any of groups 5 to 8. The RNAs of group 3 are observed to be expressed in the organs tested; i.e., they are RNAs in which the FPKM value is 1 or more.

FIG. 44 shows the results of real-time PCR analysis in D-iOrgans.

FIG. 45 shows the results of D-iOrgans using embryos removed from mice to which STZ was administered. FIG. 45 is divided into FIGS. 45-1 to 45-125. RNAs examined for their expression levels were classified as follows. RNAs in which STZ/Control is more than 1 or less than 1 were classified as group 4, RNAs in which STZ/Control is more than 1.5 or less than 0.67 were classified as group 5, RNAs in which STZ/Control is more than 2 or less than 0.5 were classified as group 6, and RNAs in which STZ/Control is more than 5 or less than 0.2 were classified as group 7. In FIG. 45, “Line No.” indicates a line number in the list, “Groups” indicates a group number of each of the groups classified based on the STZ/Control values, and “Gene Name” indicates a gene name registered with NCBI. In “Sub-Group,” “VII-1” indicates RNAs, among the RNAs of group 7, in which STZ/Control is more than 5, and “VII-2” indicates RNAs, among the RNAs of group 7, in which STZ/Control is less than 0.2. “VI-1” indicates RNAs, among the RNAs of group 6, in which STZ/Control is more than 2 and that are not included in group 7, and “VI-2” indicates RNAs, among the RNAs of group 6, in which STZ/Control is less than 0.5 and that are not included in group 7. “V-1” indicates RNAs, among the RNAs of group 5, in which STZ/Control is more than 1.5 and that are not included in group 6 or group 7, and “V-2” indicates RNAs, among the RNAs of group 5, in which STZ/Control is less than 0.67 and that are not included in group 6 or group 7. “IV-1” indicates RNAs, among the RNAs of group 4, in which STZ/Control is more than 1 and that are not included in any of groups 5 to 7. “IV-2” indicates RNAs, among the RNAs of group 4, in which STZ/Control is less than 1 and that are not included in any of groups 5 to 7. The RNAs of group 3 are observed to be expressed in the organ tested; i.e., they are RNAs in which the FPKM value is 1 or more.

FIG. 46 illustrates the staging classification for myocardial infarction.

DESCRIPTION OF EMBODIMENTS

The present invention relates to two novel disease determination methods called “Reverse iOrgans” and “Forward iOrgans” based on a new methodology called “iOrgans (Inter-Organ Cross Talks) technology.” In the methodology, a comprehensive database of changes in the amounts of gene expression, metabolites, etc., derived from organs other than a specific organ is constructed and the changes are associated with functional and histological changes of the specific organ in a subject. The disease determination is achieved by using the comprehensive database. “iOrgans” is a technology to diagnose, prevent, and/or treat disease by using the interrelationship between the state of one organ and that of one or more other organs as a measure. Assuming that the specific disease is myocardial infarction, outlines of Reverse iOrgans (also referred to as “R-iOrgans”), Forward iOrgans (also referred to as “F-iOrgans”), and Drug iOrgans (also referred to as “D-iOrgans”) are described below.

FIGS. 1 and 2 schematically illustrate an outline of Reverse iOrgans according to the present invention.

Reverse iOrgans is a method for predicting a specific disease in a subject from information regarding the pattern of gene expression in each organ other than a specific organ collected from the same subject at the same time point. It is possible to predict the presence of a specific latent disease or the state of a specific organ by this method. In the example shown in FIG. 1, a disease (e.g., myocardial infarction) in a specific organ (e.g., heart) is predicted from information regarding the pattern of gene expression in another organ (e.g., adipose tissue or cells) as an example. An outline of the prediction method of Reverse iOrgans is described with reference to FIG. 2, assuming, as an example, that the other organ is adipose tissue and that the disease in the specific organ is myocardial infarction. A to F shown in FIG. 2 represent an inter-organ cross talk indicator.

First, a pattern of gene expression (i.e., a pattern of the inter-organ cross talk indicator) in adipose tissue is collected beforehand from each state of the heart, i.e., each stage of myocardial infarction, as standard data. FIG. 2(a) shows an example of standard data 1. The standard data of FIG. 2(a) shows a pattern of the inter-organ cross talk indicator, i.e., A to F in adipose tissue at each of the stages of myocardial infarction (normal state, and acute phase (ischemic state), convalescent phase (fibrotic state), and maintenance phase (cardiac hypertrophy state) of myocardial infarction). In the patterns of the inter-organ cross talk indicators from the acute phase to the maintenance phase of myocardial infarction, items in the inter-organ cross talk indicators shown in gray represent items in the inter-organ cross talk indicators showing no changes relative to normal, and items in the inter-organ cross talk indicators shown with diagonal hatching represent items in the inter-organ cross talk indicators showing changes relative to normal.

Next, adipose tissue is collected from a subject, and the pattern of the inter-organ cross talk indicator in the adipose tissue is determined and used as data of the subject (e.g., FIG. 2(b)). Subsequently, the standard data and the data of the subject derived from adipose tissue are compared with each other, and similarity between patterns is calculated. When a pattern similar to the data of the subject is present in the standard data, it can be predicted that the state of the heart linked with the similar pattern in the standard data is the state of the heart (the disease stage of the heart) that the subject is suffering. In the example shown in FIG. 2, the pattern of the data of the subject shown in (b) is similar to the second pattern from the top in the standard data. The second pattern from the top is a pattern derived from a heart that is in the state of the acute phase of myocardial infarction. It can thus be predicted that the heart of the subject is in the state of the acute phase of myocardial infarction (ischemic state).

FIGS. 3 and 4 schematically illustrate an outline of Forward iOrgans according to the present invention.

Forward iOrgans is a method in which, after the stage of a specific disease in a specific organ in a subject is determined by using a usual test etc., the stage of the specific disease is compared with predetermined data regarding inter-organ cross talk indicators in other organs to determine the pattern of gene expression etc. derived from each organ other than the specific organ of the subject and, on the basis of this, the presence of a disease or the stage of the disease, including complications, in each of the organs other than the specific organ is predicted. The presence of a disease or the stage of the disease, including complications, in each organ other than the specific organ can be predicted by checking the pattern of gene expression etc. derived from each of the organs other than the specific organ of the subject against previously reported information regarding gene expression in the disease in each of the organs other than the specific organ. In the example of FIG. 3, the stage of a disease (e.g., myocardial infarction) in a specific organ (e.g., heart) is identified beforehand by using a usual test etc., and the state of another organ (e.g., kidney) is predicted from the stage of the disease in the specific organ. Taking this case as an example, an outline of the prediction method of Forward iOrgans is described with reference to FIG. 4.

First, information that the stage of myocardial infarction in a subject is the acute phase, the convalescent phase, or the maintenance phase is determined from the results of, for example, a biochemical test of the blood serum or the like. Next, the stage of the subject is checked against standard data 2 (e.g., FIG. 4(a)) that includes patterns of inter-organ cross talk indicators in each organ, including the heart, stored for each stage of myocardial infarction, thereby extracting patterns of the inter-organ cross talk indicators corresponding to the stage (e.g., acute phase) of myocardial infarction in the subject (FIG. 4(b)) from the data of FIG. 4(a). Furthermore, the pattern of the inter-organ cross talk indicator derived from the kidney (FIG. 4(c)) is extracted from the patterns of FIG. 4(b). By this procedure, the pattern of the inter-organ cross talk indicator derived from the kidney (FIG. 4(c)) can be inferred to be the pattern of the inter-organ cross talk indicator derived from the kidney at the stage of the subject. Based on the inter-organ cross talk indicator shown in the pattern inferred, the state of the kidney can be predicted from previously reported information regarding diseases and complications.

FIGS. 5 and 6 schematically illustrate an outline of Drug iOrgans according to the present invention for use in predicting a side effect (or side effects) and efficacy of a test substance. According to the inter-organ cross talk system, a side effect (or side effects) of many drugs are caused by changes (increase or decrease) in an inter-organ cross talk indicator from the state “(a1, a2, a3, a4, etc.)” to the state “Δ(a1, a2, a3, a4, etc.)” as a result of action of such a drug on organ A (FIG. 5(a)). In view of the inter-organ cross talk system, a side effect (or side effects) are caused in organ B, organ C, and organ D by action of a drug on organ A. The same theory as in the case of a side effect (or side effects) applies to efficacy of a drug, as shown in FIG. 5(b).

In conventional methods for detecting a side effect (or side effects) and for confirming efficacy, changes in organ A are only observed, and thus effects in organ B, organ C, and organ D are overlooked. D-iOrgans can not only evaluate changes in the inter-organ cross talk indicator from “(a1, a2, a3, a4, etc.)” to “Δ(a1, a2, a3, a4, etc.)” in organ A, but also comprehensively analyze changes in the inter-organ cross talk indicator in other organs due to administration of a drug, for example, changes from “(b1, b2, b3, b4, etc.)” to “Δ(b1, b2, b3, b4, etc.),” from “(c1, c2, c3, c4, etc.)” to “Δ(c1, c2, c3, c4, etc.),” and from “(d1, d2, d3, d4, etc.)” to “Δ(d1, d2, d3, d4, etc.)” in organ B, organ C, and organ D.

An example of the prediction method of D-iOrgans is described with reference to FIG. 6. First, a pattern of gene expression (i.e., a pattern of an inter-organ cross talk indicator) in each organ is obtained beforehand for each stage of one or more diseases as standard data Y. FIG. 6(a) shows an example of the standard data Y. The standard data Y shown in FIG. 6 (a) includes patterns of the inter-organ cross talk indicators, each of the patterns being derived from the predetermined relationship between the amount of the inter-organ cross talk indicator in the organ of a positive control individual (or positive control individuals) affected with a disease and the amount of the corresponding inter-organ cross talk indicator in the same organ in a negative control (or negative controls). This standard data Y shows a pattern of the inter-organ cross talk indicator, i.e., A to F derived from adipose tissue at each of the stages (normal state, early stage, middle stage, and late stage) of myocardial infarction, dementia, and glioma. In the patterns of the inter-organ cross talk indicators in the early stage to the late stage in each disease, items in the inter-organ cross talk indicators shown in gray represent items in the inter-organ cross talk indicators showing no changes relative to normal, and items in the inter-organ cross talk indicators shown with diagonal hatching represent items in the inter-organ cross talk indicators showing changes relative to normal.

Next, adipose tissue is collected from a subject to which a test substance has been administered, and the pattern of the inter-organ cross talk indicator in the adipose tissue is determined and used as subject data X (e.g., FIG. 6(b)). Subsequently, the standard data Y and the subject data X of adipose tissue are compared with each other, and similarity between the patterns is calculated. When a pattern similar to the subject data X is present in the standard data Y, it can be predicted that administration of the test substance causes the subject to be in the same state as when the disease at the stage associated with the similar pattern in the standard data Y has developed. In the example shown in FIG. 6, the pattern of the subject data X shown in (b) is similar to the pattern of the early stage of dementia in the standard data Y. This suggests that a disease corresponding to dementia at the early stage may have developed in the subject by administration of the test substance. It can thus be predicted that the test substance may have a side effect (or side effects) corresponding to dementia at the early stage.

Moreover, when a positive control individual or positive control individuals with individual diseases used for obtaining the standard data Y shown in FIG. 6(a) are receiving any treatment (administration of an existing substance) and the subject data X is the pattern shown in FIG. 6(b), it can be predicted that the test substance has efficacy corresponding to the existing substance.

Since subjective symptoms often do not appear at the early stage of diseases, conventional methods are unable to predict the efficacy or side effect (or side effects) of a test substance that do not appear as subjective symptoms. In contrast, in the prediction method of D-iOrgans, subject data X is compared with standard data Y of patterns of the inter-organ cross talk indicators linked with the corresponding stages of a disease, including the early stage, and the efficacy or side effect (or side effects) of the test substance is predicted using the similarity between the patterns as a measure. The prediction method of D-iOrgans thus also can predict the efficacy or side effect (or side effects) of a test substance that do not appear as subjective symptoms.

Taking colorectal cancer as an example, an embodiment of D-iOrgans is described with reference to FIG. 7. For example, FIG. 7(a) shows standard data 1 derived from the testis, kidney, skin, and colon without administration of a test substance in the case where the test substance is administered to an individual (e.g., a mouse) who is healthy, has a precancerous lesion of colorectal cancer, or has developed colorectal cancer. In FIG. 7, for example, a subject who is administered a test substance is a healthy individual and subject data X shown in FIG. 7(b) is the pattern of an inter-organ cross talk indicator derived from tissue originating from the colon of the subject. The subject data X is compared with data derived from the colon in the standard data 1 of FIG. 7(a). In this case, the subject data X is similar to the pattern of precancerous lesion of colorectal cancer in the standard data 1; therefore, it can be predicted that administration of the test substance to healthy individuals causes a precancerous lesion of colorectal cancer. Further, it can be predicted that the test substance may cause colorectal cancer in the future. Moreover, in FIG. 7, for example, a subject who is administered a test substance has colorectal cancer and subject data X shown in FIG. 7(b) is the pattern of an inter-organ cross talk indicator derived from the lesion after administration of the test substance. The subject data X is similar to the pattern of precancerous lesion of colorectal cancer in the standard data 1; therefore, it can be predicted that the test substance is effective in the treatment of colorectal cancer.

Furthermore, according to the present invention, the state of the colon can be predicted, for example, from a pattern of gene expression derived from the skin in the standard data 1 (FIG. 7(a)) without using tissue of the colon itself, in view of the inter-organ cross talk system. For example, in FIG. 7, a subject who is administered a test substance is a healthy individual and subject data X shown in FIG. 7(c) is the pattern of an inter-organ cross talk indicator derived from tissue originating from the skin of the subject. The subject data X is compared with the data derived from the skin in the standard data 1 shown in FIG. 7(a). In this case, the subject data X is similar to the pattern of precancerous lesion of colorectal cancer in the standard data 1; therefore, it can be predicted that the test substance causes a precancerous lesion in the colon. Moreover, for example, in FIG. 7, a subject who is administered a test substance has colorectal cancer and subject data X shown in FIG. 7(c) is the pattern of an inter-organ cross talk indicator derived from the skin after administration of the test substance. The subject data X is compared with the data of skin in the standard data 1. In this case, the subject data X is similar to the pattern of precancerous lesion of colorectal cancer in the standard data 1; therefore, it can be predicted that the test substance is effective against colorectal cancer. More specifically, for instance, when tissue to be observed is in, for example, the abdominal cavity and thus a laparotomy is required to collect the tissue, the skin or another organ that is easy to collect can be used instead of the tissue to predict the efficacy or side effect (or side effects) of a test substance in multiple organs other than the skin. Furthermore, the efficacy or side effect (or side effects) can be detected earlier in multiple organs at the same time by linking D-iOrgans to R-iOrgans or F-iOrgans.

1. Explanation of Terms

First, terms used in the present specification, claims, and abstract are explained.

“Individual” as used herein is not particularly limited. Examples include mammals, such as humans, mice, rats, dogs, cats, rabbits, bovines, horses, goats, sheep, and pigs, birds, such as chickens, and the like. The individual is preferably a mammal such as a human, a mouse, a dog, a cat, a bovine, a horse, or a pig, more preferably a human, a mouse, a dog, a cat, or the like, even more preferably a human or a mouse, and the most preferably a human. In addition, the term “individual” includes both individuals having disease and individuals having no disease. There is no limitation on the age or sex (male or female) of the individual; however, the individual is preferably the same species, the same age, and/or

the same sex as the subject described later. However, in the embodiment in “6. D-iOrgans” described later, when a test substance is administered to an individual, humans are excluded from the individuals.

Moreover, the term “individual” also includes individuals that gestate.

The ages of the individuals in the present invention may be classified into the following age groups in humans: under 7 years of age, 7 years of age or older but under 15 years of age, 15 years of age or older but under 30 years of age, 30 years of age or older but under 60 years of age, and 60 years of age or older. The age in the present invention is not particularly limited and is preferably 15 years of age or older but under 30 years of age, 30 years of age or older but under 60 years of age, or 60 years of age or older, and more preferably 30 years of age or older but under 60 years of age, or 60 years of age or older. In mice, the ages may be classified into the following age groups: under 6 weeks of age, 6 weeks of age or older but under 24 weeks of age, 24 weeks of age or older but under 48 weeks of age, and 48 weeks of age or older.

Here, an individual with a specific disease described later is referred to as “positive control,” and an individual without a specific disease described later is referred to as a “negative control.”

In the present invention, “tissue” refers to a collection of cells that have a similar function and a similar shape.

“Organ” as used herein means a collection of tissue in a subject that has a certain independent form and a specific function. Specific examples include organs of the circulatory system (such as the heart, arteries, veins, and lymphatic vessels), organs of the respiratory system (such as the nasal cavity, paranasal sinus, larynx, trachea, bronchus, and lungs), organs of the digestive system (such as the lips, buccal region, palate, teeth, gums, tongue, salivary glands, pharynx, esophagus, stomach, duodenum, jejunum, ileum, cecum, appendix, ascending colon, transverse colon, siymoid colon, rectum, anus, liver, gallbladder, bile duct, biliary tract, pancreas, and pancreatic duct), organs of the urinary system (such as the urethra, urinary bladder, ureter, and kidney), organs of the nervous system (such as the cerebrum, cerebellum, midbrain, brainstem, spinal cord, peripheral nerves, and autonomic nerves), organs of the female reproductive system (such as the ovaries, Fallopian tubes, uterus, and vagina), breasts, organs of the male reproductive system (such as the penis, prostate gland, testes, epididymis, and vas deferens), organs of the endocrine system (such as the hypothalamus, hypophysis, pineal body, thyroid gland, parathyroid gland, and adrenal gland), organs of the integumentary system (such as skin, hair, and nails), organs of the hematopoietic system (such as blood, bone marrow, and spleen), organs of the immune system (such as lymph nodes, tonsils, and thymus), bone and soft tissue organs (such as bones, cartilage, skeletal muscles, connective tissue, ligaments, tendons, diaphraym, peritoneum, pleura, and adipose tissue (brown fat and white fat)), organs of the sensory organ system (such as the eyeballs, eyelids, lacrimal glands, outer ear, middle ear, inner ear, and cochlea). Preferable examples of tissue in the present invention include tissue of the heart, cerebrum, lung, kidney, adipose tissue, liver, skeletal muscle, testis, spleen, thymus, bone marrow, pancreas, skin (for example, including the epidermis, the papillary layer, and the reticular layer above the subcutis; preferably not containing adipose tissue, cartilage tissue, or the like), and the like. More preferred examples of tissue include tissue of the heart, cerebrum, lung, kidney, adipose tissue, liver, skeletal muscle, spleen, bone marrow, pancreas, skin, and the like.

Furthermore, in the case of using an individual that gestates (preferably an individual other than humans) as a subject, the term “organ” in the present invention may include the whole body of an embryo or the organs described above of an embryo.

In the present invention, body fluids, such as serum, plasma, urine, spinal fluid, ascites fluid, pleural effusion, saliva, gastric fluid, pancreatic fluid, bile, and milk, particularly preferably plasma, may be used instead of the organs described above.

“Specific organ” as used herein refers to an organ with a specific disease described later. The term “organ other than the specific organ” includes the organs described above other than the specific organ. The organ other than the specific organ may be one or more kinds of organs. The organ other than the specific organ is preferably an organ other than blood. More preferably, the organ other than the specific organ does not include body fluids. The organ other than the specific organ is particularly preferably skin, adipose tissue, and the like.

“Originating from an organ” as used herein means, for example, being collected from an organ or being cultured from cells or tissue of a collected organ, or a body fluid.

“Inter-organ cross talk indicator” as used herein is at least one in vivo factor (or molecule) that is present in a living organism and acts as a measure representing the states of organs through organ-to-organ communication (i.e., inter-organ cross talk) in a living organism. In other words, the inter-organ cross talk indicator is an in vivo substance or in vivo substances that can undergo changes in cells or tissue originating from each organ, and/or a body fluid in an individual having a specific disease, depending on whether the disease is present. Examples of in vivo substances that can act as an inter-organ cross talk indicator include nucleic acids; carbohydrates; lipids; glycoproteins; glycolipids; lipoproteins; amino acids, peptides; proteins; polyphenols; chemokines; at least one metabolite selected from the group consisting of metabolic end products of the above substance or substances, intermediate metabolites of the above substance or substances, and starting substance or substances for one or more metabolic pathways of the above substance; metal ions; and the like. Preferable examples are nucleic acids.

In the present invention, the nucleic acid is preferably RNA, such as mRNA, non-coding RNA, or microRNA, and more preferably mRNA. The RNA is preferably at least one RNA selected from the group consisting of mRNAs, non-coding RNAs, and microRNAs that can be expressed in cells or tissue originating from organs described above or cells in body fluids (also referred to herein as “group 1”), more preferably RNAs expressed from genes listed in FIG. 25 or 26 in which the RNAs can be detected by RNA-Seq etc. (also referred to herein as “group 2”) and RNAs expressed from orthologs of the genes. HomoloGene (http://www.ncbi.nlm.nih.gov/homologene), a website provided by NCBI, or the like can be used to search for orthologs in animal species from the Reference Seq. IDs described in FIG. 25 or 26. Examples of orthologs in, for example, humans include those represented by the Human Gene IDs described in FIG. 30. Among these, the RNAs having polyA sequences are preferable. In an individual in which an ortholog corresponding to a gene described in FIG. 25 or 26 is not present, the ortholog is excluded from the analysis. It is more preferred that non-coding RNAs and microRNAs (their NCBI Reference Seq IDs start with “NR”) be excluded from the analysis in individuals other than mice.

For example, when the specific organ is the heart and the specific disease is myocardial infarction, at least one RNA selected from the group consisting of RNAs expressed from the genes of group 3 listed in FIG. 30 or at least one RNA selected from the group consisting of RNAs expressed from the orthologs, of the genes of group 3, that are present in the individual described above is preferable. At least one RNA selected from the group consisting of RNAs expressed from the genes of group 4 listed in FIG. 30 or at least one RNA selected from the group consisting of RNAs expressed from the orthologs, of the genes of group 4, that are present in the individual described above is more preferable than RNAs expressed from the genes of group 3. At least one RNA selected from the group consisting of RNAs expressed from the genes of group 5 listed in FIG. 30 or at least one RNA selected from the group consisting of RNAs expressed from the orthologs, of the genes of group 5, that are present in the individual described above is more preferable than RNAs expressed from the genes of group 4. At least one RNA selected from the group consisting of RNAs expressed from the genes of group 6 listed in FIG. 30 or at least one RNA selected from the group consisting of RNAs expressed from the orthologs, of the genes of group 6, that are present in the individual described above is more preferable than RNAs expressed from the genes of group 5. At least one RNA selected from the group consisting of RNAs expressed from the genes of group 7 listed in FIG. 30 or at least one RNA selected from the group consisting of RNAs expressed from the orthologs, of the genes of group 7, that are present in the individual described above is more preferable than RNAs expressed from the genes of group 6. At least one RNA selected from the group consisting of RNAs expressed from the genes of group 8 described in FIG. 31 or at least one RNA selected from the group consisting of RNAs expressed from the orthologs, of the genes of group 8, that are present in the individual described above is most preferable. However, orthologs of Sult5a1 are excluded from the orthologs of the genes of group 8 in individuals other than mice.

For example, when the specific organ is the brain and the specific disease is dementia, at least one RNA selected from the group consisting of RNAs expressed from the genes of group 3 listed in FIG. 34 or at least one RNA selected from the group consisting of RNAs expressed from the orthologs, of the genes of group 3, that are present in the individual described above is preferable. At least one RNA selected from the group consisting of RNAs expressed from the genes of group 4 listed in FIG. 34 or at least one RNA selected from the group consisting of RNAs expressed from the orthologs, of the genes of group 4, that are present in the individual described above is more preferable than RNAs expressed from the genes of group 3. At least one RNA selected from the group consisting of RNAs expressed from the genes of group 5 listed in FIG. 34 or at least one RNA selected from the group consisting of RNAs expressed from the orthologs, of the genes of group 5, that are present in the individual described above is more preferable than RNAs expressed from the genes of group 4. At least one RNA selected from the group consisting of RNAs expressed from the genes of group 6 listed in FIG. 34 or at least one RNA selected from the group consisting of RNAs expressed from the orthologs, of the genes of group 6, that are present in the individual described above is more preferable than RNAs expressed from the genes of group 5. At least one RNA selected from the group consisting of RNAs expressed from the genes of group 7 described in FIG. 34 or at least one RNA selected from the group consisting of RNAs expressed from the orthologs, of the genes of group 7, that are present in the individual described above is more preferable than RNAs expressed from the genes of group 6.

For example, when the specific disease is a tumor, at least one RNA selected from the group consisting of RNAs expressed from the genes of group 3 listed in FIG. 36, 38, or 39 or at least one RNA selected from the group consisting of RNAs expressed from the orthologs, of the genes of group 3, that are present in the individual described above is preferable. At least one RNA selected from the group consisting of RNAs expressed from the genes of group 4 listed in FIG. 36, 38, or 39 or at least one RNA selected from the group consisting of RNAs expressed from the orthologs, of the genes of group 4, that are present in the individual described above is more preferable than RNAs expressed from the genes of group 3. At least one RNA selected from the group consisting of RNAs expressed from the genes of group 5 listed in FIG. 36, 38, or 39 or at least one RNA selected from the group consisting of RNAs expressed from the orthologs, of the genes of group 5, that are present in the individual described above is more preferable than RNAs expressed from the genes of group 4. At least one RNA selected from the group consisting of RNAs expressed from the genes of group 6 listed in FIG. 36, 38, or 39 or at least one RNA selected from the group consisting of RNAs expressed from the orthologs, of the genes of group 6, that are present in the individual described above is more preferable than RNAs expressed from the genes of group 5. At least one RNA selected from the group consisting of RNAs expressed from the genes of group 7 listed in FIG. 36, 38, or 39 or at least one RNA selected from the group consisting of RNAs expressed from the orthologs, of the genes of group 7, that are present in the individual described above is more preferable than RNAs expressed from the genes of group 6.

When the disease is a tumor and the organ other than the specific organ is skin, at least one RNA selected from the group consisting of RNAs expressed from the genes of group 3 listed in FIG. 38 or 39 or at least one RNA selected from the group consisting of RNAs expressed from the orthologs, of the genes of group 3, that are present in the individual described above is preferable. At least one RNA selected from the group consisting of RNAs expressed from the genes of group 4 listed in FIG. 38 or 39 or at least one RNA selected from the group consisting of RNAs expressed from the orthologs, of the genes of group 4, that are present in the individual described above is more preferable than RNAs expressed from the genes of group 3. At least one RNA selected from the group consisting of RNAs expressed from the genes of group 5 listed in FIG. 38 or 39 or at least one RNA selected from the group consisting of RNAs expressed from the orthologs, of the genes of group 5, that are present in the individual described above is more preferable than RNAs expressed from the genes of group 4. At least one RNA selected from the group consisting of RNAs expressed from the genes of group 6 listed in FIG. 38 or 39 or at least one RNA selected from the group consisting of RNAs expressed from the orthologs, of the genes of group 6, that are present in the individual described above is more preferable than RNAs expressed from the genes of group 5. At least one RNA selected from the group consisting of RNAs expressed from the genes of group 7 listed in FIG. 38 or 39 or at least one RNA selected from the group consisting of RNAs expressed from the orthologs, of the genes of group 7, that are present in the individual described above is more preferable than RNAs expressed from the genes of group 6. RNA expressed from at least one gene selected from the group consisting of FCGR3B, FPR1, HLA-DQA1, LINC00260, LOC286437, MALAT1, MIR1184-1, MIR1247, PRG4, RPL21P44, RPPH1, RPS15AP10, SCARNA4, SNORA31, SNORA77, ZBTB20, and orthologs thereof is particularly preferable.

When the disease is breast cancer and the organ other than the specific organ is skin, at least one RNA selected from the group consisting of RNAs expressed from the genes of group 3 listed in FIG. 38 or at least one RNA selected from the group consisting of RNAs expressed from the orthologs, of the genes of group 3, that are present in the individual described above is preferable. At least one RNA selected from the group consisting of RNAs expressed from the genes of group 4 listed in FIG. 38 or at least one RNA selected from the group consisting of RNAs expressed from the orthologs, of the genes of group 4, that are present in the individual described above is more preferable than RNAs expressed from the genes of group 3. At least one RNA selected from the group consisting of RNAs expressed from the genes of group 5 described in FIG. 38 or at least one RNA selected from the group consisting of RNAs expressed from the orthologs, of the genes of group 5, that are present in the individual described above is more preferable than RNAs expressed from the genes of group 4. At least one RNA selected from the group consisting of RNAs expressed from the genes of group 6 listed in FIG. 38 or at least one RNA selected from the group consisting of RNAs expressed from the orthologs, of the genes of group 6, that are present in the individual described above is more preferable than RNAs expressed from the genes of group 5. At least one RNA selected from the group consisting of RNAs expressed from the genes of group 7 listed in FIG. 38 or at least one RNA selected from the group consisting of RNAs expressed from the orthologs, of the genes of group 7, that are present in the individual described above is more preferable than RNAs expressed from the genes of group 6. RNA expressed from at least one gene selected from the group consisting of PRG4, HLA-DQA1, LOC100302650, MIR1184-1, MIR1248, MIR203, MIR205, MIR570, RPPH1, SCARNA4, SNORA31, SNORA4, and orthologs thereof is particularly preferable.

When the disease is lung cancer and the organ other than the specific organ is skin, at least one RNA selected from the group consisting of RNAs expressed from the genes of group 3 listed in FIG. 39 or at least one RNA selected from the group consisting of RNAs expressed from the orthologs, of the genes of group 3, that are present in the individual described above is preferable. At least one RNA selected from the group consisting of RNAs expressed from the genes of group 4 listed in FIG. 39 or at least one RNA selected from the group consisting of RNAs expressed from the orthologs, of the genes of group 4, that are present in the individual described above is more preferable than RNAs expressed from the genes of group 3. At least one RNA selected from the group consisting of RNAs expressed from the genes of group 5 described in FIG. 39 or at least one RNA selected from the group consisting of RNAs expressed from the orthologs, of the genes of group 5, that are present in the individual described above is more preferable than RNAs expressed from the genes of group 4. At least one RNA selected from the group consisting of RNAs expressed from the genes of group 6 described in FIG. 39 or at least one RNA selected from the group consisting of RNAs expressed from the orthologs, of the genes of group 6, that are present in the individual described above is more preferable than RNAs expressed from the genes of group 5. At least one RNA selected from the group consisting of RNAs expressed from the genes of group 7 described in FIG. 39 or at least one RNA selected from the group consisting of RNAs expressed from the orthologs, of the genes of group 7, that are present in the individual described above is more preferable than RNAs expressed from the genes of group 6. RNA expressed from at least one gene selected from the group consisting of AGSK1, CYP2E1, KRT6C, RPL21, RPL9, TPPP, DCD, DDX3Y, FCGR3B, HBA2, HIST1H4C, HLA-DQA1, LOC286437, MALAT1, MIR1184-1, RPPH1, RPS15AP10, RPS4Y1, SCARNA4, SCGB2A1, SFTPA1, SFTPA2, SNORA31, SNORA77, ZBTB20, and orthologs thereof is particularly preferable.

When the disease is a tumor and the organ other than the specific organ is blood, at least one RNA selected from the group consisting of RNAs expressed from the genes of group 3 listed in FIG. 40 or 41 or at least one RNA selected from the group consisting of RNAs expressed from the orthologs, of the genes of group 3, that are present in the individual described above is preferable. At least one RNA selected from the group consisting of RNAs expressed from the genes of group 4 listed in FIG. 40 or 41 or at least one RNA selected from the group consisting of RNAs expressed from the orthologs, of the genes of group 4, that are present in the individual described above is more preferable than RNAs expressed from the genes of group 3. At least one RNA selected from the group consisting of RNAs expressed from the genes of group 5 listed in FIG. 40 or 41 or at least one RNA selected from the group consisting of RNAs expressed from the orthologs, of the genes of group 5, that are present in the individual described above is more preferable than RNAs expressed from the genes of group 4. At least one RNA selected from the group consisting of RNAs expressed from the genes of group 6 listed in FIG. 40 or 41 or at least one RNA selected from the group consisting of RNAs expressed from the orthologs, of the genes of group 6, that are present in the individual described above is more preferable than RNAs expressed from the genes of group 5. At least one RNA selected from the group consisting of RNAs expressed from the genes of group 7 listed in FIG. 40 or 41 or at least one RNA selected from the group consisting of RNAs expressed from the orthologs, of the genes of group 7, that are present in the individual described above is more preferable than RNAs expressed from the genes of group 6. RNA expressed from at least one gene selected from the group consisting of HNRNPH2, HP, LOC283663, SNORA40, TCN2, and orthologs thereof is particularly preferable.

When the disease is breast cancer and the organ other than the specific organ is blood, at least one RNA selected from the group consisting of RNAs expressed from the genes of group 3 listed in FIG. 40 or at least one RNA selected from the group consisting of RNAs expressed from the orthologs, of the genes of group 3, that are present in the individual described above is preferable. At least one RNA selected from the group consisting of RNAs expressed from the genes of group 4 listed in FIG. 40 or at least one RNA selected from the group consisting of RNAs expressed from the orthologs, of the genes of group 4, that are present in the individual described above is more preferable than RNAs expressed from the genes of group 3. At least one RNA selected from the group consisting of RNAs expressed from the genes of group 5 listed in FIG. 40 or at least one RNA selected from the group consisting of RNAs expressed from the orthologs, of the genes of group 5, that are present in the individual described above is more preferable than RNAs expressed from the genes of group 4. At least one RNA selected from the group consisting of RNAs expressed from the genes of group 6 listed in FIG. 40 or at least one RNA selected from the group consisting of RNAs expressed from the orthologs, of the genes of group 6, that are present in the individual described above is more preferable than RNAs expressed from the genes of group 5. At least one RNA selected from the group consisting of RNAs expressed from the genes of group 7 listed in FIG. 40 or at least one RNA selected from the group consisting of RNAs expressed from the orthologs, of the genes of group 7, that are present in the individual described above is more preferable than RNAs expressed from the genes of group 6.

When the disease is lung cancer and the organ other than the specific organ is blood, at least one RNA selected from the group consisting of RNAs expressed from the genes of group 3 listed in FIG. 41 or at least one RNA selected from the group consisting of RNAs expressed from the orthologs, of the genes of group 3, that are present in the individual described above is preferable. At least one RNA selected from the group consisting of RNAs expressed from the genes of group 4 listed in FIG. 41 or at least one RNA selected from the group consisting of RNAs expressed from the orthologs, of the genes of group 4, that are present in the individual described above is more preferable than RNAs expressed from the genes of group 3. At least one RNA selected from the group consisting of RNAs expressed from the genes of group 5 listed in FIG. 41 or at least one RNA selected from the group consisting of RNAs expressed from the orthologs, of the genes of group 5, that are present in the individual described above is more preferable than RNAs expressed from the genes of group 4. At least one RNA selected from the group consisting of RNAs expressed from the genes of group 6 listed in FIG. 41 or at least one RNA selected from the group consisting of RNAs expressed from the orthologs, of the genes of group 6, that are present in the individual described above is more preferable than RNAs expressed from the genes of group 5. At least one RNA selected from the group consisting of RNAs expressed from the genes of group 7 described in FIG. 41 or at least one RNA selected from the group consisting of RNAs expressed from the orthologs, of the genes of group 7, that are present in the individual described above is more preferable than RNAs expressed from the genes of group 6.

Metabolites that are present in cells or tissue originating from the organs described above encompass nucleic acids, carbohydrates, lipids, glycoproteins, glycolipids, lipoproteins, amino acids, peptides, proteins, polyphenols, chemokines, and metabolic end products of these substances, intermediate metabolites of these substances, and starting materials for synthesis of these substances (also referred to herein as “group A”). For example, the metabolite is preferably at least one of the metabolites listed in FIG. 27 (also referred to herein as “group B”), which can be detected by a known method. More specifically, the metabolite is at least one of the metabolites listed in FIG. 28 (also referred to herein as “group C”).

For example, when the specific organ is the heart and the specific disease is myocardial infarction, the metabolite is preferably one or more metabolites listed in FIG. 29.

For example, when the specific organ is the brain and the specific disease is dementia, the metabolite is preferably one or more metabolites listed in FIG. 33.

“An amount of an inter-organ cross talk indicator” or “amounts of inter-organ cross talk indicators” as used herein may be expressed as a quantitative value (or a quantitative level) or expressed semi-quantitatively as follows: for example, “increase,” “no change,” and “decrease.” “An amount of an inter-organ cross talk indicator” or “amounts of inter-organ cross talk indicators” may be the measurement value of the inter-organ cross talk indicator.

A disease in the specific organ to be detected in the present invention is referred to as a “specific disease.” The specific disease can include any disease and abnormality that can develop in organs mentioned above of the individual. (However, in some cases, diabetes and chronic renal failure are excluded from the disease to be detected in the present invention.) That is, the specific disease also includes abnormalities characteristic of the specific disease that occur before onset of the disease (such abnormalities are also referred to as “prelesions”). Preferable specific diseases include thrombosis, embolism, stenosis and like ischemic diseases (in particular, in the heart, brain, lung, colon, etc.); aneurysm, varix, congestion, hemorrhage, and like circulatory disturbances (in the aorta, veins, lungs, liver, spleen, retinas, etc.); allergic bronchitis, glomerulonephritis, and like allergic diseases; dementia, Parkinson's disease, amyotrophic lateral sclerosis, myasthenia gravis, and like degenerative diseases (in nerves, skeletal muscles, etc.); tumors (benign epithelial tumors, benign non-epithelial tumors, malignant epithelial tumors, and malignant non-epithelial tumors); metabolic diseases (disorders of carbohydrate metabolism, disorders of lipid metabolism, and electrolyte abnormality); infections (bacterial, viral, rickettsial, chlamydial, fungal, protozoal, parasitic, etc.); and the like. More preferred specific diseases include ischemic diseases in the heart or brain; neurodegenerative diseases including Alzheimer-type (young-onset) dementia and cerebrovascular dementia; malignant epithelial tumors or malignant non-epithelial tumors; and metabolic diseases, such as fatty liver and obesity. Particularly preferred examples include ischemic heart diseases (myocardial infarction and angina), malignant epithelial tumors (from the lungs, stomach, duodenum, colon, rectum, mammary glands, uterus, prostate gland, urinary bladder, etc.), malignant non-epithelial tumors (gliomas, such as astrocytomas, oligodendrogliomas, and ependymomas) and neurodegenerative diseases, such as Alzheimer-type dementia. Preferably, diseases that cause systemic symptoms are excluded from the specific diseases. Examples of diseases that cause systemic symptoms include autoimmune diseases such as systemic lupus erythematosus and multiple sclerosis; metabolic disorders such as hereditary mucopolysaccharidosis; influenza viral, adenoviral, and like infections.

The stage can be determined by a procedure already used for the above diseases, such as endoscopy, X-ray tests, MRI tests, ultrasonography, cardiac function tests, respiratory tests, histological tests, hematological tests, biochemical tests, immunological tests, or urinalysis. The stage also includes the period of time in which a prelesion appears (also referred to as “pre-disease stage”).

For example, myocardial infarction can be staged according to FIG. 46. FIG. 46 was prepared based on a document by Jack P. M. Cleutjens et al. (Cardiovascular Research, 1999, vol. 44, pp. 232-241). Cleutjens et al. state that cardiac tissue is repaired in small animals, such as mice and rats, after myocardial infarction faster than in humans; however, according to a study by the present inventor, there is no notable difference in progress in stage between mice and humans (e.g., see Motoaki Murakoshi et al., PLOS ONE, 2013, vol. 8, issue 11, e79374). Accordingly, the staging classification for myocardial infarction shown in FIG. 46 is also applicable to mice.

* ECM indicates extracellular matrix. ECM is deposited, first in the border zone between the infarcted area and the non-infarcted area and later in the central area of the infarct. First, fibrin starts to be deposited, and then, other extracellular matrix molecules, such as fibronectin and tenascin, start to be deposited.
** Myofibroblasts secrete interstitial collagens. In rats etc. the amount of type III collagen increases around the occluded coronary artery, followed by production of type I collagen. At this time, collagen fibers are not cross-linked. Along with activation of collagen synthesis, collagen degradation is activated.
*** MMPs indicate matrix metalloproteinases. In this phase, collagenolytic activity results in loss of tissue structure support, distortion of architecture, and loss of cardiac stiffness. The wall of the heart may become thin, and rupture of the myocardium may occur.

Further, as an example of another staging classification of myocardial infarction in humans, the disease can be staged as follows, with the day of occurrence of infarction being designated as day 0: acute phase, a period of 1 or 2 weeks from day 0; convalescent phase, a period from 3 weeks to 2 or 3 months; and maintenance phase, a lifelong period thereafter.

Particularly in the acute phase of myocardial infarction, follow-up observation can be conducted based on the test items shown in Table 1 (Shinryogun Betsu Rinsho Kensa no Gaidorain 2003: 10. Kyusei Shinkin Kosoku (Diagnosis related group clinical examination guideline 2003: 10. acute myocardial infarction) by Tsutomu Yamazaki).

TABLE 1
Hospital day (day) 1 2 3 4 5 6 7
Electrocardiogram Constantly Constantly Constantly Constantly Constantly Constantly Constantly
monitor
Blood pressure/pulse/ 24 8 6 6 4 4 2
respiration
Auscultation/physical 12 6 4 4 2 2 2
findings
Urinary output  6 6 2 2 1 1 1
Standard 12+31 lead  8 4 2 2 2 1 1
electrocardiogram
CK/CK+31 MB†  8 4 2 1 1
AST/LD  4 2 1 1 1
Troponin T (or I)/ Can be measured only once for confirming the diagnosis
myosin light chain 1
Blood count/erythrocyte  1 1 1 1
sedimentation rate/
CRP/coagulation test
Chest radiograph  1 1 1 1
Holter 1
electrocardiogram
Blood gases  1 1
Cardiac echo  1 1 1
Cardiac catheter  1
Myocardial scintigram 1
Exercise 1
electrocardiogram
▪Unit (times/day)
*Until the peak value. Thereafter, followed based on the other items.
†CK+31 MB can be measured only once for a definite diagnosis.

When the specific disease is Alzheimer-type dementia, the following classification (Koichi Kozaki (2012) Japanese Journal of Geriatrics, Vol. 49, no. 4, pp. 419-424), for example, can be used to stage the disease.

TABLE 2
Clinical
Stage Diagnosis Characteristics
1 Normal adult No objective or subjective functional impairment
2 Normal aging Misplacing objects, complaint of memory loss,
difficulty in finding words
3 Borderline Unable to perform complex work tasks, decreased
region function in a skilled job evident to co-workers,
difficulty in traveling to new locations
4 Mild Unable to perform complex tasks in daily life, such
as planning a party, shopping, and handling finances
5 Moderate Unable to choose proper attire according to time,
place, and occasion; persuasion may be necessary to
give the patient a bath
6a Moderately Unable to put on clothes in the proper order by
severe himself/herself
b Requires assistance in bathing, unwilling to taking
a bath
c Forgets to flush the toilet or wipe
d Urinary incontinence
e Fecal incontinence
7a Severe Decreased language function limited to about six
words or fewer
b Intelligible vocabulary limited to a single word,
such as “yes”
c Ambulatory ability lost
d Ability to sit up lost
e Ability to smile lost
f Unable to hold head up, ultimately loss of
consciousness (stupor or coma)
Prepared based on Sclan SG et al. Int Psychogeriatr. 1992: 4 Suppl 1: 55-69.

When the specific disease is a malignant epithelial tumor (cancer), the UICC TNM classification (7th ed.) or the like can be used to stage the disease.

For example, colorectal cancer can be staged according to the UICC TNM classification (7th ed.) as shown in Tables 3-1 to 3-3 below.

TABLE 3-1
UICC TNN classification (7th ed.) Matrix of stages
(colon and rectum)
UICC TNM
Classification N1 N2
7th edition N0 N1a N1b N1c N2a N2b
Tis 0
T1 I IIIA IIIA IIIA IIIA IIIB
T2 I IIIA IIIA IIIA IIIB IIIB
T3 IIA IIIB IIIB IIIB IIIB IIIC
T4 T4a IIB IIIB IIIB IIIB IIIC IIIC
T4b IIC IIIC IIIC IIIC IIIC IIIC
M1 M1a IVA IVA IVA IVA IVA IVA
M1b IVB IVB IVB IVB IVB IVB

TABLE 3-2
1) TNM classification (UICC) (7th ed.) 2010
T—Primary tumor; the depth of tumor invasion described in
Japanese Classification of Colorectal Carcinoma (8th ed.) is
noted in parentheses
TX Primary tumor cannot be assessed
T0 No evidence of primary tumor
Tis1 Carcinoma in situ: intraepithelial tumor or invasion of
lamina propria (M)
T1 Tumor invades submucosa (SM)
T2 Tumor invades muscularis propria (MP)
T3 Tumor invades into the subserosa or into the non-
peritonealized pericolic or perirectal tissue (SS, A)
T4 Tumor perforates the visceral peritoneum, and/or tumor
directly invades other organs or structures and/or tumor
perforates the visceral peritoneum (serosa)
T4a Tumor perforates the visceral peritoneum (SE)
T4b Tumor directly invades other organs or structures2,3 (SI,
AI)
Note 1:
Tis includes cancer cells confined within the glandular epithelial basement membrane (intraepithelial) or lamina propria (intramucosal) with no extension through the muscularis mucosae into the submucosa.
Note 2:
Direct invasion in T4b includes invasion of other organs or the colorectum by way of the serosa, as confirmed on microscopic examination, or for tumors in a retroperitoneal or subperitoneal location, direct invasion of other organs or structures by virtue of extension beyond the muscularis propria
Note 3:
A tumor that is adherent to other organs or structures, macroscopically, is classified as cT4b. However, if no tumor is present microscopically in the adhesion, the classification should be pT1-3 depending on the anatomical depth of wall invasion.

N—Regional lymph nodes
NX Regional lymph node metastasis cannot be assessed
N0 No regional lymph node metastasis
N1 Metastasis in 1-3 regional lymph nodes
N1a Metastasis in one regional lymph node
N1b Metastasis in 2-3 regional lymph nodes
N1c Tumour deposits*, i.e., satellite nodules, in the
subserosa or in non-peritonealized pericolic or perirectal
soft tissue without regional lymph node metastasis
N2 Metastasis in 4 or more regional lymph nodes
N2a Metastasis in 4-6 regional lymph nodes
N2b Metastasis in 7 or more regional lymph nodes
*Tumour deposits (satellite nodules), i.e., macroscopic or microscopic tumor nests or nodules, in the lymph drainage area of adipose tissue around the intestinal tract of a primary tumor without histological evidence of residual lymph node structure may represent discontinuous spread of tumor or venous invasion with extravascular spread (V1/2) or a lymph node totally replaced by a tumor (N1/2). If such deposits are observed with lesions that would otherwise be classified as Ti or T2, then the T classification is not changed, but the nodule(s) are classified as N1c. If a nodule is considered by the pathologist to be a lymph node totally replaced by a tumor (generally having a smooth contour), it should be recorded that lymph node metastasis is positive and not that a satellite nodule exists, and each nodule should be counted separately in the final pN determination.

M—Distant metastasis
MX Distant metastasis cannot be assessed
M0 Distant metastasis is not found
M1 Distant metastasis is found
M1a Metastasis confined to one organ (liver, lung, ovary, or
nonregional lymph node)
M1b Metastases in two or more organs or the peritoneum

TABLE 3-3
Stage
Stage 0 Tis N0 M0
Stage I T1, T2 N0 M0
Stage II T3, T4 N0 M0
Stage IIA T3 N0 M0
Stage IIB T4a N0 M0
Stage IIC T4b N0 M0
Stage III Any T N1, N2 M0
Stage IIIA T1, T2 N1 M0
T1 N2a M0
Stage IIIB T3, T4a N1 M0
T2, T3 N2a M0
T1, T2 N2b M0
Stage IIIC T4a N2a M0
T3, T4 N2b M0
T4b N1, N2 M0
Stage IVA Any T Any N M1a
Stage IVB Any T Any N M1b
See UICC TNN classification of malignant tumours, 7th ed., translated into Japanese, p. 98 (Kanehara & Co., Ltd., 2010).

When the specific disease is a glioma, the disease can be classified into the following grades, which were posted on a web page on Jan. 11, 2011, by the Japan Neurosurgical Society, (http://square.umin.ac.jp/neuroinf/medical/204.html).

TABLE 4
Astrocytoma-type Oligodendroglioma- Mixed tumor
-type
Grade 1 Pilocytic
astrocytoma
Grade 2 Diffuse Oligodendroglioma Oligoastrocytoma
astrocytoma
Grade 3 Anaplastic Anaplastic Anaplastic
astrocytoma oligodendroglioma oligoastrocytoma
Grade 4 Glioblastoma

When the specific disease is breast cancer, the disease can be classified, for example, into stages 0 to 4 according to a web page of Osaka University (http://www.med.osaka-cu.ac.jp/surgical-oncology/detail/nyugan.html), as described below.

  • Stage 0: Non-invasive cancer (cancer cells remain in lactiferous ducts or acini and rarely metastasize);
  • Stage 1: The size of the lump is 2 cm or less without metastasis to lymph nodes;
  • Stage 2A: The size of the lump is 2 cm or less and metastasis to axillary lymph nodes is observed; or the size of the lump is 2.1 to 5 cm without metastasis to lymph nodes;
  • Stage 2B: The size of the lump is 2.1 to 5 cm and metastasis to axillary lymph nodes is observed; or the size of the lump is 5 cm or more without metastasis to lymph nodes;
  • Stage 3A: The size of the lump is 5 cm or less and axillary lymph nodes are strongly attached to the surrounding tissue or lymph nodes; or the size of the lump is more than 5 cm and metastasis to axillary lymph nodes or lymph nodes behind the sternum is observed;
  • Stage 3B: Regardless of the size of the lump and metastasis to lymph nodes, the lump protrudes from the skin or is firmly attached to the chest wall;
  • Stage 3C: Regardless of the size of the lump, there is metastasis to supraclavicular and infraclavicular lymph nodes; or metastasis to both axillary lymph nodes and lymph nodes behind the sternum is observed;
  • Stage 4: Metastasis to a distant organ, such as bone, lung, or liver, is observed.

When the specific disease is lung cancer, the disease can be classified into stages I, II, III, and IV according to the criteria described on a web page of National Hospital Organization Osaka National Hospital (http://www.onh.go.jp/seisaku/cancer/kakusyu/haig.html#haig_02), as described below.

  • Stage I: The cancer is confined to the lung and there is no metastasis to lymph nodes;
  • Stage II: The cancer is confined to the lung and there is metastasis to only lymph nodes in the lung; or there is no metastasis to lymph nodes, but the cancer spreads to the surrounding area outside the lung that can be directly resected;
  • Stage III: There is no metastasis to other organs, but the disease is more advanced than stage II.
  • Stage IV: There is metastasis to another organ.

“Test substance” refers to a substance to be evaluated for its efficacy or side effect (or side effects) in the present invention.

“Existing substance” refers to a substance present at the time of practicing the present invention.

“Substance” is not particularly limited and may be novel or known. Examples of substances include compounds; nucleic acids; carbohydrates; lipids; glycoproteins; glycolipids; lipoproteins; amino acids; peptides; proteins; polyphenols; chemokines; at least one metabolite selected from the group consisting of metabolic end products, intermediate metabolites, and starting materials for synthesis, of the substances mentioned above; metal ions; microorganisms; and the like. These substances may be used singly or in a combination of two or more as a mixture. In another embodiment, examples of substances include drugs, quasi-drugs, medicated cosmetics, foods, foods for specified health uses, foods with function claims, and candidates for these. Substances that have been subjected to clinical studies for pharmaceutical approval, but that have not been commercialized are also included in the substances.

“Standard data 1” as used herein is a group of data of inter-organ cross talk indicators that serves as a measure for predicting the presence of a specific disease and/or the stage of the specific disease in a subject. More specifically, standard data 1 is a group of patterns of inter-organ cross talk indicators, each of the patterns being derived from a predetermined relationship between an amount of an inter-organ cross talk indicator in an organ other than the specific organ in a positive control (or positive controls) affected with the specific disease (hereinafter referred to as “positive control amount 1”) and an amount of the corresponding inter-organ cross talk indicator in the same organ as the organ other than the specific organ in a negative control (or negative controls) without the specific disease (hereinafter referred to as “negative control amount 1”), and preferably a group of patterns of inter-organ cross talk indicators, each of the patterns being derived from a predetermined ratio between the positive control amount 1 and the negative control amount 1 (for example, the ratio obtained by dividing the value of the positive control amount 1 by the value of the negative control amount 1). More preferably, the amount of the inter-organ cross talk indicator is the expression level of at least one RNA, and the patterns of the inter-organ cross talk indicators are a group of patterns of expression of at least one RNA (also referred to herein as “standard data 1a”). In another embodiment, more preferably, the amount of the inter-organ cross talk indicator is the amount of at least one metabolite, and the patterns of the inter-organ cross talk indicators are a group of patterns of presence of at least one metabolite (also referred to herein as “standard data 1b”).

Moreover, instead of standard data 1, correlation maps (standard data 1-Maps) may be used. The correlation maps (standard data 1-Maps) are generated using standard data 1 derived from multiple organs by determining, for each disease or each stage, the correlation of the patterns of inter-organ cross talk indicators between the organs. The method for generating the correlation maps is described below.

“Standard data 2” as used herein is a group of data of inter-organ cross talk indicators that serves as a measure for predicting the presence of a disease and/or the stage of the disease in each of one or more organs other than a specific organ in a subject affected with a specific disease. More specifically, standard data 2 is a group of patterns of inter-organ cross talk indicators predetermined for each stage, each of the patterns being derived from the predetermined relationship between the amount of an inter-organ cross talk indicator in an organ other than the specific organ in a positive control (or positive controls) affected with the specific disease (hereinafter also referred to as “positive control amount 2”) and the amount of the corresponding inter-organ cross talk indicator in the same organ as the organ other than the specific organ in a negative control (or negative controls) without the specific disease (hereinafter also referred to as “negative control amount 2”). Preferably, standard data 2 is a group of patterns of inter-organ cross talk indicators predetermined for each stage of the specific disease, each of the patterns being derived from the predetermined ratio between the positive control amount 2 and the negative control amount 2 (for example, a ratio obtained by dividing the value of the positive control amount 2 by the value of the negative control amount 2). More preferably, the amount of the inter-organ cross talk indicator is the expression level of at least one RNA, and the patterns of the inter-organ cross talk indicators are a group of patterns of expression of at least one RNA (also referred to herein as “standard data 2a”). In another embodiment, more preferably, the amount of the inter-organ cross talk indicator is the amount of at least one metabolite, and the patterns of the inter-organ cross talk indicators are a group of patterns of presence of at least one metabolite (also referred to herein as “standard data 2b”).

Standard data 1 or 2 is obtained for each stage of a specific disease, each organ or body fluid, and if necessary, each sex and/or each age group. Each pattern of the inter-organ cross talk indicator is linked with information regarding the corresponding stage of a specific disease, the corresponding organ or body fluid, and information about the sex, age, etc. of a subject.

“Subject” is a subject to which the prediction methods according to the present invention are applied, and is preferably of a species corresponding to those of individuals used for determining patterns in standard data 1 or 2. For example, if individuals used for determining patterns in the standard data are mice, then a mouse, a rat, a human, or the like may be selected as the subject. The age and sex of the subject are not particularly limited, and the subject may be in the same age group and/or of the same sex as individuals used for determining patterns in standard data 1 or 2.

“Data of a subject” or “subject data” as used herein is data of an inter-organ cross talk indicator derived from all or part of an organ collected from a subject. More specifically, data of a subject or subject data is a pattern of an inter-organ cross talk indicator representing the relationship between the amount of the inter-organ cross talk indicator in an organ other than the specific organ of the subject and the amount of the corresponding inter-organ cross talk indicator in the same organ as the organ other than the specific organ in a negative control (or negative controls) without the specific disease. Data of a subject or subject data is preferably a pattern of an inter-organ cross talk indicator represented by the ratio between the amount of the inter-organ cross talk indicator in an organ other than the specific organ of the subject and the amount of the corresponding inter-organ cross talk indicator in the same organ as the organ other than the specific organ in a negative control (or negative controls) without the specific disease (for example, a ratio calculated by dividing the value of the amount of the inter-organ cross talk indicator in an organ other than the specific organ of the subject by the value of the amount of the corresponding inter-organ cross talk indicator in the same organ as the organ other than the specific organ in a negative control (or negative controls) without the specific disease). More preferably, the amount of the inter-organ cross talk indicator is the expression level of RNA from at least one gene, and the pattern of the inter-organ cross talk indicator is a pattern of expression of RNA from at least one gene (also referred to herein as “subject data A”). In another embodiment, more preferably, the amount of the inter-organ cross talk indicator is the amount of at least one metabolite, and the pattern of the inter-organ cross talk indicator is a pattern of presence of at least one metabolite (also referred to herein as “subject data B”).

“Standard data Y” is a group of data of inter-organ cross talk indicators that serves as a measure for predicting the efficacy or side effect (or side effects) of a test substance. Standard data Y is a group of data of inter-organ cross talk indicators derived beforehand from one or more organs corresponding to the one or more organs from which subject data X is obtained. Standard data Y may be predetermined or obtained at the same time as subject data is obtained.

In an embodiment, standard data Y includes patterns of inter-organ cross talk indicators predetermined from the amounts of inter-organ cross talk indicators whose functions are already known (standard data Y1). In another embodiment, standard data Y includes patterns of inter-organ cross talk indicators, each of the patterns being derived from the predetermined relationship between the amount of an inter-organ cross talk indicator in an organ of an individual to which an existing substance has been administered and the amount of the corresponding inter-organ cross talk indicator in the same organ in a negative control (or negative controls) (standard data Y2). Standard data Y2 preferably includes patterns of inter-organ cross talk indicators, each of the patterns being predetermined from the ratio between the amount of an inter-organ cross talk indicator in an organ of an individual to which an existing substance has been administered and the amount of the corresponding inter-organ cross talk indicator in the same organ in a negative control (or negative controls) (for example, a ratio obtained by dividing the value of the amount of an inter-organ cross talk indicator in an organ of an individual to which an existing substance has been administered by the value of the amount of the corresponding inter-organ cross talk indicator in the same organ in a negative control (or negative controls)). In another embodiment, standard data Y includes patterns of inter-organ cross talk indicators, each of the patterns being derived from the predetermined relationship between the amount of an inter-organ cross talk indicator in an organ of a positive control individual or positive control individuals affected with a disease and the amount of the corresponding inter-organ cross talk indicator in the same organ in a negative control (or negative controls) (standard data Y3). Standard data Y3 preferably includes patterns of inter-organ cross talk indicators, each of the patterns being predetermined from the ratio between the amount of an inter-organ cross talk indicator in an organ of a positive control individual or positive control individuals affected with a disease and the amount of the corresponding inter-organ cross talk indicator in the same organ in a negative control (or negative controls) (for example, a ratio obtained by dividing the value of the amount of an inter-organ cross talk indicator in an organ of a positive control individual or positive control individuals with a disease by the value of the amount of the corresponding inter-organ cross talk indicator in the same organ in a negative control (or negative controls)).

In addition, standard data Y may be correlation maps generated using standard data Y2 derived from multiple organs by determining the correlation of the patterns of inter-organ cross talk indicators between the organs (standard data Y2-Maps) or correlation maps generated using standard data Y3 derived from multiple organs by determining the correlation of the patterns of inter-organ cross talk indicators between the organs (standard data Y3-Maps). The methods for determining the correlation maps are described later.

Subject data X is a group of data of an inter-organ cross talk indicator derived from each of one or more organs of an individual to which a test substance has been administered. The inter-organ cross talk indicator is derived from cells or tissue originating from each of the one or more organs. Subject data X may represent the amount of an inter-organ cross talk indicator derived from an organ of an individual to which a test substance has been administered. Preferably, subject data X may represent the relationship between the amount of an inter-organ cross talk indicator in an organ of an individual to which a test substance has been administered and the amount of the corresponding inter-organ cross talk indicator in the same organ in a negative control (or negative controls) or may be determined as the ratio between the amount of an inter-organ cross talk indicator in an organ of an individual to which a test substance has been administered and the amount of the corresponding inter-organ cross talk indicator in the same organ in a negative control (or negative controls). More preferably, subject data X may be determined as a ratio calculated by dividing the amount of an inter-organ cross talk indicator in an organ of an individual to which a test substance has been administered by the amount of the corresponding inter-organ cross talk indicator in the same organ in a negative control (or negative controls).

The term “pattern” includes, for example, the presence or absence of an inter-organ cross talk indicator, the amounts of inter-organ cross talk indicators, or changes in the amounts of inter-organ cross talk indicators over time, and a combination of the amounts of inter-organ cross talk indicators and changes in the amounts of inter-organ cross talk indicators over time. Preferably, the pattern includes the presence or absence of an inter-organ cross talk indicator, the amounts of inter-organ cross talk indicators, or changes in the amounts of inter-organ cross talk indicators over time, and a combination of the amounts of inter-organ cross talk indicators and changes in the amounts of inter-organ cross talk indicators over time, for each stage. Preferably, the pattern includes the presence or absence of expression of RNA from at least one gene, the expression level of RNA from at least one gene, or changes in the expression level of RNA from at least one gene over time, and a combination of the expression level of RNA from at least one gene and changes in the expression level of RNA from at least one gene over time.

“Gold standard” as used herein is an individual or individuals that have already been determined to have or not have the specific disease described above by a known test method and/or diagnostic method. The term “gold standard” also includes healthy individuals.

“Similarity” as used herein indicates the degree to which patterns of inter-organ cross talk indicators are similar when data of a subject is compared with standard data 1 or when subject data X is compared with standard data Y. More specifically, the similarity can be determined visually or by statistical analysis or the like.

Statistical analysis for calculating the similarity is not particularly limited as long as the similarity can be calculated. For example, the similarity can be calculated by using data of a subject and standard data 1 as independent variables and determining a quantified measure such as the correlation coefficient between the two groups.

Specific examples include (1) a method in which, if data of a subject and standard data 1 are each a single vector, the closeness between the directions in which the two compared vectors are pointing is determined; (2) a method in which the inter-organ cross talk indicator contained in data of a subject and the inter-organ cross talk indicator contained in standard data 1 are listed in descending order of amount, and the order correlation is determined; (3) a method in which the probability distribution of data of a subject and the probability distribution of standard data 1 are determined, and the pseudo-distance between the two probability distributions is measured; (4) a method in which the dimensionality of high-dimensional data of a subject and standard data 1 is reduced, and the distance and correlation between the dimensionality-reduced data are determined; (5) a method in which the Gaussian distribution of standard data 1 is determined, and the degree of matching between the Gaussian distribution of standard data 1 and the Gaussian distribution of the obtained data of a subject is quantified; and the like. Moreover, (6) a group of standard data 1 may be learned beforehand, and thus which one of the patterns in standard data 1 best matches data of a subject can be derived automatically.

Further, the measure such as the correlation coefficient may also be calculated between each item in an inter-organ cross talk indicator in data of a subject and each corresponding item in the inter-organ cross talk indicator in standard data 1.

In a more specific embodiment, examples of the method (1) described above include the Pearson product-moment correlation method. In this case, the correlation coefficient ranges from 1 to −1. The closer the correlation coefficient is to 1, the more similar the data of the subject and the standard data 1 are. Examples of the method (2) described above include Spearman's rank correlation method and the Kendall rank correlation method. In this case, the correlation coefficient ranges from 1 to −1. The closer the correlation coefficient is to 1, the more similar the data of the subject and the standard data 1 are. Examples of the method (3) described above include the Kullback-Leibler divergence method. In this case, the closer the pseudo-distance between the probability distribution of data of a subject and the probability distribution of standard data 1 is to 0, the more similar the data of the subject and the standard data 1 are. Examples of the method (4) described above include principal component analysis (PCA), Kernel principal component analysis, and the like. In the case of evaluating the measure of similarity using the distance between data of a subject and standard data 1, the closer the distance is to 0, the more similar the data of the subject and the standard data 1 are. In the case of evaluating the measure of similarity using the correlation coefficient between data of a subject and standard data 1, the closer the correlation coefficient is to 1, the more similar the data of the subject and the standard data 1 are. Examples of the method (5) described above include Z-score method. In this case, the closer the Z-score is to 0, the more similar the data of the subject and the standard data 1 are. Examples of the method (6) described above include support vector machines, k-nearest neighbors, neural networks, and the like. Standard methods for these methods may be partially modified as necessary.

Correlation coefficients calculated by using the above methods may be further analyzed using a chi-square test, a Kruskal-Wallis test, or the like.

For example, when a p-value is calculated using Spearman pairwise correlation, it can be determined as follows: when the p-value is 1, it can be determined that the data of the subject is identical to the standard data 1; when the p-value is more than 0.55 and less than 1, preferably more than 0.65 and less than 1, more preferably more than 0.75 and less than 1, and even more preferably more than 0.85 and less than 1, it can be determined that the data of the subject is similar to the standard data 1; on the other hand, when the p-value is 0.8 or less, preferably 0.65 or less, and more preferably 0.55 or less, it can be determined that the data of the subject is not similar to the standard data 1.

More preferably, in the case of predicting the presence or absence of a specific disease in a subject, when the p-value is more than 0.55 and less than 1, preferably more than 0.65 and less than 1, more preferably more than 0.75 and less than 1, and even more preferably more than 0.85 and less than 1, it can be determined that the data of the subject is similar to the standard data 1. In the case of predicting the stage of a specific disease in a subject, when the p-value is more than 0.75 and less than 1, and preferably more than 0.85 and less than 1, it can be determined that the data of the subject is similar to the standard data 1.

For example, when a z-value is calculated using a Z-score, it can be determined as follows: when the z-value is 0, it can be determined that the data of the subject is identical to the standard data 1; when the z-value falls within the range of 0±0.5 (excluding 0), preferably within the range of 0±0.35 (excluding 0), more preferably within the range of 0±0.2 (excluding 0), and even more preferably within the range of 0±0.15 (excluding 0), it can be determined that the data of the subject is similar to the standard data 1; on the other hand, when the z-value falls outside the range of 0±0.15, preferably outside the range of 0±0.2, more preferably outside the range of 0±0.35, and even more preferably outside the range of 0±0.4, it can be determined that the data of the subject is not similar to the standard data 1.

More specifically, in the case of predicting the presence or absence of a specific disease in a subject, when the z-value falls within the range of 0±0.35 (excluding 0), preferably within the range of 0±0.2 (excluding 0), and more preferably within the range of 0±0.15 (excluding 0), it can be determined that the data of the subject is similar to the standard data 1. In the case of predicting the stage of a specific disease in a subject, when the z-value falls within the range of 0±0.2 (excluding 0), and preferably within the range of 0±0.15 (excluding 0), it can be determined that the data of the subject is similar to the standard data 1.

When the similarity is determined using a Z-score, the brain, pancreas, testes, lungs, liver, and skeletal muscles are preferably excluded from the organs. Preferably, the Z-score method is excluded from the methods for determining the similarity.

Further, when at least 50%, preferably at least 70%, more preferably at least 80%, and even more preferably at least 90% of items in examined inter-organ cross talk indicators are identical or similar between standard data 1 and data of a subject, it can be determined that the pattern in the standard data 1 is similar to the pattern in the data of the subject. On the other hand, when at least 50%, preferably at least 70%, more preferably at least 80%, and even more preferably at least 90% of items in examined inter-organ cross talk indicators are not identical or similar between standard data 1 and data of a subject, it can be determined that the pattern in the standard data 1 is not similar to the pattern in the data of the subject.

The similarity between subject data X and standard data Y can be calculated by using the correlation coefficient between the subject data X and the standard data Y as an independent variable and determining an measure such as the correlation coefficient between the two groups by the method described above.

Standard data 1-Maps, standard data Y2-Maps, and standard data Y3-Maps are determined as follows. When standard data 1-Maps are determined, multiple organs are collected for a specific disease or each stage of the specific disease, and patterns of inter-organ cross talk indicators derived from each organ are determined (for example, when the inter-organ cross talk indicator is RNA, the genes expressing RNAs are listed in descending order of expression level). Correlation coefficients are calculated between the patterns of the organs using, for example, Spearman's rank correlation, and maps between the organs are generated. When the standard data Y2-Maps are determined, multiple organs are collected for each existing substance administered, and patterns of inter-organ cross talk indicators derived from each organ are determined (for example, when the inter-organ cross talk indicator is RNA, the genes expressing RNAs are listed in descending order of expression level). Correlation coefficients are calculated between the patterns of the organs using, for example, Spearman's rank correlation, and correlation maps between the organs are created. When standard data Y3-Maps are determined, multiple organs are collected for each disease or each disease stage, and patterns of inter-organ cross talk indicators in each organ are determined (for example, when the inter-organ cross talk indicator is RNA, the genes expressing RNAs are listed in descending order of expression level). Correlation coefficients are calculated between the patterns of the organs using, for example, Spearman's rank correlation, and maps between the organs are created.

More specifically, for example, the correlation coefficient of patterns of inter-organ cross talk indicators j between organ m and organ l in disease model i is represented by rijml. The number of individuals of disease model i is represented by n.

In this case, the correlation coefficient between organ m and organ l of disease model i can be represented by probability model p (the following equation).

p ⁡ ( r | i , m , l ) = 1 2 ⁢ π ⁢ σ iml ⁢ exp ⁡ ( - ( r - r iml ) 2 2 ⁢ σ iml 2 ) Equation ⁢ ⁢ 1

wherein riml is the mean of n correlation coefficients rijml, and σijml2 is the sample variance of the correlation coefficients rijml.

Comparisons between data of a subject and standard data 1-Maps, comparisons between subject data X and standard data Y2-Maps, and comparisons between subject data X and standard data Y3-Maps can be performed using Bayesian inference, machine learning methods, etc.

For example, patterns of inter-organ cross talk indicators of multiple organs in a subject are obtained, and (a) correlation coefficient(s) of the patterns of inter-organ cross talk indicators is/are determined between the organs in the subject from which the data of the subject or the subject data X is obtained, in the same manner as described above. The obtained value(s) is/are represented by the following:


{r′ml}m,l∈(collected organs)

In this case, the likelihood Li of correlation


{r′ml}m,l∈(collected organs)

with respect to each model i can be calculated using the following equation.

L i = ∏ m , l ⁢ p ⁡ ( r ′ ml | i , m , l ) Equation ⁢ ⁢ 2

The likelihood is calculated for each model i, and a model i with the highest likelihood can be inferred to be the state of the subject.

When the number of organs to be compared is three or more, the likelihood between a disease model and a subject is determined between two of each of the organs, and the product of the calculated likelihoods is determined. A model i with the highest product may be inferred to be the state of the subject.

Which inter-organ cross talk indicator is used is not particularly limited when comparisons between data of a subject and standard data 1-Maps, comparisons between subject data X and standard data Y2-Maps, or comparisons between subject data X and standard data Y3-Maps are performed. For example, it is preferable to use an inter-organ cross talk indicator in which the difference between a positive control (or positive controls) and a negative control (or negative controls) is large. More specifically, for example, when the inter-organ cross talk indicator is RNA, it is RNA in which the ratio between a positive control (or positive controls) and a negative control (or negative controls) is more than 1.5 or less than 0.65, preferably more than 2 or less than 0.5, and more preferably more than 5 or less than 0.2.

The statistical analysis described above can be performed, for example, with a computer using a calculation program. In this case, the prediction program according to the present invention described later may comprise program code of a statistical analysis program for performing statistical analysis, or commercially available statistical analysis software may be used as a statistical analysis program. For example, the analysis can be performed using commercially available statistical analysis software, such as StatFlex Ver. 6 (Artech Co., Ltd., Osaka, Japan) or IBM SPSS Statistics (IBM Japan Ltd.).

“One or more” as used herein includes cases of one kind and cases of multiple kinds. The term “multiple” is not particularly limited as long as it means two or more, and preferably refers to three or more, more preferably five or more, and even more preferably ten or more.

2. Methods for Collecting and Storing Cells or Tissue, or Body Fluids for Extraction of an Inter-Organ Cross Talk Indicator, and Methods for Extracting and Measuring an Inter-Organ Cross Talk Indicator.

The method for collecting cells or tissue for extraction of an inter-organ cross talk indicator used in the present invention and the method for their storage are not particularly limited, and cells or tissue can be collected and stored according to known methods depending on the type of inter-organ cross talk indicator. The method for extracting an inter-organ cross talk indicator used in the present invention is also not particularly limited, and the inter-organ cross talk indicator can be extracted according to a known method depending on the type of inter-organ cross talk indicator. The method for measuring an inter-organ cross talk indicator in the present invention is not particularly limited as long as the amount of an inter-organ cross talk indicator can be measured.

Cells, tissue, or body fluids used for extraction of an inter-organ cross talk indicator are not particularly limited. Examples include cells, tissue, etc., collected from a subject by, for example, puncture, biopsy, or surgery. (The collected cells or tissue is also called a “specimen.”) The cells or tissue may be, for example, fresh material after collection or cryopreserved material.

In this embodiment, an inter-organ cross talk indicator may be obtained from cells or tissue originating from a specific organ suspected of having a disease and from one or more organs other than the specific organ, for each stage of the specific disease. In addition, an inter-organ cross talk indicator may be derived from the corresponding cells or tissue in an individual without the specific disease.

The time at which cells, tissue, or body fluids are collected can suitably be selected according to the disease stage from, for example, the following: before the onset of a specific disease (in the normal state), at the onset of a specific disease, 1 month, 6 months, 1 year, 2 years, 3 years, 5 years, or 10 years after the onset of a specific disease, and the like.

When RNA is used as an inter-organ cross talk indicator, RNA extraction from cells, tissue, or body fluids is preferably performed immediately after the cells, tissue, or body fluids are collected or is performed after freezing the cells or tissue with liquid nitrogen or the like immediately after the cells or tissue is collected, and transporting and storing the cells or tissue.

The method for extracting RNA is not particularly limited, and RNA can be extracted using a known method. RNA may be purified using, for example, an oligo dT probe, as necessary. If necessary, cDNA may be synthesized from extracted or purified RNA by a reverse transcription reaction and used for measurement. Qualitative or quantitative measurement (including semi-quantitative measurement) of RNA may be performed by a known method, such as a method using a microarray, which can comprehensively analyze gene expression, or a method in which analysis is conducted by RNA-Seq, which determines the absolute amounts of RNAs in cells. As comprehensive and quantitative analysis, RNA-Seq is preferable.

Data obtained by RNA-Seq or the like can be analyzed using a known method. For example, when the data is analyzed with Illumina HiSeq (Illumina, Inc) or the like, the output data can be processed by the following method: (1) text data of nucleotide sequences are obtained from the output raw data of analysis (image data) (base calling); (2) the data is selected using predetermined filtering such as removing low fluorescence purity clusters caused by overlapping clusters from the data by using a calculation formula, such as chastity (filtering); and (3) the sample data is sorted based on index sequence information provided for each sample (specific nucleotide sequence information).

A data file (Fastq format or the like) obtained from the RNA-Seq sequencer is uploaded on, for example, Galaxy (https://usegalaxy.org/). Thereafter, analysis is carried out using, for example, Bowtie2 (http://bowtie-bio.sourceforge.net/bowtie2/index.shtml) to map each sequence to mouse genome map information mm9 or mm10. A BAM file obtained using Bowtie2 or the like is analyzed using, for example, Cufflinks (http://cole-trapnell-lab.github.io/cufflinks/) to calculate FPKM (RPKM) for each gene. In the obtained FPKM data, all FPKM values less than 1 are regarded as 0; pairwise correlation (ρ=1−(6ΣD2)/(n3−n) is calculated using Python, and a heat map is generated using MeV. The FPKM values may also be visually analyzed.

If necessary, expression can also be confirmed by real-time PCR or the like. In addition, the mRNA expression level can be normalized by the expression level of a housekeeping gene, such as GAPDH, β2-microglobulin (β2M), or Maea, as necessary, and expressed as a relative expression level.

When at least one metabolite is used as an inter-organ cross talk indicator, the metabolite can be analyzed by a known method, such as gas chromatography/mass spectrometry (GCMS), capillary electrophoresis/mass spectrometry (CEMS), liquid chromatography/mass spectrometry (LCMS), high-performance liquid chromatography/inductively coupled plasma mass spectrometry (HPLC/ICP-MS), or high-performance liquid chromatography/ion trap mass spectrometry/time-of-flight mass spectrometry (LCMS-IT-TOF). Metabolites may also be derivatized, for example, silylated, trimethylsilylated, methoximated, or acylated, according to the method of analysis used. In addition, a known substance can be used as an internal standard substance.

For example, when metabolites are analyzed by GCMS, extraction of metabolites from cells or tissue is not particularly limited, and may be performed by a known method. For instance, tissue is placed in a solvent, such as water, methanol, ethanol, chloroform, or a mixture thereof, and homogenized, and further, a solvent containing internal standard 2-isopropylmalic acid or the like is added to the solvent to prepare a crude extract. The aqueous layer is purified by adding water or a hydrophobic solvent such as chloroform to the crude extract. The purified aqueous layer is further purified by ultrafiltration or the like and used as an extract of metabolites for analysis.

After the metabolites in the extract are methoximated or trimethylsilylated, gas chromatography may be performed using, for example, GCMS-TQ8030 (Shimadzu Corporation) and DB-5 (30 m×0.25 mm (inner diameter)×1.00 um (film thickness)) (Agilent Technologies) as a capillary column for GC. Gas chromatography is performed, for example, under the following temperature increase conditions: the temperature is increased at a rate of 4° C./min from 100° C. to 320° C. The inlet temperature is, for example, about 280° C. Helium or the like may be used as carrier gas and made to flow at a rate of, for example, about 39.0 cm/sec. The energy of electron ionization may be about 150 eV, the ion source temperature may be about 200° C., and the range of m/z to be scanned may be about 45 to 600. About 1 μl of a sample may be injected and measured under the following conditions:

Heart_Split1:25_detector voltage+0.3 kV
Brain_Split1:25_detector voltage+0.2 kV
Kidney_Split1:25_detector voltage+0.3 kV
Liver_Split1:25_detector voltage+0.3 kV
Pancreas_Split1:25_detector voltage+0.3 kV
Skeletal muscle_Split1:25_detector voltage+0.2 kV
Adipose tissue_Split1:3_detector voltage+0.2 kV
Blood plasma_Split1:10_detector voltage+0.1 kV
Spleen_Split1:25_detector voltage+0.2 kV
Lung_Split1:25_detector voltage+0.3 kV
Testis_Split1:10_detector voltage+0.3 kV
Thymus_Split1:25_detector voltage+0.3 kV

Searching can be performed using the data obtained by GCMS analysis with, for example, GCMS solution Ver. 4.20, which is data analysis software, and GCMS Metabolites Database (Shimadzu Corporation). To identify metabolites, the retention time expected from the retention sample and the presence of m/z of at least two specific peaks (target ion, confirmation ion), and the ratio of the specific peaks are confirmed. In each of the identified metabolites, the peak area of the target ion is measured and normalized using the peak area of the internal standard and the sample amount. Thereafter, the corrected measurement results can be calculated by a Z-score ((sample data-average)/standard deviation) to generate a heat map using Multi Experiment Viewer (MeV). Pairwise correlation (ρ=1−[6ΣD2]/n(n2−1)) can also be calculated using Python to generate a heat map with MeV. Furthermore, analysis such as principal component analysis (PCA) can also be performed using multivariate analysis software SIMCA (Umetrics).

When metabolites are analyzed by CEMS, for example, tissue can be homogenized in 50% acetonitrile containing an internal standard substance (e.g., Solution ID: 304-1002; HMT), and the sample obtained after the homogenization can be centrifuged; the supernatant can be subjected to ultrafiltration, and the resulting sample can be dried under reduced pressure, redissolved in distilled water, and used as a sample for measurement.

For example, Agilent CE-TOFMS system (Agilent Technologies) can be used for CE-MS, and a fused silica capillary (i.d. 50 μm×80 cm) can be used for a capillary column for CE. As electrophoresis buffers in CE, a cation buffer solution (p/n: H3301-1001; HMT) or the like can be used for cations, and an anion buffer solution (p/n: 13302-1023; HMT) or the like can be used for anions.

Measurement Conditions on the Cation Side

For example, electrophoresis is performed under the following sample injection conditions: pressure injection: 50 mbar, 10 sec; electrophoresis voltage of CE: 27 kV. The energy of electron ionization may be 4,000 V, and the range to be scanned may be 50 to 1000. About 5 nl of a sample may be injected.

CE voltage: Positive, 27 kV
MS ionization: ESI Positive
MS capillary voltage: 4,000 V
MS scan range: m/z 50-1,000
Sheath liquid: HMT Sheath Liquid (p/n: H3301-1020)

Measurement Conditions on the Anion Side

For example, electrophoresis is performed under the following sample injection conditions: pressure injection: 50 mbar, 25 sec; electrophoresis voltage of CE: 30 kV. The energy of electron ionization may be 3,500 V, and the range to be scanned may be 50 to 1000. About 5 nl of a sample may be injected.

CE voltage: Positive, 30 kV
MS ionization: ESI Negative
MS capillary voltage: 3,500 V
MS scan range: m/z 50-1,000
Sheath liquid: HMT Sheath Liquid (p/n: H3301-1020)

Detected peaks can be processed with MasterHands automatic integration software ver.2.16.0.15 (developed by Keio University). Peaks having a signal-to-noise (S/N) ratio of 3 or more are automatically extracted, and metabolite identification can be performed by using the mass-to-charge ratio (m/z), peak area value, and migration time (MT). For each of the identified metabolites, the peak area of the target ion can be measured and normalized using the peak area of the internal standard and the sample amount.

The amount of an inter-organ cross talk indicator obtained by the methods described above can be stored in the storage unit of an apparatus, or an apparatus having a storage unit that is different from the apparatus, as a pattern of the inter-organ cross talk indicator for each stage of a specific disease, each organ or body fluid, each type of individual, each age group of individuals, and/or each sex of individuals.

3. Database

The amassment of standard data 1, 2, or Y above is called a “database.” The corresponding pattern of an inter-organ cross talk indicator in standard data 1 or 2 can be retrieved and extracted from the database based on information regarding the stage of a specific disease and/or the name of each organ or body fluid.

Examples of data used for standard data 1, 2, or Y include the results of qualitative or quantitative analysis of inter-organ cross talk indicators derived from cells or tissue originating from one or more organs of individuals, or one or more body fluids of individuals.

An inter-organ cross talk indicator can be derived from cells or tissue originating from an organ suspected of having a disease, or a body fluid suspected of having a disease, and from cells or tissue originating from one or more other organs for each stage of the disease. An inter-organ cross talk indicator can also be derived from the corresponding cells or tissue of an individual without the specific disease.

The time at which cells, tissue, or body fluids are collected can suitably be selected according to a specific disease from, for example, the following: before the onset of a specific disease (in the normal state), at the onset of a specific disease, 1 hour, 6 hours, 1 day, 1 week, 1 month, 6 months, 1 year, 2 years, 3 years, 5 years, or 10 years after the onset of a specific disease, and the like.

The description in the “2. Methods for collecting and storing cells or tissue, or body fluids for extraction of an inter-organ cross talk indicator, and methods for extracting and measuring an inter-organ cross talk indicator” section above is incorporated herein by reference. An inter-organ cross talk indicator is extracted and measured qualitatively or quantitatively according the methods described in Section 2, and the amount of the inter-organ cross talk indicator is obtained as data.

The obtained data can be stored in the storage unit of an apparatus, or an apparatus having a storage unit that is different from the apparatus, for each disease, each organ or body fluid, each stage, each type of individual, each age group of individuals, and/or each sex of individuals.

Next, patterns for standard data are determined from the data obtained above and used in the present invention (Reverse iOrgans, Forward iOrgans, D-iOrgans) as described below.

4. Reverse iOrgans

4-1. Outline

In this embodiment, the presence of a disease in a specific organ and/or the stage of the specific disease in a subject is predicted from a pattern of an inter-organ cross talk indicator derived from each of one or more organs other than the specific organ of the subject. Specifically, data of the subject regarding an inter-organ cross talk indicator in each of one or more organs other than the specific organ is obtained by performing the measurement method described in Section 2 above, and the inter-organ cross talk indicator is derived from cells or tissue originating from each of the one or more organs. The data of the subject is compared with standard data 1 derived beforehand from the corresponding inter-organ cross talk indicator. Then, similarity of patterns of the inter-organ cross talk indicators is calculated, and the presence of the specific disease and/or the stage of the specific disease is predicted using the similarity as a measure. More specifically, this embodiment comprises the steps of (1) obtaining data of a subject derived from an inter-organ cross talk indicator in each of one or more organs other than the specific organ of the subject, the inter-organ cross talk indicator being derived from cells or tissue originating from each of the one or more organs; (2) calculating, by comparing the data of the subject obtained in step (1) with standard data 1 derived beforehand from the corresponding inter-organ cross talk indicator, similarity of patterns of the inter-organ cross talk indicators; and (3) determining that the subject has a specific disease corresponding to the standard data 1 and/or that the subject is in a stage of a specific disease corresponding to the standard data 1 when it is determined that the similarity of patterns of the inter-organ cross talk indicators calculated in step (2) is similar. Here, step (3) can also be read as the step of predicting the presence of a disease in a specific organ and/or the stage of the disease in the specific organ using, as a measure, the similarity of patterns of the inter-organ cross talk indicators obtained in step (2). The one or more organs other than the specific organ may be two or more organs. That is, (1′) data of a subject regarding an inter-organ cross talk indicator in each of multiple organs other than the specific organ of the subject is obtained from cells or tissue originating from each of the organs; (2′) the data of the subject derived from each organ obtained in step (1′) is compared with corresponding standard data 1 derived beforehand from the inter-organ cross talk indicator in the organ, and similarity of patterns of the inter-organ cross talk indicators between each set of data of the subject and each corresponding standard data 1 is calculated; (3′) it may be determined that the subject has a specific disease corresponding to the standard data 1 and/or that the subject is in a stage of a specific disease corresponding to the standard data 1 when it is determined that the similarity of patterns of the inter-organ cross talk indicators calculated in step (2′) is similar between each set of data of the subject and each corresponding standard data 1. In this case, the similarity between the data of the subject derived from each organ and the corresponding standard data 1 derived from the organs other than the specific organ may be sequentially calculated for each standard data 1 in each organ. In another embodiment, the similarity between the data of the subject derived from each organ and the corresponding standard data 1 derived from the organs other than the specific organ may be simultaneously calculated for each standard data 1 in each organ, and the presence of the specific disease and/or the stage of the specific disease may be predicted in the organs other than the specific organ simultaneously. The calculation is preferably performed simultaneously.

Step (1) may be performed in such a manner that data of the subject is obtained by actually performing the measurement method described in Section 2 above, or in such a manner that data of the subject already obtained is further put into the prediction apparatus described later or the like. The method for calculating the similarity between the standard data 1 and the data of the subject in step (2), and the method for determining whether the standard data 1 and the data of the subject are similar in step (3), can be performed according to the methods described in the “1. Explanation of terms” section above. Here, step (1) and step (2) are not necessarily performed consecutively in the same organization. For example, the data of the subject obtained in step (1) may be sent to a third-party organization to perform step (2) and the step after step (2).

This embodiment may further comprise the following steps before step (1): (i) extracting the inter-organ cross talk indicator from the cells or tissue originating from each of the one or more organs other than the specific organ of the subject, and (ii) measuring the amount of the inter-organ cross talk indicator extracted in step (i). In this case, step (i) and step (ii) are not necessarily performed consecutively. For example, the inter-organ cross talk indicator obtained in step (i) may be sent to a third-party organization to perform step (ii). Step (ii) and step (1) are also not necessarily performed consecutively. The results of measurement of the inter-organ cross talk indicator obtained in step (ii) may be sent to a third-party organization to perform step (1) and the steps after step (1).

Here, the method for calculating the similarity between the standard data 1 and the data of the subject, and the method for determining whether the standard data 1 and the data of the subject are similar are as described in the “1. Explanation of terms” section above.

As another embodiment, this embodiment also includes a method for obtaining information regarding the similarity of patterns of inter-organ cross talk indicators to predict the presence of a specific disease and/or the stage of the specific disease in a subject, the method comprising steps (1) and (2) mentioned above, and the step of obtaining the information from step (2).

4-2. System Configuration

FIG. 8 is an overview of a system 100 according to a first embodiment of the present invention, and FIG. 9 is a block diagram illustrating a hardware configuration of the system 100. The system 100 comprises a prediction apparatus 1, an input unit 4, a display unit 5, and an apparatus 6.

The prediction apparatus 1 includes, for example, a general-purpose personal computer, and comprises a CPU 101 for performing data processing described later, a memory 102 serving as a work area for data processing, a storage unit 103 for storing processed data, a bus 104 for transmitting data between the units, and an interface unit 105 (hereinafter referred to as “I/F unit”) for performing data input and output between the apparatus 1 and external devices. The input unit 4 and the display unit 5 are connected to the prediction apparatus 1. The input unit 4 includes, for example, a keyboard, and the display unit 5 includes, for example, a liquid crystal display. The input unit 4 and the display unit 5 may be integrated and implemented as a display with a touch panel. The prediction apparatus 1 need not be a single apparatus, and the CPU 101, the memory 102, the storage unit 103, and the like may be located in separate places and connected via a network. The apparatus 1 may also be an apparatus that omits the input unit 4 and the display unit 5 and that does not require an operator.

The prediction apparatus 1 and the apparatus 6 are also not necessarily located in one place and may be configured such that the apparatuses located in separate places are communicatively connected to each other via a network.

In the explanation below, a process performed by the prediction apparatus 1 means a process performed by the CPU 101 of the prediction apparatus 1 based on a prediction program unless otherwise specified. The CPU 101 temporarily stores necessary data (such as intermediate data being processed) in the memory 102 that serves as a work area, and suitably stores data that are stored for a long period of time, such as computation results, in the storage unit 103.

The apparatus 6 is an apparatus for measuring RNA expression levels by the RNA-Seq method or measuring the amounts of metabolites by mass spectrometry. The apparatus 6 comprises an analysis unit 61. A sample in which a reaction for RNA-Seq has been carried out is set in the analysis unit 61 to perform analysis of nucleotide sequences in the analysis unit 61.

The apparatus 6 is connected to the prediction apparatus 1 by a wired or wireless connection. The apparatus 6 A/D converts the measurement values of mRNAs and transmits them as digital data to the prediction apparatus 1. Therefore, the prediction apparatus 1 can obtain the measurement values of mRNAs as digital data that can be computed. In this embodiment, digital data from the apparatus 6 is referred to as “data of a subject derived from an inter-organ cross talk indicator” or simply referred to as “data of a subject.”

4-3. Prediction Apparatus

As the first embodiment, the present invention includes a prediction apparatus for predicting the presence of a specific disease and/or the stage of the specific disease in a subject, the apparatus comprising the following computation means:

a means for obtaining data of the subject derived from an inter-organ cross talk indicator in each of one or more organs other than the specific organ of the subject, the inter-organ cross talk indicator being derived from cells or tissue originating from each of the one or more organs;

a means for calculating, by comparing the data of the subject with standard data derived beforehand from the corresponding inter-organ cross talk indicator, similarity of patterns of the inter-organ cross talk indicators; and

a means for predicting the presence of the specific disease and/or the stage of the specific disease by using, as a measure, the similarity of patterns of the inter-organ cross talk indicators calculated by the pattern similarity calculation means.

Here, the method for calculating the similarity between the standard data 1 and the data of the subject and the method for determining whether the standard data 1 and the data of the subject are similar are as described in the “1. Explanation of terms” section above.

In this embodiment, the presence of a specific disease and/or the stage of the specific disease in a subject can be predicted by the system 100 (FIGS. 8 and 9) comprising the prediction apparatus 1 as the prediction apparatus described above.

FIG. 10 is a block diagram to illustrate a function of the prediction apparatus 1 according to the first embodiment of the present invention. The prediction apparatus 1 comprises a subject data obtaining unit 11, a pattern similarity calculation unit 12, and a prediction unit 13. These functional blocks are implemented by installing the prediction program according to the present invention in the storage unit 103 or the memory 102 of the prediction apparatus 1 and causing the CPU 101 to execute the program. With this structure, the prediction apparatus 1 carries out the prediction method described later in the “4-5. Prediction method” section. The subject data obtaining means, pattern similarity calculation means, and prediction means recited in the claims correspond to the subject data obtaining unit 11, the pattern similarity calculation unit 12, and the prediction unit 13 shown in FIG. 10, respectively.

In other words, the prediction apparatus 1 is a prediction apparatus for predicting the presence of a specific disease and/or the stage of the specific disease in a subject, the apparatus executing the following computation functions by the CPU 101:

a function of obtaining data of the subject derived from an inter-organ cross talk indicator in each of one or more organs other than the specific organ, the inter-organ cross talk indicator being derived from cells or tissue originating from each of the one or more organs;

a function of calculating, by comparing the data of the subject obtained by the subject data obtaining function with standard data 1 derived beforehand from the corresponding inter-organ cross talk indicator, similarity of patterns of the inter-organ cross talk indicators; and

a function of predicting the presence of the specific disease and/or the stage of the specific disease using, as a measure, the similarity of patterns of the inter-organ cross talk indicators obtained by the pattern similarity calculation function.

In this embodiment, the subject data obtaining unit 11 obtains subject data M4 of an inter-organ cross talk indicator measured in the apparatus 6 from the apparatus 6. Standard data D1 (standard data 1) is stored outside the prediction apparatus 1 and put into the prediction apparatus 1 via, for example, the Internet.

The subject data M4 may also be put into the prediction apparatus 1 from a third-party organization (not shown) via a network. The subject data M4 and the standard data D1 (standard data 1) may be stored in the storage unit 103 or the memory 102 of the prediction apparatus 1 beforehand.

The pattern similarity calculation unit 12 compares the subject data M4 with the standard data D1 (standard data 1) and calculates the similarity of patterns of the inter-organ cross talk indicators. The prediction unit 13 predicts the presence of the specific disease and/or the stage of the specific disease using, as a measure, the similarity of patterns of the inter-organ cross talk indicators obtained by the pattern similarity calculation unit 12. The pattern similarity calculation unit 12 and the prediction unit 13 are functional blocks that respectively execute the pattern similarity calculation step and the prediction step in the prediction method according to the first embodiment of the present invention described later in the “4-5. Prediction method” section. The details of the computation processing of these steps are described in the “4-5. Prediction method” section with reference to FIG. 11.

Further, the functional blocks, i.e., the subject data obtaining unit 11, the pattern similarity calculation unit 12, and the prediction unit 13, are not necessarily executed by a single CPU, and may be processed distributively by multiple CPUs. For example, these functional blocks may be configured such that the function of the subject data obtaining unit 11 is executed by a CPU of a first computer and such that the functions of the pattern similarity calculation unit 12 and the prediction unit 13 are executed by a CPU of a second computer, i.e., another computer.

4-4. Prediction Program

Further, in order to carry out steps S11 to S16 in FIG. 11 described below, the prediction apparatus 1 stores the prediction program according to the present invention in the storage unit 103 beforehand, for example, in an executable format (for example, a form in which the program can be produced by being converted from a programming language using a compiler). The prediction apparatus 1 carries out processing using the prediction program stored in the storage unit 103.

Specifically, the prediction program according to the first embodiment of the present invention is a prediction program that, when executed by a computer, causes the computer to carry out the following processing to predict the presence of a specific disease and/or the stage of the specific disease in a subject:

processing of obtaining data of the subject derived from an inter-organ cross talk indicator in each of one or more organs other than the specific organ, the inter-organ cross talk indicator being derived from cells or tissue originating from each of the one or more organs;

processing of calculating, by comparing the data of the subject obtained by the subject data obtaining processing with standard data 1 derived beforehand from the corresponding inter-organ cross talk indicator, similarity of patterns of the inter-organ cross talk indicators; and

processing of predicting the presence of the specific disease and/or the stage of the specific disease by using, as a measure, the similarity of patterns of the inter-organ cross talk indicators obtained by the pattern similarity calculation processing.

In this embodiment, as shown in FIG. 9, the prediction program is stored in a computer-readable non-transitory tangible storage medium 109, such as a CD-ROM, and is installed in the prediction apparatus 1 from the storage medium 109; alternatively, the prediction apparatus 1 may be connected to the Internet (not shown) to download the program code of the prediction program via the Internet. To cause a computer to carry out the computation processing described above, the prediction program according to the present invention may also be linked to another program stored in the storage unit 103 or the memory 102. For example, the prediction program may be linked to statistical analysis software mentioned in the “1. Explanation of terms” section above, and the pattern similarity calculation processing may be carried out using the statistical analysis software.

The subject data obtaining processing corresponds to computation processing that is performed by the subject data obtaining unit 11 implemented through execution of the prediction program by the prediction apparatus 1. The prediction processing corresponds to computation processing that is performed by the prediction unit 13 implemented through execution of the prediction program by the prediction apparatus 1.

4-5. Prediction Method

The prediction apparatus 1 according to the first embodiment of the present invention carries out the prediction method according to the first embodiment of the present invention. The prediction method according to the first embodiment of the present invention is a method for predicting the presence of a specific disease and/or the stage of the specific disease in a subject, the method comprising:

a step of calculating similarity of patterns of the inter-organ cross talk indicators by comparing data of the subject regarding an inter-organ cross talk indicator in each of one or more organs other than the specific organ, the inter-organ cross talk indicator being derived from cells or tissue originating from each of the one or more organs, with standard data 1 derived beforehand from the corresponding inter-organ cross talk indicator; and

a step of predicting the presence of the specific disease and/or the stage of the specific disease by using, as a measure, the similarity of patterns of the inter-organ cross talk indicators obtained in the pattern similarity calculation step.

FIG. 11 is a flow chart illustrating a flow of data processing performed by the prediction apparatus 1 according to the first embodiment of the present invention to carry out the prediction method above. The processing of steps S11 to S16 shown in FIG. 11 is performed by the subject data obtaining unit 11, the pattern similarity calculation unit 12, and the prediction unit 13 shown in FIG. 10.

In step S11, the subject data obtaining unit 11 obtains subject data M4. The subject data M4 is a pattern of an inter-organ cross talk indicator in each of one or more organs other than a specific organ of a subject, the inter-organ cross talk indicator being derived from cells or tissue originating from each of the one or more organs, and transmitted from the apparatus 6 to the prediction apparatus 1.

In step S12, the pattern similarity calculation unit 12 compares the obtained subject data M4 of the inter-organ cross talk indicator with standard data D1 (standard data 1) and calculates similarity of patterns of the inter-organ cross talk indicators. The method for calculating the similarity and the method for determining whether patterns are similar are as described in the “1. Explanation of terms” section above. The prediction program described in the “4-4. Prediction program” section above may comprise program code of a program for causing the CPU 101 of the prediction apparatus 1 to perform computation processing by the pattern similarity calculation unit 12, or, for example, may be linked to statistical analysis software mentioned in the “1. Explanation of terms” section above to cause the CPU 101 to perform computation processing by the pattern similarity calculation unit 12 using the statistical analysis software.

In step S14, the prediction unit 13 predicts the presence of a specific disease and/or the stage of the specific disease by using, as a measure, the similarity obtained in step S12. Specifically, when it is determined from the similarity that patterns are similar (“YES” in step 13), the prediction unit 13 determines in step S14 that the subject has a specific disease corresponding to a pattern in the standard data D1 (standard data 1) that is similar to the subject data M4, and/or the subject is in a stage of a specific disease corresponding to the standard data D1 (standard data 1).

When it is determined from the similarity obtained in step S12 that patterns are not similar (“NO” in step 13), the prediction unit 13 determines in step S16 that the subject does not have a specific disease corresponding to the standard data D1 (standard data 1), and/or the subject is not in a stage of a specific disease corresponding to the standard data D1 (standard data 1).

In step S15, the prediction unit 13 outputs the results determined in step S14 or 16 as prediction result data. In this embodiment, the prediction results are displayed on the display unit 5 and the prediction result data is stored in the storage unit 103 in the prediction apparatus 1. The prediction results may be displayed on a display unit of a computer terminal connected to the prediction apparatus 1 via the Internet that is external to the prediction apparatus 1, for example, in a third-party organization, instead of displaying the prediction results on the display unit 5.

The specific procedure of each step is in accordance with the description in the “4-1. Outline” section above.

5. Forward iOrgans

5-1. Outline

In this embodiment, the presence of a disease and/or the stage of the disease in each of one or more organs other than a specific organ in a subject affected with a disease in the specific organ is predicted. Specifically, the presence of a disease and/or the stage of the disease in each of one or more organs other than a specific organ in a subject affected with a disease in the specific organ is predicted based on information regarding the stage of the disease in the specific organ in the subject obtained from diagnostic results of the subject. This embodiment comprises the steps of (i) obtaining information regarding a stage of the disease in the specific organ in the subject from diagnostic results of the subject; (ii) checking the information about the stage obtained in step (i) against standard data 2; (iii) determining, from the standard data 2, standard data α at a stage of the disease in the specific organ corresponding to the information about the stage, based on the checking results obtained in step (ii), and extracting, from the standard data α, a pattern of an inter-organ cross talk indicator corresponding to the stage in the subject in each of one or more organs other than the specific organ in the subject; (iv) checking the pattern of the inter-organ cross talk indicator extracted in step (iii) against known information regarding the inter-organ cross talk indicators in diseases and/or stages of the diseases, and determining the presence of a disease and/or the stage of the disease in each of the one or more organs other than the specific organ corresponding to the pattern of the inter-organ cross talk indicator in each of the one or more organs other than the specific organ in the subject; and (v) further determining that the disease in each of the one or more organs other than the specific organ determined in step (iv) is a disease from which the subject may be suffering, and/or further determining that the stage of the disease in each of the one or more organs other than the specific organ determined in step (iv) is a stage of a disease from which the subject is suffering. Here, steps (iv) and (v) above may be combined into step (iv′) predicting the presence and/or stage of a disease in each of the one or more organs other than the specific organ by using, as a measure, the pattern of the inter-organ cross talk indicator obtained in step (iii). Here, the one or more organs other than the specific organ may be multiple organs. That is, steps (iv) and (v) may be the following: (iv″) checking the patterns of the inter-organ cross talk indicators in the multiple organs other than the specific organ in the subject extracted from the standard data α determined in step (iii) against known information regarding inter-organ cross talk indicators in diseases and/or stages of the diseases, and determining the presence of a disease and/or the stage of the disease in each of the multiple organs other than the specific organ corresponding to the pattern of the inter-organ cross talk indicator in each of the multiple organs other than the specific organ in the subject; and (v″) further determining that the disease in each of the multiple organs other than the specific organ determined in step (iv″) is a disease from which the subject may be suffering, and/or further determining that the stage of the disease in each of the multiple organs other than the specific organ determined in step (iv″) is a stage of a disease from which the subject is suffering.

In step (i), the diagnostic results of the subject are not limited as long as they are derived by, for example, a physician based on, for example, test results or a medical interview. The diagnostic results may be information obtained from, for example, a paper chart or may be electronic data extracted from, for example, an electronic chart. In step (i), information about the stage of the disease in the specific organ in the subject is obtained as, for example, oral, written, or digital information based on the diagnostic results of the subject. That is, the information about the stage of the disease in the specific organ in the subject is information regarding in what stage of the disease in the specific organ the subject is.

In checking the information regarding the stage obtained in step (i) against the standard data 2 in step (ii), for example, it is checked whether the name of the stage matches the name of the stage of the disease in the specific organ assigned to each pattern of an inter-organ cross talk indicator in the standard data 2. The checking may be carried out visually, or may be carried out, for example, on database software, such as Microsoft (registered trademark) Excel (Microsoft Corporation) or Microsoft (registered trademark) Access (Microsoft Corporation), using the search function, the filtering function, or the like of the software.

In step (iii), patterns of inter-organ cross talk indicators linked with the name of the stage of the disease in the specific organ of the subject are extracted based on the results of the checking in step (ii). The group of the extracted patterns of inter-organ cross talk indicators is determined to be standard data α. Further, at least one organ other than the specific organ is selected from the names of organs linked with the corresponding patterns of inter-organ cross talk indicators contained in standard data α, and the pattern of the inter-organ cross talk indicator in the at least one selected organ is extracted. Selection of at least one organ other than the specific organ and extraction of the pattern of the inter-organ cross talk indicator in the at least one selected organ may be carried out visually, or may be carried out on the database software described above using the search function, the filtering function, or the like of the software. When the group of the extracted patterns of inter-organ cross talk indicators is a group of patterns of expression of at least one RNA, the standard data α may also be referred to as “standard data α1.” When the group of the extracted patterns of inter-organ cross talk indicators is a group of patterns of presence of at least one metabolite, the standard data α may also be referred to as “standard data α2.”

In step (iv), the similarity between the extracted pattern of the inter-organ cross talk indicator in the at least one selected organ and the information regarding inter-organ cross talk indicators in diseases and/or stages of the diseases stored in a database of known information regarding diseases (e.g., DPC database (provided by Japanese Ministry of Health, Labour and Welfare), PubMed (provided by National Center for Biotechnology Information), Embase (provided by Elsevier), or Cochrane Library (Cochrane); hereinafter also referred to as “disease information database”) is calculated and determined. Subsequently, the name of a disease, or the name of a stage of a disease, whose pattern of the inter-organ cross talk indicator stored in the disease information database is determined to be wholly or partially similar to the pattern of the inter-organ cross talk indicator in the at least one selected organ is extracted. Whether the pattern of the inter-organ cross talk indicator in the at least one selected organ is similar to the known information can be determined according to the method for determining similarity described in the “1. Explanation of terms” section above. It can then be determined that the extracted disease is present in the selected organ other than the specific organ or that the selected organ other than the specific organ is in the extracted stage of the disease. In this determination process, the pattern of the inter-organ cross talk indicator in the at least one selected organ can be compared with known information regarding the inter-organ cross talk indicator in healthy individuals to determine that the organ is normal.

In step (v), it is further determined that the disease in the selected organ other than the specific organ and/or the stage of the disease determined in step (iv) is a disease and/or a stage of a disease from which the subject may be suffering. When multiple diseases are determined in step (iv), it can be determined that a disease showing high similarity to the pattern of the inter-organ cross talk indicator in the selected organ is a disease from which the subject may be suffering. When multiple stages of diseases are determined in step (iv), it can be determined that a stage of a disease showing high similarity to the pattern of the inter-organ cross talk indicator in the selected organ is the stage of the disease from which the subject may be suffering.

Further, this embodiment may also be a method for obtaining information to predict the presence of a disease and/or the stage of the disease in each of one or more organs other than a specific organ in a subject affected with a disease in the specific organ, the method comprising steps (i) to (iii) above, and further comprising, instead of step (iv) above, step (iv′) of checking the pattern of the inter-organ cross talk indicator extracted in step (iii) against known information regarding inter-organ cross talk indicators in diseases and/or the stages of the diseases, and obtaining information regarding the presence of a disease and/or the stage of the disease in each of the one or more organs other than the specific organ corresponding to the pattern of the inter-organ cross talk indicator in each of the one or more organs other than the specific organ in the subject. The step of checking the extracted pattern of the inter-organ cross talk indicator against known information regarding inter-organ cross talk indicators in diseases and/or stages of the diseases is in accordance with step (iv) above.

5-2. System Configuration

FIG. 12 is an overview of a system 110 according to a second embodiment of the present invention, and FIG. 13 is a block diagram illustrating the hardware configuration of the system 110. The system 110 comprises a prediction apparatus 2, an input unit 4, and a display unit 5.

The prediction apparatus 2 includes, for example, a general-purpose personal computer, and comprises a CPU 101 for performing data processing described later, a memory 102 serving as a work area for data processing, a storage unit 103 for storing processed data, a bus 104 for transmitting data between the units, and an interface unit 105 (hereinafter referred to as an “I/F unit”) for performing data input and output between the apparatus 2 and external devices. The input unit 4 and the display unit 5 are connected to the prediction apparatus 2. The input unit 4 includes, for example, a keyboard, and the display unit 5 includes, for example, a liquid crystal display. The input unit 4 and the display unit 5 may be integrated and implemented as a display with a touch panel. The prediction apparatus 2 need not be a single apparatus, and the CPU 101, the memory 102, the storage unit 103, and the like may be located in separate places and connected via a network. The apparatus 2 may also be an apparatus that omits the input unit 4 and the display unit 5 and that does not require an operator.

In the explanation below, a process performed by the prediction apparatus 2 means a process performed by the CPU 101 of the prediction apparatus 2 based on a prediction program unless otherwise specified. The CPU 101 temporarily stores necessary data (such as intermediate data being processed) in the memory 102 that serves as a work area, and suitably stores data that are stored for a long period of time, such as computation results, in the storage unit 103.

As described above, the hardware configuration of each of the prediction apparatus 2, the input unit 4, and the display unit 5 of the system 110 may be the same as that of each of the prediction apparatus 2, the input unit 4, and the display unit 5 of the system 100 shown in FIG. 8.

5-3. Prediction Apparatus

The invention includes, as the second embodiment, a prediction apparatus for predicting the presence of a disease and/or the stage of the disease in each of one or more organs other than the specific organ in a subject affected with a specific disease, the apparatus comprising the following computation means:

a means for obtaining information about a stage of the disease in the specific organ in the subject;

a means for checking the information about the stage obtained by the stage information obtaining means against standard data 2;

a means for extracting a pattern of an inter-organ cross talk indicator in each of one or more organs other than the specific organ in the subject based on the results obtained by the stage information checking means; and

a means for predicting the presence of a disease and/or the stage of the disease in each of the one or more organs other than the specific organ by using, as a measure, the pattern of the inter-organ cross talk indicator obtained by the pattern extraction means.

In this embodiment, the presence of a disease and/or the stage of the disease in each of one or more organs other than a specific organ in a subject can be predicted by the system 110 (FIGS. 12 and 13) comprising the prediction apparatus 2 described in the “5-2. System configuration” section as the prediction apparatus above.

FIG. 14 is a block diagram to illustrate a function of the prediction apparatus 2 according to the second embodiment of the present invention. The prediction apparatus 2 comprises a stage information obtaining unit 21, a stage information checking unit 22, a pattern extraction unit 23, and a prediction unit 24. These functional blocks are implemented by installing the prediction program according to the present invention in the storage unit 103 or the memory 102 of the prediction apparatus 2 and causing the CPU 101 to execute the program. With this structure, the prediction apparatus 2 carries out the prediction method described later in the “5-5. prediction method” section. The stage information obtaining means, stage information checking means, pattern extraction means, and prediction means recited in the claims correspond to the stage information obtaining unit 21, the stage information checking unit 22, the pattern extraction unit 23, and the prediction unit 24 shown in FIG. 14, respectively.

In other words, the prediction apparatus 2 is a prediction apparatus for predicting the presence of a disease and/or the stage of the disease in each of one or more organs other than a specific organ in a subject affected with a disease in the specific organ, the apparatus executing the following computation functions by the CPU 101:

a function of obtaining information regarding a stage of the disease in the specific organ in the subject;

a function of checking the information regarding the stage obtained by the stage information obtaining function against standard data 2;

a function of extracting a pattern of an inter-organ cross talk indicator in each of one or more organs other than the specific organ in the subject based on the results obtained by the stage information checking function, and

a function of predicting the presence of a disease and/or the stage of the disease in each of the one or more organs other than the specific organ by using, as a measure, the pattern of the inter-organ cross talk indicator obtained by the pattern extraction function.

In this embodiment, for example, a user operates the input unit 4 to input information regarding in what stage of the disease in the specific organ (specific disease) the subject is. The stage information obtaining unit 21 obtains the input information about the stage of the specific disease (specific disease stage information). Standard data D1 (standard data 2) and disease information database D2 are stored outside the prediction apparatus 2 and put into the prediction apparatus 2 via, for example, the Internet.

The standard data D1 (standard data 2) and the disease information database D2 may be stored in the storage unit 103 or the memory 102 of the prediction apparatus 2 beforehand.

The stage information checking unit 22 checks the stage of the specific disease obtained by the stage information obtaining unit 21 against the standard data D1 (standard data 2), and the pattern extraction unit 23 extracts a pattern of an inter-organ cross talk indicator in each of one or more organs other than the specific organ in the subject based on the results obtained by the stage information checking unit 22. The prediction unit 24 predicts the presence of a disease and/or the stage of the disease in each of the one or more organs other than the specific organ by using, as a measure, the pattern of the inter-organ cross talk indicator obtained by the pattern extraction unit 23. The stage information checking unit 22, the pattern extraction unit 23, and the prediction unit 24 are functional blocks that respectively execute the stage information checking step, the pattern extraction step, and the prediction step of the prediction method according to the second embodiment of the present invention described later in the “5-5. Prediction method” section. The details of the computation processing of these steps are described in the “5-5. Prediction method” section with reference to FIG. 15.

Further, the functional blocks, i.e., the stage information obtaining unit 21, the stage information checking unit 22, the pattern extraction unit 23, and the prediction unit 24, are not necessarily executed by a single CPU, and may be processed distributively by multiple CPUs. For example, these functional blocks may be configured such that the function of the stage information obtaining unit 21 is executed by a CPU of a first computer and such that the functions of the stage information checking unit 22, the pattern extraction unit 23, and the prediction unit 24 are executed by a CPU of a second computer, i.e., another computer.

5-4. Prediction Program

Further, in order to carry out steps S21 to S29 in FIG. 15 described below, the prediction apparatus 2 stores the prediction program according to the present invention beforehand in the storage unit 103, for example, in an executable format. The prediction apparatus 2 carries out processing using the prediction program stored in the storage unit 103.

Specifically, the prediction program according to the second embodiment of the present invention is a prediction program that, when executed by a computer, causes the computer to carry out the following processing to predict the presence of a disease and/or the stage of the disease in each of one or more organs other than a specific organ in a subject affected with a disease in the specific organ:

processing of obtaining information regarding a stage of the disease in the specific organ in the subject;

processing of checking the information about the stage obtained by the stage information obtaining processing against standard data 2;

processing of extracting a pattern of an inter-organ cross talk indicator in each of one or more organs other than the specific organ in the subject based on the results obtained by the stage information checking processing; and

processing of predicting the presence of a disease and/or the stage of the disease in each of the one or more organs other than the specific organ by using, as a measure, the pattern of the inter-organ cross talk indicator obtained by the pattern extraction processing.

In this embodiment, as shown in FIG. 13, the prediction program is stored in a computer-readable non-transitory tangible storage medium 109, such as a CD-ROM, and installed to the prediction apparatus 2 from the storage medium 109; alternatively, the prediction apparatus 2 may be connected to the Internet (not shown) to download the program code of the prediction program via the Internet. To cause a computer to carry out the computation processing described above, the prediction program according to the present invention may be linked to another program stored in the storage unit 103 or the memory 102. For example, the prediction program may be linked to commercially available database software mentioned in the “5-1. Outline” section above, and the stage information checking processing and the pattern extraction processing may be carried out using the database software.

The stage information obtaining processing corresponds to computation processing that is performed by the stage information obtaining unit 21 implemented through execution of the prediction program by the prediction apparatus 2. The stage information checking processing corresponds to computation processing that is performed by the stage information checking unit 22 implemented through execution of the prediction program by the prediction apparatus 2. The pattern extraction processing corresponds to computation processing that is performed by the pattern extraction unit 23 implemented through execution of the prediction program by the prediction apparatus 2. The prediction processing corresponds to computation processing that is performed by the prediction unit 24 implemented through execution of the prediction program by the prediction apparatus 2.

5-5. Prediction Method

The prediction apparatus 2 according to the second embodiment of the present invention carries out the prediction method according to the second embodiment of the present invention. The prediction method according to the second embodiment of the present invention is a method for predicting the presence of the disease and/or the stage of the disease in each of one or more organs other than a specific organ in a subject affected with a disease in the specific organ, the method comprising:

a step of obtaining information regarding a stage of the disease in the specific organ in the subject;

a step of checking the stage obtained in the stage information obtaining step against standard data 2;

a step of extracting a pattern of an inter-organ cross talk indicator in each of one or more organs other than the specific organ in the subject based on the checking results obtained in the stage information checking step; and

a step of predicting the presence of a disease and/or the stage of the disease in each of the one or more organs other than the specific organ by using, as a measure, the pattern of the inter-organ cross talk indicator obtained in the pattern extraction step.

FIG. 15 is a flow chart illustrating a flow of data processing performed by the prediction apparatus 2 according to the second embodiment of the present invention to carry out the prediction method above. The processing of steps S21 to S29 shown in FIG. 15 is performed by the stage information obtaining unit 21, the stage information checking unit 22, the pattern extraction unit 23, and the prediction unit 24 shown in FIG. 14.

In step S21, the stage information obtaining unit 21 obtains stage information. The stage information is information regarding in what stage of the disease in the specific organ the subject is. The stage information obtaining unit 21 obtains the stage information by, for example, operation of the input unit 4. The manner in which the stage information is obtained is not limited to this, and the stage information may be stored in the storage unit 103 of the prediction apparatus 2 from an electronic chart or by any method, such as external data communication.

In step S22, the stage information checking unit 22 checks the stage information against standard data D1 (standard data 2). Subsequently, in step S23, the pattern extraction unit 23 determines, from the standard data D1 (standard data 2), standard data α at a stage of the disease in the specific organ corresponding to the stage information, based on the checking results obtained in step S22, and extracts, from the standard data α, a pattern of an inter-organ cross talk indicator corresponding to the stage in the subject in each of the one or more organs other than the specific organ in the subject. The specific procedure for extraction is in accordance with the description in the “4-1. Outline” section above. The prediction program described in the “5-4. Prediction program” section above may comprise program code of a program for causing the CPU 101 of the prediction apparatus 2 to perform computation processing by the stage information checking unit 22 and the pattern extraction unit 23 or, for example, may be linked to commercially available database software mentioned above to cause the CPU 101 to perform the computation processing by the stage information checking unit 22 and the pattern extraction unit 23, using the database software.

In step S24, the prediction unit 24 suitably accesses a disease information database D2 downloaded outside of the prediction apparatus 2 or downloaded in the memory 102 or the storage unit 103, and calculates and determines similarity between the pattern of the inter-organ cross talk indicator in each of the one or more organs extracted in step S23 and information regarding the inter-organ cross talk indicator stored in the disease information database. In step S26, it is determined that there is, in an organ other than the specific organ, a disease determined to have a pattern that is wholly or partially similar to the pattern of the inter-organ cross talk indicator in the organ (“YES” in step S25), or it is determined that an organ other than the specific organ is in a stage of a disease determined to have a pattern that is wholly or partially similar to the pattern of the inter-organ cross talk indicator in the organ (“YES” in step S25). In step S27, it is predicted that the subject is suffering from the disease determined in step S26 or that the subject is in the stage of the disease determined in step S26. The prediction program described in the “5-4. Prediction program” section above may comprise program code of a program for causing the CPU 101 of the prediction apparatus 2 to perform computation processing by the prediction unit 24 or, for example, may be linked to statistical analysis software mentioned in the “1. Explanation of terms” section above to cause the CPU 101 to perform the computation processing by the prediction unit 24, using the statistical analysis software.

In step S28, the prediction unit 24 outputs the results predicted in step S27. In this embodiment, the prediction results are displayed on the display unit 5, and the prediction results are stored in the storage unit 103 in the prediction apparatus 2. The prediction results may be displayed on a display unit of a computer terminal connected to the prediction apparatus 2 via the Internet that is external to the prediction apparatus 2, for example, in a third-party organization, instead of displaying the prediction result on the display unit 5.

When it is determined in step S25 from the results in step S24 that patterns are not similar (“NO” in step S25), the prediction unit 24 determines in step S29 that there are no similar patterns.

The specific procedure of each step is in accordance with the description in the “5-1. Outline” section above.

6. D-iOrgans

6-1. Outline

In this embodiment, the efficacy or side effect (or side effects) of a test substance are predicted from subject data X regarding an inter-organ cross talk indicator in each of one or more organs of an individual to which the test substance has been administered. The inter-organ cross talk indicator is derived from cells or tissue originating from each of the one or more organs. Specifically, subject data X regarding the inter-organ cross talk indicator in each of one or more organs of an individual to which a test substance has been administered, derived from cells or tissue originating from each of the one or more organs is compared with standard data Y derived beforehand from the corresponding inter-organ cross talk indicator, similarity of patterns of the inter-organ cross talk indicators is calculated, and the efficacy or side effect (or side effects) of the test substance in each of the one or more organs and/or each of one or more organs other than the one or more organs are predicted by using the similarity as a measure. The subject data X is obtained by performing the measurement method described in Section 2 above. More specifically, this embodiment comprises (1) a step of calculating similarity of patterns of the inter-organ cross talk indicators by comparing subject data X regarding an inter-organ cross talk indicator in each of one or more organs of an individual to which a test substance has been administered, the inter-organ cross talk indicator being derived from cells or tissue originating from each of the one or more organs, with standard data Y derived beforehand from the corresponding inter-organ cross talk indicator, and (2) a step of predicting efficacy a side effect (or side effects) of the test substance in each of the one or more organs and/or each of one or more organs other than the one or more organs by using, as a measure, the similarity of patterns of the inter-organ cross talk indicators obtained in step (1). Preferably, step (2) is a step of predicting efficacy or a side effect (or side effects) of the test substance in each of one or more organs other than the one or more organs by using, as a measure, the similarity of patterns of the inter-organ cross talk indicators calculated in step (1). When the test substance is a known substance, the known efficacy or side effect (or side effects) of the known substance are excluded from the efficacy or side effect (or side effects) described above. Preferably, the liver and kidney can be excluded from organs when a side effect (or side effects) are predicted. Examples of preferred organs collected for predicting efficacy or a side effect (or side effects) include body fluids except for blood, skin, brown adipose, and white adipose tissue. Further, when the efficacy or side effect (or side effects) of the test substance in each of one or more organs other than the one or more organs are predicted, the efficacy or side effect (or side effects) may be predicted in one organ or multiple organs. When the efficacy or side effect (or side effects) are predicted in multiple organs, the prediction may be sequentially performed for each organ or simultaneously performed. The prediction is preferably performed simultaneously.

To obtain information about subject data X, this embodiment may further comprise, before step (1), step (i) of obtaining information relating to the subject data X regarding an inter-organ cross talk indicator in each of the one or more organs in the individual to which the test substance has been administered, the inter-organ cross talk indicator being derived from the cells or tissue originating from each of the one or more organs. Step (i) may comprise determining the subject data X of an inter-organ cross talk indicator from the amount of the inter-organ cross talk indicator in each of the one or more organs of the individual to which the test substance has been administered, the inter-organ cross talk indicator being derived from the cells or tissue originating from each of the one or more organs. Further, step (i) may comprise identifying or quantifying the inter-organ cross talk indicator extracted from the cells or tissue originating from each of the one or more organs of the individual to which the test substance has been administered. Moreover, to determine the value of the subject data X, step (i) may comprise step (m) of obtaining information regarding the amount of the inter-organ cross talk indicator derived from cells or tissue originating from one or more organs of a negative control (or negative controls) corresponding to the cells or tissue originating from the one or more organs of the individual to which the test substance has been administered. Further, step (m) may comprise identifying or quantifying the inter-organ cross talk indicator extracted from the cells or tissue originating from each of the one or more organs of the negative control (or negative controls).

Step (i) may also comprise extracting the inter-organ cross talk indicator derived from the cells or tissue originating from each of the one or more organs of the individual to which the test substance has been administered (if necessary, from the cells or tissue collected from the one or more organs of a negative control (or negative controls)).

Here, the negative control (or negative controls) may be used synonymously with a negative control (or negative controls) with no disease, and includes untreated animals, sham-operated animal models, etc. An individual from which data of a subject is obtained and a negative control individual or negative control individuals may be the same species or different species, and preferably are the same species.

The prediction method according to this embodiment may further comprise, before step (i), the steps of:

(ii) providing the test substance;

(iii) providing the individual;

(iv) administering the test substance provided in step (ii) to the individual provided in step (iii);

(v) collecting the one or more organs from the individual administered the test substance in step (iv); and

(vi) obtaining the cells or tissue from the one or more organs collected in step (v).

Cells or tissue used for this method is not particularly limited, and the description in the “2. Methods for collecting and storing cells or tissue, or body fluids for extraction of an inter-organ cross talk indicator, and methods for extracting and measuring an inter-organ cross talk indicator” section above is incorporated herein by reference. Regarding the method for extracting the inter-organ cross talk indicator derived from cells, tissue, or the like collected from an individual, the description in Section 2 above can also be incorporated herein by reference.

Regarding extraction of RNA, the description in Section 2 above can be incorporated herein by reference. Analysis of RNA expression may be performed according to a known method, and the description in Section 2 above can be incorporated herein by reference. Preferably, analysis of RNA expression can be performed, for example, by using real-time PCR, a microarray, or RNA-Seq. When qualitative or quantitative analysis of RNA expression is performed using a microarray, a microarray chip comprising probes corresponding to each RNA species contained in standard data Y may be prepared beforehand for each existing substance, each disease, and/or each organ.

When at least one metabolite is used as an inter-organ cross talk indicator, extraction of the metabolite and analysis of the amount of the metabolite can be performed by the methods described in Section 2 above. When metabolites shown in FIG. 27 or 28 are analyzed, GCMS analysis or CEMS analysis is preferably performed.

The similarity between subject data X and standard data Y can be determined according to the method for determining similarity described in Section 1 above.

Further, among examined inter-organ cross talk indicators, when the pattern of any one inter-organ cross talk indicator in subject data X is similar to a pattern of the corresponding inter-organ cross talk indicator in standard data Y, the efficacy or side effect (or side effects) may be predicted from the inter-organ cross talk indicator. When the pattern of two or more inter-organ cross talk indicators in subject data X is similar to a pattern of the corresponding inter-organ cross talk indicator in the standard data Y, the efficacy or side effect (or side effects) may be predicted from the inter-organ cross talk indicators.

When it is determined by this method that subject data X is similar to standard data Y, it is determined that due to administration of the test substance, the individual to which the test substance has been administered undergoes the same changes in the inter-organ cross talk indicator as the individual from which the standard data Y is obtained.

In particular, when subject data X is similar to standard data Y1, it can be predicted that the test substance leads to a state of one or more organs and tissue reflected by an inter-organ cross talk indicator showing changes in the standard data Y1, a similar state of one or more organs and tissue reflected by an inter-organ cross talk indicator showing changes in the standard data Y1, or a state of one or more organs and tissue that can be easily presumed to be related to the inter-organ cross talk indicator from existing knowledge. When subject data X is similar to standard data Y2, it can be predicted that the test substance leads to efficacy or a side effect (or side effects) that are the same as or similar to the state that the existing substance used for obtaining the standard data Y2 leads to, or efficacy or a side effect (or side effects) that can be easily presumed to be related to the existing substance from existing knowledge. Further, when subject data X is similar to standard data Y3, it can be predicted that administration of the test substance causes the same state as the disease in the positive control individual or positive control individuals from which the standard data Y3 is obtained, or the same state as that of the organ or tissue with a lesion or condition in the positive control individual or positive control individuals from which the standard data Y3 is obtained, and it can be predicted that such a state is the side effect (or side effects) due to the test substance. Alternatively, when subject data X is similar to standard data Y3, it can be predicted that due to administration of the test substance, efficacy or a side effect (or side effects) appear in one or more organs or tissue that can be easily presumed from existing knowledge about the disease to be related to the disease in the positive control individual or positive control individuals from which the standard data Y3 is obtained. In addition, in cases where a positive control individual or positive control individuals affected with a disease from which standard data Y3 is obtained is receiving any treatment (administration of an existing substance) and where an individual before administration of a test substance has the same disease as the positive control individual or positive control individuals from which the standard data Y3 is obtained, when subject data X obtained after administration of the test substance is similar to the standard data Y3 obtained from the positive control individual or positive control individuals, it can be predicted that the test substance has efficacy that is the same as or similar to that of the treatment (administration of the existing substance) or efficacy that can be easily presumed to be related to the treatment from existing knowledge.

Further, standard data 2 and standard data 3 may be obtained from multiple organs.

In another embodiment, the efficacy or side effect (or side effects) of a test substance can be predicted by using standard data 1 used in R-iOrgans. Specifically, (2-1) when an individual to which a test substance is to be administered is a healthy individual, the similarity of an inter-organ cross talk indicator between subject data X derived from an organ (e.g., organ A) of the subject to which the test substance has been administered (FIG. 16(b)) and standard data 1 derived from an organ corresponding to the organ (e.g., organ A) (FIG. 16(a)) is determined, (2-2) a disease and/or a stage of the disease (e.g., disease W, and/or a stage of disease W) corresponding to standard data 1 (standard data 1-2 of organ A of FIG. 16(a)) similar to the subject data X of the organ (e.g., organ A) is determined, and (2-3) it is further determined that the test substance causes the same state as the disease and/or the specific stage of the disease, thereby predicting the disease state that the test substance causes. Here, multiple organs may also be used. That is, (2-1′) when an individual to which a test substance is to be administered is a healthy individual, the similarity of the inter-organ cross talk indicator between subject data X derived from each of multiple organs (e.g., organs A and B) of the subject to which the test substance has been administered (FIG. 16(b) and FIG. 16(c)) and standard data 1 derived from each of the multiple organs (e.g., organs A and B) (organs A and B of FIG. 16(a)) is determined, (2-2′) a disease and/or a stage of the disease corresponding to standard data 1 similar to the subject data X of each of the multiple organs (e.g., organs A and B) (standard data 1-2 of organ A and standard data 1-3 of organ B in FIG. 16(a)) is determined; (2-3′) it is further determined that the test substance causes the same state as the disease and/or the stage of the disease (e.g., disease W and/or the stage of disease W) in an organ (e.g., organ A) and further determined that the test substance causes the same state as the disease and/or the stage of the disease (e.g., disease Z and/or the stage of disease Z) in another organ (e.g., organ B), thereby predicting the disease states in the multiple organs that the test substance causes.

In another embodiment, when an individual to which a test substance is to be administered has a disease in organ A, (3-1) the stage in the individual is determined before administration of the test substance (e.g., stage 2 of disease U in FIG. 17(a)), (3-2) the similarity of an inter-organ cross talk indicator between subject data X of an organ (e.g., organ A) after administration of the test substance (FIG. 17(b)) and standard data 1 of the organ (e.g., organ A) (organ A in FIG. 17(a)) is determined, (3-3) a stage (stage 1 of disease U) corresponding to standard data 1 (standard data 1-2 of organ A in FIG. 17(a)) similar to the subject data X of the organ (e.g., organ A) is determined, and (3-4) when the stage (stage 1 of disease U) determined in (3-3) is reduced compared to the stage (stage 2 of disease U) determined in (3-1), it can be determined that the test substance is effective against the disease that the individual has.

Furthermore, in another embodiment, in view of the inter-organ cross talk system network, for example, the state of organ A can be predicted by using data of organ B contained in standard data 1 as subject data X. For instance, when an individual to which a test substance is to be administered is a healthy individual, (4-1) the similarity of an inter-organ cross talk indicator between subject data X of an organ (e.g., organ B) (FIG. 16(d)) and standard data 1 of an organ corresponding to the organ (e.g., organ B) (organ B in FIG. 16(a)) is determined, (4-2) a disease and/or a stage (disease W and/or a stage of disease W) corresponding to standard data 1 (standard data 1-2 of organ B in FIG. 16(a)) similar to the subject data X of the organ (e.g., organ B) is determined, and (4-3) when the disease and/or the stage determined in (4-2) (disease W and/or the stage of disease W) is a disease/or stage having a primary lesion (disease W and/or a stage of disease W) in another organ (e.g., organ A), it can be predicted that the test substance causes the same state as the disease and/or the stage determined in (4-2) (disease W and/or the stage of disease W), in the other organ (e.g., organ A).

When an individual to which a test substance is to be administered has a disease in organ A, (5-1) the stage in the individual is determined before administration of the test substance (e.g., stage 2 of disease U in FIG. 17(a)), (5-2) the similarity of an inter-organ cross talk indicator between subject data X of an organ (e.g., organ B) after administration of the test substance (FIG. 17(c)) and standard data 1 of an organ corresponding to the organ (e.g., organ B) is determined, (5-3) a stage (e.g., stage 1 of disease U in FIG. 17(a)) corresponding to standard data 1 (standard data 1-2 of organ B of FIG. 17(a)) similar to the subject data X (FIG. 17(c)) of the organ (e.g., organ B) is determined, (5-4) when the stage determined in (5-3) (e.g., stage 1 of disease U in FIG. 17(a)) is a stage of a disease in another organ (e.g., organ A), it is determined that the test substance causes the same state as the stage determined in (5-3) in the other organ (e.g., organ A), and (5-5) when the stage determined in (5-3) is reduced compared to the stage determined in (5-1), it can be predicted that the test substance is effective against the disease in the other organ that the individual has.

A specific embodiment using standard data Y3-Maps is described below.

For example, when a clinical trial of a drug candidate substance X is performed in a clinical study (see FIG. 18), organs A and D are collected from a human with a disease (e.g., disease 1) to which the drug candidate substance X has been administered (an individual to which a test substance has been administered), and a pattern of an inter-organ cross talk indicator in each organ is determined. The correlation coefficient of the patterns of the inter-organ cross talk indicators between organ A and organ D is calculated according to the method described in the “1. Explanation of terms” section above. The likelihood between the calculated correlation coefficient and the correlation coefficient among the corresponding organs in standard data Y3-Maps generated beforehand is calculated, and it can be determined that the state linked to a standard data Y3-Map showing the highest likelihood is the state of the individual (the human) after administration of the drug candidate substance X. When the state of the human after administration of the drug candidate substance X is better than that before administration of the drug candidate substance X (in FIG. 18, when the correlation coefficient of the patterns between organ A and organ D in the disease 1 human specimen changes into the correlation coefficient of the patterns between organ A and organ D of the healthy human specimen), it can be predicted that the drug candidate substance X is effective against the disease (e.g., disease 1). Moreover, from the principle of the R-iOrgans technology, the patterns of the inter-organ cross talk indicators derived from organ B and organ C in the human mentioned above from which organ A and organ D are collected can be predicted by using standard data 1; therefore, the action of the drug candidate substance X on organ B and organ C can be predicted from the correlation coefficient between organ B and organ C by using standard data 1-Maps according to a method similar to the method for calculating likelihood of the correlation coefficient between organ A and organ D from that between organ B and organ C.

In another embodiment, for example, when a preclinical study of drug candidate substances Y and Z for a disease (e.g., disease 1) is performed by using laboratory animals, such as mice (see FIG. 19), multiple organs are collected from a mouse model of a disease (e.g., disease 1) to which a first candidate drug (e.g., drug candidate substance Y) or a second candidate drug (e.g., drug candidate substance Z) has been administered (an individual to which a test substance has been administered), and a pattern of an inter-organ cross talk indicator in each organ is determined. The correlation coefficient of patterns of the inter-organ cross talk indicators between two different organs is calculated for all of the multiple organs according to the method described in the “1. Explanation of terms” section above. The likelihood between the calculated correlation coefficient and the correlation coefficient among the corresponding organs in standard data Y3-Maps generated beforehand is calculated, and it can be predicted that the state linked to a standard data Y3-Map showing the highest likelihood is the state of the mouse after administration of the first drug candidate substance or the second drug candidate substance. When the condition of the mouse after administration of the first drug candidate substance or the second drug candidate substance is improved after the administration of the first drug candidate substance or the second drug candidate substance, it can be predicted that the first drug candidate substance or the second drug candidate substance is effective against the disease (e.g., disease 1). In FIG. 19, the correlation between the patterns of the inter-organ cross talk indicators when the drug candidate substance Y has been administered to the disease 1 mouse model is represented as “drug candidate substance Y administration disease 1 mouse model,” and the correlation between the patterns of the inter-organ cross talk indicators when the drug candidate substance Z has been administered to the disease 1 mouse model is represented as “drug candidate substance Z administration disease 1 mouse model.” The correlation between the patterns of the inter-organ cross talk indicators in the drug candidate substance Y administration disease 1 mouse model matches the correlation between the patterns of the inter-organ cross talk indicators in the drug candidate substance Z administration disease 1 mouse model, except for organ A and organ B. It can thus be determined that the correlation map of the patterns of the inter-organ cross talk indicators in the drug candidate substance Y administration disease 1 mouse model is similar to the correlation map of the patterns of the inter-organ cross talk indicators in the drug candidate substance Z administration disease 1 mouse model. That is, it can be predicted that the first drug candidate substance and the second drug candidate substance have similar action. It can also be predicted that the drug candidate substance Z is more therapeutically effective against the disease 1 because the correlation map of the patterns of the inter-organ cross talk indicators in the drug candidate substance Z administration disease 1 mouse model is the same as the correlation maps of the patterns of the inter-organ cross talk indicators in the healthy mouse and the healthy human specimen in FIG. 19. Specifically, in the treatment of a disease, when the correlation map of the patterns of the inter-organ cross talk indicators obtained using a second drug candidate substance is closer to the correlation map of the patterns of the inter-organ cross talk indicators of a healthy individual than the correlation map of the patterns of the inter-organ cross talk indicators obtained using a first drug candidate substance, it can be determined that the second drug candidate substance is more effective in the treatment of the disease.

Further, in another embodiment, for example, the side effect (or side effects) of a test substance (e.g., drug candidate substance 3) can be predicted using laboratory animals, such as mice, in a preclinical study (see FIG. 20). Multiple organs (e.g., organs A, B, C, and D) are collected from an individual (e.g., a mouse) to which a test substance has been administered, and a pattern of an inter-organ cross talk indicator in each organ is determined. The correlation coefficient of patterns of the inter-organ cross talk indicators between two different organs is calculated for all of the multiple organs (e.g., organs A and D) according to the method described in the “1. Explanation of terms” section above. The likelihood between the calculated correlation coefficient and the correlation coefficient among the corresponding organs in standard data Y3-Maps generated beforehand is calculated, and it can be predicted that the state linked to a standard data Y3-Map showing the highest likelihood is the state of the individual after administration of the test substance. When the state corresponding to the standard data Y3-Map with the highest likelihood is a disease or a stage of the disease, it can be predicted that the test substance causes the disease or the stage of the disease. For example, in FIG. 20, when the correlation coefficient between organs A and D in the correlation map of the drug candidate substance 3 administration mouse model is similar to the correlation coefficient between organs A and D in the correlation map of the disease 1 mouse model, or the correlation coefficient between organs A and D in the correlation map of the disease 1 human specimen, it can be determined that the drug candidate substance 3 causes a side effect (or side effects) that are the same as the state of the disease 1. Further, in cases where the disease is myocardial infarction and organ B is the heart, when the test drug candidate substance 3 is known to act directly on the heart, but does not act directly on another organ (organ A, C, or D) (i.e., when there is common technical knowledge that the drug candidate substance 3 acts on cardiac cells, e.g., myocardial cells, in culture-based assays, but causes no changes in gene expression in other cultured cells, e.g., cells derived from organ A, C, or D), it can be predicted that a change in the correlation coefficient between organs A and D caused by administration of the drug candidate substance 3 is a change caused by a change in the heart resulting from the action of the drug candidate substance 3 on the heart through cross-talk with organs other than the heart.

6-2. System Configuration

FIG. 21 is an overview of a system 120 according to a third embodiment of the present invention, and FIG. 22 is a block diagram illustrating a hardware configuration of the system 120. The system 120 comprises a prediction apparatus 3, an input unit 4, a display unit 5, and an apparatus 6.

The prediction apparatus 3 includes, for example, a general-purpose personal computer, and comprises a CPU 101 for performing data processing described later, a memory 102 serving as a work area for data processing, a storage unit 103 for storing processed data, a bus 104 for transmitting data between the units, and an interface unit 105 (hereinafter referred to as “I/F unit”) for performing data input and output between the apparatus 3 and external devices. The input unit 4 and the display unit 5 are connected to the prediction apparatus 3. The input unit 4 includes, for example, a keyboard, and the display unit 5 includes, for example, a liquid crystal display. The input unit 4 and the display unit 5 may be integrated and implemented as a display with a touch panel. The prediction apparatus 3 need not be a single apparatus, and the CPU 101, the memory 102, the storage unit 103, and the like may be located in separate places and connected via a network. The apparatus 3 may also be an apparatus that omits the input unit 4 and the display unit 5 and that does not require an operator.

The prediction apparatus 3 and the apparatus 6 are also not necessarily located in one place, and may be configured such that the apparatuses located in separate places are communicatively connected to each other via a network.

In the explanation below, a process performed by the prediction apparatus 3 means a process performed by the CPU 101 of the prediction apparatus 3 based on a prediction program unless otherwise specified. The CPU 101 temporarily stores necessary data (such as intermediate data being processed) in the memory 102 that serves as a work area, and suitably stores data that are stored for a long period of time, such as computation results, in the storage unit 103.

The apparatus 6 is an apparatus for measuring RNA expression levels by the RNA-Seq method or measuring the amounts of metabolites by mass spectrometry. The apparatus 6 comprises an analysis unit 61. A sample in which a reaction for RNA-Seq has been carried out is set in the analysis unit 61 to perform analysis of nucleotide sequences in the analysis unit 61.

The apparatus 6 is connected to the prediction apparatus 3 by a wired or wireless connection. The apparatus 6 A/D converts the measurement values of mRNAs and transmits them as digital data to the prediction apparatus 3. Therefore, the prediction apparatus 3 can obtain the measurement values of mRNAs as digital data that can be computed. In this embodiment, digital data from the apparatus 6 is referred to as “subject data regarding an inter-organ cross talk indicator” or simply referred to as “subject data.”

6-3. Prediction Apparatus

As the third embodiment, the present invention includes an apparatus for predicting efficacy or a side effect (or side effects) of a test substance, the apparatus comprising the following computation means:

a means for calculating, by comparing subject data X regarding an inter-organ cross talk indicator in each of one or more organs of an individual to which the test substance has been administered, the inter-organ cross talk indicator being derived from cells or tissue originating from each of the one or more organs, with standard data Y derived beforehand from the corresponding inter-organ cross talk indicator, similarity of patterns of the inter-organ cross talk indicators between the subject data X and the standard data Y; and

a means for predicting efficacy or a side effect (side effects) s of the test substance in each of the one or more organs and/or each of one or more organs other than the one or more organs by using, as a measure, the similarity of patterns of the inter-organ cross talk indicators obtained by the pattern similarity calculation means.

Here, the method for calculating similarity between the subject data X and the standard data Y and the method for determining whether the subject data X and the standard data Y are similar are as described in the “1. Explanation of terms” section above.

In this embodiment, the efficacy or side effect (or side effects) of a test substance can be predicted by the system 120 (FIG. 22) comprising the prediction apparatus 3 described in the “6-2. System configuration” section above as the prediction apparatus above.

FIG. 23 is a block diagram to illustrate a function of the prediction apparatus 3 according to the third embodiment of the present invention. The prediction apparatus 3 comprises a subject data obtaining unit 31, a pattern similarity calculation unit 32, and a prediction unit 33. These functional blocks are implemented by installing the program according to the present invention in the storage unit 103 or the memory 102 of the prediction apparatus 3 and causing the CPU 101 to execute the program. With this structure, the prediction apparatus 3 carries out the prediction method described later in the “6-5. Prediction method” section. The pattern similarity calculation means and the prediction means recited in the claims correspond to the pattern similarity calculation unit 32 and the prediction unit 33 shown in FIG. 23, respectively.

In this embodiment, subject data M4 (subject data X) and standard data D1 (standard data Y) may be stored outside the prediction apparatus 3 and put into the prediction apparatus 3 via, for example, the Internet.

The subject data M4 and the standard data D1 may be stored in the storage unit 103 or the memory 102 of the prediction apparatus 3 beforehand.

Further, the functional blocks, i.e., the subject data obtaining unit 31, the pattern similarity calculation unit 32, and the prediction unit 33, are not necessarily executed by a single CPU and may be processed distributively by multiple CPUs. For example, these functional blocks may be configured such that the function of the subject data obtaining unit 31 is executed by a CPU of a first computer and such that the functions of the pattern similarity calculation unit 32 and the prediction unit 33 are executed by a CPU of a second computer, i.e., another computer.

In other words, the prediction apparatus 3 is a prediction apparatus for predicting efficacy or a side effect (or side effects) of a test substance, the apparatus executing the following computation functions by the CPU 101:

a function of calculating, by comparing subject data X regarding an inter-organ cross talk indicator in each of one or more organs of an individual to which the test substance has been administered, the inter-organ cross talk indicator being derived from cells or tissue originating from each of the one or more organs, with standard data Y derived beforehand from the corresponding inter-organ cross talk indicator, similarity of patterns of the inter-organ cross talk indicators between the subject data X and the standard data Y; and

a function of predicting efficacy or a side effect (or side effects) of the test substance in each of the one or more organs and/or each of one or more organs other than the one or more organs by using, as a measure, the similarity of patterns of the inter-organ cross talk indicators obtained by the pattern similarity calculation function.

In this embodiment, the subject data obtaining unit 31 obtains subject data M4 (subject data X) of an inter-organ cross talk indicator measured in the apparatus 6 from the apparatus 6. Standard data D1 (standard data Y) is stored outside the prediction apparatus 3 and put into the prediction apparatus 3 via, for example, the Internet.

The subject data M4 (subject data X) may also be put into the prediction apparatus 3 from a third-party organization (not shown) via a network. The subject data M4 (subject data X) and the standard data D1 (standard data Y) may be stored in the storage unit 103 or the memory 102 of the prediction apparatus 3 beforehand.

The pattern similarity calculation unit 32 compares the subject data M4 (subject data X) with the standard data D1 (standard data Y) and calculates the similarity of patterns of the inter-organ cross talk indicators. The prediction unit 33 predicts the efficacy or side effect (or side effects) of the test substance in each of the one or more organs and/or each of one or more organs other than the one or more organs by using, as a measure, the similarity of patterns of the inter-organ cross talk indicators obtained by the pattern similarity calculation unit 32. The pattern similarity calculation unit 32 and the prediction unit 33 are functional blocks that respectively execute the pattern similarity calculation step and the prediction step of the prediction method according to the third embodiment of the present invention described later in the “6-5. Prediction method” section. The details of the computation processing of these steps are described in the “6-5. Prediction method” section with reference to FIG. 24.

Further, the functional blocks, i.e., the subject data obtaining unit 31, the pattern similarity calculation unit 32, and the prediction unit 33, are not necessarily executed by a single CPU, and may be processed distributively by multiple CPUs. For example, these functional blocks may be configured such that the function of the subject data obtaining unit 31 is executed by a CPU of a first computer and such that the functions of the pattern similarity calculation unit 32 and the prediction unit 33 are executed by a CPU of a second computer, i.e., another computer.

6-4. Prediction Program

Further, in order to carry out steps S31 to S37 in FIG. 24 described below, the prediction apparatus 3 stores the prediction program according to the present invention in the storage unit 103 beforehand, for example, in an executable format (for example, a form in which the program can be produced by being converted from a programming language using a compiler). The prediction apparatus 3 carries out processing using the prediction program stored in the storage unit 103.

Specifically, the prediction program according to the third embodiment of the present invention is a program that, when executed by a computer, causes the computer to carry out the following processing to predict efficacy or a side effect (or side effects) of a test substance:

processing of calculating, by comparing subject data X regarding an inter-organ cross talk indicator in each of one or more organs of an individual to which the test substance has been administered, the inter-organ cross talk indicator being derived from cells or tissue originating from each of the one or more organs, with standard data Y derived beforehand from the corresponding inter-organ cross talk indicator; and

processing of predicting efficacy or a side effect (or side effects) of the test substance in each of the one or more organs and/or each of one or more organs other than the one or more organs by using, as a measure, the similarity of patterns of the inter-organ cross talk indicators obtained by the pattern similarity calculation processing.

In this embodiment, as shown in FIG. 22, the prediction program is stored in a computer-readable non-transitory tangible storage medium 109, such as CD-ROM and installed to prediction apparatus 3 from the storage medium 109; alternatively, the prediction apparatus 3 may be connected to the Internet (not shown) to download the program code of the prediction program via the Internet. In addition, to cause a computer to carry out the computation processing described above, the prediction program according to the present invention may be linked to another program stored in the storage unit 103 or the memory 102. For example, the prediction program may be linked to statistical analysis software mentioned in the “1. Explanation of terms” section above, and the pattern similarity calculation processing may be carried out using the statistical analysis software.

The pattern similarity calculation processing corresponds to computation processing that is performed by the pattern similarity calculation unit 32 implemented through execution of the prediction program by the prediction apparatus 3. The prediction processing corresponds to computation processing that is performed by the prediction unit 33 implemented through execution of the prediction program by the prediction apparatus 3.

6-5. Prediction Method

The prediction apparatus 3 according to the third embodiment of the present invention carries out the prediction method according to the third embodiment of the present invention. The prediction method according to the third embodiment of the present invention is a method for predicting efficacy or a side effect (or side effects) of a test substance, the method comprising:

a step of calculating, by comparing subject data X regarding an inter-organ cross talk indicator in each of one or more organs of an individual to which the test substance has been administered, the inter-organ cross talk indicator being derived from cells or tissue originating from each of the one or more organs, with standard data Y derived beforehand from the corresponding inter-organ cross talk indicator, similarity of patterns of the inter-organ cross talk indicators between the subject data X and the standard data Y; and

a step of predicting efficacy or a side effect (or side effects) of the test substance in each of the one or more organs and/or each of one or more organs other than the one or more organs by using, as a measure, the similarity of patterns of the inter-organ cross talk indicators obtained in the pattern similarity calculation step.

FIG. 24 is a flow chart illustrating a flow of data processing performed by the prediction apparatus 3 according to the third embodiment of the present invention to carry out the prediction method above. The processing of steps S31 to S37 shown in FIG. 24 is performed by the subject data obtaining unit 31, the pattern similarity calculation unit 32, and the prediction unit 33 shown in FIG. 23.

In step S31, the subject data obtaining unit 31 obtains subject data M4 (subject data X). The subject data M4 (subject data X) is a pattern of an inter-organ cross talk indicator in each of one or more organs of an individual to which the test substance has been administered, the inter-organ cross talk indicator being derived from cells or tissue originating from each of the one or more organs, and transmitted from the apparatus 6 to the prediction apparatus 3.

In step S32, the pattern similarity calculation unit 32 compares the obtained subject data M4 (subject data X) with standard data D1 (standard data Y) and calculates the similarity of patterns of the inter-organ cross talk indicators. The method for calculating the similarity and the method for determining whether patterns are similar are as described in the “1. Explanation of terms” section above. The prediction program described in the “6-4. Prediction program” section above may comprise program code of a program for causing the CPU 101 of the prediction apparatus 3 to perform computation processing by the pattern similarity calculation unit 32 or, for example, may be linked to statistical analysis software mentioned in the “1. Explanation of terms” section above to cause the CPU 101 to perform computation processing by the pattern similarity calculation unit 32 using the statistical analysis software.

In step S33, the prediction unit 33 predicts the similarity of patterns of the inter-organ cross talk indicators by using, as a measure, the similarity obtained in step S32. Specifically, when it is determined from the similarity that patterns are similar (“YES” in step 33), the prediction unit 33 determines in step S34 that due to administration of the test substance, the individual to which the test substance has been administered undergoes the same changes in an inter-organ cross talk indicator as the individual from which the standard data Y is obtained, and further determines in step S35 that the test substance exhibits efficiency or a side effect (or side effects) reflected by the inter-organ cross talk indicator that have undergone changes.

When it is determined from the similarity obtained in step S32 that patterns are not similar (“NO” in step 33), the prediction unit 33 determines in step S37 that there are no similar patterns.

In step S36, the prediction unit 33 outputs the results determined in step S35 or S37 as prediction result data. In this embodiment, the prediction results are displayed on the display unit 5 and the prediction result data is stored in the storage unit 103 in the prediction apparatus 3. The prediction results may be displayed on a display unit of a computer terminal connected to the prediction apparatus 3 via the Internet that is external to the prediction apparatus 3, for example, in a third-party organization, instead of displaying the prediction results on the display unit 5.

For example, when STZ is used as a test substance, gene candidates presented are Hamp and Saa1 in FIG. 44 described later in the Examples. In the explanation of FIG. 44, the prediction unit 33 or an operator suitably accesses a disease information database and obtains information about diseases of Hamp and Saa1 genes, thereby obtaining prediction results about the presence of efficacy or a side effect (or side effects) of the test substance (results of checking against a known database of diseases). When gene candidates are presented to an operator, results of checking against a known database about diseases (including information regarding efficacy and a side effect (or side effects)) can be presented so that the operator can easily understand the results, for example, by associating the results with each gene candidate.

7. Generation of Standard Data, and Standard Data

7-1. Generation of Standard Data

The present invention relates to a method for generating standard data 1 for use in “4. Reverse iOrgans” above and a method for generating standard data 2 for use in “5. Forward iOrgans” above. The definition of terms is in accordance with the “1. Explanation of terms” section above.

The method for generating standard data is a method for generating standard data 1 of patterns of inter-organ cross talk indicators used for predicting the presence of a specific disease and/or the stage of the specific disease in a subject, the method comprising the steps of:

(A) obtaining information about an amount of an inter-organ cross talk indicator derived from cells or tissue originating from each of one or more organs other than the specific organ collected from a positive control (or positive controls) as a gold standard for each stage of the specific disease;

(B) obtaining information regarding an amount of the inter-organ cross talk indicator derived from cells or tissue originating from each of the one or more organs other than the specific organ collected from a negative control (or negative controls) as a gold standard;

(C) determining patterns of inter-organ cross talk indicators, each of the patterns being determined from a relationship (preferably a ratio) between the amount of the inter-organ cross talk indicator in the organ other than the specific organ collected from the positive control (or positive controls) affected with the specific disease obtained in step (A) and the amount of the corresponding inter-organ cross talk indicator in the same organ as the organ other than the specific organ collected from the negative control (or negative controls) without the specific disease obtained in step (B); and

(D) linking the patterns of the inter-organ cross talk indicators to the corresponding stages of the specific disease.

More specifically, step (A) comprises the steps of:

extracting an inter-organ cross talk indicator from cells or tissue originating from each of one or more organs other than the specific organ collected from a positive control (or positive controls) as a gold standard for each stage of the specific disease; and

identifying and quantifying the inter-organ cross talk indicator.

Step (B) comprises the steps of:

extracting the inter-organ cross talk indicator from cells or tissue originating from each of the one or more organs other than the specific organ collected from a negative control (or negative controls) as a gold standard; and

identifying and quantifying the inter-organ cross talk indicator.

Specifically, the procedure for generating standard data 1 is a procedure as described later in the Examples.

First, cells or tissue is collected from one or more organs (e.g., fat) other than the specific organ of a negative control (or negative controls) and a positive control (or positive controls) in individual stages of the specific disease, and the inter-organ cross talk indicator is extracted. The extracted inter-organ cross talk indicator is then identified and quantified.

Next, patterns of inter-organ cross talk indicators are determined, each of the patterns being determined from the relationship between the amount of an inter-organ cross talk indicator in an organ other than the specific organ of a positive control (or positive controls) affected with the specific disease and the amount of the corresponding inter-organ cross talk indicator in the organ other than the specific organ of the negative control (or negative controls) without the specific disease (for example, a ratio, preferably a value obtained by dividing the value of the amount of an inter-organ cross talk indicator in an organ other than the specific organ collected from a positive control (or positive controls) affected with the specific disease by the value of the amount of the corresponding inter-organ cross talk indicator in the organ other than the specific organ of the negative control (or negative controls) without the specific disease). The determined patterns of inter-organ cross talk indicators are linked to the specific disease and stored in, for example, a storage device as standard data 1. Further, the standard data 1 can be stored in a server.

Furthermore, the present invention includes a method for generating standard data 2.

This method is a method for generating standard data 2 of patterns of inter-organ cross talk indicators for use in prediction of the presence of a disease and/or the stage of the disease in each of one or more organs other than a specific organ in a subject affected with the specific disease, the method comprising the steps of:

(A′) obtaining information regarding an amount of an inter-organ cross talk indicator derived from cells or tissue originating from each of one or more organs other than the specific organ collected from a positive control (or positive controls) as a gold standard for each stage of the specific disease;

(B′) obtaining information regarding an amount of the inter-organ cross talk indicator derived from cells or tissue originating from each of the one or more organs other than the specific organ collected from a negative control (or negative controls) as a gold standard;

(C′) determining patterns of inter-organ cross talk indicators, each of the patterns being determined from a relationship (preferably a ratio) between the amount of the inter-organ cross talk indicator in the organ other than the specific organ of the positive control (or positive controls) affected with the specific disease obtained in step (A′) and the amount of the corresponding inter-organ cross talk indicator in the same organ as the organ other than the specific organ in the negative control (or negative controls) without the specific disease obtained in step (B′); and

(D′) linking the patterns of the inter-organ cross talk indicators to the corresponding stages of the specific disease.

More specifically, step (A′) comprises the steps of:

extracting an inter-organ cross talk indicator from cells or tissue originating from each of one or more organs other than the specific organ collected from a positive control (or positive controls) as a gold standard for each stage of the specific disease; and

identifying and quantifying the inter-organ cross talk indicator.

Step (B′) comprises the steps of:

extracting the inter-organ cross talk indicator from cells or tissue originating from each of the one or more organs other than the specific organ of a negative control (or negative controls) as a gold standard; and

identifying and quantifying the inter-organ cross talk indicator.

Specifically, the procedure for generating standard data 2 is a procedure as described later in the Examples.

First, cells or tissue are collected from one or more organs other than the specific organ collected from a negative control (or negative controls) and a positive control or positive controls affected with the specific disease, and the inter-organ cross talk indicator is extracted. The extracted inter-organ cross talk indicator is then identified and quantified.

Next, patterns of inter-organ cross talk indicators are determined for each stage of the specific disease, each of the patterns being determined from the relationship between the amount of an inter-organ cross talk indicator in an organ other than the specific organ collected from a positive control (or positive controls) affected with the specific disease and the amount of the corresponding inter-organ cross talk indicator in the organ other than the specific organ collected from the negative control (or negative controls) without the specific disease (for example, a ratio, preferably a value obtained by dividing the value of the amount of an inter-organ cross talk indicator in an organ other than the specific organ collected from a positive control (or positive controls) with the specific disease by the value of the amount of the corresponding inter-organ cross talk indicator in the organ other than the specific organ collected from the negative control (or negative controls) without the specific disease). Such patterns of inter-organ cross talk indicators determined for each stage of the specific disease are stored in, for example, a storage device as standard data 2. Further, the standard data 2 can be stored in an external server.

To obtain standard data Y1, information regarding the function of an inter-organ cross talk indicator or information regarding expression levels when there are diseases or symptoms can be obtained from, for example, known disease databases, documents, or protein and gene databases. Examples of public disease databases include disease information databases mentioned in Section 5-1 above.

To obtain standard data Y2, an inter-organ cross talk indicator is extracted from cells or tissue originating from one or more organs collected from a positive control individual or positive control individuals to which existing substances have been individually administered and, if necessary, the one or more organs collected from a negative control individual or negative control individuals (extraction step). The method for extracting the inter-organ cross talk indicator is not particularly limited, and the inter-organ cross talk indicator may be extracted by a known method. When the inter-organ cross talk indicator is RNA or a group of metabolites, extraction of the inter-organ cross talk indicator can be performed by, for example, the method described in Section 2 above. Here, the negative control (or negative controls) may be used synonymously with a negative control (or negative controls) with no disease, and includes untreated animals, sham-operated animal models, and the like. The time at which cells or tissue is collected from one or more organs of the positive control individual or positive control individuals to which the existing substances have been individually administered is as follows: according to the pharmacokinetics of the existing substances, cells or tissue may be collected when the efficacy or side effect of the substances appears in the individuals, collected within the period of time in which the effect is sustained, or collected when or after the effect wears off.

Next, the inter-organ cross talk indicator extracted in the extraction step is identified and quantified (identification and quantification step). The method for identifying and quantifying the inter-organ cross talk indicator is not limited as long as the inter-organ cross talk indicator can be identified or quantified. For example, when the inter-organ cross talk indicator is RNA or a group of metabolites, they can be identified and quantified according to the method of analysis of RNAs or the method for measuring metabolites described in Section 2 above.

To obtain standard data Y3, a positive control individual or positive control individuals with individual diseases can be used instead of the positive control individual or positive control individuals to which the existing substances have been individually administered in the method for obtaining standard data Y2. Examples of the positive control individual or positive control individuals with individual diseases include animals that have spontaneously developed a disease, disease animal models, transgenic animals, and the like.

The extraction step and the identification and quantification step can be performed according to the method for obtaining standard data Y2. Here, the positive control individual or positive control individuals with individual diseases may be individuals that are untreated or subjected to treatment (administration of an existing substance).

Next, standard data Y of an inter-organ cross talk indicator is determined from the amount of the inter-organ cross talk indicator quantified in the identification and quantification step (determination step). The amount of the inter-organ cross talk indicator obtained in the identification and quantification step may be used as is as standard data Y. Standard data Y2 may be determined, preferably from the relationship between the amount of the inter-organ cross talk indicator in an organ of an individual to which an existing substance has been administered and the amount of the corresponding inter-organ cross talk indicator in the same organ in a negative control (or negative controls), more preferably the ratio between the amount of the inter-organ cross talk indicator in an organ of an individual to which an existing substance has been administered and the amount of the corresponding inter-organ cross talk indicator in the same organ in a negative control (or negative controls), and even more preferably the ratio of the amount of the inter-organ cross talk indicator in an organ of an individual to which an existing substance has been administered to the amount of the corresponding inter-organ cross talk indicator in the same organ in a negative control (or negative controls). In another embodiment, standard data Y3 may be determined as the relationship between the amount of the inter-organ cross talk indicator in an organ of a positive control individual or positive control individuals affected with a disease and the amount of the corresponding inter-organ cross talk indicator in the same organ in a negative control (or negative controls), preferably the ratio of the amount of the inter-organ cross talk indicator in an organ of a positive control individual or positive control individuals affected with a disease and the amount of the corresponding inter-organ cross talk indicator in the same organ in a negative control (or negative controls), more preferably the ratio of the amount of the inter-organ cross talk indicator in an organ of a positive control individual or positive control individuals affected with a disease to the amount of the corresponding inter-organ cross talk indicator in the same organ in a negative control (or negative controls).

A database of standard data Y may be made beforehand, or standard data Y may be obtained when subject data X is obtained.

7-2. Standard Data

The present invention includes standard data 1 generated by the method described above.

Generated standard data 1 may be stored in the storage unit 103 or the memory 102 of the prediction apparatus 1. Alternatively, generated standard data 1 may be stored in a storage device connected locally to the prediction apparatus 1 or in an external storage device, for example, a storage device of a server, accessible via a network by the prediction apparatus 1.

Further, the present invention includes standard data 2 generated by the method described above.

Generated standard data 2 may be stored in the storage unit 103 or the memory 102 of the prediction apparatus 2. Alternatively, generated standard data 2 may be stored in a storage device connected locally to the prediction apparatus 2 or in an external storage device, for example, a storage device of a server, accessible via a network by the prediction apparatus 2.

When the inter-organ cross talk indicator is RNA, RNA that shows changes may be predetermined for each of the animals to which existing substances have been individually administered or each of the animals with each disease, and a microarray for detecting target RNA may be prepared. In this case, changes mean that the ratio mentioned above is more than 1 or less than 1, preferably more than 1.5 or less than 0.67, more preferably more than 2 or less than 0.5, even more preferably more than 5 or less than 0.2.

The third embodiment of the present invention allows for not only more accurate and comprehensive prediction of the efficacy or side effect (or side effects) of test substances, but also identification of new and previously unknown efficacy or side effect (or side effects) of existing substances. Further, based on the obtained data, this embodiment enables studies of methods for preventing the side effect (or side effects) of test substances, and makes it possible to find new applications of test substances that have limited use despite desirable efficacy. Thus, the third embodiment of the present invention may comprise the step of selecting, depending on changes in subject data X, a drug that balances out or enhances the changes. Here, changes in subject data X mean that the ratio mentioned above is more than 1 or less than 1, preferably more than 1.5 or less than 0.67, more preferably more than 2 or less than 0.5, even more preferably more than 5 or less than 0.2.

8. Microarray and Kit

The present invention includes a microarray (also referred to as “DNA chip”) for use in the methods described in Section 4, Section 5, and/or Section 6 above.

Probes that the microarray comprises are not particularly limited as long as they can detect nucleic acids described in Section 1 above or nucleic acids reverse-transcribed or amplified using nucleic acids described in Section 1 above as templates. The probes that the microarray comprises are preferably those including complementary nucleotide sequences, at least in part, to the nucleotide sequences of RNAs expressed from genes of group 1 described in Section 1 above or cDNAs synthesized by reverse transcription from RNAs expressed from genes of group 1, and more preferably those including complementary nucleotide sequences, at least in part, to the nucleotide sequences of RNAs expressed from genes of group 2 or cDNAs synthesized by reverse transcription from RNAs expressed from genes of group 2. Among these, particularly preferred are those including complementary nucleotide sequences, at least in part, to the nucleotide sequences of RNAs expressed from genes of group 1 or group 2 containing polyA sequences or cDNAs synthesized by reverse transcription from RNAs expressed from genes of group 1 or group 2 containing polyA sequences.

For example, when the specific organ is the heart and the specific disease is myocardial infarction, more specifically, the probes are ones including complementary nucleotide sequences, at least in part, to the nucleotide sequences of at least one RNA selected from the group consisting of RNAs expressed from the genes of group 3 described in FIG. 30 or at least one RNA selected from the group consisting of RNAs expressed from the orthologs, of the genes of group 3, that are present in the individual described above, or cDNAs synthesized by reverse transcription from the at least one RNA. More preferably, the probes are ones including complementary nucleotide sequences, at least in part, to the nucleotide sequences of at least one RNA selected from the group consisting of RNAs expressed from the genes of group 4 described in FIG. 30 or at least one RNA selected from the group consisting of RNAs expressed from the orthologs, of the genes of group 4, that are present in the individual described above, or cDNAs synthesized by reverse transcription from the at least one RNA. More preferably, the probes are ones including complementary nucleotide sequences, at least in part, to the nucleotide sequences of at least one RNA selected from the group consisting of RNAs expressed from the genes of group 5 described in FIG. 30 or at least one RNA selected from the group consisting of RNAs expressed from the orthologs, of the genes of group 5, that are present in the individual described above, or cDNAs synthesized by reverse transcription from the at least one RNA. More preferably, the probes are ones including complementary nucleotide sequences, at least in part, to the nucleotide sequences of at least one RNA selected from the group consisting of RNAs expressed from the genes of group 6 described in FIG. 30 or at least one RNA selected from the group consisting of RNAs expressed from the orthologs, of the genes of group 6, that are present in the individual described above, or cDNAs synthesized by reverse transcription from the at least one RNA. More preferably, the probes are ones including complementary nucleotide sequences, at least in part, to the nucleotide sequences of at least one RNA selected from the group consisting of RNAs expressed from the genes of group 7 described in FIG. 30 or at least one RNA selected from the group consisting of RNAs expressed from the orthologs, of the genes of group 7, that are present in the individual described above, or cDNAs synthesized by reverse transcription from the at least one RNA. Most preferably, the probes are ones including complementary nucleotide sequences, at least in part, to the nucleotide sequences of at least one RNA selected from the group consisting of RNAs expressed from the genes of group 8 described in FIG. 30 or at least one RNA selected from the group consisting of RNAs expressed from the orthologs, of the genes of group 8, that are present in the individual described above, or cDNAs synthesized by reverse transcription from the at least one RNA.

For example, when the specific organ is the brain and the specific disease is dementia, the probes are, more specifically, ones including complementary nucleotide sequences, at least in part, to the nucleotide sequences of at least one RNA selected from the group consisting of RNAs expressed from the genes of group 3 described in FIG. 34 or at least one RNA selected from the group consisting of RNAs expressed from the orthologs, of the genes of group 3, that are present in the individual described above, or cDNAs synthesized by reverse transcription from the at least one RNA. More preferably, the probes are ones including complementary nucleotide sequences, at least in part, to the nucleotide sequences of at least one RNA selected from the group consisting of RNAs expressed from the genes of group 4 described in FIG. 34 or at least one RNA selected from the group consisting of RNAs expressed from the orthologs, of the genes of group 4, that are present in the individual described above, or cDNAs synthesized by reverse transcription from the at least one RNA. More preferably, the probes are ones including complementary nucleotide sequences, at least in part, to the nucleotide sequences of at least one RNA selected from the group consisting of RNAs expressed from the genes of group 5 described in FIG. 34 or at least one RNA selected from the group consisting of RNAs expressed from the orthologs, of the genes of group 5, that are present in the individual described above, or cDNAs synthesized by reverse transcription from the at least one RNA. More preferably, the probes are ones including complementary nucleotide sequences, at least in part, to the nucleotide sequences of at least one RNA selected from the group consisting of RNAs expressed from the genes of group 6 described in FIG. 34 or at least one RNA selected from the group consisting of RNAs expressed from the orthologs, of the genes of group 6, that are present in the individual described above, or cDNAs synthesized by reverse transcription from the at least one RNA. More preferably, the probes are ones including complementary nucleotide sequences, at least in part, to the nucleotide sequences of at least one RNA selected from the group consisting of RNAs expressed from the genes of group 7 described in FIG. 34 or at least one RNA selected from the group consisting of RNAs expressed from the orthologs, of the genes of group 7, that are present in the individual described above, or cDNAs synthesized by reverse transcription from the at least one RNA.

For example, when the specific disease is a tumor, the probes are, more specifically, ones including complementary nucleotide sequences, at least in part, to the nucleotide sequences of at least one RNA selected from the group consisting of RNAs expressed from the genes of group 3 described in FIG. 36, 38, or 39 or at least one RNA selected from the group consisting of RNAs expressed from the orthologs, of the genes of group 3, that are present in the individual described above, or cDNAs synthesized by reverse transcription from the at least one RNA. More preferably, the probes are ones including complementary nucleotide sequences, at least in part, to the nucleotide sequences of at least one RNA selected from the group consisting of RNAs expressed from the genes of group 4 described in FIG. 36, 38, or 39 or at least one RNA selected from the group consisting of RNAs expressed from the orthologs, of the genes of group 4, that are present in the individual described above, or cDNAs synthesized by reverse transcription from the at least one RNA. More preferably, the probes are ones including complementary nucleotide sequences, at least in part, to the nucleotide sequences of at least one RNA selected from the group consisting of RNAs expressed from the genes of group 5 described in FIG. 36, 38, or 39 or at least one RNA selected from the group consisting of RNAs expressed from the orthologs, of the genes of group 5, that are present in the individual described above, or cDNAs synthesized by reverse transcription from the at least one RNA. More preferably, the probes are ones including complementary nucleotide sequences, at least in part, to the nucleotide sequences of at least one RNA selected from the group consisting of RNAs expressed from the genes of group 6 described in FIG. 36, 38, or 39 or at least one RNA selected from the group consisting of RNAs expressed from the orthologs, of the genes of group 6, that are present in the individual described above, or cDNAs synthesized by reverse transcription from the at least one RNA. More preferably, the probes are ones including complementary nucleotide sequences, at least in part, to the nucleotide sequences of at least one RNA selected from the group consisting of RNAs expressed from the genes of group 7 described in FIG. 36, 38, or 39 or at least one RNA selected from the group consisting of RNAs expressed from the orthologs, of the genes of group 7, that are present in the individual described above, or cDNAs synthesized by reverse transcription from the at least one RNA.

The probes that the microarray comprises may be DNA or RNA, and preferably DNA. The length of the probes is not particularly limited as long as the probes have a length that can be used as capture probes of the microarray, and is preferably about 100 mer, more preferably about 60 mer, and even more preferably about 20 to 30 mer. The probes can be produced with, for example, a known oligonucleotide synthesizer.

The basal material of the microarray is also not particularly limited as long as nucleic acid probes can be immobilized on it. Examples include glass, polymers, such as polypropylene, nylon membranes, and the like.

The probes may be immobilized on the basal material according to a known method. For example, a spacer containing a reactive group or a cross-linker for immobilizing probes may be used.

Further, the present invention includes a kit comprising the microarray mentioned above for use in the methods described in Section 4, Section 5, and/or Section 6 above. The kit of the present invention preferably comprises not only the microarray, but also a medium, such as paper or a compact disc, on which information about nucleic acids that can detect the probes on the microarray and information about the locations of the probes are stored, or a medium, such as paper or a compact disc, on which information for accessing such information is stored.

Additionally, a buffer or the like used for hybridization may be supplied with the kit.

9. Supplementary Note

In the prediction apparatuses and the prediction programs based on the inter-organ cross talk system described in the above embodiments, regarding the presence of efficacy against a disease or a side effect (or side effects), the results of checking against a known database of diseases can be output by computer processing as prediction results based on gene candidates. Moreover, the prediction apparatuses and the prediction programs based on the inter-organ cross talk system can serve as apparatuses and programs for assisting an operator in prediction by presenting gene candidates to the operator and further presenting efficacy or a side effect (or side effects) associated with the gene candidates so that the operator can easily understand them.

EXAMPLES

The present invention is described in more detail below with reference to examples. The present invention, however, should not be construed as limited to the examples.

I. i-Organs

1. Myocardial Infarction Model

1-1. Establishment of Myocardial Infarction Mouse Model, Organ Collection, and Blood Collection

8- to 12-week-old male ICR mice were anesthetized with 2-2.5% isoflurane (Abbott Japan, Wako Japan) and endotracheally intubated with a 20-gauge venous catheter. The mice were ventilated with a volume-controlled respirator (Harvard Apparatus) with 200 μL per cycle at a rate of 110 cycles per minute. After the hair of the mice was removed with a depilatory agent, the chest of each mouse was opened, and the left coronary artery 1 to 2 mm below the left auricle was tied with a 8-0 nylon suture. Occlusion was confirmed by a change in the color of the left ventricle wall (becoming pale). Suturing between the incised ribs was performed by using 5-0 silk thread, and the skin was sutured using a 9-mm Autoclip. After the surgery, the mice were placed on a hot plate set at 37° C., followed by waiting for the mice to wake up for 30 minutes. In sham-operated mice, the same operation was performed, except that a suture was only passed under the left coronary artery; i.e., the left coronary artery was not tied with a suture. Thereafter, the cardiac function was monitored by echocardiography. Tissue of the heart, brain, kidney, adipose tissue, spleen, liver, lung, testis, muscle, pancreas, thymus, bone marrow, and ear (skin containing no cartilage portions; the same applies hereinafter) was collected 1 hour, 6 hours, 1 day, 7 days, and 8 weeks after myocardial infarction, rapidly frozen in liquid nitrogen, and stored at −80° C. In addition, blood was collected from the tail vein with a micro blood collection tube treated with heparin lithium (Terumo Corporation) 1 day, 7 days, and 8 weeks after myocardial infarction. The collected blood was transferred to a 1.5-mL tube rinsed with Novo-Heparin (Mochida Pharmaceutical Co., Ltd.) and centrifuged at 15,000 rpm for 5 minutes, and the supernatant (plasma) was separated and stored at −80° C. Mice for organ collection and mice for blood collection were separately prepared.

1-2. Echocardiography

Whether the myocardial infarction mouse model was appropriately generated was evaluated by echocardiography.

Toshiba Diagnostic Ultrasound System Machine (Aplio MX SSA-780A) and Vevo2100 Imaging System (Primetech Corporation) were used for the echocardiography. Monitoring the mice by the echocardiography was performed 1 hour, 6 hours, 1 day, 7 days, 2 weeks, 4 weeks, 6 weeks, and 8 weeks after myocardial infarction. The mice were anesthetized with 2-2.5% isoflurane, and movement of the heart was recorded in the long-axis 2D-mode view and M-mode view. The diameter of the cavity in diastole and systole in the long-axis 2D-mode view was measured, and the left ventricular contractile function was evaluated by ejection fraction (% EF).


% EF=[(EDv−ESv)/EDv]×100

EDv: diameter at the end of diastole
ESv: diameter at the end of systole

Mice that did not show a decrease in % EF value after coronary artery ligation were deemed a ligation failure and excluded from the experiment. Mice that showed a decrease in the % EF value after ligation, but showed an increase in the % EF value again at a later date, were determined to have had the ligature become released for some reason, and such mice were excluded from the experiment.

1-3. Analysis of Metabolite

(1) Extraction and Derivatization of Metabolite

For fat, the pancreas, and testis, tissue of each organ and methanol (100 μL per 100 mg of tissue) were individually placed in tubes for homogenization (Bio Medical Science Inc.) containing Zr beads (2 beads (5 mm), 5 beads (3 mm), and 50 beads (1.5 mm)) and homogenized with a Cell Destroyer PS1000 (Bio Medical Science Inc.) (4,260 rpm, 45 sec×2). Subsequently, 500 μL of methanol (containing 2-isopropylmalic acid, which is an internal standard) was added to each kind of tissue in an amount equivalent to 50 mg and mixed with Cell Destroyer, and the resulting mixtures were used as samples (4,260 rpm, 45 sec×1). For the spleen and lung, 100 mg of each tissue sample and 500 μL of methanol (containing 20 μL of a 0.5 mg/mL aqueous solution of 2-isopropylmalic acid) were individually placed in tubes for homogenization containing Zr beads (2 beads (5 mm), 5 beads (3 mm), 50 beads (1.5 mm)) and homogenized with Cell Destroyer, thereby obtaining samples (4,260 rpm, 45 sec×2). For the heart, brain, kidney, liver, and muscle, each tissue sample and 500 μL of methanol (containing 2-isopropylmalic acid) were individually placed in tubes for homogenization containing Zr beads (2 beads (5 mm), 5 beads (3 mm), 50 beads (1.5 mm)) and homogenized with Cell Destroyer (4260 rpm, 45 sec×2). After centrifugation at 15,000 rpm for 15 minutes, the supernatant in each tube was transferred to another tube. Some of the supernatant in an amount equivalent to 50 mg was transferred to still another tube and used as a sample. For a plasma sample, 500 μL of methanol (containing 2-isopropylmalic acid) was added to 10 μL of the plasma sample, and the mixture was stirred by vortexing for 30 seconds, left to stand at room temperature for 10 minutes, and used as a sample. 200 μL of Milli-Q water and 500 μL of chloroform were added to each of these samples, and each mixture was vortexed for 30 seconds and centrifuged at 7,100 rpm for 5 minutes. 400 μL of the aqueous layer was collected into a fresh tube. 200 μL of Milli-Q and 200 μL of chloroform were added thereto, and the mixture was vortexed again for 30 seconds and centrifuged at 7,100 rpm for 5 minutes. Thereafter, 400 μL of the aqueous layer was transferred to an ultrafiltration unit cup (Hydrophlic PTFE membrane, 0.2 μm; Millipore), centrifuged at 10,000 rpm for 15 minutes, and stored at −80° C. until analysis. Before measurement, each sample in an amount equivalent to 10 mg or 10 μL was dried under reduced pressure, and 50 μL of a pyridine solution containing 20 mg/mL methoxyamine hydrochloride was added. Each mixture was then shaken with a shaker at 37° C. for 90 minutes. After that, 50 μL of N-methyl-N-trimethylsilyltrifluoroacetamide (MSTFA) was further added, and the resulting mixtures were shaken with a shaker at 37° C. for 30 minutes and trimethylsilylated.

(2) GCMS Measurement

GCMS-TQ8030 (Shimadzu Corporation) was used for GCMS, and DB-5 (30 m×0.25 mm (inner diameter)×1.00 μm (film thickness)) (Agilent Technologies) was used as a capillary column for GC. GC was performed under the following temperature increase conditions: the temperature was increased at a rate of 4° C./min from 100° C. to 320° C. The injector port temperature was 280° C. Helium was used as carrier gas and made to flow at a rate of 39.0 cm/sec. The energy of the electron ionization was 150 eV, the ion source temperature was 200° C., and the range of m/z to be scanned was 45 to 600. 1 μL of each sample was individually injected and measured under the following conditions.

Heart_Split1:25_detector voltage+0.3 kV
Brain_Split1:25_detector voltage+0.2 kV
Kidney_Split1:25_detector voltage+0.3 kV
Liver_Split1:25_detector voltage+0.3 kV
Pancreas_Split1:25_detector voltage+0.3 kV
Skeletal muscle_Split1:25_detector voltage+0.2 kV
Adipose tissue_Split1:3_detector voltage+0.2 kV
Blood plasma_Split1:10_detector voltage+0.1 kV
Spleen_Split1:25_detector voltage+0.2 kV
Lung_Split1:25_detector voltage+0.3 kV
Testis_Split1:10_detector voltage+0.3 kV
Thymus_Split1:25_detector voltage+0.3 kV

(3) Analysis of GCMS Data

Searching was performed by using GCMS solution Ver. 4.2, which is data analysis software, and GCMS Metabolites Database (Shimadzu Corporation). The target items were metabolites described in FIG. 28. To identify metabolites, the expected retention time and the presence of m/z of at least two specific peaks (target ion, confirmation ion), and the ratio of the specific peaks were confirmed. In each identified metabolite, the peak area of the target ion was measured and normalized using the peak area of the internal standard (2-isopropylmalic acid) and the sample amount.

The value of the normalized peak area mentioned above of each metabolite detected by GCMS in the myocardial infarction mouse model was divided by the value corresponding to the metabolite in the sham-operated mice. FIG. 29 shows metabolites in which the determined value (also referred to as “MI/Sham value”) is more than 1 or less than 1. When there were multiple kinds of trimethylsilylated derivatives in a single metabolite, the total value of the plurality of derivatives was calculated.

1-4. Analysis of RNA

(1) Extraction of RNA from Each Tissue (for RNAseq)

Each cryopreserved tissue was individually homogenized in TRIzol Reagent (Life Technologies) with a PT 10-35 6T Polytron homogenizer (Kineatica). After homogenized tissue with TRIzol Reagent in a tube was incubated at room temperature for 5 minutes to separate proteins, 0.2 mL of chloroform was added per mL of TRIzol, and the tubes were capped. Subsequently, the mixture in each tube was vortexed vigorously for 15 seconds. After the vortexing, the mixture was incubated at room temperature for 3 minutes and centrifuged at 12,000×g for 15 minutes at 4° C., and the RNA-containing aqueous layer was collected in a fresh tube. An equal amount of 70% ethanol was added to the collected aqueous layer, and mixed. Then, 700 μL of the mixture was applied to each RNeasy mini column (Qiagen), and purified RNAs were collected according to the RNeasy mini kit (Qiagen) standard protocol. The quality of each of the collected RNAs was evaluated by 1% agarose electrophoresis. The concentration of each of the collected RNAs was measured by Nanodrop.

(2) Obtaining RNAseq Data

RNAseq data was obtained using the samples described above by the following procedure.

i. Quality Check

Quality testing of the samples was performed based on the following items.

    • Concentration measurement using Nanodrop (spectrophotometer)
    • Concentration measurement and quality check using an Agilent 2100 Bioanalyzer
      ii. Preparation of Sample

A library for sequencing was prepared using 500 to 1000 ng of each total RNA sample that passed the quality testing as a template with Illumina's TruSeq RNA Sample Prep Kit according to the standard protocol in the following manner.

(a) Purification of poly(A)-RNA using Oligo-dT beads
(b) Poly(A)-RNA fragmentation
(c) Reverse transcription/2nd strand cDNA synthesis
(d) Terminus repair and 3′A addition
(e) Adapter ligation
Note: The adapters contain index tags for identification of specimens.
(f) PCR amplification
(g) Purification and removal of low-molecular-weight substances (<200 bp) using AMPure XP beads
iii. Obtaining Data Using Next-Generation Sequencer

Nucleotide sequence data was obtained using an Illumina HiSeq next-generation sequencer by reading 100 bases according to the single-read method.

(3) Analysis of RNAseq Data and Generation of Heat Map

(3-1) Analysis of Output Data Obtained Using Next-Generation Sequencer

The following information processing was carried out for the output data.

i. Base calling: text data of nucleotide sequences was obtained from the output raw data of analysis (image data).
ii. Filtering: selection of read data by predetermined filtering was performed.
iii. Sorting based on index sequences: sample data was sorted based on index information.

(3-2) Secondary Analysis of Output Data

The data file (Fastq format) obtained using Illumina Hiseq was uploaded on Galaxy (https://usegalaxy.org/) downloaded to a local server. Then, analysis was carried out using Bowtie2 (http://bowtie-bio.sourceforge.net/bowtie2/index.shtml) to map each sequence to mouse genome map information mm9. The BAM file obtained using Bowtie2 was analyzed using Cufflinks (http://cole-trapnell-lab.github.io/cufflinks/) to calculate FPKM (RPKM) for each gene (each of the genes shown in FIG. 25).

(3-3) Classification of RNA

Values were calculated by dividing the expression level of each RNA (FPKM value) in the myocardial infarction mouse model by the expression level of the corresponding RNA (FPKM value) in the sham-operated mice (hereinafter also referred to as “MI/Sham”). RNAs in which MI/Sham is more than 1 or less than 1 were classified as group 4, RNAs in which MI/Sham is more than 1.5 or less than 0.67 were classified as group 5, RNAs in which MI/Sham is more than 2 or less than 0.5 were classified as group 6, and RNAs in which MI/Sham is more than 5 or less than 0.2 were classified as group 7 (FIG. 30). The RNAs of group 3 were observed to be expressed in the organs tested (heart, cerebrum, lung, kidney, adipose tissue, liver, skeletal muscle, testis, spleen, thymus, bone marrow, pancreas, and ear) within 8 weeks after left coronary artery ligation in the myocardial infarction mouse model; i.e., they are RNAs in which the FPKM value is 1 or more.

Further, FIG. 31 shows time-course changes in the RNA expression in each organ among the analyzed RNAs that have MI/Sham of more than 5 or less than 0.2.

(4) cDNA Synthesis and Quantifying Relative Expression Level by Real-Time PCR

Genes in which MI/Sham was larger or smaller in the analysis of RNAs were selected, and their expression was confirmed by real-time PCR (FIG. 32).

1 μg of total RNA obtained from each tissue was used as a template for cDNA synthesis, and cDNA was synthesized using Oligo dT20 primer according to the standard protocol of Superscript III First-Strand Synthesis Supermix (Life Technologies). After the synthesized cDNA was diluted 20-fold with 10-fold diluted TE buffer (10 mM Tris-HCl, pH 8.0, 0.1 mM EDTA), real-time PCR was performed with a LightCycler 48011 (Roche) according to the standard protocol of LightCycler 480 SYBR Green I Master (Roche) and Cp values were measured. The relative expression level of each gene relative to the reference gene was calculated by comparing the Cp value obtained for each gene with the Cp value for β2-microglobulin (B2m) or Maea as a reference gene, and MI/Sham was determined. The primer pairs used in the real-time PCR are as shown in Tables 9-1 to 9-3. However, with the primer set for Hba-a, Hba-a1 and Hba-a2 cannot be distinguished in PCR, and with the primer set for Hbb-b, Hbb-b1, Hbb-bs, and Hbb-bt cannot be distinguished in PCR. Thus, when there are Hba-a1 and Hba-a2, or Hbb-b1, Hbb-bs, and Hbb-bt, in a sample, the expression level is their total amount.

2. Young-Onset Dementia Model

2-1. Young-Onset Dementia Mouse Model, Organ Collection, and Blood Collection

Male mice (SAMP8/Ta S1c) (hereinafter also referred to as “SAMP8”; Japan SLC, Inc.) were used as a young-onset dementia mouse model, and male mice (SAMR1/Ta S1c) (hereinafter also referred to as “SAMR1”; Japan SLC, Inc.) were used as control mice. The SAM strain of mice is a mouse model for senescence acceleration reported by Toshio Takeda (Jpn. J. Hyp., 51, 569-578, 1996).

The step-through test was performed by using mice at 8 weeks of age (early stage), 16 weeks of age (middle stage), and 32 weeks of age (late stage), 10 mice at each stage, in each of the strains SAMP8 and SAMR1, and mice were selected in the early stage, the middle stage, and the late stage, six mice in each stage.

(1) Step-Through Test

The mice were subjected to acclimatization and an acquisition trial on day 1 and subjected to a retention trial on day 2. Each trial was performed by using a shuttle box (Muromachi Kikai Co., Ltd.). The shuttle box had a light compartment on one side and a dark compartment on the other side, and an openable partition was provided between the two compartments. Electricity was applied in only the dark compartment.

In acclimatization, the mice were placed in the light compartment, and 10 seconds later, the partition was opened. Immediately after the mice moved to the dark compartment, the partition was closed, and the state was maintained for 10 seconds. No electric shock was given.

In the acquisition trial, the mice were placed in the light compartment, and 10 seconds later, the partition was opened. From this point, latency (time elapsed until a mouse moves to the dark compartment) was measured for up to 300 seconds. When a mouse moved to the dark compartment, the partition was rapidly closed, and an electric shock was given (0.2 mA, 3 seconds). When a mouse did not move to the dark compartment even after the elapse of 300 seconds, the mouse was forced to move to the dark compartment; the partition was then closed, and an electric shock was given (0.2 mA, 3 seconds).

In the retention trial, the mice were placed in the light compartment, and 10 seconds later, the partition was opened. From this point, latency (time until a mouse moves to the dark compartment) was measured for up to 300 seconds.

(2) Selection and Grouping of Animals

The average value of the latency in the retention trial in the step-through test was determined for the mice of each strain and each age in weeks. Six mice of the same animal species and the same age in weeks (three for extraction of RNAs and three for extraction of metabolites) were selected in each case in order of proximity of the latency in the retention trial to the average value. When mice showed the same latency, a mouse with the smaller individual identification number was selected.

Table 5 shows the results of the step-through test.

TABLE 5
Individual Difference
Weeks identification Latency in Latency in from average
Strain of age No. acquisition trial retention trial value Selection Group name
SAMR1  8 1 11.57 140.19 32.9 Group B
2 5.9 61.47 −45.82 Group B
3 5.4 42.57 −64.72 Group A
4 12.25 31.19 −76.1 Group B
5 5.97 300 192.71 x
6 7.65 50.87 −56.42 Group A
7 4 7.12 −100.17 x
8 7.69 19.65 −87.64 x
9 12.06 246.37 139.08 x
10 16.85 173.5 66.21 Group A
Mean 8.93 107.29
S.E. 1.28 32.48
SAMR1 16 11 5.81 21.53 −194.37 x
12 17.82 300 84.1 Group D
13 9.94 300 84.1 Group C
14 9.88 300 84.1 Group D
15 14.91 300 84.1 Group C
16 6.56 300 84.1 Group C
17 10.5 199.03 −16.87 Group D
18 7.25 126.28 −89.62 x
19 9.1 300 84.1 x
20 11.53 12.19 −203.71 x
Mean 10.33 215.9
S.E. 1.18 38.01
SAMP8  8 31 7.75 11.06 −7.21 Group H
32 4.63 12.97 −5.3 Group G
33 10.1 48.06 29.79 x
34 7.15 9.5 −8.77 Group G
35 4.09 23.57 5.3 Group H
36 6.54 32.87 14.6 x
37 4.41 9.04 −9.23 x
38 6.07 11.5 −6.77 Group H
39 5.12 3.84 −14.43 x
40 4.34 20.25 1.98 Group G
Mean 6.02 18.27
S.E. 0.61 4.25
SAMP8 16 41 11.69 2.59 −5.59 x
42 9.69 13.5 5.32 x
43 3.15 9.97 1.79 Group J
44 3.87 2.75 −5.43 x
45 1.62 6.75 −1.43 Group J
46 7.06 8.5 0.32 Group I
47 7.44 3.15 −5.03 Group J
48 6.34 6.04 −2.14 Group I
49 7.59 15.85 7.67 x

(3) Organ Collection and Blood Collection

Each mouse from which organs were to be collected for extraction of metabolites first had laparotomy performed under anesthesia with isoflurane, and blood was collected from the abdominal vena cava using a syringe and an injection needle. The obtained blood was collected in a micro blood collection tube (BD Microtainer Tubes with K2E(K2EDTA)) and stored in ice until centrifugation. After centrifugation, plasma was separated. The obtained plasma was stored at −80° C. After blood collection, the mouse was euthanized by cervical dislocation to collect organs, and 14 organs (heart, brain, kidney, adipose tissue (around the epididymis), brown fat, spleen, liver, lung, testis, muscle, pancreas, thymus, stomach, and large intestine) were collected. After the wet weights of the collected organs were measured, the organs were rapidly frozen in liquid nitrogen and stored at −80° C.

Each mouse from which organs were to be collected for extraction of RNAs was euthanized by cervical dislocation without anesthesia, and 16 organs (muscle, brown fat, heart, lung, thymus, kidney, liver, large intestine, stomach, adipose tissue (around the epididymis), testis, spleen, pancreas, brain, ear, bone marrow) were collected. After the wet weights of the organs were measured, the organs were rapidly frozen in liquid nitrogen and stored at −80° C.

2-2. Measurement of Metabolite

(1) Extraction of Metabolite

For the brain, adipose tissue (around the epididymis), brown fat, spleen, pancreas, testis, stomach, large intestine, liver, kidney, lung, heart, and skeletal muscle, tissue of each organ and 50% acetonitrile containing an internal standard substance (Solution ID: 304-1002; HMT) (1500 μL per 50 mg of the tissue) were individually placed in tubes for homogenization (Bio Medical Science Inc.) containing Zr beads (5 beads (5 mm), 1 bead (10 mm)) and homogenized with Shake Master Neo V.1.0 (Bio Medical Science Inc.), thereby obtaining samples (1,500 rpm, 60 sec×3).

For the thymus, its tissue and 50% acetonitrile containing an internal standard substance (Solution ID: 304-1002; HMT) (1500 μL per 50 mg of the tissue) were placed in a tube for homogenization (Bio Medical Science Inc.) containing Zr beads (1 bead (5 mm), 5 beads (3 mm)) and homogenized with MS-100R of Tomy Seiko Co., Ltd. (1,500 rpm, 60 sec×3). When homogenization was insufficient, it was performed until the tissue was homogenized.

The samples after the homogenization were centrifuged (2,300×g, 4° C., 5 minutes), and 800 μL of each supernatant had ultrafiltration performed using an ultrafiltration unit cup (UFC3LCCNB-HMT, 5k; HMT) (9,100×g, 4° C., 5 hours). Each of the samples after the ultrafiltration was dried under reduced pressure, redissolved in 50 μL of MiliQ, and measured.

For plasma, 450 μL of methanol containing an internal standard substance (Solution ID: 304-1002; HMT), 500 μL of chloroform, and 200 μL of MiliQ were added to 50 μL of the sample. The mixture was vortexed and centrifuged (2,300×g, 4° C., 5 minutes), and ultrafiltration (UFC3LCCNB-HMT, 5k; HMT) (9,100×g, 4° C., 5 hours) was performed on 400 μL of the supernatant. The sample after the ultrafiltration was dried under reduced pressure, and the sample after drying under reduced pressure was dissolved in 50 μL of MiliQ and measured.

(2) CE-MS Measurement

Agilent CE-TOFMS system (Agilent Technologies) was used for CE-MS, and a fused silica capillary (i.d. 50 μm×80 cm) was used for a capillary column for CE. As electrophoresis buffers in CE, a cation buffer solution (p/n: H3301-1001; HMT) was used for cations, and an anion buffer solution (p/n: 13302-1023; HMT) was used for anions.

Measurement Conditions on the Cation Side

Electrophoresis was performed under the following sample injection conditions: pressure injection: 50 mbar, 10 sec; the electrophoresis voltage of CE: 27 kV. The energy of electron ionization was 4,000 V, and the range to be scanned was 50 to 1000. 5 nL of each sample was individually injected.

CE voltage: Positive, 27 kV
MS ionization: ESI Positive
MS capillary voltage: 4,000 V
MS scan range: m/z 50-1,000
Sheath liquid: HMT Sheath Liquid (p/n: H3301-1020)

Measurement Conditions on the Anion Side

Electrophoresis was performed under the following sample injection conditions: pressure injection: 50 mbar, 25 sec; the electrophoresis voltage of CE: 30 kV. The energy of the electron ionization was 3,500 V, and the range to be scanned was 50 to 1000. 5 nL of each sample was individually injected.

CE voltage: Positive, 30 kV
MS ionization: ESI Negative
MS capillary voltage: 3,500 V
MS scan range: m/z 50-1,000
Sheath liquid: HMT Sheath Liquid (p/n: H3301-1020)

(3) Analysis of CE-MS Data

The metabolites shown in FIG. 28 were analyzed. Detected peaks were processed with automatic integration software MasterHands ver.2.16.0.15 (developed by Keio University). Peaks having a signal-to-noise (S/N) ratio of 3 or more were automatically extracted, and metabolite identification was performed by using the mass-to-charge ratio (m/z), peak area value, and migration time (MT). The target items were metabolites listed in an HMT CE-MS annotation list.

For each of the identified metabolites, the peak area of the target ion was measured and normalized using the peak area of the internal standard and the sample amount.

The peak area of each metabolite in SAMP8 was divided by the peak area of the corresponding metabolite in SAMR1 (control). The obtained values (SAMP8/Control values) are shown in FIG. 33.

2-3. Analysis of RNA

(1) Extraction of RNA from Each Kind of Tissue

Each cryopreserved tissue was individually homogenized in TRIzol Reagent (Life Technologies) with Cell Destroyer PS1000 (Pro Sense Inc.) or PT 10-35 6T Polytron homogenizer (Kineatica). After homogenized tissue with TRIzol Reagent in a tube was incubated for 5 minutes at room temperature to separate proteins, 0.2 mL of chloroform was added per mL of TRIzol, and the tubes were capped. Subsequently, the mixture in each tube was vortexed vigorously for 15 seconds. After the vortexing, the mixture was incubated at room temperature for 3 minutes and centrifuged at 12,000×g for 15 minutes at 4° C., and the RNA-containing aqueous layer was collected in a fresh tube. An equal amount of 70% ethanol was added to the collected aqueous layer, and mixed. Then, 700 μL of the mixture was applied to each RNeasy mini column (Qiagen), and purified RNAs were collected according to the RNeasy mini kit (Qiagen) standard protocol. The quality of each of the collected RNAs was evaluated by 1% agarose electrophoresis. The concentration of each of the collected RNAs was measured by Nanodrop.

(2) Obtaining RNAseq Data

RNAseq data was obtained using the samples described above by the following procedure.

i. Quality Check

Quality testing of the samples was performed based on the following item.

    • Concentration measurement and quality check using Agilent 2200 TapeStationSytem
      ii. Preparation of Sample

A library for sequencing was prepared using 500 to 1000 ng of each total RNA sample that passed the quality testing as a template with Illumina's TruSeq RNA Sample Prep Kit according to the standard protocol in the following manner.

(a) Purification of poly(A)-RNA using Oligo-dT beads
(b) Poly(A)-RNA fragmentation
(c) Reverse transcription/2nd strand cDNA synthesis
(d) Terminus repair and 3′A addition
(e) Adapter ligation
Note: The adapters contain index tags for identification of specimens.
(f) PCR amplification
(g) Purification and removal of low-molecular-weight substances (<200 bp) using AMPure XP beads
iii. Obtaining Data Using Next-Generation Sequencer

Nucleotide sequence data was obtained using an Illumina HiSeq 4000 next-generation sequencer by reading 100 bases according to the paired-end method.

(3) Analysis of RNAseq Data and Generation of Heat Map

(3-1) Analysis of Output Data Obtained Using Next-Generation Sequencer

The following information processing was carried out for the output data.

i. Base calling: text data of nucleotide sequences was obtained from the output raw data of analysis (image data).
ii. Filtering: selection of read data by predetermined filtering was performed.
iii. Sorting based on index sequences: sample data was sorted based on index information.

(3-2) Secondary Analysis of Output Data

The data file (Fastq format) obtained using Illumina Hiseq was uploaded on Galaxy (https://usegalaxy.org/) downloaded to a local server. Thereafter, analysis was carried out using Bowtie2 (http://bowtie-bio.sourceforge.net/bowtie2/index.shtml) to map each sequence to mouse genome map information mm10. The BAM file obtained using Bowtie2 was analyzed using Cufflinks (http://cole-trapnell-lab.github.io/cufflinks/) to calculate FPKM for each gene (each of the genes shown in FIG. 26).

(3-3) Classification of RNA

Values were calculated by dividing the expression level of each RNA (FPKM value) in SAMP8 by the expression level of the corresponding RNA (FPKM value) in SAMR1 (control) (hereinafter also referred to as “SAMP8/Control”). RNAs in which SAMP8/Control is more than 1 or less than 1 were classified as group 4, RNAs in which SAMP8/Control is more than 1.5 or less than 0.67 were classified as group 5, RNAs in which SAMP8/Control is more than 2 or less than 0.5 were classified as group 6, and RNAs in which SAMP8/Control is more than 5 or less than 0.2 were classified as group 7 (FIG. 34). The RNAs of group 3 were observed to be expressed in any of the organs tested by the time the SMAP8 mice were 32 weeks old; i.e., they are RNAs in which the FPKM value is 1 or more.

Further, among the analyzed RNAs, FIG. 35 shows time-course changes in the RNAs of group 7 in each organ.

3. Glioma Model

3-1. Glioma Mouse Model, Organ Collection, and Blood Collection

Hair on the heads of 7-week-old male NOD/ShiJic-scid JCI mice was shaved with a hair clipper without anesthesia by the day of transplantation. A mixture of three kinds of anesthetics ((i) medetomidine hydrochloride (trade name: Domitor, Nippon Zenyaku Kogyo Co., Ltd.), (ii) midazolam (trade name: Dormicum, Astellas Pharma Inc.), and (iii) butorphanol tartrate (trade name: Vetorphale, Meiji Seika Pharma Co., Ltd.) was intraperitoneally administered to deeply anesthetize the animals.

The head of each animal was fixed using a brain stereotaxis apparatus (model no.: 68012, RWD), and the skull was exposed by incision of the skin of the head. The brain stereotaxis apparatus was operated to bring an injection needle into contact with the skull above the transplantation site and the skull was marked. A hole was drilled in the marked area of the skull with a dental drill.

A microsyringe (model no.: 80300, Hamilton) filled with a cell suspension of human glioblastoma U87-MG (concentration of cells to be transplanted: 1×108 cells/mL) was attached to a manual stereotaxic injector (model no.: 68606, RWD) provided with the brain stereotaxis apparatus. The cell suspension adhering around the needle of the microsyringe was wiped off. The dial of the electrode holder of the brain stereotaxis apparatus was turned to slowly lower the needle tip of the microsyringe to the dura mater of the transplantation site. The needle broke through the dura mater, and outflow of cerebrospinal fluid was confirmed. Subsequently, the needle was slowly inserted from there to a depth of 3 mm into the cerebral parenchyma. The dial of the manual stereotaxic injector was turned, and 2 μL of the cell suspension was injected over 2 minutes. It was confirmed that there was no backflow, and that the microsyringe was advanced to 2 μL of the scale. After the injection, the needle was maintained for 5 minutes in that state. Then, the dial of the electrode holder was slowly turned in the opposite direction to withdraw the needle of the microsyringe over a period of 2 minutes. After withdrawing the needle of the microsyringe, the cell suspension was wiped off with sterilized gauze if present. The incision was sutured with a nylon suture. Atipamezole hydrochloride (trade name: Antisedan, Nippon Zenyaku Kogyo Co., Ltd.) was intraperitoneally administered to allow the mice to wake from anesthesia, and the mice were returned to their cage. In a solvent transplantation group (control), only the PBS as the solvent was administered intracerebrally instead of the cell suspension.

On day 3 and day 7 after transplantation, the animals were euthanized by cervical dislocation, and 16 organs (muscle, brown fat, heart, lung, kidney, liver, large intestine, stomach, adipose tissue (around the epididymis), testis, spleen, pancreas, left brain, right brain, ear, and bone marrow) and blood were collected. After their wet weights were measured, the organs and blood were rapidly frozen in liquid nitrogen and stored at −80° C.

3-2. Analysis of RNA

Extraction of RNAs from each tissue, obtaining RNAseq data, analysis of RNAseq data and generation of heat map, and secondary analysis of output data were performed as described in 2-1 and 2-3 of “I. iOrgans” above.

Values were calculated by dividing the expression level of each RNA (FPKM value) in the glioma mouse model by the expression level of the corresponding RNA (FPKM value) in the mice of the control group (hereinafter also referred to as “Glioma/Control”). RNAs in which Glioma/Control is more than 1 or less than 1 were classified as group 4, RNAs in which Glioma/Control is more than 1.5 or less than 0.67 were classified as group 5, RNAs in which Glioma/Control is more than 2 or less than 0.5 were classified as group 6, and RNAs in which Glioma/Control is more than 5 or less than 0.2 were classified as group 7 (FIG. 36). The RNAs of group 3 were observed to be expressed in the organs tested by day 7 after the glioma transplantation; i.e., they are RNAs in which the FPKM value is 1 or more.

Further, among the analyzed RNAs, FIG. 37 shows time-course changes in the RNAs of group 7 in each organ.

4. Human Tumor Patient

4-1. Collecting Skin and Blood from Human Tumor Patient and Healthy Individual

Human specimens were collected in the clinical study “Haigan oyobi Nyugan Kanja kara Saishushita Soshiki Taieki no Idenshi Hatsugen Kaiseki (Gene expression analysis of tissue and body fluids collected from lung cancer and breast cancer patients)” conducted with approval from the ethics committee of the National Hospital Organization Kure Medical Center and Chugoku Cancer Center.

Blood was collected from one female breast cancer patient and one male lung cancer patient. Skin was collected from two female breast cancer patients and one male lung cancer patient. The selected patients met the following criteria.

Inclusion Criteria

  • (1) Patient diagnosed with lung cancer or breast cancer and scheduled to be operated on
    • In the case of lung cancer, patient with clinical stage I-II non-small-cell lung cancer
    • In the case of breast cancer, patient with clinical stage
  • (2) Patient who is able to fully understand this study plan and is able to consent by himself or herself
  • (3) Patient aged 20 years or older at the time of obtaining consent

Exclusion Criteria

  • (1) Patient who is deemed unsuitable as a subject by a researcher
  • (2) HBs antigen-positive patient, HBc antibody-positive patient, HCV antibody-positive patient, HIV-infected patient, HTLV-1-infected patient, syphilis-positive patient
  • (3) Patient with a history of cancer
  • (4) Patient with a history of myocardial infarction
  • (5) Patient with a history of diabetes
  • (6) Patient with a history of kidney disease

Blood was also collected from five healthy women. Breast skin of healthy women were obtained from Biopredic International.

3 mL of blood was individually collected in Tempus Blood RNA Tubes (Thermo Fisher Scientific), and immediately after the collection, the tubes were vigorously shaken for 10 seconds to uniformly mix the blood and the stabilizer and then stored at −20° C.

The skin was stored at −80° C. until use.

4-2. Analysis of RNA

Extraction of RNAs from each tissue, obtaining RNAseq data, analysis of RNAseq data and generation of heat map, and secondary analysis of output data were performed as described in 2-1 and 2-3 of “I. iOrgans” above.

Values were calculated by dividing the expression level of each RNA (FPKM value) in the skin of the breast cancer patients by the expression level of the corresponding RNA (FPKM value) in the skin of the healthy individuals. RNAs in which the determined value is more than 1 or less than 1 were classified as group 4, RNAs in which the determined value is more than 1.5 or less than 0.67 were classified as group 5, RNAs in which the determined value is more than 2 or less than 0.5 were classified as group 6, and RNAs in which the determined value is more than 5 or less than 0.2 were classified as group 7 (FIG. 38). The RNAs of group 3 are RNAs in which the FPKM value is 1 or more.

Values were calculated by dividing the expression level of each RNA (FPKM value) in the skin of the lung cancer patient by the expression level of the corresponding RNA (FPKM value) in the skin of the healthy individuals. RNAs in which the determined value is more than 1 or less than 1 were classified as group 4, RNAs in which the determined value is more than 1.5 or less than 0.67 were classified as group 5, RNAs in which the determined value is more than 2 or less than 0.5 were classified as group 6, and RNAs in which the determined value is more than 5 or less than 0.2 were classified as group 7 (FIG. 39). The RNAs of group 3 are RNAs in which the FPKM value is 1 or more.

RNAs in which large variation was observed between the healthy human individuals were excluded from the results. More specifically, the ratio of the FPKM value in one healthy individual to the FPKM value in another healthy individual was determined; RNAs in which this ratio falls within the range of 0.75 to 1.25 were divided into groups.

It was believed that FCGR3B, FPR1, HLA-DQA1, LINC00260, LOC286437, MALAT1, MIR1184-1, MIR1247, PRG4, RPL21P44, RPPH1, RPS15AP10, SCARNA4, SNORA31, SNORA77, and ZBTB20 can be markers for cancer because they underwent large changes in the skin both in breast cancer and lung cancer.

Further, values were calculated by dividing the expression level of each RNA (FPKM value) in the blood of the breast cancer patient by the expression level of the corresponding RNA (FPKM value) in the healthy individuals (FPKM value). RNAs in which the determined value is more than 1 or less than 1 were classified as group 4, RNAs in which the determined value is more than 1.5 or less than 0.67 were classified as group 5, RNAs in which the determined value is more than 2 or less than 0.5 were classified as group 6, and RNAs in which the determined value is more than 5 or less than 0.2 were classified as group 7 (FIG. 40). The RNAs of group 3 are RNAs in which the FPKM value is 1 or more.

Values were calculated by dividing the expression level of each RNA (FPKM value) in the blood of the lung cancer patient by the expression level of the corresponding RNA (FPKM value) in the blood of the healthy individuals. RNAs in which the determined value is more than 1 or less than 1 were classified as group 4, RNAs in which the determined value is more than 1.5 or less than 0.67 were classified as group 5, RNAs in which the determined value is more than 2 or less than 0.5 were classified as group 6, and RNAs in which the determined value is more than 5 or less than 0.2 were classified as group 7 (FIG. 41). The RNAs of group 3 are RNAs in which the FPKM value is 1 or more.

RNAs in which large variation was observed between the healthy human individuals was excluded from the results. More specifically, the average (AV) and the standard deviation (SD) of the FPKM values in each RNA in the healthy individuals were determined; RNAs in which the value obtained by dividing the SD value by the AV value is less than 0.25 were divided into groups.

It was believed that HNRNPH2, HP, LOC283663, SNORA40, and TCN2 can be markers for cancer because they underwent large changes in the blood both in the breast cancer and the lung cancer.

5. Example

To demonstrate that a disease in a specific organ and a stage can be predicted from a pattern of inter-organ cross talk indicator in each organ other than the specific organ, obtained from cells or tissue of each organ according to the theory of R-iOrgans, correlation coefficients between patterns of expression of RNAs of group 7 in each of the myocardial infarction model, the young-onset dementia model, and the glioma model was determined for each stage were calculated. The correlation coefficients were calculated in each organ and in each stage. The correlation coefficients were determined by modifying Spearman's rank correlation method and Z-score method.

The similarity was calculated based on correlation coefficients of the patterns of inter-organ cross talk indicators between two organs.

5-1. Spearman's Rank Correlation

Calculation was performed by using function cor (method=“spearman”) of analysis software R. Tables 6-1 to 6-3 show the results.

TABLE 6-1
Myocardial infarction Glioma Dementia
1d 1w 8w d3 d7 E M L
Liver
Myocardial 1d 1.00 0.02 −0.21 0.10 −0.22 0.06 0.02 0.06
infarction 1w 0.02 1.00 0.04 0.05 0.03 0.12 0.02 0.17
8w −0.21 0.04 1.00 0.03 0.04 0.08 0.00 0.07
Glioma d3 0.10 0.05 0.03 1.00 −0.38 0.07 −0.05 0.12
d7 −0.22 0.03 0.04 −0.38 1.00 0.00 0.14 −0.12
Dementia E 0.06 0.12 0.08 0.07 0.00 1.00 0.29 0.60
M 0.02 0.02 0.00 −0.05 0.14 0.29 1.00 0.23
L 0.06 0.17 0.07 0.12 −0.12 0.60 0.23 1.00
Kidney
Myocardial 1d 1.00 0.16 −0.15 −0.15 −0.14 0.12 0.13 0.11
infarction 1w 0.16 1.00 −0.06 −0.07 0.04 0.07 0.06 0.07
8w −0.15 −0.06 1.00 0.07 0.08 0.03 −0.02 0.01
Glioma d3 −0.15 −0.07 0.07 1.00 −0.01 −0.18 −0.16 −0.16
d7 −0.14 0.04 0.08 −0.01 1.00 0.06 −0.02 0.05
Dementia E 0.12 0.07 0.03 −0.18 0.06 1.00 0.40 0.58
M 0.13 0.06 −0.02 −0.16 −0.02 0.40 1.00 0.33
L 0.11 0.07 0.01 −0.16 0.05 0.58 0.33 1.00
Lung
Myocardial 1d 1.00 0.17 0.16 0.08 −0.10 0.04 0.05 0.20
infarction 1w 0.17 1.00 0.13 0.03 0.11 0.11 0.13 −0.05
8w 0.16 0.13 1.00 0.11 0.04 −0.03 −0.06 0.07
Glioma d3 0.08 0.03 0.11 1.00 0.04 −0.25 −0.32 0.03
d7 −0.10 0.11 0.04 0.04 1.00 0.04 0.02 −0.05
Dementia E 0.04 0.11 −0.03 −0.25 0.04 1.00 0.83 0.16
M 0.05 0.13 −0.06 −0.32 0.02 0.83 1.00 0.14
L 0.20 −0.05 0.07 0.03 −0.05 0.16 0.14 1.00
Skeletal muscle
Myocardial 1d 1.00 0.16 −0.02 −0.12 −0.21 0.16 0.23 0.28
infarction 1w 0.16 1.00 0.00 0.00 −0.03 0.01 0.11 0.14
8w −0.02 0.00 1.00 0.02 −0.03 0.16 0.08 0.15
Glioma d3 −0.12 0.00 0.02 1.00 0.04 0.13 −0.19 −0.10
d7 −0.21 −0.03 −0.03 0.04 1.00 −0.21 −0.02 −0.19
Dementia E 0.16 0.01 0.16 0.13 −0.21 1.00 0.15 0.42
M 0.23 0.11 0.08 −0.19 −0.02 0.15 1.00 0.39
L 0.28 0.14 0.15 −0.10 −0.19 0.42 0.39 1.00
Spleen
Myocardial 1d 1.00 −0.15 −0.21 −0.01 −0.21 −0.01 −0.06 0.15
infarction 1w −0.15 1.00 0.30 0.00 0.24 0.08 0.01 −0.03
8w −0.21 0.30 1.00 −0.07 0.20 −0.10 −0.04 −0.17
Glioma d3 −0.01 0.00 −0.07 1.00 0.11 0.13 0.07 0.08
d7 −0.21 0.24 0.20 0.11 1.00 −0.03 −0.08 −0.04
Dementia E −0.01 0.08 −0.10 0.13 −0.03 1.00 0.43 0.48
M −0.06 0.01 −0.04 0.07 −0.08 0.43 1.00 0.22
L 0.15 −0.03 −0.17 0.08 −0.04 0.48 0.22 1.00
Glioma Glioma
Myocardial infarction Left brain Right Left brain Right Dementia
1d 1w 8w d3 brain d3 d7 brain d7 E M L
Brain
Myocardial 1d 1.00 0.13 −0.05 0.10 0.14 0.10 −0.06 −0.01 0.05 0.00
infarction 1w 0.13 1.00 −0.12 −0.03 0.10 0.04 0.09 −0.07 0.01 −0.01
8w −0.05 −0.12 1.00 0.01 0.07 0.03 −0.01 −0.01 0.00 −0.01
Glioma Left brain 0.10 −0.03 0.01 1.00 0.08 −0.06 0.01 0.03 0.03 0.00
d3
Right 0.14 0.10 0.07 0.08 1.0 0.31 0.05 −0.22 −0.04 −0.12
brain d3
Glioma Left brain 0.10 0.04 0.03 −0.06 0.31 1.00 −0.16 −0.32 −0.04 −0.23
d7
Right −0.06 0.09 −0.01 0.01 0.05 −0.16 1.00 0.05 −0.06 0.07
brain d7
Dementia E −0.01 −0.07 −0.01 0.03 −0.22 −0.32 0.05 1.00 0.12 0.43
M 0.05 0.01 0.00 0.03 −0.04 −0.04 −0.06 0.12 1.00 1.10
L 0.00 −0.01 −0.01 0.00 −0.12 −0.23 0.07 0.43 0.10 1.00

TABLE 6-2
Myocardial infarction Glioma Dementia
1d 1w 8w d3 d7 E M L
Adipose tissue
Myocardial 1d 1.00 0.07 −0.09 −0.25 −0.34 0.11 −0.05 0.01
infarction 1w 0.07 1.00 −0.01 0.18 0.02 0.09 0.11 0.05
8w −0.09 −0.01 1.00 0.05 −0.04 −0.02 0.04 0.03
Glioma d3 −0.25 0.18 0.05 1.00 0.40 0.05 0.23 0.13
d7 −0.34 0.02 −0.04 0.40 1.00 −0.10 0.03 −0.07
Dementia E 0.11 0.09 −0.02 0.05 −0.10 1.00 0.15 0.55
M −0.05 0.11 0.04 0.23 0.03 0.15 1.00 0.28
L 0.01 0.05 0.03 0.13 −0.07 0.55 0.28 1.00
Testis
Myocardial 1d 1.00 0.17 0.12 0.07 −0.06 0.05 0.05 0.05
infarction 1w 0.17 1.00 0.06 0.07 −0.04 0.11 0.03 0.09
8w 0.12 0.06 1.00 0.04 −0.01 −0.01 0.04 −0.03
Glioma d3 0.07 0.07 0.04 1.00 −0.37 −0.22 0.33 −0.05
d7 −0.06 −0.04 −0.01 −0.37 1.00 0.14 −0.25 −0.02
Dementia E 0.05 0.11 −0.01 −0.22 0.14 1.00 0.02 0.34
M 0.05 0.03 0.04 0.33 −0.25 0.02 1.00 0.15
L 0.05 0.09 −0.03 −0.05 −0.02 0.34 0.15 1.00
Thymus
Myocardial infarction Dementia
1d 1w 8w E M L
Myocardial 1d 1.00 0.37 0.40 0.33 0.21 0.31
infarction 1w 0.37 1.00 0.45 0.27 0.18 0.34
8w 0.40 0.45 1.00 0.24 0.11 0.28
Dementia E 0.33 0.27 0.24 1.00 0.75 0.60
M 0.21 0.18 0.11 0.75 1.00 0.47
L 0.31 0.34 0.28 0.60 0.47 1.00
Myocardial infarction Glioma Dementia
1d 1w 8w d3 d7 E M L
Bone marrow
Myocardial 1d 1.00 −0.04 −0.01 0.03 0.08 −0.07 0.10 0.04
infarction 1w −0.04 1.00 0.03 0.22 0.21 −0.04 0.08 0.05
8w −0.01 0.03 1.00 −0.19 −0.15 0.13 0.10 0.06
Glioma d3 0.03 0.22 −0.19 1.00 0.46 −0.34 −0.19 −0.22
d7 0.08 0.21 −0.15 0.46 1.00 −0.29 −0.09 −0.08
Dementia E −0.07 −0.04 0.13 −0.34 −0.29 1.00 0.47 0.40
M 0.10 0.08 0.10 −0.19 −0.09 0.47 1.00 0.62
L 0.04 0.05 0.06 −0.22 −0.08 0.40 0.62 1.00
Myocardial 1d 1.00 0.01 0.02 0.01 −0.02 0.07 0.03 −0.01
infarction 1w 0.01 1.00 0.17 0.04 −0.11 0.09 0.03 0.06
Pancreas
8w 0.02 0.17 1.00 −0.02 −0.06 0.07 0.01 0.06
Glioma d3 0.01 0.04 −0.02 1.00 −0.16 0.08 0.08 0.12
d7 −0.02 −0.11 −0.06 −0.16 1.00 −0.07 −0.05 −0.12
Dementia E 0.07 0.09 0.07 0.08 −0.07 1.00 0.47 0.36
M 0.03 0.03 0.01 0.08 −0.05 0.47 1.00 0.41
L −0.01 0.06 0.06 0.12 −0.12 0.36 0.41 1.00

TABLE 6-3?
Myocardial infarction Glioma Dementia
1d 1w 8w d3 d7 E M L
Heart
Myocardial 1d 1.00 0.41 0.35 0.02 0.00 0.14 0.16 0.30
infarction 1w 0.41 1.00 0.55 0.01 0.12 0.10 0.11 0.26
8w 0.35 0.55 1.00 0.13 0.19 0.11 0.15 0.34
Glioma d3 0.02 0.01 0.13 1.00 0.26 0.10 0.23 0.18
d7 0.00 0.12 0.19 0.26 1.00 −0.03 0.13 0.15
Dementia E 0.14 0.10 0.11 0.10 −0.03 1.00 0.57 0.50
M 0.16 0.11 0.15 0.23 0.13 0.57 1.00 0.58
L 0.30 0.26 0.34 0.18 0.15 0.50 0.58 1.00
Ear (skin)
Myocardial 1d 1.00 0.01 0.00 0.25 −0.09 0.00 −0.16 0.29
infarction 1w 0.01 1.00 0.15 −0.05 −0.02 −0.16 −0.09 −0.06
8w 0.00 0.15 1.00 0.04 −0.07 −0.09 −0.14 0.01
Glioma d3 −0.02 0.25 −0.05 1.00 −0.16 0.14 0.21 −0.10
d7 −0.01 −0.09 −0.02 −0.16 1.00 −0.27 −0.25 0.00
Dementia E 0.02 0.00 −0.16 0.14 −0.27 1.00 0.46 0.44
M 0.03 −0.16 −0.09 0.21 −0.25 0.46 1.00 0.05
L −0.01 0.29 −0.06 −0.10 0.00 0.44 0.05 1.00

Tables 6-1 to 6-3 show p-values within the following ranges: less than 0.55; 0.55 or more but less than 0.65; 0.65 or more but less less than 0.75; 0.75 or more but less than 1; and 1.00.

Tables 6-1 to 6-3 show that, in the same organ, when diseases are different, the p-value is less than 0.55. In the case of the same organ and the same disease, when the stages are different, the p-value is less than 0.75. In other words, it was believed that when the p-value obtained between standard data 1 and test data is 0.55 or more, it can be determined that the test data indicates the same disease as the disease corresponding to the standard data 1; when the p-value obtained between standard data 1 and test data is 0.75 or more, it can be determined that the test data indicates the same stage as the stage corresponding to the standard data 1.

5-2. Application of Z-Score Method

The amount of expression of each gene in test data was divided by the amount of expression of the corresponding gene in standard data, and the obtained value was scaled by log 2. The scaled value was represented by xi (i=1, . . . , the number of genes). Regarding the value xi, the mean μ and variance σ of all the analyzed genes were determined.

Here, Z-score zi for a gene i is represented by the following equation.

z i = x i - μ σ Equation ⁢ ⁢ 3

This is a quantification value indicating how far the scaled value xi of the gene i is from the mean of all the analized genes. Here, this value indicates how much the gene i exhibits specific changes in expression compared to all the analyzed genes. The closer this value is to 0, the less the gene exhibits specific changes in expression. The farther this value is from 0, the more the gene exhibits specific changes in expression. How much a gene exhibits specific changes in expression can be quantified by taking the median (Z′) of the scaled value zi.

For the analysis, a script for calculating Equation 1 was described using R. Tables 7-1 to 7-3 show the results.

TABLE 7-1
Myocardial infarction Glioma Dementia
1d 1w 8w d3 d7 E M L
Heart
Myocardial 1d 0.00 0.46 1.79 6.87 7.55 2.78 5.20 6.30
infarction 1w 0.46 0.00 1.42 5.97 6.76 2.10 4.31 5.39
8w 1.79 1.42 0.00 3.69 4.32 0.35 2.39 3.15
Glioma d3 6.87 5.97 3.69 0.00 1.91 5.96 1.86 1.00
d7 7.55 6.76 4.32 1.91 0.00 6.81 2.89 2.22
Dementia E 2.78 2.10 0.35 5.96 6.81 0.00 5.14 6.59
M 5.20 4.31 2.39 1.86 2.89 5.14 0.00 1.24
L 6.30 5.39 3.15 1.00 2.22 6.59 1.24 0.00
Kidney
Myocardial 1d 0.00 1.96 2.26 1.88 1.34 1.27 0.42 0.59
infarction 1w 1.96 0.00 0.15 0.67 1.22 3.53 2.47 1.80
8w 2.26 0.15 0.00 1.10 1.83 4.52 3.05 2.43
Glioma d3 1.88 0.67 1.10 0.00 1.13 4.50 2.72 1.91
d7 1.34 1.22 1.83 1.13 0.00 4.19 2.13 1.19
Dementia E 1.27 3.53 4.52 4.50 4.19 0.00 1.18 4.29
M 0.42 2.47 3.05 2.72 2.13 1.18 0.00 1.48
L 0.59 1.80 2.43 1.91 1.19 4.29 1.48 0.00
Adipose tissue
Myocardial 1d 0.00 11.83 1.52 9.00 9.29 3.37 8.64 0.92
infarction 1w 11.83 0.00 13.38 5.00 5.06 9.32 1.99 12.03
8w 1.52 13.38 0.00 12.16 12.77 5.30 10.33 0.66
Glioma d3 9.00 5.00 12.16 0.00 0.71 6.84 1.84 11.49
d7 9.29 5.06 12.77 0.71 0.00 6.58 2.16 11.74
Dementia E 3.37 9.32 5.30 6.84 6.58 0.00 7.28 6.56
M 8.64 1.99 10.33 1.84 2.16 7.28 0.00 10.92
L 0.92 12.03 0.66 11.49 11.74 6.56 10.92 0.00
Bone marrow
Myocardial 1d 0.00 0.32 1.52 1.66 2.32 5.13 2.31 2.52
infarction 1w 0.32 0.00 1.24 2.29 2.15 5.70 2.93 3.19
8w 1.52 1.24 0.00 3.26 0.24 6.32 3.84 4.09
Glioma d3 1.66 2.29 3.26 0.00 7.29 4.19 0.83 1.07
d7 2.32 2.15 0.24 7.29 0.00 7.70 6.15 6.76
Dementia E 5.13 5.70 6.32 4.19 7.70 0.00 4.79 4.50
M 2.31 2.93 3.84 0.83 6.15 4.79 0.00 0.35
L 2.52 3.19 4.09 1.07 6.76 4.50 0.35 0.00
Glioma Glioma
Myocardial infarction Left brain Right Left brain Right Dementia
1d 1w 8w d3 brain d3 d7 brain d7 E M L
Brain
Myocardial 1d 0.00 2.35 0.91 0.13 1.36 1.27 2.75 0.54 3.31 1.04
infarction 1w 2.35 0.00 2.97 2.81 1.12 1.45 0.00 3.15 1.21 3.66
8w 0.91 2.97 0.00 1.24 2.79 2.91 4.68 0.72 4.59 0.14
Glioma Left brain 0.13 2.81 1.24 0.00 2.50 3.50 7.10 0.95 4.69 2.00
d3
Right 1.36 1.12 2.79 2.50 0.00 0.40 1.97 2.80 2.66 3.76
brain d3
Glioma Left brain 1.27 1.45 2.91 3.50 0.40 0.00 3.60 3.76 3.17 5.04
d7
Right 2.75 0.00 4.68 7.10 1.97 3.60 0.00 7.44 1.67 8.92
brain d7
Dementia E 0.54 3.15 0.72 0.95 2.80 3.76 7.44 0.00 5.23 1.46
M 3.31 1.21 4.59 4.69 2.66 3.17 1.67 5.23 0.00 5.76
L 1.04 3.66 0.14 2.00 3.76 5.04 8.92 1.46 5.76 0.00

TABLE 7-2
Myocardial infarction Glioma Dementia
1d 1w 8w d3 d7 E M L
Testis
Myocardial 1d 0.00 3.74 4.19 5.24 4.91 3.47 7.64 1.86
infarction 1w 3.74 0.00 0.04 0.53 0.17 1.29 4.26 2.88
8w 4.19 0.04 0.00 0.56 0.26 1.53 4.53 3.35
Glioma d3 5.24 0.53 0.56 0.00 1.00 2.36 4.76 4.72
d7 4.91 0.17 0.26 1.00 0.00 1.89 5.19 4.58
Dementia E 3.47 1.29 1.53 2.36 1.89 0.00 6.41 3.30
M 7.64 4.26 4.53 4.76 5.19 6.41 0.00 8.05
L 1.86 2.88 3.35 4.72 4.58 3.30 8.05 0.00
Pancreas
Myocardial 1d 0.00 2.18 2.11 3.23 0.72 0.01 1.05 5.53
infarction 1w 2.18 0.00 0.29 0.04 1.73 2.29 1.33 2.00
8w 2.11 0.29 0.00 0.29 1.64 2.24 1.17 2.53
Glioma d3 3.23 0.04 0.29 0.00 2.64 3.44 1.85 3.17
d7 0.72 1.73 1.64 2.64 0.00 0.73 0.44 5.18
Dementia E 0.01 2.29 2.24 3.44 0.73 0.00 1.68 7.72
M 1.05 1.33 1.17 1.85 0.44 1.68 0.00 6.05
L 5.53 2.00 2.53 3.17 5.18 7.72 6.05 0.00
Skeletal muscle
Myocardial 1d 0.00 1.42 0.39 0.54 1.71 3.11 1.98 0.95
infarction 1w 1.42 0.00 1.20 1.46 0.00 5.09 3.70 2.87
8w 0.39 1.20 0.00 0.07 1.53 4.03 2.57 1.58
Glioma d3 0.54 1.46 0.07 0.00 2.50 5.45 3.16 2.15
d7 1.71 0.00 1.53 2.50 0.00 6.39 4.48 3.73
Dementia E 3.11 5.09 4.03 5.45 6.39 0.00 1.48 4.38
M 1.98 3.70 2.57 3.16 4.48 1.48 0.00 1.85
L 0.95 2.87 1.58 2.15 3.73 4.38 1.85 0.00
Liver
Myocardial 1d 0.00 6.92 2.51 1.00 1.13 0.19 0.65 0.40
infarction 1w 6.92 0.00 8.80 6.91 8.49 7.01 5.28 7.51
8w 2.51 8.80 0.00 4.36 2.03 2.55 2.83 2.52
Glioma d3 1.00 6.91 4.36 0.00 2.72 1.25 0.01 1.69
d7 1.13 8.49 2.03 2.72 0.00 0.96 1.59 0.81
Dementia E 0.19 7.01 2.55 1.25 0.96 0.00 1.03 0.36
M 0.65 5.28 2.83 0.01 1.59 1.03 0.00 1.22
L 0.40 7.51 2.52 1.69 0.81 0.36 1.22 0.00
Lung
Myocardial 1d 0.00 12.80 1.32 2.20 3.88 2.53 6.21 3.86
infarction 1w 12.80 0.00 12.63 15.24 13.75 10.09 5.58 12.57
8w 1.32 12.63 0.00 0.79 2.64 1.51 5.26 2.51
Glioma d3 2.20 15.24 0.79 0.00 4.32 1.18 5.55 3.14
d7 3.88 13.75 2.64 4.32 0.00 0.43 4.36 0.06
Dementia E 2.53 10.09 1.51 1.18 0.43 0.00 7.34 0.48
M 6.21 5.58 5.26 5.55 4.36 7.34 0.00 4.55
L 3.86 12.57 2.51 3.14 0.06 0.48 4.55 0.00

TABLE 7-3
Myocardial infarction Glioma Dementia
1d 1w 8w d3 d7 E M L
Spleen
Myocardial 1d 0.00 0.07 0.21 2.19 1.01 0.13 9.50 1.67
infarction 1w 0.07 0.00 0.19 2.22 1.11 0.06 9.68 1.65
8w 0.21 0.19 0.00 1.35 0.44 0.14 6.30 0.78
Glioma d3 2.19 2.22 1.35 0.00 4.75 3.63 10.75 5.96
d7 1.01 1.11 0.44 4.75 0.00 1.31 13.04 1.08
Dementia E 0.13 0.06 0.14 3.63 1.31 0.00 14.51 3.64
M 9.50 9.68 6.30 10.75 13.04 14.51 0.00 15.95
L 1.67 1.65 0.78 5.96 1.08 3.64 15.95 0.00
Ear (skin)
Myocardial 1d 0.00 3.12 1.85 4.80 8.67 8.92 2.96 3.91
infarction 1w 3.12 0.00 1.18 2.16 6.06 7.19 2.24 1.31
8w 1.85 1.18 0.00 2.98 7.36 8.38 2.50 2.14
Glioma d3 4.80 2.16 2.98 0.00 3.16 7.89 2.41 1.65
d7 8.67 6.06 7.36 3.16 0.00 5.02 1.48 0.92
Dementia E 8.92 7.19 8.38 7.89 5.02 0.00 0.65 7.78
M 2.96 2.24 2.50 2.41 1.48 0.65 0.00 1.85
L 3.91 1.31 2.14 1.65 0.92 7.78 1.85 0.00

Tables 7-1 to 7-3 show Zi values within the following ranges: more than 0.35; more than 0.2 but 0.35 or less; more than 0.15 but less than 0.2; more than 0.00 but 0.15 or less; and 0.00.

Tables 7-1 to 7-3 show that, in the same organ, when diseases are different, the Zi value is more than 0.35. In the case of the same organ and the same disease, when the stages are different, the Zi value is less than 0.15. In other words, it was believed that when the Zi value obtained between standard data 1 and test data falls within the range of 0.35 to 0, it can be determined that the test data indicates the same disease as the disease corresponding to the standard data 1; when the Zi value obtained between standard data 1 and test data falls within the range of 0.15 to 0, it can be determined that the test data indicates the same stage as the stage corresponding to the standard data 1.

5-3. Calculation of Similarity Based on Correlation Coefficients of the Patterns of Inter-Organ Cross Talk Indicators Between Two Organs

The similarity between the patterns of inter-organ cross talk indicators in the STZ-treated mice described later and the myocardial infarction mouse model described above was determined from the correlation coefficients of the patterns of inter-organ cross talk indicators between two organs.

The correlation coefficient of the patterns of inter-organ cross talk indicators (RNA expression levels (j)) between adipose tissue (m) and bone marrow (1) in each stage of the myocardial infarction model (i) is represented by rijml. The number of individuals of the myocardial infarction model (i) is represented by n. The correlation coefficient was calculated according to the Spearman's rank correlation method described above. In this analysis, the number of n is 2.

In this case, the correlation coefficient of the patterns of inter-organ cross talk indicators between adipose tissue and bone marrow is represented by probability model p (the following equation).

p ⁡ ( r | i , m , l ) = 1 2 ⁢ π ⁢ σ iml ⁢ exp ⁡ ( - ( r - r iml ) 2 2 ⁢ σ iml 2 ) Equation ⁢ ⁢ 4

wherein riml is the mean of n correlation coefficients rijml, and σijml2 is the sample variance of the correlation coefficients rijml.

The correlation coefficient of patterns of RNA expression levels between adipose tissue and bone marrow of the STZ administration model described later was determined using the above equation. This value is represented by


{r′ml}m,l∈(collected organs)

In this case, the likelihood Li of correlation


{r′ml}m,l∈(collected organs)

with respect to myocardial infarction model i was calculated using the following equation.

L i = ∏ m , l ⁢ p ⁡ ( r ′ ml | i , m , l ) Equation ⁢ ⁢ 5

Table 8-1 shows the results of determining the likelihood in the myocardial infarction model and the STZ administration model. The likelihood was calculated between the two organs, i.e., adipose tissue and bone marrow.

The likelihood in the myocardial infarction model and the STZ administration model was also determined between three organs, i.e., adipose tissue, bone marrow, and liver. First, the correlation coefficient of patterns of RNA expression levels between adipose tissue and bone marrow, the correlation coefficient of patterns of RNA expression levels between adipose tissue and liver, and the correlation coefficient of patterns of RNA expression levels between liver and bone marrow were calculated in each stage of the myocardial infarction model. Further, the correlation coefficient of patterns of RNA expression levels between adipose tissue and bone marrow, the correlation coefficient of patterns of RNA expression levels between adipose tissue and liver, and the correlation coefficient of patterns of RNA expression levels between liver and bone marrow were calculated in the STZ administration model.

Next, for each stage of the myocardial infarction model, the likelihood was calculated using the correlation coefficient of patterns of RNA expression levels between adipose tissue and bone marrow of the myocardial infarction model and the correlation coefficient of patterns of RNA expression levels between adipose tissue and bone marrow of the STZ administration model, the likelihood was calculated using the correlation coefficient of patterns of RNA expression levels between adipose tissue and liver of the myocardial infarction model and the correlation coefficient of patterns of RNA expression levels between adipose tissue and liver of the STZ administration model, and the likelihood was calculated using the correlation coefficient of patterns of RNA expression levels between liver and bone marrow of the myocardial infarction model and the correlation coefficient of patterns of RNA expression levels between liver and bone marrow of the STZ administration model. The product of these likelihoods was calculated for each stage of the myocardial infarction model. Table 8-2 shows the obtained values.

TABLE 8-1
STZ
Stage of administration
myocardial model
infarction adipose tissue—
model bone marrow
1d 1.0966E-33
1w 3.0618
8w 0.3855

TABLE 8-2
STZ administration model
All
Stage of Adipose (product of
myocardial tissue- Adipose Bone likelihoods
infarction bone tissue- marrow- between the
model marrow liver liver organs)
1d 1.0966E-33 5.7395E-11 8.9045E-76 5.6044E-119
1w 3.0618 5.1335 6.8654E-25 1.0790E-23
8w 0.3855 6.2778 5.2806E-08 1.2778E-07

II. D-iOrgans

1. Analysis of D-iOrgans in Adult Mice

1-1. Administration of STZ and Organ Collection

0.01% citrate buffer solution (pH 4.5) of streptozotocin (STZ) was intraperitoneally administered to 4-week-old male C57BL/6NCr S1c mice in an amount of 75 mg/kg in terms of STZ for 3 consecutive days (administered solution amount: 10 mL/kg). 0.01% citrate buffer solution (pH 4.5), which is a solvent, was intraperitoneally administered to the control group for 3 consecutive days (administered solution amount: 10 mL/kg).

On the day after the administration of STZ or the solvent, organs and tissue (heart, brain, kidney, adipose tissue (around the epididymis), brown fat, spleen, liver, lung, testis, muscle, pancreas, thymus, bone marrow, stomach, large intestine, and ear (skin)) were collected.

The animals from which the organs and tissue were to be collected were fasted overnight from the day before dissection. On the day of dissection, the tail vein of each mouse was cut, and the blood glucose level was measured with a simple blood glucose meter. On the following day, the mice were euthanized by cervical dislocation without anesthesia, and the organs and tissue were collected. After the wet weights of the collected organs and tissue were measured, the organs and tissue were rapidly frozen in liquid nitrogen and stored at −80° C.

Table 10 shows the blood glucose levels of the mice after the administration of STZ.

If STZ is administered to a mouse for a long period of time (for a week or more), the mouse becomes hyperglycemic (type 1 diabetes model). Thus, in this example, the influence before becoming hyperglycemic was measured in each organ. Accordingly, changes in gene expression in each organ in this example are believed to reflect the action of STZ as an anticancer drug, not systemic changes due to hyperglycemia, which are already commonly known.

1-2. Measurement of Metabolite

Metabolites were extracted from the brain, adipose tissue (around the epididymis), brown fat, spleen, pancreas, testis, stomach, large intestine, liver, kidney, lung, heart, skeletal muscle, thymus, and plasma. The method for extracting metabolites, CE-MS measurement conditions, and analysis of CE-MS data were as described in 2-1 and 2-2 of “I. iOrgans” above. FIG. 42 shows the measurement results.

1-3. Analysis of RNA

Extraction of RNAs from each tissue, obtaining RNAseq data, analysis of RNAseq data and generation of heat map, and secondary analysis of output data were performed as described in 2-1 and 2-3 of “I. iOrgans” above.

Values were calculated by dividing the expression level of each RNA (FPKM value) in D-iOrgans using STZ by the expression level of the corresponding RNA (FPKM value) in the control group mice (hereinafter also referred to as “STZ/Control”). RNAs in which STZ/Control is more than 1 or less than 1 were classified as group 4, RNAs in which STZ/Control is more than 1.5 or less than 0.67 were classified as group 5, RNAs in which STZ/Control is more than 2 or less than 0.5 were classified as group 6, and RNAs in which STZ/Control is more than 5 or less than 0.2 were classified as group 7 (FIG. 43).

1-4. cDNA Synthesis and Quantifying Relative Expression Level by Real-Time PCR

Genes in which STZ/Control was larger or smaller in the analysis of RNAs were selected, and their expression was confirmed by real-time PCR.

Real-time PCR was conducted according to the procedure described in 1-4 (4) of “I. iOrgans” to measure Cp values. The relative expression level of each gene relative to the reference gene was calculated by comparing the Cp value obtained for each gene with the Cp value for β2-microglobulin (B2m) or Maea as a reference gene to, and STZ/Control was determined. The primer pairs used in the real-time PCR were as shown in Tables 9-1 to 9-3.

FIG. 44 shows the results of the real-time PCR.

Among the genes shown in FIG. 44, Hamp was confirmed to show changes in the myocardial infarction model (middle stage: 1W, ear: skin) shown in FIG. 30. Saa1 was also confirmed to show changes in the myocardial infarction model (middle stage: 1W, heart). Hamp has already been reported to be involved in iron metabolism (http://ghr.nlm.nih.gov/gene/HAMP). The increase in the expression of this gene in the heart suggests a possibility that there arises a need to increase uptake of iron in the blood into cardiac cells (such as myocardial cells and endothelial cells) in the heart. Thus, it was believed that STZ can decrease the amount of iron in cardiac cells, i.e., cause the heart to be in an anemic state locally. Further, it was believed that the heart increased the expression of Hamp to uptake iron, which was insufficient. Further, Saa1 has been reported to be involved in inflammation (http://www.ncbi.nlm.nih.gov/gene/6288). The increase in the expression of this gene in the liver of the STZ administration mice indicated that STZ was highly likely to cause an inflammatory response in the liver.

2. D-iOrgans Analysis in Mouse Embryo

2-1. Administration of STZ and Organ Collection

75 mg of STZ was weighed and dissolved in 10 mL of 0.01 M citrate buffer solution (pH 4.5) under ice cooling.

The STZ solution prepared above at the time of use was intraperitoneally administered to mice (C57BL/6NCr S1c) on day 13 of gestation once daily for 3 consecutive days (administered solution amount: 10 mL/kg). To the control group, 0.01 M citrate buffer solution (pH 4.5), which is a medium, was intraperitoneally administered once daily for 3 consecutive days (administered solution amount: 10 mL/kg).

On day 16 of gestation, the mice of the administration group and the control group were euthanized by cervical dislocation without anesthesia, and four embryos were collected from each mother, frozen in liquid nitrogen, and stored.

2-2. Analysis of RNA

(1) Extraction of RNA

The tissue of each cryopreserved embryo was individually homogenized in TRIzol Reagent (Life Technologies) with a PT 10-35 GT Polytron homogenizer (Kineatica). After homogenized tissue with TRIzol Reagent in a tube was incubated for 5 minutes at room temperature to separate proteins, 0.2 mL of chloroform was added per mL of TRIzol, and the tubes were capped. Subsequently, the mixture in each tube was vortexed vigorously for 15 seconds. After the vortexing, the mixture was incubated at room temperature for 3 minutes and centrifuged at 12,000×g for 15 minutes at 4° C., and the RNA-containing aqueous layer was collected in a fresh tube. An equal amount of 70% ethanol was added to the collected aqueous layer, and mixed. Thereafter, 700 μL of the mixture was applied to each RNeasy mini column (Qiagen), and purified RNAs were collected according to the RNeasy mini kit (Qiagen) standard protocol. The quality of each of the collected RNAs was evaluated by 1% agarose electrophoresis. The concentration of each of the collected RNAs was measured by Nanodrop.

(2) Obtaining RNAseq Data

RNAseq data was obtained using the samples described above by the following procedure.

i. Quality Check

Quality testing of the samples was performed based on the following item.

    • Concentration measurement and quality check using Agilent 2100 Bioanalyzer (G2939A) (Agilent Technologies).
      ii. Preparation of Sample

A library for a HiSeq next-generation sequencer was prepared using 500 to 1000 ng of each total RNA sample that passed the quality testing as a template with a SureSelect Strand-Specific RNA library preparation kit in the following manner. The detailed procedure was carried out according to the protocol of the kit.

(a) Collection of poly (A)RNA (=mRNA) from total RNA using Oligo (dT) magnetic beads

(b) Fragmentation of RNA

(c) cDNA synthesis
(d) Double-stranded cDNA synthesis
(e) Terminus repair, phosphorylation, A tail addition
(f) Ligation of adapters with indices
(g) 13-cycle PCR
(h) Purification with magnetic beads

Library Preparation

Reagent kit: SureSelect Strand-Specific RNA library preparation kit (G9691A) (Agilent Technologies)

Reagent: Actinomycin D(A1410) (Sigma)

Reagent: DMSO (molecular biology grade) (D8418) (Sigma)
Reagent: Nuclease-free water (not DEPC-treated) (A149930) (Ambion)
Purification kit: AMPure XP beads (A63880) (Beckman Coulter)
iii. Obtaining Data Using Next-Generation Sequencer

Nucleotide sequence data was obtained using an Illumina HiSeq 2000 next-generation sequencer by reading 100 bases according to the paired-end method.

(a) Addition of sequencing reagent
(b) Single-base extension reaction
(c) Removal of unreacted bases
(d) Incorporation of fluorescent signal
(e) Removal of protecting groups and fluorescence
The cycle was repeated (e.g., cycle 2, cycle 3 . . . ) and these steps were carried out to 100 cycles.
(f) For the opposite strand (Read 2), (a) to (e) were carried out to 100 cycles.

(2) Analysis of RNAseq Data and Generation of Heat Map

(2)-1 Analysis of Output Data Obtained Using Next-Generation Sequencer

The following information processing was carried out for the output data above.

i. Base calling: text data of nucleotide sequences was obtained from the output raw data of analysis (image data).
ii. Filtering: selection of read data by predetermined filtering was performed.
iii. Sorting based on index sequences: sample data was sorted based on index information.

(2)-2 Secondary Analysis of Output Data

The data file (Fastq format) obtained using Illumina Hiseq was uploaded on Galaxy (https://usegalaxy.org/) downloaded to a local server. Thereafter, analysis was carried out using Bowtie2 (http://bowtie-bio.sourceforge.net/bowtie2/index.shtml) to map each sequence to mouse genome map information mm10. The BAM file obtained using Bowtie2 was analyzed using Cufflinks (http://cole-trapnell-lab.github.io/cufflinks/) to calculate FPKM for each gene.

Values were calculated by dividing the expression level of each RNA (FPKM value) in D-iOrgans using STZ by the expression level of the corresponding RNA (FPKM value) in the mice of the control group (hereinafter also referred to as “STZ/Control”). RNAs in which STZ/Control is larger than 1 or less than 1 were classified as group 4, RNAs in which STZ/Control is larger than 1.5 or less than 0.67 were classified as group 5, RNAs in which STZ/Control is larger than 2 or less than 0.5 were classified as group 6, and RNAs in which STZ/Control is larger than 5 or less than 0.2 were classified as group 7 (FIG. 45).

TABLE 9-1
Gene Forward (SEQ ID NO:) Reverse (SEQ ID NO:)
 1 Adrb3 ACAGCAGACAGGGACAGAGG (1) TCCTGTCTTGACACTCCCTCA (2)
 2 Ager ACTACCGAGTCCGAGTCTACC (3) CCCACCTTATTAGGGACACTGG (4)
 3 Aqp5 TAACCTGGCCGTCAATGC (5) GCCAGCTGGAAAGTCAAGAT (6)
 4 Alas2 GCAGCTATGTTGCTACGGTC (7) GATGGGGCAGCGTCCAATAC (8)
 5 Alb TGACCCAGTGTTGTGCAGAG (9) TTCTCCTTCACACCATCAAGC (10)
 6 Aldob GAAACCGCCTGCAAAGGATAA (11) GAGGGTCTCGTGGAAAAGGAT (12)
 7 Angptl4 CCCCACGCACCTAGACAATG (13) GCCTCCATCTGAAGTCATCTCA (14)
 8 Ano3 CTTCAGCAATGCTACTCGAAGC (15) GGCTACTCTTGTAGGCTCCCT (16)
 9 Arg1 GAATCTGCATGGGCAACC (17) GAATCCTGGTACATCTGGGAAC (18)
10 Arntl TCAAGACGACATAGGACACCT (19) GGACATTGGCTAAAACAACAGTG (20)
11 Arrdc2 GTGGCACGATCCTGGTACTG (21) GATGACCTCGCCTGGAGTGTA (22)
12 Arrdc3 GCAGTCAGTGTAGCATGAGTATGA (23) CATAGCTGGGTGGTGCTTC (24)
13 Atp6v0d2 AAGCCTTTGTTTGACGCTGT (25) GCCAGCACATTCATCTGTACC (26)
14 B2m GCTCGGTGACCCTGGTCTTT (27) AATGTGAGGCGGGTGGAACT (28)
15 Cebpd GTTGTCGGCCGAGAACGAGAA (29) CGGGCTGGGCAGTTTTTTGA (30)
16 Ciart CTGAACGGACTCAAGATGGGT (31) ACCTCCTGAGGATGACTTCTG (32)
17 Cidea TTCAAGGCCGTGTTAAGGA (33) CCTTTGGTGCTAGGCTTGG (34)
18 Cwc22 CGGAAAGGCTATCGAAGGAAC (35) ATTTGAGACCACACTCTTTGAGG (36)
19 Dbp TCTGCAGGGAAACAGCAAG (37) CCTTGCGCTCCTTTTCCT (38)
20 Ddit4 CCAGAGAAGAGGGCCTTGA (39) CCATCCAGGTATGAGGAGTCTT (40)
21 Fabp4 GGATGGAAAGTCGACCACAA (41) TGGAAGTCACGCCTTTCATA (42)
22 Fabp5 ACGGCTTTGAGGAGTACATGA (43) CTCGGTTTTGACCGTGATG (44)
23 Foxo1 CTTCAAGGATAAGGGCGACA (45) GACAGATTGTGGCGAATTGA (46)
24 Fst AAGCATTCTGGATCTTGCAACT (47) GATAGGAAAGCTGTAGTCCTGGTC (48)
25 Ftcd CAGAGTGTGTCGTAGAGGGG (49) GAGCTGCCTCACCATAGAGATA (50)
26 Gdpd3 GTCAGACCGGCACATGATTAG (51) GGTTGGCTACCTTGTGAATGA (52)
27 Gnmt GCTGGACGTAGCCTGTGG (53) CACGCTCATCACGCTGAA (54)
28 Gpnmb AGAAATGGAGCTTTGTCTACGTC (55) CTTCGAGATGGGAATGTATGCC (56)
29 Hba-a TGACAGACTCAGGAAGAAACCA (57) GGGAAGCTAGCAAACATCCTT (58)
30 Hbb-b GTGACAAGCTGCATGTGGAT (59) GTGAAATCCTTGCCCAGGT (60)

TABLE 9-2
Gene Forward (SEQ ID NO:) Reverse (SEQ ID NO:)
31 Hif3a CCAGGCCGAACCTGTCAAA (61) GCGTGCTCTTCATTCGCAG (62)
32 Hlf CCCTCGCAAACGGAAGTTCT (63) GTCATCCTTCAAATCATCGGGAA (64)
33 Hmgcs2 GAAGAGAGCGATGCAGGAAAC (65) GTCCACATATTGGGCTGGAAA (66)
34 Hpcal4 GGAGATGCTGGAGATCATCG (67) TCCTTATCCTGGTCCATCTTCT (68)
35 Hpd ACAAAGGACCAAAGCCTGAGA (69) AGCCCATCTTGTTGCAGTAGA (70)
36 Ky CCTGAATGAGCTGGTGAGTG (71) GCAGCCTCAACGTCGTACT (72)
37 Maea AAGACCTTGAGTAGTTGCCCA (73) TGCTCGATCCTACGTTTGCAG (74)
38 Mmp12 CTGCTCCCATGAATGACAGTG (75) AGTTGCTTCTAGCCCAAAGAAC (76)
39 Nmrk2 GAAACTCATCATAGGCATTGGA (77) TGGATCACGCAGCAGTTG (78)
40 Nppa TCGTCTTGGCCTTTTGGCT (79) TCCAGGTGGTCTAGCAGGTTCT (80)
41 Nppb GTCAGTCGTTTGGGCTGTAAC (81) AGACCCAGGCAGAGTCAGAA (82)
42 Pah GAGCCTGAGGAACGACATTGG (83) CTGATTGGCGAATCTGTCCAG (84)
43 Pdk4 AGGGAGGTCGAGCTGTTCTC (85) GGAGTGTTCACTAAGCGGTCA (86)
44 Plin4 GTGTCCACCAACTCACAGATG (87) GGACCATTCCTTTTGCAGCAT (88)
45 Prm1 TCACAGGTTGGCTGGCTCGAC (89) GCATCGCCTCCTCCGTCTGC (90)
46 Scgb1a1 ATGAAGATCGCCATCACAATCAC (91) GGATGCCACATAACCAGACTCT (92)
47 Sftpc GGTCCTGATGGAGAGTCCAC (93) GATGAGAAGGCGTTTGAGGT (94)
48 Snap25 CCATCAGTGGTGGCTTCAT (95) GCGGAGGTTTCCGATGAT (96)
49 Snph GAGGCGCTCCATGAAGTACAC (97) GGATGCAAACCTCCTTCTGTT (98)
50 Spp1 AGAGCGGTGAGTCTAAGGAGT (99) TGCCCTTTCCGTTGTTGTCC (100)
51 Sult5a1 ATGAAGTCCAAGGCCAAGGT (101) CATCCACAAAGTCCTCAAAGG (102)
52 Thrsp GCAGGTCCTGTAGGTCTTTGA (103) CACTCAGAGGGAGACGGAAG (104)
53 Tnnc2 GAGTGCGGAGGAGACAACC (105) AGCCTGTTGGTCCGTCAT (106)
54 Umod GGTCCCATAACACGACAAGG (107) ATGCTCAGGAGCCTCAAGTT (108)
55 Vgll2 CAGCAGCAAAGCACACAGA (109) GCGCTGTTCCAGAAGGAG (110)
56 Elovl3 AAACCGTGTGCTTTGCCATC (111) CAGGATGATGAAGGCCGTGT (112)
57 Saa1 ACTGACATGAAGGAAGCTAACTGG (113) GCCGAAGAATTCCTGAAAGGC (114)
58 Saa2 TGACATGAAGGAAGCTGGCTG (115) TGCCGAAGAATTCCTGAAAGC (116)
59 Apoa1 GCACGTATGGCAGCAAGATG (117) TTCCTGCAGCTGACTAACGG (118)
60 Apoa2 GACGGACCGGATATGCAGAG (119) CTGACCTGACAAGGGGTGTC (120)

TABLE 9-3
Gene Forward (SEQ ID NO:) Reverse (SEQ ID NO:)
61 Cdkn1a TTGTCGCTGTCTTGCACTCT (121) AATCTGTCAGGCTGGTCTGC (122)
62 Ces2e ACACTGAGGAAGAGGAGCAA (123) GATGTCCAGCTGCAGGTACT (124)
63 Cfd CACGTACCATGACGGGGTAG (125) TTTTGCCATTGCCACAGACG (126)
64 Cidec TCGACCTGTACAAGCTGAACC (127) CCTGCATGCTGAAGAGGGTC (128)
65 Cyp27b1 TTGCATCTCTTCCCTTCGGC (129) CCTGGCTCAGGTAGCACTTC (130)
66 Cyp8b1 GGTACGCTTCCTCTATCGCC (131) GAGGGATGGCGTCTTATGGG (132)
67 Eda2r ACAGAGCTGGACCTGCAAAA (133) AGCAACAAGCAATGGCAAGG (134)
68 Gdf15 GAGCTACGGGGTCGCTTC (135) GGGACCCCAATCTCACCT (136)
69 Hamp AAAGCAGGGCAGACATTGCG (137) GGATGTGGCTCTAGGCTATGTT (138)
70 Hmox1 ATGGCGTCACTTCGTCAGAG (139) AAGCTGAGAGTGAGGACCCA (140)
71 Isg15 TCTGACTGTGAGAGCAAGCAG (141) ACCTTTAGGTCCCAGGCCATT (142)
72 Klf7 GTTTTGCACGGAGCGATGAG (143) TATGGAGCGCAAGATGGTCA (144)
73 Krt16 CACAGCACTCCTCTGGACAGT (145) TCAGCTTGAGAGGCAGTTGT (146)
74 Krt20 ATACCAGCTGAGCACTTTGGA (147) ACCTTGCCGTCTACCACTTC (148)
75 Lcn2 GGCCAGTTCACTCTGGGAAA (149) AATGCATTGGTCGGTGGGG (150)
76 Lgals3 CCACTTTAACCCCCGCTTCA (151) TAGGTGAGCATCGTTGACCG (152)
77 Mgmt TGGAAGCTGCTGAAGGTTGT (153) CTCCGGAGTAATGGCCGATG (154)
78 Myl7 CTCATGACCCAGGCAGACAA (155) CCCGTGGGTGATGATGTAGC (156)
79 Phlda3 CTGGAACGCTCAGATCACCC (157) CCAACCAACCAAAGTGGACAG (158)
80 Prss3 AACATGGTCTGTGCTGGCTT (159) TCTATTGCAGACCACAGGGC (160)
81 Reg2 TGCCAACCGTGGTTATTGTG (161) TGCCTCACAGTTTTCGTCCTT (162)
82 Reg3a CCTCTACTGTCAACCGTGGTC (163) AAATGCTGGATGCTGCTTGTC (164)
83 Reg3d CCTCCATGTCTGCACACCAC (165) TCTTGGTGAGCCATCATGCTT (166)
84 Saa3 AATACTTCCATGCTCGGGGG (167) GCTCCATGTCCCGTGAACTT (168)
85 Serpina7 GGTATGAGGGATGCCTTTGCT (169) ATGTGTAGCACAGCCTTGTGA (170)
86 Serpine1 CCCCCACGGAGATGGTTATAG (171) CCCACTGTCAAGGCTCCATC (172)
87 Sln AGACTGAGGTCCTTGGTAGC (173) AAGGAGAACGGTGATGAGGAC (174)

TABLE 10
Body weight Blood
at dissection glucose
Animal No. (g) mg/dL
001 11.8 121 Control
002 13.2 110 Control
003 12.0 143 Control
201 12.8 65 STZ
202 12.8 83 STZ
203 10.3 42 STZ

DESCRIPTION OF REFERENCE NUMERALS

  • 1 Prediction apparatus
  • 2 Prediction apparatus
  • 3 Prediction apparatus
  • 4 Input unit
  • 5 Display unit
  • 6 Apparatus
  • 11 Test data obtaining unit
  • 12 Pattern similarity calculation unit
  • 13 Prediction unit
  • 21 Stage information obtaining unit
  • 22 Stage information checking unit
  • 23 Pattern extraction unit
  • 24 Prediction unit
  • 31 Test data obtaining unit
  • 32 Pattern similarity calculation unit
  • 33 Prediction unit
  • 100 System
  • 101 CPU
  • 102 Memory
  • 103 Storage unit
  • 104 Bus
  • 105 Interface unit
  • 109 Storage medium
  • 110 System
  • 120 System

Claims

What is claimed is:

1. An apparatus for predicting efficacy or a side effect or side effects of a test substance, the apparatus comprising:

a memory for storing a program;

an interface; and

a processor, during execution of the program, configured to:

obtain a group of predetermined standard data that serves as a measure for predicting efficacy or a side effect or side effects of the test substance;

calculate, by statistical analysis using subject data regarding an inter-organ cross talk indicator in each of one or more organs of an individual to which the test substance has been administered and the predetermined standard data corresponding to the one or more organs from which the subject data originates, similarity of patterns of the inter-organ cross talk indicators between the subject data and the predetermined standard data, wherein the subject data is derived from cells or tissue originating from each of the one or more organs, the predetermined standard data is extracted from the group of predetermined standard data,

and the inter-organ cross talk indicator comprises RNA or metabolites; and

predict efficacy or a side effect or side effects of the test substance in each of one or more organs other than the one or more organs from which the subject data originates by using, as a measure, the similarity of patterns of the inter-organ cross talk indicators.

2. The apparatus according to claim 1, wherein the subject data is a pattern of the inter-organ cross talk indicator representing a relationship between an amount of the inter-organ cross talk indicator in the organ of the individual to which the test substance has been administered and an amount of the corresponding inter-organ cross talk indicator in the same organ in a negative control.

3. The apparatus according to claim 1, wherein the standard data is a pattern of inter-organ cross talk indicators predetermined from amounts of inter-organ cross talk indicators whose functions are already known.

4. The apparatus according to claim 1, wherein the standard data is a pattern of inter-organ cross talk indicators, each of the patterns being derived from a predetermined relationship between an amount of an inter-organ cross talk indicator in an organ of an individual to which an existing substance has been administered and an amount of the corresponding inter-organ cross talk indicator in the same organ in a negative control.

5. The apparatus according to claim 1, wherein the standard data is a pattern of inter-organ cross talk indicators, each of the patterns being derived from a predetermined relationship between an amount of an inter-organ cross talk indicator in an organ of a positive control individual or positive control individuals affected with a disease and an amount of the corresponding inter-organ cross talk indicator in the same organ in a negative control.

6. A method for predicting efficacy or a side effect or side effects of a test substance, the method comprising the steps of:

(1) obtaining a group of predetermined standard data that serves as a measure for predicting efficacy or a side effect or side effects of the test substance;

(2) calculating, by statistical analysis using subject data regarding an inter-organ cross talk indicator in each of one or more organs of an individual to which the test substance has been administered and the predetermined standard data corresponding to the one or more organs from which the subject data originates, similarity of patterns of the inter-organ cross talk indicators between the subject data and the predetermined standard data, wherein the subject data is derived from cells or tissue originating from each of the one or more organs, and the predetermined standard data is obtained from the group of standard data,

and the inter-organ cross talk indicator comprises RNA or metabolites; and

(3) predicting efficacy or a side effect or side effects of the test substance in each of one or more organs other than the one or more organs from which the subject data originates by using, as a measure, the similarity of patterns of the inter-organ cross talk indicators calculated in step (2).

7. The method according to claim 6, wherein the subject data is a pattern of the inter-organ cross talk indicator representing a relationship between an amount of the inter-organ cross talk indicator in the organ of the individual to which the test substance has been administered and an amount of the corresponding inter-organ cross talk indicator in the same organ in a negative control.

8. The method according to claim 6, wherein the standard data is a pattern of inter-organ cross talk indicators predetermined from amounts of inter-organ cross talk indicators whose functions are already known.

9. The method according to claim 7, wherein the standard data is a pattern of inter-organ cross talk indicators predetermined from amounts of inter-organ cross talk indicators whose functions are already known.

10. The method according to claim 6, wherein the standard data is a pattern of inter-organ cross talk indicators, each of the patterns being derived from a predetermined relationship between an amount of an inter-organ cross talk indicator in an organ of an individual to which an existing substance has been administered and an amount of the corresponding inter-organ cross talk indicator in the same organ in a negative control.

11. The method according to claim 7, wherein the standard data is a pattern of inter-organ cross talk indicators, each of the patterns being derived from a predetermined relationship between an amount of an inter-organ cross talk indicator in an organ of an individual to which an existing substance has been administered and an amount of the corresponding inter-organ cross talk indicator in the same organ in a negative control.

12. The method according to claim 6, wherein the standard data is a pattern of inter-organ cross talk indicators, each of the patterns being derived from a predetermined relationship between an amount of an inter-organ cross talk indicator in an organ of a positive control individual or positive control individuals affected with a disease and an amount of the corresponding inter-organ cross talk indicator in the same organ in a negative control.

13. The method according to claim 7, wherein the standard data is a pattern of inter-organ cross talk indicators, each of the patterns being derived from a predetermined relationship between an amount of an inter-organ cross talk indicator in an organ of a positive control individual or positive control individuals affected with a disease and an amount of the corresponding inter-organ cross talk indicator in the same organ in a negative control.

14. The method according to claim 6, further comprising, before step (2), (i) obtaining information about the subject data regarding the inter-organ cross talk indicator in each of the one or more organs in the individual to which the test substance has been administered, the inter-organ cross talk indicator being derived from the cells or tissue originating from each of the one or more organs.

15. The method according to claim 14, wherein step (i) comprises determining the subject data regarding the inter-organ cross talk indicator from an amount of the inter-organ cross talk indicator in each of the one or more organs of the individual to which the test substance has been administered, the inter-organ cross talk indicator being derived from the cells or tissue originating from each of the one or more organs.

16. The method according to claim 15, wherein step (i) comprises identifying or quantifying the inter-organ cross talk indicator extracted from the cells or tissue originating from each of the one or more organs of the individual to which the test substance has been administered.

17. The method according to claim 14, further comprising, before step (i), the steps of:

(ii) providing the test substance;

(iii) providing the individual;

(iv) administering the test substance provided in step (ii) to the individual provided in step (iii);

(v) collecting the one or more organs from the individual administered the test substance in step (iv); and

(vi) collecting the cells or tissue from the one or more organs collected in step (v).

Resources

Images & Drawings included:

Sources:

Similar patent applications:

Recent applications in this class:

Recent applications for this Assignee: