Patent application title:

SELECTION AND USE OF COLD-TOLERANT BACILLUS STRAINS AS BIOLOGICAL PHYTOSTIMULATORS

Publication number:

US20230098245A1

Publication date:
Application number:

17/507,363

Filed date:

2021-10-21

Abstract:

The invention relates to a biological means for improving the yield of cultivated plants. The areas of application of the invention are agriculture, horticulture and plant protection.

Inventors:

Assignee:

Interested in similar patents?

Get notified when new applications in this technology area are published.

Classification:

C12N1/205 »  CPC further

Microorganisms, e.g. protozoa; Compositions thereof ; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor; Bacteria; Culture media therefor Bacterial isolates

C12R2001/07 »  CPC further

Microorganisms ; Processes using microorganisms; Bacteria or Actinomycetales ; using bacteria or Actinomycetales Bacillus

C12N1/20 »  CPC main

Microorganisms, e.g. protozoa; Compositions thereof ; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor Bacteria; Culture media therefor

A01N63/25 »  CPC further

Biocides, pest repellants or attractants, or plant growth regulators containing microorganisms, viruses, microbial fungi, animals or substances produced by, or obtained from, microorganisms, viruses, microbial fungi or animals, e.g. enzymes or fermentates; Bacteria; Substances produced thereby or obtained therefrom Paenibacillus

A01N63/22 »  CPC further

Biocides, pest repellants or attractants, or plant growth regulators containing microorganisms, viruses, microbial fungi, animals or substances produced by, or obtained from, microorganisms, viruses, microbial fungi or animals, e.g. enzymes or fermentates; Bacteria; Substances produced thereby or obtained therefrom Bacillus

C05F11/02 »  CPC further

Other organic fertilisers from peat, brown coal, and similar vegetable deposits

C05G3/60 »  CPC further

Mixtures of one or more fertilisers with additives not having a specially fertilising activity Biocides or preservatives, e.g. disinfectants, pesticides or herbicides; Pest repellants or attractants

C05G3/00 »  CPC further

Mixtures of one or more fertilisers with additives not having a specially fertilising activity

Description

The invention relates to a biological means for improving the yield of cultivated plants. The areas of application of the invention are agriculture, horticulture and plant protection.

STATE OF THE ART

The introduction of biological plant protection and organic fertilisers is an environmentally friendly alternative to chemical pesticides and mineral fertilisers. “Plant-growth-promoting” rhizobacteria (PGPR) are used for the production of effective organic formulae. Members of the Bacillus type with the ability to form permanent endospores are of great importance since they have a natural high degree of stability. Spores are permanent forms of the bacterial cell, which can withstand extreme environmental influences such as heat and aridity, and can be stored for years without a loss of activity.

Organic formulae of members of the Bacillus type are the most frequently used biological plant protection and phytostimulators (Borriss 2011). Aside from the known producers of the insecticides Bacillus thuringiensis and Bacillus kurstakii, these are strains of the Bacillus subtilis, family incl. B. amyloliquefaciens subsp. plantarum, B. subtilis, B. licheniformis and B. pumilus, which are most commonly used in this field. Examples of commercial products (organic fertilizers and/or plant protection) that contain B. amyloliquefaciens plantarum spores are Kodiak™ (Bayer Crop Science), Companion (Growth Products Ltd.), BioYield™ (Bayer Crop Science), INTEGRAL® (BASF), VAULT® (BASF), SERENADE Max® (Bayer Crop Science), CEASE® (BioWorks, Inc.), RhizoVital® (ABiTEP GmbH), FZB24® (ABiTEP GmbH), Double Nickel 55™ (Certis U.S.A.), Amylo-X® (Certis U.S.A.). Plant protection based on B. licheniformis are Green Releaf and EcoGuard (Novozyme Biologicals Inc.). The B. pumilus GB34 strain (Yield Shield, Bayer Crop Science) is an active ingredient of organic fungicides. Other EPO-registered B. pumilus organic fungicides are SONATA (Bayer Crop Science), and GHA 180 (Premier Horticulture). Members of B. mojavensis have also been described as photostimulatory and capable of endophytic growth (Bacon & Hinton 2002). Other bacilli which do not belong to the B. subtilis species complex also stimulate plant growth and plant health. B. firmus GB126 (BioNem AgroGreen, Israel now taken over by Bayer Crop Science) is used as an EPO-registered nematicide for the organic control of phytopathogenic nematodes. A similar product from B. firmus Bmj WG is currently being developed by Certis U.S.A. A phytostimulatory B. megaterium (Lopez-Bucio et al. 2007) strain is the basis for the BioArc organic fungicide. Members of the Bacillus cereus species complex, e.g. B. cereus UW8 (Handelsman et al. 1990), B. thuringiensis and B. weihenstephanensis have also been described as plant growth promoting, endospore-forming rhizobacteria.

These bacteria used for producing the current organic products are known as “mesophile” bacteria and require growth temperatures of over 15° C. in order to develop their effect as phytostimulators. More than 85% of the Earth's surface is covered by cold ecosystems, however, including Alpine mountain regions and areas that are oceanic and close to the poles (Feller & Gerday 2003). At temperature conditions below 15° C., which are typical for these regions, mesophile bacteria can have no positive effect on plant growth. An attractive alternative is the use of cold-tolerant microorganisms. Although their optimal growth conditions lie in the mesophile range, these microorganisms have developed mechanisms which give them the ability to continue to grow at lower temperatures (≤10°-0° C.) (Kumar et al. 2010). A note was made that the use of cold-tolerant and plant growth promoting bacteria as inoculants, in particular for agricultural production in tempered climate zones with low temperatures and a short growth season can be attractive (Mishra et al. 2012). However, the known examples for the use of cold-tolerant bacteria in plant production on gram-negative phytostimulatory bacteria such as Pseudomonas (Katiyar & Goel 2003), Burkholderia (Barka et al. 2006), Acinetobacter (Gulati et al. 2009), Azospirillum (Kaushik et al. 2002), Rhizobium (Prevost et al. 2003), Bradyrhizobium (Zhang et al. 2003), Pantoea (Selvakumar et al. 2008a), Serratia (Selvakumar et al. 2008b). Although in the past, several psychrophile or cold-tolerant Bacillus types, such as Bacillus globisporus (now Sporosarcina globisporus), Bacillus insolitus (now: Psychrobacillus insolitus), Paenibacillus macquariensis, Bacillus marinus (now: Marinibacillus marinus), Bacillus psychrophilus (now: Sporosarcina psychrophilus), Bacillus psychrosaccharolyticus, Bacillus psychrotolerans (now: Psychrobacillus psychrotolerans) and Bacillus psychrodurans (now: Psychrobacillus psychrodurans) have been described (El-Rahman et al. 2002, Krishnamurti et al. 2010), there is a lack of information regarding Bacillus strains with a phytostimulatory effect.

Goal and Objective of the Invention

The goal of the invention is to develop an environmentally sensitive and sustainable means for stimulating plant growth, including at temperatures below 15° C. The means should in particular be used in climatically unfavourable regions such as mountain regions and areas relatively close to the poles of the northern and southern hemisphere.

Nature of the Invention

The object is attained according to the claim; subclaims 2-11 are preferred variants. The core of the invention is the use of cold-tolerant bacillus strains as biological phytostimulators. The scope of the invention further includes the combination of cold-tolerant Bacillus strains with mesophile bacteria of the order Bacillales, preferably of type Bacillus and Paenibacillus, and the combination with humic acids. In the search for plant growth-promoting bacteria that show clear growth at temperatures below 15° C., it was found that endospore-forming bacilli that were isolated from cool climate regions such as mountain regions in the uplands of Tibet (People's Republic of China) or the Alpine foothills (1400 m) are also able to grow at temperatures below 12° C. In accordance with their 16S rNA sequences, these cold-adapted bacteria were assigned to the types Bacillus simplex, Bacillus pumilus and to the Bacillus subtilis species complex. Due to their gyrA and cheA sequences, the members of the B. subtilis species complex were identified as belonging to the type Bacillus atrophaeus. The plant growth-promoting effect was examined with Arabidopsis seedlings in potted experiments. Cold-tolerant members of the types Bacillus simplex, Bacillus atrophaeus and Bacillus pumilus showed a clear phytostimulatory effect (example 6). The B. simplex (ABIO2S1), B. atrophaeus (ABIO2A1), and B. pumilus (ABIO2P1) strains were selected as examples for further examinations. These strains are described below:

Bacillus atrophaeus differs from B. subtilis through its DNA sequence and the formation of a dark pigment (Nakamura 1989). Its ability to promote plant growth has been documented (Karlidag et al. 2010, Ertuk et al. 2011, Chan et al. 2013). The taxonomic affiliation of the strain ABI021A1 with Bacillus atrophaeus was determined by comparing its 16S rRNA, gyrA and cheA partial sequence (see example 1):

TABLE 1
Gene
Primer fragment Species Accession BLAST
pRB1601 16SrRNA B. atrophaeus CP002207.1 451/453
1942 (99%)
pRB1602 16SrRNA B. atrophaeus CP002207.1 470/473
1942 (99%)
gyrFW gyrA B. atrophaeus CP002207.1 863/872
1942 (99%)
gyrRV gyrA B. atrophaeus CP002207.1 857/865
1942 (99%)
cheAFW cheA B. atrophaeus CP002207.1 604/698
1942 (87%)
cheARV cheA B. atrophaeus CP002207.1 509/533
1942 (95%)

ABI02A1, ABI03 and ABI05 are characterised by the following properties:

The physiological properties of BI02A1, ABI03 and ABI05 are shown in application example 3. The strains promote plant growth (see application example 1) and suppress the growth of bacterial (Xanthomonas oryzae) and fungal (Sclerotinia sclerotorum) pathogens in vitro. ABI02A1 was stored as strain DSM 32019, ABI03 was stored as strain DSM 32285 and ABI05 was deposited as strain DSM 29418 at the DSMZ, Braunschweig. Bacillus atrophaeus has already been described as a plant growth-promoting bacterium (Bai et al. 2002). To date, no reports have been made of a phytostimulatory effect at low temperatures with regard to B. simplex, however.

Bacillus simplex ABI02S1 and ABI12 already grow at 4° C. The growth maximum is 45° C. The physiological properties of the strain are shown in illustrative representation 4. Members of the Bacillus simplex species have currently been identified as phytostimulatory bacteria (Schwartz et al. 2013). To date, no reports zo have been made of a growth stimulation effect at low temperatures. The ABI02S1 strain was deposited as DSM 32020 and the ABI12 was deposited as DSM 32283 at the DSMZ Braunschweig, Germany.

The invention will now be explained in greater detail with reference to examples.

Illustrative Embodiments

EXAMPLE 1

Isolation of Potential Cold-Tolerant Bacteria

Cold-tolerant bacillus strains were isolated e.g. from the uplands of the Autonomous Province of Tibet and the Alpine foothills, height 1,400 m. The Tibetan mountainous region lies at an average altitude of 4,000 m and has an annual average temperature of 10° C. Typical for this region are the large differences in temperature between day and night. The samples were either removed directly from plant roots or from the adhered earth:

2.5 g sample material were re-suspended in 25 g of distilled water for 2 h under continuous shaking. To kill vegetative cells, the suspension was then incubated for an hour at 80° C. 10 ml of the suspension were added to 40 ml of a mineral-salt medium and incubated for one week at 20° C. until under microscopic monitoring, rod-shaped cells emerged. Then, the suspension was diluted to 10−1 to 10−5 and plated on minimal agar. The plates were incubated at 20° C. and the colonies formed were separated on nutrient agar or LB agar.

The taxonomic classification of the isolates was achieved by determining their 16S rRNA sequence, and with strains from the related group of subtilis through their gyrA and cheA sequence. The isolation of the chromosome DNA of exponentially growing Bacillus cells, DNA amplification and sequencing was conducted in accordance with Idriss et al. 2002. Here, the following primers were used to amplify the DNA sequences using polymerase chain reaction (PCR):

pRB1601:
5′GGATCCTAATACATGCAAGTCGAGCGG
pRB1602:
5′GGATCCACGTATTACCGCGGCTGCTGGC
gyrFW:
5′ CAGTCAGGAAATGCGTACGTC
gyrRV:
5′ CAAGGTAATGCTCCAGGCATT
cheAFW:
5′ GAAACGGAKAYATGGMAGTBACMTCARACTGGCTG
cheARV:
5′ TGCTCRAGACGCCCGCGGWCAATGACAAGCTCTTC

An overview of the isolates obtained and their taxonomic classification on the basis of their 16S rRNA sequence is shown in Table 2.

TABLE 2
DNA sequences of cold-adapted bacillus isolates from the
Tibetan uplands and the Alpine foothills (altitude 1,400m)
Place of Similarity with
Strain isolation 16SrRNA PGP1 Growth
ABI02S1 Grass roots, B.simplex + 04-45° C.
Sejila 338/358(94%)
Mountain, (pRB1601)
Nyingtri, B.simplex
Tibet 403/464(87%)
(pRB1602)
ABI02A1 Grass roots, B. atropheus + 10-45° C.
Nyingtri, 450/458
Tibet (98%) (pRB1601)
B.atrophaeus
572/590(97%)
(gyrFW)
B.atrophaeus
733/757(97%)
(gyrREV)
ABI02P1 Namtso B. pumilus + 10-50° C.
Lake, 457/468(98%)
Lhasa, (pRB1602)
Tibet
ABI03 Grass roots, B. atropheus + 10-45° C.
Alpine 446/465
foothills, (96%) (pRB1601)
height 474/475 (99%)
1,400m B.atrophaeus
608/625
(97%) (gyrFW)
(pRB1602)
ABI05 Grass roots, Bacillus + 10-45° C.
Alpine atrophaeus
foothills, 450/458 (98%)
height (pRB1601)
1,400m 447/478(94%)
(pRB1601)
ABI12 Grass roots, B. simplex + 04-45° C.
Alpine 450/472
foothills, (95%) (pRB1601)
height 461/472(98%)
1,400m (pRB1602)
1PGP = plant growth promoting effect.

EXAMPLE 2

Growth Characteristic of Cold-Tolerant Bacteria

The growth attempts were conducted in LB medium at different temperatures. Table 2 provides an overview of the growth behaviour of the cold-tolerant strains. The upper growth limit of B. simplex ABI02S1 and ABI12, and B. atrophaeus ABI02A1 ABI03 and ABI05 was 45° C., while B. pumilus ABI02P1 also grows at 50° C. B. atrophaeus and the mesophile B. amyloliquefaciens subsp. plantarum FZB42 were cultivated at 20° C. and 25° . At these temperatures, the cold-tolerant B. atrophaeus strain had a faster growth rate than FZB42 (FIG. 1).

B. atrophaeus ABI02A1 was cultivated at different temperatures between 20° and 50° C. (FIG. 1). The growth optimum was determined at 33-35° C. At 30° C., a slight deceleration of growth speed was registered. Below 30° C., this effect was reinforced (25° C. and 20° C.). At 40° C., growth was significantly delayed. At 50° C., a lysis of the cells was also observed (FIG. 2). The results confirm that in the case of B. atrophaeus ABI02A1, this is a mesophile, but also cold-tolerant strain, which despite a growth optimum of 33-35° C. also grows well at low temperatures.

The physiological properties of the cold-tolerant Bacillus atrophaeus and Bacillus simplex strains are described in examples 3 and 4 below.

EXAMPLE 3

Physiological Properties of Bacillus atrophaeus

TABLE 3
Physiological properties of Bacillus atrophaeus
ABI02A1, ABI03 and ABI05
The use of sugars
Glucose +
Saccharose +
Lactose
Maltose +
Fructose +
Voges Proskauer +
Exoenzyme formation
Lipase (tributyrin) +
Amylase (starch) +
Protease (casein) +
Keratinase (keratin)
Cellulase (cellulose)
Egg yoke test (lecithinase)
Pigment formation +
Inhibition by antibiotics (flake test)
CM5 chloramphenicol +
KM5 kanamycin +++
ER1 erythromycin ++
Li25 lincomycin +
AP100 ampicillin ++
RIF 25** rifampicin +++
SPEC 100 spectinomycin ++
Bleo1 bleomycin +

In contrast to B. amyloliquefaciens subsp. plantarum FZB42, Bacillus atrophaeus ABI02A1, ABI03 and ABI05 also grow at 10° C. At 20° C. and 25° C., ABI02A1 also has a higher growth speed than FZB42 (FIG. 2). In the agar diffusion test, ABI02A1, ABI03 and ABI05 inhibit Bacillus subtilis, Bacillus megaterium, and the phytopathogens Erwinia amylovora, Xanthomonas oryzae, Fusarium oxysporum, Rhizoctonia solani and Sclerotinia sclerotiorum.

EXAMPLE 4

Physiological Properties of Bacillus simplex

B. simplex ABI02S1 and ABI12 have the following physiological properties (Table 4).

TABLE 4
Physiological properties of ABI02S1 and ABI12
Cell form Rod, 0.9-1.0 × 3.0−>4.0m
Endospores Ellipsoid
Spore parent cell Not swollen
Use of citric acid +
Use of propionic acid
Catalase +
Nitrate reductase +
(NO2 from NO3)
Phenylalanin desaminase
Arginin dihydrolase
Indole formation
Anaerobic growth
Voges Proskauer
(acetone formation)
pH in Voges Proskauer medium 6.2
Lecithinase (egg yoke reaction)
Growth at 50° C.
Growth at 45° C. (+)
Growth at 40° C. +
Growth at pH 5.7
Growth at 2% NaCl +
Growth at 5% NaCl
Growth at 7% NaCl
Growth at 10% NaCl
Acid formation of D-glucose +
Acid formation of L-arabinose +
Acid formation of D-xylose +
Acid formation of D-mannite +
Acid formation of D-fructose +
Gas of D-glucose
Hydrolysis of starch +
Hydrolysis of gelatine +
Hydrolysis of casein +
Hydrolysis of Tween 80 +
Hydrolysis of aesculin (+)

The physiological properties largely confirm the assignment to Bacillus simplex, but are not typical for Bacillus simplex for all features. The analysis of the cellular fatty acids shows a typical profile for the Bacillus type.

B. simplex ABI02S1 and ABI12 grow in LB medium at 10° C., a temperature at which B. amyloliquefaciens FZB42 can no longer grow. In further experiments, it was shown that these two B. simplex strains can also grow at a temperature of 4° C. The growth maximum was 45° C.

io In the agar diffusion test, B. simplex had a suppressive effect on the pathogenic funghi Rhizoctonia solani and Fusarium oxysporum, and on Xanthomonas oryzae.

EXAMPLE 5

Fermentation of Bacillus atrophaeus ABIO2A1 and the Production of a Spore Suspension

For example, a description is given here for the production of a spore suspension for B. atrophaeus ABI02A1. The fermentation of B. atrophaeus was conducted in a conventional stirring fermenter with a base volume of 1.4 I medium under the following conditions:

Medium: Full medium with organic N and C source: Soya flour or maize steeping liquor, low fat milk powder, yeast extract, salts

Sterilisation of the medium: 20 mins. at 121° C.

Template anti-foam agent: 200 ml

Stirrer speed: 700 RPM.

Fermentation temperature: 33° C.

Ventilation: 0.7 l/min (40% O2 saturation)

pH: with NaOH set to 6.9

After 16 h, a maximum cell density of 1×1010 cells/ml was achieved. The culture was continued in order to achieve the most complete possible sporing of the vegetative cells. After 40 h, a spore titer of 3×109 was achieved. The spores were centrifuged out and transferred to 10% of the original medium volume, under addition of propandiol (final concentration: 5%).

EXAMPLE 6

Promotion of Germination of Maize Seeds Through Cold-Tolerant Bacillae

10 ml of a Bacillus spore suspension were mixed with 30 ml 1% carboxymethyl celluluse (CMC), which served as an adhesive for improved adhesion of the spores to the maize surface. The final concentration of the Bacillus spores in the suspension was 1×107, 1×106, 1×105, 1×104 cfu/ml. The maize seeds were surface-disinfected with 75% ethanol, 5% NaClO for 5 mins., before they were treated with the different dilutions of the bacillus spore suspension for 5 mins. In each case, 3×10 seeds of a spore concentration were laid out in a petri dish with damp filter paper. The germination rate was determined after a week of dark incubation at 30° C. As a control, maize grains were used which had been treated with a sterile nutrient medium+CMC.

A clear increase in germination speed was determined with the application of B. simplex and B. atrophaeus (FIG. 4).

EXAMPLE 7

Growth Experiments with Arabidopsis thaliana

The roots of a 6-day-old Arabidopsis thaliana seedling were incubated for 5 mins. in a spore suspension (105 spores/ml) of cold-adapted bacillae. For comparison, a treatment with a spore suspension of FZB42, which is known for its growth-promoting effect, was conducted. Then, the treated seedlings were transferred to Murashige-Skoog (MS) agar (1%). The quadratic plates (12×12 cm) were closed with parafilm and kept for three weeks at 23° C. (8/16 light-dark rhythm). Then, the fresh weight of the Arabidopsis plants was determined. Cold-tolerant members of the types Bacillus simplex, Bacillus atrophaeus and Bacillus pumilus showed a clear phytostimulatory effect (FIG. 5, FIG. 6).

EXAMPLE 8

Potted Test with Potato Plants in a Greenhouse

The test was conducted at the test facility for potato research, Agro Nord, D-18190 Groβ-Lüsewitz as a potted test from 11.07.-11.10. 2011. The tubers of the potato test plant, of type “Burana”, was infested with symptoms of a Rhizoctonia solani attack (“black scurf”, “pocks”). The tubers were “stained” before planting with a diluted spore suspension of the Bacillus formulae. The planting was conducted after the tubers had dried. The potatoes were harvested three months after planting. The rating of the potato plants and tubers showed a reduction of the Rhizoctonia infestation compared to the control of 40-45% with the variants treated with Bacillus pumilus ABI02P1 and Bacillus simplex ABI02S1. At the same time, a yield increase of 95% (ABI02P1) and 57% (ABI02S1) was achieved (FIG. 7). The results achieved with the use of the cold-tolerant strains are thus comparable with the results achieved with the use of FZB42. Here, it should be taken into account that the test was conducted in the summer and early autumn, when the average daytime temperatures are by no means optimal for the use of cold-tolerant bacteria.

EXAMPLE 9

Field Test, Potatoes with B. pumilus and B. simplex

See the example below for information on the test procedure. The staining of the potato tubers with the mesophile, plant growth promoting bacterium FZB42 led to an increased yield compared to the untreated control of 14% (quantity used: 1 I spore suspension/ha). The increase in yield through staining with the cold-tolerant Bacillus pumilus ABI02P1 (quantity used: 1 I spore suspension/ha) was 6% compared to the untreated control. No increase in yield was achieved with the use of a spore suspension of the cold-tolerant Bacillus simplex ABI02S1 (FIG. 8). When interpreting the results, it should be taken into account that the test was conducted from May to September, when the average daytime temperatures are by no means optimal for the use of cold-tolerant bacteria.

EXAMPLE 10

Field Test: The use of Bacillus atrophaeus (ABI02A1) Leads to an Increase in Yield with Potatoes

The field test was conducted by Agro Nord, Prüfstelle für Kartoffelforschung, 18190 Groβ Lüsewitz, in Sanitz (Mecklenburg-West Pomerania). Preceding crop: maize. Soil type/number IS/35, fertilisation: 140 kg N. The potato type “Verdi” (medium-late-late) was used. The spore suspension was applied using injection (lot injection PL1, nozzle type: Flat-jet nozzles TJ 800 15). Here, the spore suspensions used (2×1013 spores/I) were diluted in 300 I of water before use. The “staining” was conducted on 05.05. 2013 in the storage building. Following successful drying of the tubers, they were planted on 06.05.2013 at a soil temperature of 15.8° C.

Climatic conditions: The month of May was too warm by 1.2° C., and too damp by 42.5 mm (79%). These were good emergence conditions for the potatoes. The month of June generally matched the average values recorded for a period of many years. However, precipitation primarily occurred in the form of heavy rain (13th=26 mm; 20th=14.3 mm; 25th=13.5 mm) approx. 74% of the precipitation total for the month. The only significant precipitation in July occurred on 3rd July with 28.4 mm; it was followed by a very long dry period, which continued until the end of August combined with too high temperatures.

The test was influenced by the occurrence of the phytopathogen, ground level fungus Rhizoctonia solani. Rhizoctonia solani J. G. Kühn is the amorphous form of Thanatephorus cucumeris (A. B. Frank) Donk (teleomorph), a basidiomycete from the

Agaricales family. It leads to yield losses (loss of emergence, necroses on stalks and stolons, many small or misshapen tubers) and quality losses (potato pocks, “dry core” symptoms). The antagonistic effect of B. atrophaeus, FZB42 and the chemical fungicide Monceren Pro was determined (FIG. 10).

The use of a spore suspension (2×1010 cfu/ml) of Bacillus atrophaeus (ABI02A1) in a concentration of 1.0 l/ha leads to a reduction in disease symptoms of “black scurf” (dry core) and an increase in yield of 10%. Thus the effect of this organic phytostimulator corresponds to that of the chemical fungicide Monceren Pro (concentration: 1.5 l/ha).

EXAMPLE 11

Field Test: Confirmation: The use of Bacillus atrophaeus (ABI02A1) Leads to an Increased Yield for Potatoes and a Reduced Infestation of Rhizoctonia solani (Kuerzinger 2014)

In a second test series (Kürzinger 2014), the results of example 10 were confirmed. The effect of B. atrophaeus ABI02A1 spore suspensions was comparable with that of the chemical fungicide Monceren (FIG. 12 and FIG. 13).

LEGEND FOR THE FIGURES

FIG. 1: Comparison of the growth of B. atrophaeus ABI02A1 and the mesophile strain FZB42 at 20° C. and 25° C.

FIG. 2: Growth of B. atrophaeus ABI02A1 at different temperatures. The growth optimum was determined at 33-35° C.

FIG. 3: Phase contrast: Bacillus simplex ABI02S1. The distal, oval endospores are clearly visible in the non-swollen spore parent cells.

FIG. 4: Improved germination of Zea mays following incubation with B. simplex ABI02A1 (bottom row) compared to the control.

FIG. 5: Growth stimulation (in g fresh weight) of rabidopsis thaliana through spore suspensions of cold-tolerant Bacillus strains. In comparison: The effect of B. amyloliquefaciens FZB42. Control: without inoculation of Bacillus spores. The columns show the average value of three independent tests.

FIG. 6: Stimulation of root growth of Arabidopsis thaliana by B. atrophaeus ABI02A1 (upper left), and B. simplex ABI02S1 (upper right). CK=Control without inoculation with bacteria

FIG. 7: Potted test with potato plants (Kürzinger GmbH 2011). Comparison of the tuber yield with untreated control. Application of 1 spore suspension per ha of FZB42 and B. pumilus ABI02P1. The spore suspension of B. simplex ABI02S1 showed a lower concentration by a factor of 5, and was applied in a correspondingly higher quantity (5 l/ha) to the potato plants.

FIG. 8: Application of B. pumilus ABI02P1 (1 L/ha) and B. simplex ABI02S1 to potato plants. Single application through staining with the spore suspension (FZB42 and Bacillus pumilus ABI02P1: 2×1019 cfu/ml, Bacillus simplex ABI02S1: 4×109 cfu/ml) before planting.

FIG. 9: Randomised location map: 1 (control, no addition), 2 chemical fungicide (Monceren Pro, 1.5 l/ha), 3 FZB42 (0.5 l/ha), 4 FZB42 (1.0 l/ha), 5 FZB42 (2×0.5 l/ha), 8 ABI02A (1 l/ha). For each variant, four repetitions were conducted. The lot size was as follows: 6.90 m×3.00 m=20.70 m2, space between rows: 75 cm, space between tubers in the row: 30 cm. “Staining” of the tubers in the storage building: 0.5.2013, date planted: 06.05.2013, emergence date: 02.06. 2013, harvest: 30.08.2013, treatment: 07. 10. 2013.

FIG. 10: Reduction in disease symptoms (“black scurf”) following application of chemical fungicides (Monoceren Pro) and organic stimulators. The use of ABI02A ‘Bacillus atrophaeus’ (1.0 l/ha) leads to a considerable reduction in disease symptoms.

FIG. 11: The use of Monoceren (chemical fungicide) and spore suspensions of FZB42 and ABI02A1 (Bacillus atrophaeus) among potatoes of type Verdi (Sanitz, Kürzinger 2013) leads to an increase in yield (%). Quantities used: 1.0=1.0 kg/ha.

FIG. 12: The application of Bacillus atrophaeus ABI02A1 leads to a considerable increase in yield, which can be compared to that of the chemical fungicide Monoceren. With the mesophile strain FZB42, a somewhat higher yield increase was achieved. Quantities of fungicides used: 1.5 l/ha (Monceren), 0.5 1.0 l/ha and 2×0.5 I/ha with spore suspensions of FZB42 and ABI02A1.

FIG. 13: At the same time, the infestation of sclerotia (Rhizoctonia solani) was reduced with the application of Bacillus atrophaeus ABI02A1 compared to the untreated control. Illustration of all infestation classes (% sclerotia infestation) with the use of Monoceren, FZB42 and B. atrophaeus. B. atrophaeus leads to a reduction in sclerotia infestation compared to the untreated control. Infestation classes: 0, <1, 1.1-5, 5.1-10, 10.1-15 and >15.

LIST OF REFERENCES

Abd El-Rahman, H. A., Fritze, D., Cathrin Sproer, C., Claus, D. 2002. Two novel psychrotolerant species, Bacillus psychrotolerans sp. nov. and Bacillus psychrodurans sp. nov., which contain ornithine in their cell walls. Int. J. Syst. Evol. Microbiol. 52, 2127-2133

Bai, Y., D'Aoust, F., Smith, D. L., Driscoll, B. T. 2002. Isolation of plant-growth-promoting Bacillus strains from soybean root nodules. Can. J. Microbiol. 48, 230-238 (2002)

Barka, A. E., Nowk, J., Clement, C. 2006. Enhancement of chilling resistance of inoculated grapevine plantlets with plant growth promoting rhizobacteria Burkholderia phytofermans strain PsJN. Appl Environ Microbiol 72:7246-7252

Benhamou, N., Kloepper, J. W., Quadt-Hallman, A., Tuzun, S. 1996. Induction of defense-related ultrastructural modifications in pea root tissues inoculated with endophytic bacteria. Plant Physiol. 112, 919-929

Borriss, R. 2011. Use of plant-associated Bacillus strains as biofertilizers and biocontrol agents, In: Maheshwari DK (ed). Bacteria in agrobiology: plant growth responses. Springer, Germany, pp 41-76

Chan, W. Y., Dietel, K., Lapa, S. et al. 2013. Draft Genome Sequence of Bacillus atrophaeus UCMB-5137, a Plant Growth-Promoting Rhizobacterium. Genome Announcement 1, e00233-13

Erturk, Y., Cakmakci, R., Omur Duyar, O., Turan, M. 2011. The Effects of Plant Growth Promotion Rhizobacteria on Vegetative Growth and Leaf Nutrient Contents of Hazelnut Seedlings (Turkish hazelnut cv, Tombul and Sivri). Int. J. Soil Science, 6, 188-198.

Feller, G. & Gerday C. 2003. Psychrophilic enzymes: hot topics in cold adaptation. Nature Reviews Microbiology 1, 200-208

Gulati, A., Vyas, P., Rai, P., Kasana, R. C. 2009. Plant growth promoting and rhizosphere-competent Acinetobacter rhizosphaerae strain BIHB 723 from the cold deserts of the Himalayas. Curr. Microbiol. 58, 371-377

Handelsman, J., Raffel, S., Mester, E.H. et al. 1990. Biological control of damping-off of alfalfa seedlings with Bacillus-cereus UW85. Appl. Env. Microbiol. 56, 713-718

Katiyar, V., Goel, R. 2003. Solubilization of inorganic phosphate and plant growth promotion by cold tolerant mutants of Pseudomonas fluorescens. Microbiol Res

Idriss, E. E., Makarewicz, O., Farouk, A. et al. 2002. Extracellular phytase activity of Bacillus amyloliquefaciens FZB45 contributes to its plant -growth-promoting effect. Microbiology 148, 2097-2109.

Kaushik, R., Saxena, A. K., Tilak, K. V. B. R. 2002. Can Azospirillum strains capable of growing at a suboptimal temperature perform better in field-grown-wheat rhizosphere. Biol Fertil Soils 35, 92-95

Karlidag, H., Esitken, A., Yildrim, E. et al. 2010. Effects of plant growth promoting bacteria on yield, growth, leaf water content, membrane permeability, and ionic composition of strawberry under saline conditions. J. Plant Nutr. 34, 34-45

Krishnamurti, S., Ruckmani, A., Pukall, R., Chakrabarti, T. 2010. Psychrobacillus gen. nov. and proposal for reclassification of Bacillus insolitus Larkin & Stokes, 1967,

B. psychrotolerans Abd-El Rahman et al., 2002 and B. psychrodurans Abd-El Rahman et al., 2002 as Psychrobacillus insolitus comb. nov., Psychrobacillus psychrotolerans comb. nov. and Psychrobacillus psychrodurans comb. nov. Syst. Appl. Microbiol. 33, 367-373

Kumar, P. K., Joshi, P., Bisht, J. K. et al. 2011. Cold-Tolerant Agriculturally Important Microorganisms. In: Plant Growth and Health Promoting Bacteria. Microbiology Monographs. Volume 18, 2011, pp 273-296.

Lopez-Bucio, J., Campos-Cuevas, J. C., Hernandez-Calderon, E. et al. 2007. Bacillus megaterium rhizobacteria promote growth and alter root-system architecture through an auxin-and ethylene-independent signaling mechanism in Arabidopsis thaliana. Mol. Plant Microbe Interact. 20, 207-217

Mishra, P. K., Bisht, S. C., Bisht, J. K., Bhatt, J.C. 2012. Cold-tolerant PGPRs as bioinoculants for stress management. In: Maheshwari DK (ed). Bacteria in agrobiology: Stress Management, DOI 10.1007/978-3-642-23465-1_6, #Springer-Verlag Berlin Heidelberg

Nakamura, L. K. 1989. Taxonomic relationship of black-pigmented Bacillus subtilis strains and a proposal for Bacillus atrophaeus sp. nov. Int. J. Syst. Bacteriol. 39, 295-300.

Prevost D, Drouin P, Laberge S, et al. 2003. Cold-adapted rhizobia for nitrogen fixation in temperate regions. Can. J. Bot. 81, 1153-1161

Schwartz, A. R., Ortiz, I., Maymon, M. et al. 2013. Bacillus simplex—A little known PGPB with anti-fungal activity—alters pea legume root architecture and nodule morphology when coinculated with Rhizobium leguminosarum by. viciae. Agronomy 3, 595-620

Selvakumar, G., Kundu, S., Joshi, P. et al. 2008a. Characterization of a cold-tolerant plant growth-promoting bacterium Pantoea dispersa 1A isolated from a sub-alpine soil in the North Western Indian Himalayas. World J. Microbiol. Biotechnol. 24, 955-960

Selvakumar, G., Mohan, M., Kundu, S. et al. 2008b. Cold tolerance and plant growth promotion potential of Serratia marcescens strain SRM (MTCC 8708) isolated from flowers of summer squash (Cucurbita pepo). Lett. Appl. Microbiol. 46:171-175

Zhang, H., Prithiviraj, B., Charles, T. C. et al. 2003. Low temperature tolerant Bradyrhizobium japonicum strains allowing improved nodulation and nitrogen fixation of soybean in a short season (cool spring) area. Eur. J. Agron. 19,205-213

Claims

1-11. (canceled)

12. A composition for stimulating the growth of cultivated plants, comprising a cold-tolerant Bacillus strain, wherein the cold-tolerant Bacillus strain comprises a Bacillus atrophaeus species or a Bacillus simplex species or a mixture thereof, and wherein the cold-tolerant Bacillus simplex species comprises ABI02S1 DSM 32020 or ABI12 DSM 32283, or a mixture thereof.

13. The composition according to claim 12, wherein the cold-tolerant Bacillus strain comprises a Bacillus atrophaeus species, and wherein the Bacillus atrophaeus species comprises ABI02A1 DSM 32019, ABI03 DSM 32285, or ABI05 DSM 29418, or a mixture thereof.

14. The composition according to claim 12, wherein the cold-tolerant Bacillus strain comprises a cold-tolerant Bacillus strain comprising Bacillus atrophaeus ABIO2A1 DSM 32019, ABIO3 DSM 32285, or ABIOS DSM 29418, or a mixture thereof; and a cold-tolerant Bacillus strain comprising Bacillus simplex ABIO2S1 DSM 32020 or ABI12 DSM 32283, or a mixture thereof.

15. The composition according to claim 12, wherein the cold-tolerant Bacillus strain is formulated as a fluid spore suspension.

16. The composition according to claim 12, wherein the cold-tolerant Bacillus strain is used for treating seeds during planting or treating seeds after planting.

17. The composition according to claim 12, wherein the cold-tolerant Bacillus strain is formulated as a dry preparation (“dry stain”).

18. The composition according to claim 12, further comprising humic acid.

19. The composition according to claim 12, further comprising a mesophile plant growth promoting bacteria of the Bacillales group.

20. The composition according to claim 12, further comprising a plant growth promoting fungus Trichoderma sp.

21. The composition according to claim 15, wherein the fluid spore suspension comprises at least 2×109 spores/ml.

22. The composition according to claim 15, wherein the fluid spore suspension comprises at least 1×1010 spores/ml.

23. The composition according to claim 16, wherein said treating is by pour administration or by spray administration.

24. The composition according to claim 17, wherein the cold-tolerant Bacillus strain is formulated with at least 5×109 spores/ml.

25. The composition according to claim 17, wherein the cold-tolerant Bacillus strain is formulated with at least 2×1010 spores/ml.

26. The composition according to claim 19, wherein said mesophile plant growth promoting bacteria of the Bacillales group comprises a Bacillus bacteria or a Paenibacillus bacteria.

27. The composition according to claim 26, wherein said Bacillus bacteria comprises a Bacillus amyloliquefaciens ssp. plantarum.

Resources

Images & Drawings included:

Sources:

Similar patent applications:

Recent applications in this class:

Recent applications for this Assignee: