US20230279429A1
2023-09-07
18/048,828
2022-10-21
This invention comprises: compositions comprising a derivative, plasmids, a reagent kit and methods of making these compositions a derivative, vaccine- and non-vaccine-compositions of above for causing death of cancer cells that form part of a tumour and virus infected Dengue, Measles and other diseased cells; the derivative comprising replicating as well as non-replicating derivatives of an attenuated negative stranded RNA virus belonging to family paramyxoviridae, including Measles Virus, comprising a single additional transcriptional unit carrying either only one or two or more non-viral genes, and the non-replicating derivatives being free from contaminating replicating Measles Virus (b) a Measles Virus packaging cell line for making above compositions, expressing the M, F and H proteins of MV stably. And (c) a reagent kit for producing the Measles Virus derivatives described above.
Get notified when new applications in this technology area are published.
C12N2760/18443 » CPC further
ssRNA viruses negative-sense; Details; Paramyxoviridae; Morbillivirus, e.g. Measles virus, canine distemper; Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
C12N2840/20 » CPC further
Vectors comprising a special translation-regulating system translation of more than one cistron
C12N2770/24134 » CPC further
ssRNA viruses positive-sense; Details; Flaviviridae; Flavivirus, e.g. yellow fever virus, dengue, JEV Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein
C12N2770/24123 » CPC further
ssRNA viruses positive-sense; Details; Flaviviridae; Flavivirus, e.g. yellow fever virus, dengue, JEV Virus like particles [VLP]
C12N2760/18432 » CPC further
ssRNA viruses negative-sense; Details; Paramyxoviridae; Morbillivirus, e.g. Measles virus, canine distemper Use of virus as therapeutic agent, other than vaccine, e.g. as cytolytic agent
C12N2760/18421 » CPC further
ssRNA viruses negative-sense; Details; Paramyxoviridae; Morbillivirus, e.g. Measles virus, canine distemper Viruses as such, e.g. new isolates, mutants or their genomic sequences
C12N2760/18433 » CPC further
ssRNA viruses negative-sense; Details; Paramyxoviridae; Morbillivirus, e.g. Measles virus, canine distemper Use of viral protein as therapeutic agent other than vaccine, e.g. apoptosis inducing or anti-inflammatory
C12N15/86 » CPC main
Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor; Recombinant DNA-technology; Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression; Vectors or expression systems specially adapted for eukaryotic hosts for animal cells Viral vectors
A61P37/04 » CPC further
Drugs for immunological or allergic disorders; Immunomodulators Immunostimulants
A61P35/00 » CPC further
Antineoplastic agents
This application is a divisional of co-pending U.S. patent application Ser. No. 15/541,691 filed on Jul. 5, 2017, which is a U.S. National Phase application, under 35 U.S.C. § 371, of International Application no. PCT/IN2016/000004, with an international filing date of Jan. 4, 2016, and claims benefit of India Application no. 39/MUM/2015 filed on Jan. 5, 2015; all of which are hereby incorporated herein by reference in their entireties for all purposes.
The contents of the electronic sequence listing (Seq_Listing_LKS4566DIV2.xml; Size: 319 kilobytes; and Date of Creation: Oct. 21, 2022) is herein incorporated by reference in its entirety.
The entirety of the electronically filed sequence listing text file named Sequence_ListingCRF_ST25.txt, created Aug. 20, 2018, 359 kB, is incorporated by reference herein.
The present invention relates to the production of recombinant derivatives of negative stranded RNA viruses. More specifically, the present invention relates to the production of replicating derivatives of measles virus (MV) that contain a single additional transcriptional unit (ATU) coding for 2 to 4 non-MV genes. This invention also relates to the production of custom designed non-replicating measles virus derivatives. Moreover, this invention relates to production of replicating measles virus derivatives that are useful for transferring 2 to 4 non-measles genes into animal cells including into human cancer cells and other human cells. The invention also relates to use of replicating MV derivatives for treatment of Cancer. This invention also relates to use of the non-replicating MV derivatives described in this invention as vectors for gene therapy of cancer and other diseases. Non-replicating MV derivatives useful for use as vaccinating agents for prevention of diseases like Measles and Dengue are also described.
Measles is an acute potentially lethal respiratory infection of infants & children caused by measlesvirus (MV), a member of morbillivirus genus of negative stranded RNA viruses. Development of live attenuated virus MV vaccine in 1960s has helped reduce the incidence of and deaths caused by Measles to near eradication and MV vaccine is recognized as one of the most effective and safe vaccines available till date.
MV is a member of the genus morbillivirus of family Paramyxoviridae. It contains a negative stranded RNA genome that has unique highly conserved 3ā² and 5ā² termini called leader and trailer respectively and codes for 6 genes-N (nucleocapsid protein), P (phosphoprotein), M (matrix protein), F (fusion protein), H (hemagglutinin) and L (large protein/a polymerase) separated by similarly conserved intergenic sequences. The H and F genes that code for glycoproteins are essential for entry of MV into susceptible cells. The H protein binds to its receptor proteins and induces conformational changes in F protein which cause the fusion of cell membrane with viral membrane and releases the MV nucleocapsid into host cells. Once inside the host cell, the viral RNA dependent RNA polymerase initiates the expression of MV genes. The newly expressed H and F proteins in turn are expressed on the cell membrane and mediate cellācell fusion and transfer of MV into neighbouring cells resulting into large multinuclear syncytia that are a typical of MV cytopathic effect.
Early in 1970s, several case reports described the spontaneous regression of haematological cancers following infection with Measles virus (MV) [1-4] suggesting that MV may exert cancer therapeutic effect. Subsequent observations showed that MV induces preferential lysis of a wide variety of cancer cell types including breast [5], cutaneous T cell leukemia [6, 7], lung cancer [8], mesothelioma [9] etc in vitro and in vivo in xenotransplant models. This oncolytic effect of MV is also observed in clinical setting as reported in case of CTCL [6], ovarian cancer [10] and myeloma [11, 12], which showed that MV treatment is safe even after treatment with extremely high dose (106 times the vaccine dose) and has potential to induce an objective and dose dependent tumor response [13], Russell and coworkers showed that MV-NIS induced complete regression of long standing relapsing drug-refractory myeloma and multiple glucose-avid plasmacytomas [12] and the patients remained tumour free for significant albeit different lengths of time.
Thus, MV has emerged as a potent oncolytic virus capable of causing complete regressions of established tumours in clinical setting and several researchers have reported the synthesis of oncolytic MV derivativesāU.S. Pat. Nos. 7,670,598, 8,586,364, 6,896,881, 7,118,740, 7,393,527 and 7,670,598. However, the currently used oncolytic derivatives of MV also have certain limitations. They are developed using the original method developed by Billeter and colleagues [14] (WO 97/06270). However, the nucleotide sequence of the plasmid used to synthesize MV is closer to the wild type Edmonston strain [15, 16]. Additionally, this method uses cell lines like chicken embryo fibroblasts (CEK) or 293 human embryonic kidney (HEK) cells which are not approved for vaccine production. In contrast, strains already used as vaccines for MV (e.g. Edmonston-Zagreb, Edmonston-Enders, Alk C, Edmonston A, Schwarz and Edmonston BāMoraten) are already manufactured in approved cell lines & processes and have been used clinically since 1960s and shown excellent safety in clinical situations. Their oncolytic derivatives may prove safer clinically & could have a greater chance of reaching the clinic.
Three other important shortcomings may prevent further translation of Measles as a cancer therapeutic agent: (1) Measles virus must be used at extremely high doses which are difficult to manufacture, (2) cancer cells respond heterogeneously to MV treatment and unkilled tumour cells may grow into recurring tumours after different time intervals and harbour MV used for therapy, and (3) most people are immunized against measles and harbour long lasting anti-MV immunity. This pre-existing anti-MV immunity can compromise efficacy of oncolytic MV and development of effective strategies for circumventing anti-MV immunity is essential. As a result, it is necessary to develop new improved oncolytic Measles virotherapies which will be more potent, exert a comprehensive therapeutic effect and may be able to circumvent anti-MV immunity.
The formation of syncytia stimulated by the binding of H protein to its receptors and their subsequent apoptotic death is responsible for the cancer therapeutic effect of MV. Two cell surface moleculesāSignalling lymphocyte-activation molecule (SLAM) and CD46 are known [17, 18] to function as specific receptors for MV. CD46 is ubiquitously present on primate cells but is over-expressed on several cancer cells. CD46 is a membrane associated complement regulatory protein that protects human cells against autologous complement mediated lysis. The expression of CD46 is increased in a wide range of cancer cells and helps cancer cells avoid their immunological clearance. The vaccine strain of MV infects cancer cells which express CD46 at high levels preferentially and induces cell death; however, it has no effect on non-cancerous cells which express CD46 at low levels [19].
The oncolytic effect of MV depends on the ability of its fusogenic proteins (H & F) to form syncytia that undergo apoptotic cell death. Since the H and F proteins present in most of the currently reported oncolytic MV derivatives are similar (e.g. U.S. Pat. No. 7,670,598, 8,586,364, 5,689,6881, 7,118,740, 7,393,527 and 7,670,598), they exhibit similar potency for inducing cancer cell death. Therefore enhancement of the binding affinity & the fusogenic potential of these proteins may represent one method of enhancing the oncolytic potency of MV. Mutational analysis of the H & F proteins have identified several critical aminoacids which determine the efficiency & potency of cell fusion. This information may be used to improve the oncolytic potency of MV. However, the effect of mutating MV H and F proteins on the pathogenic activity of MV is difficult to predict and so this approach may not be desirable.
Another approach may be to combine oncolytic effect of MV with the therapeutic effect of other genes. Recent gene therapy trials have shown that a large variety of genes including (1) suicide genes which induce cell death [20], (2) genes that increase the susceptibility of cancer cells to chemotherapy [20] (3) genes that restore specific oncogene/tumour suppressor gene function [21-23] and (4) genes that induce anti-tumour immune responses and arm the patient's immune system to eliminate cancer cells [24] have therapeutic benefit and MV derivatives incorporating some of these may be useful. Indeed MV derivatives encoding genes/proteins that enhance the sensitivity of cancer cells to radiotherapy (MV-NIS), [11, 25] or susceptibility to specific cancer therapeutic agents by arming MV to pro-drug converting enzymes like purine nucleoside phosphorylase have already been developed [26-28]. Similarly, arming MV derivatives with genes encoding human GMCSF [29] or antibodies to CTLA4 or PD-L1 proteins [30] were found to increase the therapeutic efficacy of oncolytic MV.
However, such modifications are not sufficient to make MV uniformly effective as an oncolytic agent against cancer cells. The vaccine strain of MV infects cancer cells which express CD46 at high levels preferentially and induces cell death. However, cancer cells are known to be heterogenous. Different cancer cells are known to harbour genetic defects in specific one or more oncogenes and/or tumour suppressor genes like p53, Ras, Her-2, etc which help them maintain the cancerous phenotype. And introducing the variants of these genes which either restore their function or inhibit their aberrant function into cancer cells is known to inhibit cancer cell growth. Similarly, well differentiated cancer cells are more likely to express higher levels of CD46 than less differentiated cells [31]. As a result, MV does not kill the subset of cancer cells which express CD46 at low levels [19]. Therefore, arming oncolytic MV with appropriate genes that help identify & kill cancer cells which may be infected with MV but have escaped oMV-induced cell death is required. Russell and coworkers, armed MV-NIS with sodium iodide symporter gene which allows such cells to be killed by radioiodine therapy selectively. Similar arming of MV to seek and kill MV infected (cancer) cells that escape MV-induced death would be essential.
Arming MV derivatives with prodrug modifying enzymes like Prostate acidic phosphatase, Cytosine deaminase, Thymidine kinase, Purine nucleotide phosphorylase etc can be one way to facilitate the use of the prodrugs of 5FU, acyclovir, etc for killing tumor cells which escape oMV induced death. Such a strategy will also help eliminate all residual MV remaining in the body after successful treatment with oMV. Arming MV derivatives with one or more such genes will help increase the potency of its oncolytic effect and also make the effect more uniform.
Two types of events are known to make establishment and maintenance of tumour cells feasible in human body. Firstly, accumulations of mutations in key tumor suppressor and oncogenes, cell cycle regulatory genes and other genes are well known to induce the cancer phenotype. A parallel failure of human immune response to identify such cancerous/abnormal cells and eliminate them is necessary to promote an uncontrolled growth of these cancer cells. Further accumulation of mutations makes the tumors more aggressive. Therefore, a two pronged attack on cancers and human immune system will help cancer therapy.
A number of cytokines have been shown to be useful for enhancing the immune response against cancer and help its immune elimination. Several of them are currently used as therapeutic agents. Human GMCSF is a potent inducer of granulocyte and macrophage growth. It also attracts and induces maturation of dendritic cells, CD4+ and CD8+ T cells and induces anti-tumor immune responses and causes tumor necrosis. It is used as an adjuvant therapy of cancer. GMCSF-secreting cells have also been shown to be useful tumor vaccines. More recently, virus mediated GMCSF expression (T-Vec, JX 594 and JX929) has also been shown to enhance the oncolytic effect through immune stimulation [29].
Tumor cells also use a number of molecular pathways for evading their clearance by human immune system. They are known to express a number of immunoregulatory molecules including CD46, Fas ligand, the ligands of the Programmed death 1 (PD-1) molecules etc which help in the evasion of immune system. Targeting the PD-1:PD-Ligand pathways has emerged as a very effective way of enhancing the anti-tumour immune response. PD-1 is an immunoinhibitory molecule that belongs to the CD28 family and is expressed on the T cells, B cells, monocytes, natural killer cells and many tumour infiltrating cells. It has 2 ligands PD-L1 and PD-L2. PD-L1 is expressed on resting T and B cells, dendritic cells, macrophages, vascular endothelial cells and pancreatic islet cells where as PD-L2 is expressed on dendritic cells and macrophages alone. A number of tumor cells express PD-L1 at high levels. Some tumor cells are also known to express PD-L2. Various cancers such as melanoma, hepatocellular carcinoma, glioblastoma, lung, kidney, breast, ovarian, pancreatic and esophageal cancers as well as haematological malignancies have positive PD-L1 expression and this is correlated to poor prognosis. Triple negative breast cancer (TNBC) which is a particularly aggressive type of breast cancer, frequently shows high levels of PD-L1 which is correlated with higher grade, larger tumours, and poor prognosis. Even in case of advanced lung cancer, levels of regulatory T cells (CD4+), which help suppress tumour immune surveillance are increased, immune checkpoint pathways involving PD-1/PD-L1 are involved in regulating T cell responses and inhibition of this pathway is suggested to offer a useful means of controlling it. A number of anti-PD-1 and anti-PD-L1 antibodies have emerged as useful therapeutic options for different types of cancer. However, they are associated with immune-related adverse effects such as pneumonitis, vitiligo, colitis, hepatitis, hypophysitis and thyroiditis. In contrast, expression of PD-1 inhibitors within the tumour microenvironment may help limit the effects of PD-1 blockade to the tumours and eliminate these adverse effects [30]. Additionally, it will also remove the inhibitory effect on Tumor infiltrating lymphocytes and increase the immunological clearance of tumors. GMCSF will attract immune cells into tumour microenvironment. However, their inactivation by PD-L1 mediated immunoregulatory signals will nullify the advantage of GMCSF incorporation into oMV. Therefore, it was decided to introduce a soluble PD-1 molecule into the oncolytic MV.
Several strategies may be used to kill cancer cells which are infected with oMV but escape cell death. Russell and coworkers have used sodium iodide symporter. Cytosine deaminase which degrades prodrugs and sensitizes cells to death caused by 5-fluorouracil has also been used [27, 28].
A large proportion of people are usually immunized against MV in childhood and this pre-existing immunity has been shown to interfere in the therapeutic effect of MV derivatives [12]. Evasion of this anti-MV immunity is essential for using MV virus as anti-cancer agent.
Therefore, strategies like the use of MV-infected cell carriers instead of MV have been used to circumvent the hurdle posed by pre-existing anti-MV immunity [32]. This strategy has been suggested to mask the MV from anti-MV immunity long enough to allow successful therapy. However, its efficiency has yet to be clinically proven and alternate modalities that will help overcome this hurdle are needed. Employing chimeric MV derivatives that express non-MV fusogenic proteins capable of stimulating oncolysis may provide another approach. Indeed, Miest et al, (2011) showed that chimeric MV derivatives expressing glycoproteins of the related canine distemper virus (CDV) were capable of evading anti-MV immunity [33] in animals. Such replacement of fusogenic proteins may give rise to a new virus with unpredictable pathogenic potential and since oMV need to be used at extremely high doses, this approach may not be desirable.
This invention comprises compositions, methods of making the same, methods of using the same and a reagent kit wherein the compositions comprise non-replicating and replicating negative stranded RNA virus derivatives comprising a genome coding for two or more non-viral genes inserted in the same, or plasmid molecules coding for the genomes of the said negative stranded RNA virus derivatives comprising two or more non-viral genes inserted in the same. The feature ācomprising two or more non-viral genes inserted in the sameā is the common technical feature of the above mentioned compositions.
The invention also comprises compositions comprising non-replicating negative stranded RNA virus derivatives comprising one or more non-viral genes.
This invention comprises a derivative of an attenuated negative stranded RNA virus belonging to family paramyxoviridae, wherein the derivative comprises two or more non-viral genes inserted in the same. The said derivative comprises two or more or three or more or four or more non-viral genes. The said virus may be a Measles Virus (MV) or any other virus with equivalent attenuation, equivalent safety for a human being and with same requirements for rescuing the any other virus from cDNA; the said requirements comprising use of viral N, P and L proteins expressed from three distinct helper plasmids and use of a plasmid coding a viral anti-genomic RNA modified by insertion of a single additional transcriptional unit.
This invention also comprises a process of making the said derivative of attenuated Measles Virus, the process comprises use of (a) a two plasmid system and comprising (i) one cloning plasmid comprising the entire anti-genome of measles virus with or without an additional transcriptional unit (ATU) coding for non-MV genes or MV genome like replicon RNA coding for non-MV genes along with a subset of MV genes. wherein MV stands for āMeasles Virusā, (ii) one helper plasmid coding for and expressing N, P, L proteins respectively, and (iii) a cell line supporting measles virus replication; the cell line may or may not be modified to express one or more of M or F or H proteins of MV stably but not requiring the help of exogenous vaccinia virus or exogenous T7 RNA polymerase.
The derivative of an attenuated negative stranded RNA virus of measles virus of his invention consists of a replicating derivative or a non-replicating derivative. The non-replicating derivative is named as āVirosomeā for the purpose of this specification. In one aspect of the invention, the replicating derivative of the attenuated Measles Virus comprises a single additional transcriptional unit (ATU) coding for 2 to 4 non-Measles Virus genes inserted in Measles Virus genome. The non-Measles Virus genes comprise, without limitation, one or more of following features: (a) genes that code for cytokines or chemokines, (b) genes that code for growth factors, (c) genes that code for immuno-regulatory genes, (d) genes that cause death of cancer cells, (e) genes that code for tumour associated antigen, (f) genes that arrest the growth of cancer cells, (g) genes that sensitize cancer cells to death by prodrugs, (h) genes that sensitize cancer cells to death by other therapeutic agents/mechanisms, and the like. The said non-MV genes include, one or more, without limitation, (a) genes that code for cytokine comprise human GMCSF, IL-2, IL-11, IL-15, TNF-alpha, etc, (b) genes that kills or arrests the growth of cancer cell death comprise dominant negative cyclin G1, p53, Bcl-2, etc. (c) genes that code for immune-regulatory genes comprise soluble PD-1, soluble CTLA-4, or antibodies blocking the activity of these molecules, (d) genes that code for tumor specific antigen comprise prostatic acid phosphatase, prostate specific antigen, carcinoembryonic antigen, (e) genes that sensitize cancer cells to death by prodrugs comprising cytosine deaminase, thymidine kinase, prostatic acid phosphatase and the other therapeutic agents comprise sodium iodide symporter. The derivatives of the attenuated Measles Virus of this embodiment of the invention are illustrated by (a) rMV-GP, wherein an ATU comprising sequence ID #10 is inserted upstream of N protein coding region, (b) rMV-GC, wherein an ATU comprising sequence ID #11 is inserted upstream of N protein coding region, (c) rMV-GsPP, wherein an ATU comprising sequence ID #12 is inserted upstream of N protein coding region, (d) rMV-GsPC, wherein an ATU comprising sequence ID #13 is inserted upstream of N protein coding region, (e) rMV-GsPDP, wherein an ATU comprising sequence ID #14 is inserted upstream of N protein coding region or rMV-GsPDC, wherein an ATU comprising sequence ID #15 is inserted upstream of N protein coding region.
The Virosomes comprise (a) Virosomes coding exclusively non-MV genes, and (b) Virosomes coding non-MV genes and/or a subset of MVgenes. Some of the features these Virosomes are capable of include, without limitation, (a) displaying antigens from other pathogenic organisms including viruses like Dengue, (b) delivering and inducing the expression of genes coding for antigens from other pathogenic organisms including viruses like Dengue, (c) inducing immunity against different non-measles virus antigens, (d) delivering non-measles virus genes into human/animal cells for modulating the expression of cellular genes, (e) capable of serving as vaccines against different diseases, and (f) serving as therapeutic agents for treatment of different disease. Some illustrations of Virosome comprise: (a) GFP virosome comprising genome coding for green fluorescent protein and produced from the plasmid pMTX-P1T (Seq ID #1)āby inserting the cDNA encoding green fluorescence protein (GFP) in between Pml I and Pme I sites, (b) Virosome comprising a genome that codes for prM and E proteins of dengue virus and produced from the plasmid pMTX-P1T-D2G comprising Seq ID #21, (c) Virosome comprising a genome that codes for the preM and E proteins of Dengue Virus along with the N, P and L proteins of measles Virus, produced from a plasmid derived from pMTX-P1T-High (Seq ID #7) by inserting the cDNA coding for prM and E proteins in between Asc I and Xho I sites, (d) Virosome comprising a genome that codes for a truncated-prM and E proteins of Dengue virus, and produced by deleting the region corresponding to Seq ID #22 from Seq ID #21, (e) Virosome comprising a genome that codes for a truncated-prM and E proteins of Dengue virus along with N, P and L proteins of Measles Virus, and produced from a plasmid derived from pMTX-P1T-High by inserting a cDNA corresponding to prM truncated by deleting Seq ID #22 and E proteins at Asc I and Xho I sites, (f) Virosome, comprising a genome that codes the H and F proteins of Measles Virus and is derived from pMV (Seq ID #9 or Seq ID #28) by deleting the sequences corresponding to the N, P, M and L genes of MV, and (g) Virosome, comprising a genome for one or more of therapeutically useful genes and a sub-set of MV genes derived from pMTX-P1T-N P-RE1-FH-RE2-RE3 (Seq ID #8) or by replacing one or more of the MV protein coding regions from pMV (Seq ID #9 or Seq ID #28) with other therapeutically useful genes. Further specific examples of these Virosomes comprise: a Virosome comprising one or more of genes comprising dominant negative mutant of Cyclin G1, cytocidal genes, Cytosine deaminase gene, human granulocyte macrophage colony stimulating factor gene (GMCSF) gene, soluble PD-1 blockade gene, PD1 blocking antibody gene and gene for prostate specific acid phosphatase (PAP).
This invention also includes plasmids coding for the anti-genome of replicating Measles Virus derivatives comprising a single additional transcriptional unit (ATU) that comprises two or more non-viral genes inserted in the same. These plasmids comprise, without limitation, pMV-GP of sequence ID #16, pMV-GC of sequence ID #17, pMV-GsPP of sequence ID #23, pMV-GsPC of sequence ID #25, pMV-GsPDP of sequence ID #24, pMV-GsPDC of sequence ID #26.
This invention also comprises a method for producing a non-replicating derivatives of an attenuated derivative of a Measles Virus, the term āMeasles Virusā being abbreviated as āMVā hereafter, the non-replicating derivative being named as virosome and the method comprising of one or more of following steps: (a) co-transfecting MV Packaging cell line with a Cloning Plasmid and a Helper plasmid, (b) incubating at a temperature between 35° C. to 38° C. for 3 to 10 days, and (c) collecting Virosome containing culture supernatant; wherein the non-replicating derivative of an attenuated derivative of Measles Virus comprises two or more non-viral genes inserted in the same.
This invention also discloses a plasmid coding for and expressing N, P, and L proteins of Measles Virus. In one embodiment, this plasmid has Seq ID 18 and is used along with plasmid coding for a MV derivative comprising two or more non-viral genes inserted in the same. This invention also discloses a plasmid coding for Measles Virus genome-like replicon RNA, the term āMeasles Virusā being abbreviated as āMVā hereafter, comprising one or more of non-MV genes and a subset of MV genes. This embodiment of plasmids of this invention has been illustrated, without limitation, by plasmids pMTX-P1T (Seq ID #1), pMTX-P1T-Intermediate (Seq ID #4), pMTX-P1T-High (Seq ID #7) and pMTX-P1T-NP-RE1-FH-RE2-RE3 (Seq ID #8).
This invention also discloses a Measles Virus packaging cell line for producing derivative of an attenuated negative stranded virus belonging to family paramyxoviridae, the derivative comprising two or more non-viral genes inserted in the same. In one embodiment, this cell line is capable of expressing the M, F and H proteins of MV stably. Illustrations of this type of MV packaging cell lines comprises ViroMFH In another embodiment, this cell line is capable of expressing the M protein of MV stably. Illustration of this type of MV packaging cell line comprises ViroM.
This invention discloses a reagent kit for producing the non-replicating Measles Virus derivative, the reagent kit comprising (a) MV Packaging cell lines expressing the one or more of M, F and H proteins of MV stably, (b) cloning plasmid coding for MV genome-like replicon RNA comprising sites for cloning one or more of non-MV genes and a subset of MV genes, (c) helper plasmid coding for and expressing N, P, and L proteins of Measles Virus stably. This kit comprises MV packaging cell line comprising of VEROMFH or VeroM or both; cloning plasmids comprising any one selected from pMTX-P1T (Seq ID #1), pMTX-P1T-Intermediate (Seq ID #4), pMTX-P1T-High (Seq ID #7) and pMTX-P1T-NP-RE1-FH-RE2-RE3 (Seq ID #8), and a helper plasmid comprises plasmid of Seq ID #18; wherein the non-replicating measles Virus derivative comprising two or more non-viral genes inserted in the same.
This invention comprises a composition comprising: (a) replicating and non-replicating derivatives of an attenuated virus wherein the virus is Measles Virus, the term āMeasles Virusā being abbreviated as āMVā hereafter, or any other virus with equivalent attenuation, equivalent safety for a human being and with requirements for rescuing the any other virus from cDNA, the requirements comprising use of viral N, P and L proteins expressed from three distinct helper plasmids and use of a plasmid coding a viral anti-genomic RNA modified by insertion of a single additional transcriptional unit, (b) Pharmaceutically acceptable excepients' wherein the replicating and non-replicating derivatives comprise two or more non-viral genes inserted in the same. This composition wherein the derivative of an attenuated virus is a non-replicating derivative, called for the purpose of this invention as āVirosomeā. The Virosome is one or more, without limitation, comprising a genome that codes for either exclusively non-measles genes or a combination of non-MV and a subset of MV genes. This composition includes a vaccine. The vaccine comprises, without limitation, one or more of: (a) GFP virosome comprising genome coding for green fluorescent protein, (b) Virosome comprising a genome that codes for prM and E proteins of dengue virus, (c) Virosome comprising a genome that codes for the preM and E proteins of Dengue Virus along with the N, P and L proteins of measles Virus, (d) Virosome comprising a genome that codes for a truncated prM and E proteins of Dengue virus, (e) Virosome comprising a genome that codes for a truncated prM and E proteins of Dengue virus along with N, P and L proteins of Measles Virus, and (g) Virosome, comprising a genome that codes the H and F proteins of Measles Virus. The vaccine comprising virosomes of above (b), (c), (d) and (e) corresponds to one or more of serotype 1, serotype 2, serotype 3 or serotype 4 of Dengue Virus. The composition Virosomes of above (b), (c), (d) and (e) are used as vaccine for prevention of Dengue and Virosome of (f) comprises a Measles Vaccine.
The Virosomes also comprise a non-vaccine medication; non-vaccine medication comprising, without limitation, a genome that codes for one or more of therapeutically useful genes and a sub-set of MV genes. This Virosome may be produced using plasmid pNPHF-GCG as a cloning plasmid.
It is also an embodiment of this invention that the composition of the derivative of an attenuated virus is a replicating derivative comprising derivatives that are capable to induce the death of cancer cells but do not adversely affect non-cancerous cells. In this embodiment, the cancer cells comprise breast cancer cells, lung cancer cells or prostate cancer cells and the non-cancerous cells are human non-cancerous cells or Vero cell line. The cancer cells, in such embodiments, comprise at least one of T47D, A-549 or PC-3 and human non-cancerous cells comprising at least one of human normal dermal fibroblasts or mesenchymal stem cells. In these compositions the replicating derivative is one or more selected from the group consisting of rMV-GP, wherein an ATU comprising sequence ID #10 is inserted upstream of N protein coding region, rMV-GC, wherein an ATU comprising sequence ID #11 is inserted upstream of N protein coding region, rMV-GsPP, wherein an ATU comprising sequence ID #12 is inserted upstream of N protein coding region, rMV-GsPC, wherein an ATU comprising sequence ID #13 is inserted upstream of N protein coding region, rMV-GsPDP, wherein an ATU comprising sequence ID #14 is inserted upstream of N protein coding region or rMV-GsPDC, wherein an ATU comprising sequence ID #15 is inserted upstream of N protein coding region.
This invention also includes composition of plasmids comprising: (a) a plasmid coding for the anti-genome of replicating MV derivatives comprising a single additional transcriptional unit (ATU) coding for 2 to 4 non-Measles Virus genes, (b) helper plasmid coding for and expressing N, P, and L proteins of Measles Virus, and (c) Pharmaceutically acceptable excipients; wherein the plasmid coding for anti-genome of replicating MV derivative comprises two or more non-viral genes inserted in the same. These composition comprise plasmid coding for the anti-genome of replicating Measles Virus derivatives comprising a single additional transcriptional unit (ATU) coding for 2 to 4 non-Measles Virus genes comprise one or more of pMV-GP of sequence ID #16, pMV-GC of sequence ID #17, pMV-GsPP of sequence ID #23, pMV-GsPC of sequence ID #25, pMV-GsPDP of sequence ID #24, pMV-GsPDC of sequence ID #26. And the helper plasmid comprises a plasmid of Seq ID 18. This invention also comprises a method of reducing the number of cancer cells, wherein the cancer cells are part of a tumour, the method comprising the steps of administering: (a) an oncolytic virus selected from the group consisting of rMV-GP, wherein an ATU comprising sequence ID #10 is inserted upstream of N protein coding region, rMV-GC, wherein an ATU comprising sequence ID #11 is inserted upstream of N protein coding region, rMV-GsPP, wherein an ATU comprising sequence ID #12 is inserted upstream of N protein coding region, rMV-GsPC, wherein an ATU comprising sequence ID #13 is inserted upstream of N protein coding region, rMV-GsPDP, wherein an ATU comprising sequence ID #14 is inserted upstream of N protein coding region or rMV-GsPDC, wherein an ATU comprising sequence ID #15 is inserted upstream of N protein coding region, or (b) a combination of the helper plasmid of Seq ID #18 and one or more of the plasmids selected from the group consisting of pMV-GP of sequence ID #16, pMV-GC of sequence ID #17, pMV-GsPP of sequence ID #23, pMV-GsPC of sequence ID #25, pMV-GsPDP of sequence ID #24, pMV-GsPDC of sequence ID #26, or (c) a defective interfering particles without the presence of contaminating replicating Measles Virus, named as Virosomes; the Virosomes comprising artificially designed Measles Virus genome like replicon RNAs that comprise exclusively of non-Measles Virus genes or a combination of non-Measles Virus and a subset of MV genes' wherein the oncolytic virus, the said one or more plasmids and the defective interfering particles comprise two or more non-viral genes inserted in the same.
This invention also includes a method wherein the cloning plasmid is derived from the plasmids pMTX-P1T (Seq ID #1), pMTX-P1T-intermediate (Seq ID #4) or pMTX-P1T-high (Seq ID #7) or pMTXP1T-NP-RE1-FH-RE2-RE3 (Seq ID #8) by inserting non-measles protein coding DNA sequences in one or both of the multiple cloning sites (MCS) provided; wherein the cloning plasmid comprises two or more non-viral genes inserted in the same.
The instant invention further comprises a method of improving the oncolytic potency of Measles Virus by incorporating one or more non-MV genes known to have anti-cancer effect.
This invention also includes Defective Interfering Particles, named as Virosome, the Defective Interfering Particles being without the presence of contaminating replicating Measles Virus; the Virosomes comprising artificially designed Measles Virus genome like replicon RNAs that comprise exclusively of non-Measles Virus genes or a combination of non-Measles Virus and a subset of MV genes; wherein the Virosome comprises two or more non-viral genes inserted in the same.
This invention comprises a oMV derivative that codes for multiple non-MV genes. Illustrative incorporation has been done of 3 different types of genesāimmuno-modulating genes, genes that sensitize MV infected cells to treatment of other cancer therapies and genes which may rectify molecular lesions in cells that precipitate the cancerous phenotype or selectively kill those cells.
Cytosine deaminase and another enzymeāhuman prostatic acid phosphatase (PAP) are known to be useful to sensitize cancer cells to chemotherapy with prodrugs producing 5FU, BRdU and/or AraC. PAP enzyme also offers other advantage that it is only produced by prostate tissue, does not perform a physiologically critical function and can be easily assayed. Therefore, it may be useful as a marker for oMV proliferation as well as an enzyme for sensitizing oMV infected cells to chemotherapy. Therefore, Cytosine deaminase and human PAP were selected for introduction into oMV.
However, all these genes will not have a direct effect on the survival and/or proliferation of cancer cells. Discovery of defects in a number of genes such as p53, Bcl-2, HER-2/neu, PKA, TGF-alpha, EGFR, TGF-beta, IGFIR, P12, MDM2, BRCA, Bcl-2, ER, VEGF, MDR, ferritin, transferrin receptor, IRE, C-fos, HSP27, C-myc, C-raf and metallothionein genes etc [32-34] and their association with cancer and the advent of gene therapy has prompted their evaluation as potential therapeutic agents for cancer. Although most of these clinical trials have failed, genes like p53, dominant mutant of cyclin G1 (DnG1) etc have emerged as important genes which when delivered into cancer cells can help control the cancer cell growth and survival [35]. The DnG1 gene has recently emerged as a particularly useful gene for treatment of a wide range of solid tumour types. Incorporation of this gene into oncolytic MV may help increase the potency of oMV as a cancer therapeutic agent.
Therefore, it was decided to synthesize oMV derivatives which are armed with these genes for GMCSF, soluble PD-1, PAP and dominant negative cyclin G1 protein genes. Such oMV may exhibit a more potent cytotoxic effect on cancer cells and also enhance the anti-cancer immune response more effectively.
It is an embodiment of this invention that the pre-existing anti-MV immunity is circumvented by use of the DNA molecules which are useful to produce oncolytic MV derivatives. DNA will escape detection and neutralization by pre-existing anti-MV immunity and can be readily used as therapeutic agents. Previously, we have demonstrated that MV can also be produced using a simple 2 plasmid system (WO/2013/046216). In this invention, we further show that these 2 plasmids may be sufficient to induce cancer cell death by inducing the generation of oncolytic MV within the cancer cells in situ.
Reverse genetic studies have shown the feasibility of inserting up to 30% additional genetic material into MV genomic RNA and a several recombinant MV derivatives which code for and express a wide range of non-MV proteins including other viral protein genes and genes encoding human cytokines, other immunoregulatory proteins and other genes have been produced. In all these cases, the non-MV genes are introduced in the form of an artificially designed, additional transcriptional units (ATU) formed by assembling the target protein with cis-acting intergenic regions of MV genome. The ATUs can be introduced either at the start or end of viral genome or in between any two genes of MV. However, insertion of ATU at different locations seems to affect the growth kinetics of the resulting MV differently. Therefore, most reported recombinant MV derivatives only contain a single ATU coding for non-MV proteins. Consequently, inserting multiple ATUs each coding for a single gene may not be feasible.
It is well known that the oncolytic effect of MV is known to be due to the fusogenic activity of its surface glycoproteins H & F [8, 34, 35] and that expression of these fusogenic proteins alone, is sufficient to cause cancer cell death. Obviously therefore, other MV genes may NOT be essential. Elimination of these genes from the oncolytic MV derivatives may eliminate any prospects of pathogenic reversal of MV. Like all other RNA viruses, MV is also known to produce defective interfering (DI) particles which consist of truncated MV genomes. They use the proteins produced from the full length replicating MV genomes for their own replication and assembly and so, they can only be generated in cells infected with replicating MV. Reverse genetics studies have also shown that artificially designed MV genome like RNA molecules which code exclusively for non-MV proteins, can be packaged into such DI particles along with full length MV genomic RNA molecules. However, such DI particle preparations are always contaminated with parent MV.
If defective interfering particles can be produced in pure form without the presence of contaminating replicating MV, then it could be possible to design artificial MV derivatives which code for combination of any preferred genes and used as therapeutic agents for cancer and other diseases. Therefore, this invention also provides a method for generation of defective interfering particles containing artificially designed MV genome like replicon RNAs that comprise exclusively of non-MV genes or a combination of non-MV and a subset of MV genes. Such DI particles are designated/named for the purpose of this invention as non-replicating viruses or Virosomes. Since these Virosomes are formed from MV proteins, they retain the functional properties of MV and enter the cells using MV-H and MV-F proteins & express the genes coded by their genome but do not replicate to produce new progeny. They can be custom designed to contain up to 6 or more different genes of choice and help generate new more potent MV derivatives for treatment of cancer and other diseases by gene therapy. This property of Virosomes has been demonstrated by development of Oncolytic Measles Virosome derivatives by combining the expression fusogenic proteins with one or more of the above mentioned therapeutically useful genes. Such synthetic Measles Virosomes will help eliminate the complications that can potentially emerge from treatment with extremely high doses of live & replicating MV.
Moreover, Virosomes coding for non-MV surface glycoproteins such as CDV glycoproteins similar to Miest et al (2011) or Dengue virus E proteins may also be produced and used either for therapy or as novel vaccine agents for prevention of a wide range of diseases. Indeed, a number of researchers have reported the development of new vaccines against a wide range of diseases including HIV [36], SARS [37], Mumps & SIV [38], West nile fever [39] Chikengunya [40], dengue [41] and other diseases [42]. However, the problem of pre-existing anti-MV immunity has also prevented the translation of these reports into clinical use which limitation can be circumvented by the Virosomes of this invention.
Virosomes that contain a genome coding for other viral proteins and also display these proteins may provide a more useful alternative as vaccine agents. Importantly, chimeric Virosomes which display non-MV antigens alone without displaying MV surface glycoproteins (H and F) may be more potent vaccinating agents and also overcome the problem of anti-MV immunity altogether. This is shown in the present invention by producing Chimeric Dengue Virosomes which induce anti-Dengue immunity and Measles virosomes which induce anti MV immunity. This invention first demonstrates the utility of a simple two plasmid system described previously (WO/2013/046216) for producing replicating derivatives of the of MV that code for 2 to 4 additional genes as part of a single multi-cistronic additional transcriptional unit (ATU) and then goes on the describe reagents & a method for producing non-replicating MV derivatives (MV virosomes) which comprises of a genome coding either exclusively non-MV genes or a combination of a subset of MV genes and non-MV genes. This invention further shows that such āNon-replicating Measles Virusesā can mediate the gene transfer into mammalian cells effectively and will be useful as potent therapeutic agents for cancer and other diseases. The āNon-replicating Measles Virusesā are named, for the purpose of this specification as āVirosomesā.
MV: Measles virus. oMV: oncolytic measles virus. CPE: Cytopathic effect. N or MV-N: N protein of Measles virus. P or MV-P: P protein of Measles virus. L or MV-L: L protein of Measles virus. CytD: Cytosine deaminase. DnG1: dominant negative mutant of cyclin G1. GMCSF: human granulocyte macrophage colony stimulating factor. PAP: human prostatic acid phosphatise. ATU: additional transcriptional unit. RdRP: RNA dependent RNA polymerase. IRES: internal ribosomal entry site. Virosome: name used to describe non-replicating MV derivatives. prM: prM protein of Dengue virus. E: Envelope (E) protein of Dengue virus. GFP: green fluorescent protein. sPD-1: human soluble programmed cell death-1 (PD-1). PD-L1 or PD-L2: human programmed cell death ligand 1 or 2
FIG. 1: Schematic representation of multicistronic ATU (additional transcriptional unit) produced for incorporation of 2 to 4 non-MV genes into replicating MV derivatives. Bi-, Tri- and Tetra-cistronic genes were assembled in silico and the resulting sequences inserted in between ntd #107 and ntd #108 of Sac II digestible fragment of MV genomic sequence. Resulting ATU was then appended to the a linker containing Afe I site on 5ā² end followed by Hammerhead ribozyme or RNA polymerase I sequence and the resulting fragment synthesized by gene synthesis technology. Sequences corresponding to the ATU were then digested by Afe I and Sac II enzymes and cloned into cloned into similarly digested pMV (Seq ID #28 or Seq ID #9).
FIG. 2: Schematic representation of plasmids (1) pMTX-P1T, (2) pMTX-P1T-Intermediate, (3) pMTX-P1Tāhighly useful as cloning plasmids for synthesis of non-replicating MV derivatives. All the plasmids code for a MV genome like replicon RNA containing 2 multiple cloning sites (MCS) for insertion of non-measles genes.
FIG. 3: Schematic representation of strategies used for inserting ATU at different locations in MV genome.
FIG. 4: Schematic representation of the plasmid pN-RE1-FH-RE2-RE3
FIG. 5: Schematic representation of the Helper plasmid that codes for MV-N, MV-P and MV-L proteins.
FIG. 6: Characterization of replicating MV derivatives (rMV-GP) (A) Emerging MV cytopathic effect in Vero cells co-transfected with pMV-GP and Helper plasmid. (B) Growth curve of rMV-GP (Increasing levels of rMV-GP released into culture medium of Vero cells infected with rMV-GP): Freshly plated, actively growing Vero cells were infected with culture supernatant containing rMV-GP and incubated. Culture supernatant was harvested every 24 hours and the amount of rMV-GP produced titrated using TCID50 method. (C) Analysis of proteins expressed in Vero cells infected with rMV-GP: Freshly growing, actively plated Vero cells were infected with rMV-GP and extracts prepared 72 hrs after infection. They were subjected to SDS polyacrylamide gel electrophoresis followed by western blot analysis using antibodies specific to the (1) N protein of MV, (2) P protein of MV; (kind gifts from Prof. M. S. Shaila, DMCB, IISc, Bangalore), and (3) human GMCSF (RnD systems, USA): Lane 1āuninfected cells, 2āCells infected with rMV-GP infected cells, and Lane 3āCells infected with unmodified MV. (D) Detection of RNA corresponding to cloned and native MV genes: Vero cells were infected with rMV-GP or unmodified MV and total cellular RNA prepared after 72 hrs post infection. This was subjected to RT-PCR analysis using primers specific to (1) GMCSF (lanes 1, 2 & 3), (2) M protein of MV (Lanes 4 & 5) and (3) N protein of MV (Lanes 6, 7 & 8). Lanes 1, 4 & 7ā RNA from cells infected with rMV-GP; Lanes 2, 5 & 8: plasmids coding for corresponding proteins used as positive controls; Lanes 3, 6 & 9: RNA from cells infected with unmodified MV.
FIG. 7: Production of Vero MFH cell line: (A) Cloning of MV-M, MV-F and MV-H genes into pCDNA3.1(ā): (Invitrogen, USA): (1) H gene clone: 1-pCDNA undigested, 2-pCDNA digested with Bam HI and Xho I, 3-pCDNA-H undigested, 4-pCDNA-H digested with Bam HI and Xho I; (2) F gene clone: 1-pCDNA undigested, 2-pcDNA digested with Bam HI and Nhe I, 3-pCDNA-F undigested, 4-pCDNA-F digested with Bam HI and Nhe I; (3) M gene clone: 1-pCDNA undigested, 2-pCDNA digested with Bam HI and Xho I, 3-pCDNA-M undigested, 4-pCDNA-M digested with Bam HI and Xho I; (B) Expression of MV-M, MV-F and MV-H in vero cells: Freshly plated and actively growing Vero cells were co-transfected with pCDNA-M, pCDNA-F and pCDNA-H plasmids and incubated for 48 hrs. Cell extracts were prepared and analysed for the expression of M, F and H proteins using western blot analysis. Uāuntransfected vero cells, Tācells co-transfected with M, F & H plasmids.
FIG. 8: Production of non-replicating MV (Virosomes): (A) RNA purified from virosomes pelleted from Dengue virosome containing culture supernatants and subjected to RT-PCR using primers specific for MV-start and MV-end regions 1-1 kb ladder, 2-negative control, 3-RNA purified from Virosomes, 4-plasmid encoding Virosome RNA (positive control) (B) SDS polyacrylamide gel electrophoresis followed by western blot analysis with antibodies specific to Rinderpest virus P protein (known to cross react with MV-P protein & a kind gift by Prof. M. S. Shaila, DMCB, IISC, Bangalore, INDIA) and Dengue virus E protein (Santacruz, USA). (C) dot immune-blot analysis: GFP virosomes & Dengue Virosomes. 1-negative control, 2-Dengue Virus like particles, GFP virosomes, Dengue virosomes
FIG. 9: Virus induced oncolytic effect: Active growing PC-3 cells or Vero cells were plated in 24 well plates at 80000 cells/well and infected with (1) UV irradiated virus, (2) rMV-GP, (3) rMV-GC, (4) rNPFH-GCG at different multiplicity of infections and incubated. At the end of 5 days, number of viable cells were determined using MTT assay and percent toxicity caused by each virus calculated. Representative toxicity observed of rMV-GP against alone is shown as all viruses were found to be non-toxic to Vero cells.
FIG. 10: Enhancement of virus induced oncolytic effect by insertion of DnG1 coding sequence: Replicating MV derivatives coding for 2 (GMCSF and PAP-rMV-GP-rMV-GP), 3 (GMCSF, PAP and sPD-1ārMV-GsPP) and 4 (GMCSF, sPD-1, PAP and DnG1ā-rMV-GsPDP) non-MV genes were synthesized. Cell extracts produced from Vero cells infected with these viruses were tested for the presence of cloned genes by western blot analysis; (B) The effect of rMV-GP, and rMV-GsPP on the viability of PC-3, A-549 and MCF-7 cells was tested as described. It showed that both viruses were equally effective as oncolytic agents (C) Similarly, the effect of rMV-GP and rMV-GsPDP was tested against MCF-7 cells. As shown, the inhibitory effect of rMV-GPP on cancer cells was increased by incorporation of DnG1 gene in rMV-GsPDP.
FIG. 11: Plasmid induced cancer cell death: Freshly plated actively growing PC-3 cells were co-transfected with different quantities of pMV-GP (Seq ID #16) and Helper plasmid (Seq ID #18) and incubated for 5 days. The number of viable cells were then determined using MTT assay percent viability calculated.
FIG. 12: In vivo Oncolytic efficacy: PC-3 tumors were established in SCID mice and treated with (1) Saline, (2) 106 TCID50 units of rMV-GP or (3) 10 ug of a mixture of pMV-GP and Helper plasmids (1:1.3) intratumorally every 4th day and the effect on tumor volumes (lengthĆbreadthĆbreadth/2) was determined.
FIG. 13: Virosome mediated gene transfer: Vero cells were infected with Virosomes and their ability to transfer expression of green fluorescence protein (GFP) to vero cells determined by staining nuclei with DAPI and monitoring for expression of GFP using confocal microscopy.
FIG. 14: Dengue virosomes induce humoral and cellular anti-Dengue immune response: (A & B) Serum from mice immunized with Dengue virosomes and a standard anti-Dengue virus E protein antibody recognize the same protein. (A) Dengue virus E protein was immunoprecipitated with serum from mice immunized with Dengue virosomes or Dengue virus like particles and subjected to SDS polyacrylamide gel electrophoresis followed by western blotting using anti-Dengue virus E protein antibody (Santacruz, USA) and vice versa. Lane 1: E protein immunoprecipitated from Dengue virosomes with standard antibody followed by detection with serum from mice immunized with Dengue virosomes; Lane 2: E protein immunoprecipitated from Dengue virosomes with serum from mice immunized with Dengue virosomes followed by detection with standard antibody; Lane 3: E protein immunoprecipitated from Dengue virus like particles (VLP) with standard antibody followed by detection with serum from mice immunized with Dengue VLP; Lane 4: E protein immunoprecipitated from Dengue VLP with serum from mice immunized with Dengue virosomes followed by detection with standard antibody. (C) Splenocytes of mice immunized with Measles virosomes, Dengue virosomes, Chimeric Dengue virosomes and Dengue virus like particles were harvested and tested for the presence of Dengue reactive cells producing IFNgamma by ELISPOT assay.
FIG. 15: Protective effect of serum from mice immunized with Measles Virosomes: Freshly plated, actively growing Vero cells were infected with PBS (A), MV (B) or MV treated with serum from mice immunized with Measles virosomes (C) and incubated for 7 days. Cells infected with untreated MV but NOT the MV treated with anti-serum showed the appearance of typical cytopathic effect indicating that the anti-Measles-virosome serum protected cells from MV infection.
Seq ID 1: Plasmid pMTX-P1T. Seq ID 2: Modified Pst I fragment. Seq ID 3: Age-MVuptoSpe-Age fragment. Seq ID 4: Plasmid pMTX-P1T-Intermediate. Seq ID 5: PmlāL2āEco RI fragment. Seq ID 6: PmlāL1āPml I fragment. Seq ID 7: Plasmid pMTX-P1T-High Seq ID 8: Plasmid pMTXāNP-RE1-FH-RE2-RE3. Seq ID 9: Plasmid pMV. Seq ID 10: GMCSF-ires-PAP. Seq ID 11: GMCSF-ires-CytD. Seq ID 12: GMCSF-ires-sPD1-2A-PAP. Seq ID 13: GMCSF-ires-sPD1-2A-CytD. Seq ID 14: GMCSF-ires-sPD1-2A-DnG1-ires-PAP. Seq. ID 15: GMCSF-ires-sPD1-2A-DNG1-ires-CytD. Seq ID 16: Plasmid pMV-GP. Seq ID 17: pMV-GC Seq ID 18: Helper plasmid. Seq ID 19: Modified Afe IāNot I fragment. Seq ID 20: pMV-NPFH-GCG. Seq ID 21: pMTX-P1T-D2G. Seq ID 22: Sequence that was deleted from the pMTX-P1T-D2G. Seq ID 23: pMV-GsPP. Seq ID 24: pMV-GsPDP. Seq ID 25: pMV-GsPC Seq ID 26: pMV-GsPDC. Seq ID 27: ires-sPD1-2A-DnG1-ires. Seq ID 28: ires-sPD1-2A-DnG1-ires.
This invention describes the use of a recently described two plasmid system described in WO2013046216 that harnesses the RNA Dependent RNA Polymerase (RdRP) of non-segmented negative strand RNA viruses for expression of recombinant proteins and production of measles virus derivatives. The invention comprises (a) one cloning plasmid coding for suitably modified MV genome or a MV genome like replicon RNA that codes for desired non-MV genes cloned at conveniently provided restriction enzyme sites, and (b) one helper plasmid coding for and expressing N, P, L proteins respectively.
This invention comprises replicating and non-replicating derivatives of a virus that is attenuated. In one aspect of this invention, the said attenuated virus comprises attenuated MV (Measles Virus). Although this invention has been illustrated by using MV genome, any other virus with similar requirements for rescuing viruses from cDNA, equivalent attenuation and safety for a human being may be used in place of MV. The requirements for rescuing the above referred āany other virusā from cDNA comprise use of viral N, P and L proteins expressed from three distinct helper plasmids and use of a plasmid coding a viral anti-genomic RNA modified by insertion of a single additional transcriptional unit.
The MV derivatives of this invention comprise recombinant replicating and non-replicating derivatives of MV. The replicating MV derivatives of this invention are considered more effective as therapeutic agents for cancer than other currently used oncolytic MV derivatives due to multiple features. Firstly, the replicating MV described in this invention code for 2 to 4 non-MV genes from a single ATU, these non-MV genes have the potential to cause cancer cell death and also induce anti-tumour immunity. Secondly, these viruses are armed to deliver other/additional genes that either sensitize them to death by prodrug activating enzymes like cytosine deaminase or kill cancer cells or inhibit their growth through other mechanisms. Secondly, the non-replicating Measles virus derivatives (named as āVirosomesā) described in this invention offer a greater versatility at combining therapeutically useful genes into MV, increased safety provide an opportunity to overcome the problem of pre-existing anti-MV immunity and also expand the application of therapeutic MV to other disease conditions
This invention has been illustrated by disclosing an Oncolytic Measles Virosome that combines the oncolytic effect of MV with the therapeutic effect of a dominant negative mutant of Cyclin G1, sensitizing effect of Cytosine deaminase and immunopotentiating effect of GMCSF and/or PD-1 blockade. Such Virosomes will also help eliminate the potential risk factors associated with using live MV for therapy.
The MV derivatives described in this invention can be produced using just 2 plasmid DNA molecules which can be directly used as therapeutic agents thus eliminating the high costs & difficulties involved in manufacturing the currently used massive doses of MV for cancer therapy. Such oMV producing plasmid DNA molecules can will not be recognized by anti-MV immunity and so will help overcoming the problem of pre-existing anti-MV immunity.
This invention also comprises means for designing the said replicating and non-replicating viruses. In one aspect of this invention, the said means comprise DNA molecules. The said DNA molecules comprise plasmids.
In a further aspect, this invention comprises recombinant Measles virus genome cloned with two or more therapeutically effective genes.
In a further aspect, this invention comprises plasmids useful for producing non-replicating measles viruses which contain non-viral genes including therapeutically useful genes along with a variable number of MV-genes to ensure a pre-determined level of expression.
This invention illustrates synthesis of replicating MV derivatives comprising recombinant MV derivatives that also code for 2 to 4 non-MV genes like human granulocyte macrophage colony stimulating factor (GMCSF) which is known to induce anti-tumour immune responses, prostate specific acid phosphatase (PAP) which will help enhance the specificity of induced immune response, serve as a marker to determine the replicative capacity of rMV-GP as a function of phosphatase enzyme activity, exhibit an enhanced potency of anti-cancer effect due to incorporation of cytocidal genes like Cytosine deaminase and the dominant negative mutant of Cyclin G1.
This invention also comprises synthesis of non-replicating MV derivatives, designated/named for the purpose of this specification as āVirosomesā. Depending on the composition of their genome, the virosomes comprise three different types (1) those coding exclusively non-MV genes, (2) those coding for MV-N and MV-P genes along with non-MV genes and (3) those coding for MV-N, MV-P and MV-L genes along with the non-MV genes. These three virosomes are useful for expressing non-MV genes in infected cells at low, intermediate and high levels respectively.
The concept of Virosomes is illustrated by producing GFP virosomes. Ability of different types of Virosomes to express non-MV genes at different levels is illustrated by producing Dengue Virosomes which code for Dengue virus pr-M and E proteins either exclusively or in combination with MV-N, MV-P and MV-L proteins.
One virosome comprises of a genome that codes for dengue virus prM and E proteins and green fluorescent protein but NO measles virus gene.
The second synthesized Virosome contains a genome that codes for MV-N, MV-P and MV-L proteins along with Dengue virus preM and E proteins and the Green fluorescent protein.
The third synthesized Virosome contains a genome that codes for a truncated prM and E proteins of Dengue virus and the Green fluorescent protein. These Dengue virosomes have been shown to be capable of inducing in animals, an anti-Dengue immunity (FIG. 14) that protects cells from infection with Dengue virus.
In a further aspect of this invention an Oncolytic Virosome (nr-MV-HF-GCG) has also been synthesized a. This virosome comprises of a genome that codes for MV-N, MV-P, MV-H and MV-F proteins along with other non-MV genes which have therapeutically beneficial effects. Such virosomes will offer new more effective and safer MV derivatives for cancer therapy.
It is an embodiment of this invention that replicating MV derivatives like rMV-GP, rMV-GC, rMV-GsPP, rMV-GsPC, rMV-GsPDP and rMV-GsPDC induce the death of cancer cell lines like T47D, A549 or PC-3 but do not adversely affect non-cancerous cells as illustrated with cells like Vero cells.
This invention also embodies the demonstration that plasmid DNA molecules which are useful to produce replicating MV derivatives like rMV-GP and the Helper plasmid (Seq ID #18) together, are sufficient to induce cell death in PC-3 cells in a manner similar to oncolytic MV and may be useful to circumvent the problem of pre-existing anti-MV immunity that hinders MV virotherapy.
In a further aspect this invention comprises pharmaceutical compositions comprising viruses or DNA molecules. This invention also comprises use of viruses or DNA molecules as therapeutic agents for diseases. The diseases include cancer and Dengue. Thus, this invention discloses replicating derivative of MV that induces cancer cell death and Virosomes effective against Dengue.
This invention also discloses non-replicating derivative of MV that mediates transfer of different therapeutically useful genes into cancerous and other human cells and will be useful either as therapeutic agents or agents capable of inducing desired immune responses.
This invention also embodies a reagent kit for producing the said non-replicating MV derivatives.
In another aspect this invention comprises a method of treating cancer by administering an oncolytic measles virus or DNA molecules producing the said oncolytic measles virus to a patient so as to reduce the number of cancer cells wherein the said cancer cells are part of a tumour.
In yet another aspect this invention comprises a method of reducing the number of cancer cells, wherein the cancer cells are part of a tumour, by administering an oncolytic virus or DNA molecules producing the said oncolytic measles virus to the patient.
This invention also comprises a method of producing recombinant replicating derivatives of measles virus using a single Helper plasmid and a Cloning plasmid.
This invention discloses a method of producing a non-replicating derivatives of measles virus using a single Helper plasmid and a Cloning plasmid and a packaging cell line.
This invention also embodies a cell line derived from Vero cells that expresses the M, F and H proteins of Measles virus stably and is useful as a packaging cell line for the production of non-replicating derivatives of measles virus described in non-replicating derivatives of measles virus. This invention also embodies a cell line derived from Vero cells that expresses the M protein of MV stably and is useful as a packaging cell line for the production of non-replicating MV derivatives which do not contain the H and F proteins of MV.
This invention embodies a method of producing recombinant replicating derivatives of measles virus using a single Helper plasmid and a Cloning plasmid wherein the helper plasmid expresses the N, P and L proteins of measles virus and is identical to Seq ID #18.
This invention also discloses a method of producing recombinant derivatives of measles virus wherein the cloning plasmids codes for the entire genome of measles virus modified suitably to include additional transcription unit that codes for a non-measles virus gene at a location immediately upstream of the N protein gene.
This invention embodies a method of producing recombinant derivatives of measles virus wherein the cloning plasmid codes for the entire genome of measles virus modified suitably to include non-measles virus genes as part of the different genes of measles virus.
This invention also comprises a method where in the Cloning plasmid is derived from the plasmids pMTX-P1T (Seq ID #1), pMTX-P1T-intermediate (Seq ID #4) or pMTX-P1T-high (Seq ID #7) by inserting non-measles protein coding DNA sequences in one or both of the multiple cloning sites (MCS) provided.
This invention further comprises a method where in the Cloning plasmids for producing recombinant derivatives of measles virus may code for a genome comprising exclusively of non-measles genes expressed while being a part of a measles virus genome-like replicon. This cloning plasmid may be derived from plasmid pMTX-P1T (Seq ID #1) by cloning non-MV genes in to one or both of the 2 multiple cloning sites (MCS) provided in this plasmid.
This invention also discloses a method wherein the Cloning plasmid codes for a genome comprising of the N, P, F and H protein genes of Measles virus and up to 3 additional genes coding for non-measles proteins in the form of a measles virus genome-like replicon. This plasmid may be derived from Seq ID #8) OR a non-replicating derivative of MV that contains a genome coding for the fusogenic glycoproteins like MV-H & MV-F proteins and a combination of other genes such as suicide genes, pro-drug activating enzyme coding genes, or genes that code for cytokines & proteins which induce anti-tumour immunity.
This invention comprises one or more DNA molecules useful for producing variants of non-replicating derivatives of MV termed as VirosomesāCloning plasmidsāSeq ID #1, Seq ID #4, Seq ID #7, Seq ID #20,
This invention further comprises a method of producing non-replicating derivatives of measles virus using a single Helper plasmid and a Cloning plasmid and a packaging cell line where in the cloning plasmid codes for a genome comprising of non-measles virus genes and the N, P and/or L proteins of measles virus in the form of a measles virus genome-like replicon and the said cloning plasmid is derived from the plasmid pMTX-P1T-Intermediate (Seq ID #4) or pMTX-P1T-high (Seq ID #7) by inserting non-measles genes in to one or both of the multiple cloning sites (MCS) provided in these plasmids.
This invention discloses a method of producing recombinant derivatives of measles virus where in the helper plasmid codes for the N, P and L proteins of Measles virus and is identical to Sequence ID #18.
This invention comprises a replicating derivative of MV that codes for 2 or more non-MV genes which may either enhance the potential of the virus for inducing anti-cancer immunity or its cancer therapeutic effect. Such genes may include but not be limited to a cytokine and immunoregulatory cell surface molecule like sPD-1 or CTLA4, a tumour associated antigen, and genes that affects the cancer phenotype or induces cancer cell death (e.g. dominant negative mutant of Cyclin G1). Thus, MV derivatives encoding 2, 3 or 4 different non-MV genes are described.
This invention also embodies a replicating derivative of MV wherein the cytokine consists of one or more of GMCSF and other cytokines.
This invention discloses a replicating derivative of MV wherein the tumour associated antigen is prostatic acid phosphatase (PAP) or any other tumor associated antigen.
This invention discloses a replicating derivative of MV wherein the immuno-regulatory cell surface molecule is soluble PD-1 molecule.
This invention discloses a replicating derivative of MV wherein the cytocidal gene is cytosine deaminase.
This invention comprise a replicating derivative of MV wherein the cytokine is human GMCSF and the tumour associated antigen is human prostatic acid phosphatase (PAP).
This invention also comprises a method of treating cancer by administering replicating derivative of MV wherein the cytokine is human GMCSF and the tumour associated antigen is human prostatic acid phosphatase (PAP).
This invention further comprises a method of treating cancer by administering recombinant measles virus made by a method wherein the Cloning plasmid codes for a genome comprising of the N, P, F and H protein genes of Measles virus and up to 3 additional genes coding for non-measles proteins in the form of a measles virus genome like replicon further wherein the plasmid may be derived from Seq ID #8 and more specifically from Seq ID #20.
This invention discloses a pharmaceutical composition of a non-replicating virus and method to use it for treatment of one or more diseases; the pharmaceutical composition comprising, at least, the non-replicated virus and a sodium chloride or a balanced salt solution in a buffered base.
This invention also discloses a pharmaceutical composition of a replicating virus & method to use it for treatment of one or more diseases further comprising a cancer; the pharmaceutical composition comprising, at least, sodium chloride or balanced salt solution in a buffered base.
This invention embodies a pharmaceutical composition comprising one or more of DNA molecules useful for producing replicating and/or non-replicating derivatives of measles virus for therapeutic benefit, the said pharmaceutical composition comprising of water containing EDTA, salt and an agent promoting entry of DNA into animal cells.
This invention also embodies a method of using DNA molecules useful for producing the said replicating and/or non-replicating derivatives of measles virus for therapeutic benefit. The method comprising of administering a pharmaceutical composition comprising the DNA molecules useful for producing the said replicating and/or non-replicating derivatives of measles virus, water containing EDTA, salt and an agent promoting entry of DNA into animal cells.
This invention also comprises a method of treating disease by transfer genes that code for therapeutically useful proteins and/or RNA molecules into human cells by administering the recombinant non-replicating measles viruses produced by a method that comprises use of a single Helper plasmid and a Cloning plasmid and a MV packaging cell line where in (a) the Cloning plasmid is derived from the plasmids pMTX-P1T (Seq ID #1), pMTX-P1T-intermediate (Seq ID #4) or pMTX-P1T-high (Seq ID #7) by inserting non-measles protein coding DNA sequences in one or both of the multiple cloning sites (MCS) provided, or (b) where in the cloning plasmid may code for a genome comprising exclusively of non-measles genes expressed in the form of a measles virus genome like replicon, further wherein the cloning plasmid may be derived from plasmid pMTX-P1T (Seq ID #1) by cloning non-MV genes in to one or both of the 2 multiple cloning sites (MCS) provided in this plasmid; or (c) wherein the Cloning plasmid codes for a genome comprising of the N, P, F and H protein genes of Measles virus and up to 3 additional genes coding for non-measles proteins in the form of a measles virus genome like replicon further wherein the said plasmid may be derived from Seq ID #8.
This invention embodies non-replicating virus coding for Dengue virus subviral particles comprised of preM and E genes and a method for using this as a vaccinating agent for prevention of Dengue.
Below are given examples which are only illustrative of working of this invention and are not be construed as limiting the scope of the disclosure of this invention or the means/reagents used for the examples or conditions used for the examples. Any variation that is an obvious variation and equivalents are considered to be included within the scope of the disclosure of this invention.
1. Cells and Viruses
Vero (African green monkey kidney) cells were procured from the National Center for Cell Sciences (NCCS), Pune and grown as monolayers in Dulbecco's modified Eagle's Medium (DMEM) supplemented with 10% fetal calf serum (FCS). MVAC (Measles Virus Live I.P.) manufactured by Serum Institute of India was purchased off the counter from Emke Medicals by Applicant. To prepare a seed stock, Vero or MRC5 cells (NCCS, Pune) were seeded in 25 sq. cm flasks at 105 cells/flask and incubated overnight at 37 C in 5% CO2. Cells were washed with HBSS and seeded with MV-E at a multiplicity of infection (MOI) of 0.1 and incubated for 7 days. Culture supernatant was removed at every 24 hrs and replaced with DMEM containing 2% FCS. Virus from the harvested supernatants was pooled together, quantitated by TCID50 method. Culture supernatants containing the maximum virus titre were pooled together and used as seed stock.
2. Plasmids
The method described in this invention essentially envisages co-transfecting a Cloning plasmid and a Helper plasmid into different cell lines like vero cells which are conducive to measles virus propagation and producing the desired type of measles virus. The various Cloning plasmids which may be used for this purpose are described in details below.
Cloning Plasmids
The two plasmid expression system used here was earlier described in WO/2013/046216 and comprises of a helper plasmid that expresses the N, P and L proteins of Measles virus and a Cloning plasmid that is useful to express an artificial replicon in which up to 2 proteins can be cloned. The cloning plasmid pUC-P1P-Rep-P1T which was earlier described in WO/2013/046216 as sequence ID #6 was modified using standard molecular biology techniques as follows:
2.1 Cloning Plasmid Vectorsāfor Producing Non-Replicating MV Derivatives (Virosomes)
2.1.1 pMTX-P1T: Commercially available pIRES (Clonetech Takara) was digested with Bgl II and Hpa I and processed to create blunt end. The 4172 bp fragment corresponding to the nucleotide numbers 1930 to 6102 was isolated and processed with klenow fragment of E coli DNA polymerase I to generate blunt ends. This was then ligated with T4 DNA ligase to the 969 base pair fragment corresponding to the sequence ID no. 3 (WO/2013/046216) which was removed from the sequence ID no 6 (WO/2013/046216) by digesting with Sac I and Hind III and processed with Klenow fragment of E coli DNA polymerase I to produce blunt ends. The resulting plasmid was called pNeo_P1T. The plasmid pNeo_P1T was then digested with Bst BI and Stu I and the larger fragment was purified. This was then manipulated in silico so that the Neomycin resistance gene open reading frame was replaced by protein coding region for mouse Dihydrofolate reductase (DHFR) enzyme (NP-034179.1, Genbank) and the resultant sequence (termed DHFR cassette) synthesized using the gene synthesis method (Genscript Inc, USA). and digested with Bst BI and Stu I. This Bst BI and Stu I digested DHFR cassette then was ligated into the larger fragment of Bst BI and Stu I digested pNeo_P1T to generate pMTX_P1T. The resulting pMTX_P1T plasmid contains the replicon coding gene under the control of RNA polymerase I promoter and DHFR as a selection marker (FIG. 2) and depicted by the Seq. Id. No 1.
2.1.2 pMTX-P1T-Intermediate: This pMTX-P1T plasmid was modified further. This pMTX-P1T plasmid was digested with Pst I and the smaller fragment corresponding to the MVstart to MCS2 was discarded. A DNA corresponding to the Sequence ID no 2 was synthesized using the gene synthesis technology (Genscript Inc, USA), digested with Pst I and ligated into the larger fragment of Pst I digested pMTX-P1T to generate the plasmid pMTX-P1T-MVstart-Age-MCS1-N/P-MCS2. This pMTX-P1T-MVstart-Age-MCS1-N/P-MCS2 plasmid was digested with Age I. The region corresponding to sequence ID no. 3 was amplified by polymerase chain reaction (PCR) and extended by adding the nucleotides āTCTCGACGCGTACATGTAGCGCTCGCACCGGTā (SEQ ID NO. 29). This resulting PCR amplified DNA was digested with Age I and cloned into Age I digested P1T-MVstart-Age-MCS1-N/P-MCS2 to generate āpMTX-P1T-Intermediateā plasmid (Seq ID no. 4).
2.1.3 pMTX-P1T-High: The plasmid pMTX-P1T-Intermediate was digested with Pml I and Eco RI and the larger fragment was purified. A DNA corresponding to a sequence starting from the Pml I site in L protein coding region of MV (AY486084) up to the end of MV genome was PCR amplified using primers specific to the Pml I site containing region of L protein and the 3ā² end of MV genomic sequence extended to contain Eco RI site to obtain a Pml-L2-EcoRI fragment. This was digested with Pml I and Eco RI and cloned into the larger fragment of Pml I & Eco RI digested pMTX-P1T. The Eco RI site immediately downstream of the L2 fragment was then removed by in vitro mutagenesis to generate a pMTX-P1T-Intermediate-L2 plasmid. A DNA corresponding to H/L intergenic region followed by the 5ā² part of L coding region up to Pml I enzyme site (sequence ID no. 6) was then PCR amplified from plasmid encoding MV genomic RNA (WO/2013/046216) and digested with Pml I enzyme. This was then ligated into Pml I digested pMTX-P1T-Intermediate-L2 plasmid to produce āpMTX-P1T-Highā (Seq ID No. 7).
2.1.4 pMTX-P1T-NP-RE1_FH_RE2_RE3: Plasmid pMV was used to produce this plasmid. The L protein coding region from pMV was replaced by an oligonucleotide coding for restriction enzyme sites Mlu I and Afe I by in vitro mutagenesis to produce pMV-del-L. Sequence corresponding to MV-M protein was replaced by oligonucleotide linker for Eco RI and Nru I to produce pMV-del-LM. Plasmid pMV-del-LM was then digested with Afe I and Not I and the smaller fragment discarded. This was then replaced with a Modified āAfe I to Not I fragmentā that introduces an additional ATU region containing the sites for restriction enzyme sites for Mlu I and Xho I into the MV backbone. This a plasmid that expresses a MV replicon that codes for N, P, F and H proteins of MV along with 3 additional transcriptional units which can be modified by insertion of up to 3 non-MV proteins (Seq ID 8).
2.1.5 Cloning Plasmids to be Used for Producing Specific Virosomes
2.1.5.1 Dengue Virosome Cloning plasmids: The sequence coding for the Dengue virus like particles containing the preM and Envelope (E) proteins of Dengue virus serotype 2 along with a signal peptide (as described by Wang and co-workers (2009) [43] flanked by Asc I enzyme site was synthesized using Gene synthesis technology (Genscript Inc, USA) and cloned in between the Asc I & Xho I sites of pMTX-P1T to produce pMTX-P1T-D2. An orientation that showed that 5ā² end of D2 gene was towards the 5ā² end of the replicon coded by pMTX-P1T was selected.
Similarly, a nucleotide sequence corresponding to the eGFP protein was PCR amplified from the pUC-P1T plasmid (WO/2013/046216) using gene specific primers with Pac I enzyme site. The resulting GFP coding segment was then cloned into the Pac I site present in the MCS2 of pMTX-P1T to produce pMTX-P1T-D2G plasmid. An orientation that showed that 5ā² end of GFP gene was immediately downstream of D2 protein gene was selected. (Seq ID #21)
The same cloning strategy was used to clone D2 and GFP coding genes into pMTX-P1T-intermediate and pMTX-P1T-high to produce āpMTX-P1T-intermediate-D2Gā and āpMTX-P1T-high-D2Gā plasmids.
2.1.5.2 Chimeric Dengue Virosome Coding Plasmid
The coding region for the Dengue virus prM region of Dengue virus was identified from the plasmid pMTX-P1T-D2G and 273 bases corresponding to the pr region (Seq ID #21) were deleted using in vitro mutagenesis to generate pMTX-P1T-D2Gdelpr plasmid. 2.1.5.2 GFP Virosome coding plasmid: Plasmid pUC-P1T (WO/2013/046216) was digested with Asc I enzyme and the sequence corresponding to the eGFP protein cloned into the MCS1 of pMTX-P1T at Asc I site to produce pMTX-P1T-G plasmid.
2.1.5.3 Oncolytic Virosomes: Sequence corresponding to Cytosine deaminase (CytD) reported by Erbs et al, (2000) [44] appended with sequences for Mlu I site at both ends was assembled in the order 5ā²-Mlu I-CytD-Afe I-Mlu 1-3ā². Sequence corresponding to the cytotoxic dominant negative Cyclin G1 (dnG1) protein was derived from the Cyclin G1 sequence reported by Gordon et al (2000) [45] and appended at 5ā² and 3ā² ends with suitable restriction enzyme sites in the order 5ā²-Eco RI-dnG1-Nru I-Eco RI-3ā². The resultant Cyt D and dnG1 sequences were synthesized using gene synthesis technology (Genscript Inc, USA). On the other hand, GMCSF coding sequence was PCR amplified from the GMCSF-ires-PAP coding DNA using a forward gene specific primer containing Xho I site and a reverse gene specific primer containing the sites for Xho 1 and Pml 1 enzyme at the 5ā² ends.
PCR amplified GMCSF coding region was digested with Xho 1 and Pml 1 and ligated into similarly digested pMTX-P1T-NP-RE1-FH-RE2-RE3 to produce pNPFH_GMCSF. Sequence corresponding to Cyt D protein was digested with Mlu I and Afe 1 and ligated into similarly digested pNPFH-GMCSF to produce pNPFH-GMCSF-CytD. Finally plasmid pNPFH-GMCSF-CytD was the digested with Eco RI and Nru I and ligated to similarly digested dnG1 coding fragment to produce pNPFH_GCdnG1 to produce pNPFH_GCdnG. Plasmid pNPFH_GCdnG (or pNPFH-GCG) (Seq ID 20) codes for a MV replicon that codes for the N, P, F and H proteins of MV and GMCSF, Cytosine Deaminase and cytotoxic mutant of Cyclin G1.
2.2 Cloning PlasmidsāUseful for Producing Replicating Measles Virus Coding Derivatives
2.2.1 pMVāMeasles virus coding plasmid: A plasmid encoding the entire cDNA of MV genomic RNA (AY486084) was described in WO/2013/046216. This plasmid was digested with Spe I enzyme and the smaller 5802 bp Spe I fragment consisting of the nucleotide nos 3373 to 9175 from the MV genome (AY486084.1, Genbank) was isolated. Similarly the plasmid pMTX-P1T-High was then digested with Spe I and the larger 14564 bp fragment was purified. These two fragments were then ligated with T4 DNA ligase and the orientation with correct sequence orientation w.r.t. MV genomic RNA was selected to obtain the pMTX-P1T-MV plasmid. This plasmid was used to introduce additional genes and/or protein coding regions at various locations within the MV genomic sequence (Seq ID No 9). Additionally, cDNA coding for MV antigenomic RNA containing a cis-acting hammerhead ribozyme (HH) at the 5ā² end and the hepatitis delta virus ribozyme (HDV) at the 3ā² end and containing Afe I and Pme I enzyme sites at its 5ā² and 3ā² end in the order 5ā²-AfeI-PmeI-HH-MV antigenomic cDNA-HDV-PmeI-3ā² was synthesized by gene synthesized technology and cloned at the Eco RV site of pUC57 and an orientation wherein the Hind III site from the multiple cloning site of pUC57 was located upstream of the N protein coding gene was selected. This plasmid was also called as pMV and is represented by Seq ID #28.
2.2.2 Additional transcriptional unit (ATU) coding DNA fragments: The nucleotide sequences corresponding to the protein coding regions of human GMCSF (NM000758.3; Genbank), prostatic acid phosphatase (PAP) (BC016344.1; Genbank), the GTX homeodomain IRES element described by Chappell et al, (2000) [46], Cytosine deaminase (AF 312392, Genbank), soluble human programmed cell death 1 (L27440. Genbank) and the porcine Tischovirus 2A peptide described by Szymczak et al (2004)[47] were then assembled into bi-cistronic (1) bi-cistronic (e.g. GMCSF-ires-PAP (Seq ID 10) and GMCSF-ires-CytD (Seq ID 11), (2) tri-cistronic (e.g. GMCSF-ires-sPD1-2a-PAP (Seq ID 12), GMCSF-ires-sPD1-2a-CytD (Seq ID 13)), and tetra-cistronic (e.g. GMCSF-ires-sPD1-2aDnG1-ires-PAP, Seq ID 14, GMCSF-ires-sPD1-2aDnG1-ires-CytD, Seq ID 15) constructs in silico as shown in FIG. 1.
These were then assembled into additional transcriptional units by appending selected regions from the MV genomic RNA (AY486084) as described in Table 2 to produce ATU coding DNA fragments. Resultant fragments were synthesized by gene synthesis technology (Genscript Inc, USA).
| Order of assembly of the | ||
| Regions selected from the MV genomic | fragments with | |
| ATU No | RNA | multicistronic constructs |
| ATU -1 | (1) MV start (ntd # 1 to 107), (2) N/P | 5ā²-HindIII-Mvstart-MGC- |
| intergenic region (ntd # 1686-1807), (3) | N/P-N upto Bam-3ā² | |
| Part of the N protein open reading frame | ||
| upto Bam HI (ntd # 108 to 174) | ||
| ATU - 2 | (1) N/P intergenic region (ntd # 1686 to | 5ā²-N/P intergenic-MGC-N/P |
| 1806), (2) N-P intergenic region along with | intergenic with part of P-3ā² | |
| a part of MV-P gene (ntd # 1686 to 1957 | ||
| ATU - 3 | (1) Porf end (ntd # 3265 to 3330), (2) N/P | 5ā²-Porf end-N/P intergenic- |
| intergenic region (ntd # 1686 to 1806), (3) | MGC-P/M intergenic-3ā² | |
| P/M intergenic region (ntd # 3331 to | ||
| 3440), | ||
| ATU - 4 | (1)F/H intergenic region (ntd 7111 to | 5ā²-F/H intergenic-GMCSF- |
| 7247), and (2) F/H intergenic region (ntd | ires-PAP-F/H intergenic-3ā² | |
| 7111 to 7247) | ||
| ATU - 5 | (1) H/L intergenic region (ntd # 9175 to | 5ā²-H/L intergenic-GMCSF- |
| 9233), (2) N/P intergenic region (ntd # | ires-PAP-N/P intergenic- | |
| 1686 to 1806), (3) part of the L protein | Lorf-3ā² | |
| coding region (ntd # 9234 to 9577) | ||
The resulting sequences were cloned into the plasmid coding for MV genomic RNA as described to produce plasmids coding for MV containing additional genes at different locations of the MV genome.
2.2.3 Modified pUC57 plasmids: First the Aat II site present in the pUC57 vector was removed replacing the A present at position 2642 with G residue by site directed mutagenesis. The resulting plasmid was called pUC-delAat. Plasmid pUC57-delAat was then digested with Eco RI and Hind III to remove the multiple cloning site (MCS) and treated with the klenow fragment of E coli DNA polymerase I to produce blunt ended pUC57. This was then ligated with each one of the following oligonucleotide linkers to produce different modified pUC57 plasmids
| Sr | Plasmid | ||
| No | Oligonucleotideāsequence | name | |
| 2 | SpeāIālinker | pUC-Spe | |
| 3 | 5ā²-GACGTCATGCCCTGCAGG-3ā² | pUC-AS | |
| (SEQāIDāNO.ā30) | |||
| 4 | 5ā²-CCTGCAGGATGCACTAGT-3ā² | pUC-SS | |
| (SEQāIDāNO.ā31) | |||
2.2.4 Plasmids Coding for MV Genomic RNA Containing ATU at Different Locations:
Plasmids encoding the MV genomic RNA containing an additional ATU coding for 2 or more non-MV genes inserted at different locations of the MV genome were synthesized from pMV, pATU-GP and pUC57 using standard molecular biology techniques as shown in FIG. 3 and described below:
2.2.4.1 Inserting ATU upstream of N gene (pMV-GP): A plasmid encoding the entire MV genomic RNA including an additional ATU coding for bi-cistronic gene coding for GMCSF and PAP proteins was synthesized from pMV (Seq ID #9), pATU-GP (Seq ID 10) and pUC57 using standard molecular biology techniques.
The plasmid pMV was then digested with Aat II and Sbf I and the smaller 3989 bp fragment that codes for part of the RNA pol I promoter and the MV-N was removed and re-circularised by ligating it with an oligonucleotide linker for Aat II and Sbf I (5ā²-GACGTCATGCCCTGCAGG-3ā²) (SEQ ID NO. 30) to produce pMV-AS. The plasmid pMV-AS was then digested with Bam HI and Hin dIII and the larger 3613 bp fragment was selected.
Similarly, the ATU-GP DNA was then digested with Bam HI and Hind III and the ATU coding 2151 bp fragment was then cloned into the Bam HI & Hin DIII digested pMV-AS plasmid to generate pUC-with-ATU plasmid. This ATU coding region from pUC-with-ATU plasmid was then removed by digestion with Aat II and Sbf I and cloned into Aat II and Sbf I digested pMV plasmid to generate pMV-GP plasmid. The resulting pMV-GP contains an additional transcription unit coding for GMCSF & PAP proteins immediately upstream of MV-N protein coding region (Seq ID #16). The same strategy was used to synthesize a plasmid encoding the genome of MV containing GMCSF and Cytosine deaminase genes (pMV-GC, (Seq ID no 17). The plasmids encoding tri- (Seq ID 23 and Seq ID 25) and tetra-cistronic (Seq ID 24, Seq ID 26) genes upstream of the N gene of MV were produced using similar strategy from Seq ID 12, Seq ID 13, Seq ID 14 and Seq ID 15 respectively.
2.2.4.2 Insertion of ATU upstream of P gene (pMV-GP-ATU2): Plasmid pMV was digested with Sac II, the resulting 6213 bp fragment was purified and circularized by re-ligation with T4 DNA polymerase to produce pSacII-of-MV. This plasmid was digested with Sbf I and Xba I and the larger fragment purified. This was ligated to ATU2 DNA (described in 2.2.2.2 above) digested with Sbf I and Xba I to produce pN-ATU2-P. Plasmid pN-ATU2-P was digested with Sac II and the smaller ATU coding fragment was ligated into the larger 14153 bp fragment of pMV digested with Sac II to produce pMV-GP-ATU2. This plasmid contains ATU inserted upstream of P gene of MV.
2.2.4.3 Insertion of ATU upstream of M gene (pMV-GP-ATU3): Plasmid pMV was digested with Spe I and the larger 14 kb fragment was circularized by re-ligation with T4 DNA polymerase to produce pNPL. Plasmid pNPL was digested with Sbf I and Spe I and the resulting 1415 bp fragment was purified cloned into pUC-SS digested with Spe I and Sbf I to produce pUC_PL. Plasmid pUC_PL was then digested with Eco RV and Spe I and the larger fragment purified. This was then ligated to ATU3 DNA digested with Eco RV and Spe I to produce pP-ATU3-L. Plasmid pP-ATU-L was digested with Sbf I and Spe I and the ATU coding region cloned into pNPL to produce pNP-ATU-L. Plasmid pNP-ATU-L was the digested with Spe I and ATU coding fragment was ligated to the 5802 bp fragment produced by digesting pMV with Spe I to produce pMV-GP-ATU3. This plasmid contains ATU inserted upstream of M gene of MV.
2.2.4.4 Insertion of ATU upstream of H gene (pMV-GP-ATU4): Plasmid pMV was digested with Pac I. Similarly, ATU4 DNA (described in 2.2.2.4 above) was digested Pac I and ligated with Pac I digested pMV to produce pMV-GP-ATU4. This plasmid contains ATU inserted upstream of H gene of MV.
2.2.4.5 Insertion of ATU upstream of L gene (pMV-GP-ATU5): ATU5 DNA (described in 2.2.2.5 above) was digested with Spe I and Eco RI and ligated into the larger fragment produced by digesting pNLP (described 2.3.3.3 above) to produce pNP-ATU-L. The 5802 bp fragment produced by digesting pMV with Spe I was then ligated to pNP-ATU-L digested with Spe I to produce pMV-GP-ATU5. This plasmid contains ATU inserted upstream of L gene of MV.
2.2 Helper plasmid: RNA was prepared from the purified MVAC (Measles Virus Live I.P.) as manufactured by Serum Institute of India, which was purchased off the counter from Emke Medicals by Applicant, using the GeneJet RNA purification kit (Fermentas) according to the manufacturer's protocol. 1 μg RNA was reverse transcribed using random hexamers and amplified using primers specific for the N (F:
| (SEQāIDāNO.ā32) | |
| 5ā²-GCTAGCATGGCCACACTTTTAAGG-3ā² | |
| and | |
| (SEQāIDāNO.ā33)) | |
| Rā5ā²-GCGGCCGCCTAGTCTAGAAGATT-3ā², | |
| (SEQāIDāNO.ā34) | |
| Pā(Fā5ā²-GCTAGCATGGCAGAAGAGCAGG-3ā², | |
| (SEQāIDāNO.ā35)) | |
| Rā5ā²-GCGGCCGCCTACTTCATTATTATC-3ā² | |
| andā | |
| (SEQāIDāNO.ā36) | |
| Lā(Fā5-GCTAGCATGGACTCGCTATCTGTCAAC-3, | |
| (SEQāIDāNO.ā37)) | |
| Rā5-GCGGCCGCTTAGTCCTTAATCAG-3ā |
N protein sequence was then amplified and sub-cloned in between the Nhe I and Xho I sites to obtain pIRES_N. P protein sequence was then amplified from pIRES_P and cloned into the Eco RI and Mlu I sites to create pIRES_NP. Finally, the L sequence was amplified from pIRES_L and cloned into pIRES_NP between the Sal I and Not I sites to obtain pIRES_NPL. In this form, this plasmid will express N and L proteins but not P. Therefore an oligonucleotide corresponding to the mammalian HTX homeobox internal ribosomal entry site reported by Chappell et al (2000) [46] was inserted in between the MV-N and MV-P protein coding regions by site directed mutagenesis. Resulting plasmid pNiPL expresses MV-N, MV-P and MV-L in transfected cells (FIG. 4) (Seq ID #18).
3. Generation of a Packaging Cell Line for Non-Replicating Viruses
The DNAs corresponding to the coding regions of MV-M, MV-F and MV-H proteins were PCR amplified using gene specific primers using Pfu polymerase (Invitrogen) according to manufacturer's protocol. These amplified genes were then cloned into suitably digested pCDNA3.1(ā) (Invitrogen, USA) plasmid vector. Clones encoding MV-M, MV-F and MV-H proteins were identified by digestion with specified restriction enzymes and confirmed by single pass sequence determination (data not shown) (FIG. 7A).
VeroMFH cell line: Plasmids encoding MV-M, MV-F and MV-H genes were linearised by digestion with Not I enzyme and mixed in equal quantities and used to transfect Vero cells (3 ug in each well of Vero cells plated in 6 well plates) in Lipofectamine 2000 (Invitrogen). Transfection was allowed for 4 hrs and culture medium changed to DMEM containing 10% FCS. Cells were incubated for 24 hrs at 37 C in 5% CO2. At the end of 24 hrs, culture medium was removed and replaced by DMEM containing 10% FCS and 500 uM Geneticin. The incubation was continued at 37 C in 5% CO2 with frequent changing to fresh Geneticin containing medium for next 3 weeks. At the end of 3 weeks, colonies of Geneticin resistant cells were trypsinized and cultured as cells expressing MV-M, MV-F and MV-H proteins. These cells were diluted and plated in 96 well plate at 1 cell per plate and allowed to grow in DMEM containing 10% FCS and 500 uM Geneticin. The ability of these cells to express MV-M, MV-F and MV-H proteins was ascertained by SDS-polyacrylamide gel electrophoresis of the cell lysate followed by western blot with antibodies reactive to corresponding proteins (FIG. 7B) These were tested for their ability to support production of Virosomes (MV like particles) and selected for use as a packaging cell line. The resulting cell line was called VeroMFH and used as a packaging cell line for producing non-replicating MV derivatives containing H and F proteins of MV.
VeroM cell line: Plasmid encoding MV-M gene was linearised by digestion with Not I enzyme transfected into Vero cells (3 ug in each well of Vero cells plated in 6 well plates). Transfection was allowed for 4 hrs and culture medium changed to DMEM containing 10% FCS. Cells were incubated for 24 hrs at 37 C in 5% CO2. At the end of 24 hrs, culture medium was removed and replaced by DMEM containing 10% FCS and 500 uM Geneticin. The incubation was continued at 37 C in 5% CO2 with frequent changing to fresh medium for next 3 weeks. At the end of 3 weeks, colonies of Geneticin resistant cells were trypsinized and cultured as cells expressing MV-M protein. These cells were diluted and plated in 96 well plate at 1 cell per plate and allowed to grow in DMEM containing 10% FCS and 500 uM Geneticin. The ability of these cells to express MV-M proteins was ascertained by SDS-polyacrylamide gel electrophoresis of the cell lysate followed by western blot with antibodies reactive to MV-M protein. These were tested for their ability to support production of Virosomes (MV like particles) and selected for use as a packaging cell line to produce non-replicating MV derivatives lacking the H and F proteins of MV. The resulting cell line was called VeroM
4. Production of Replicating Measles Viruses
Actively growing Vero cells were trypsinized and plated into 6 well plates in DMEM containing 10% FCS. After incubating at 37 C in 5% CO2 for 24 hrs, culture medium was removed and cells washed with HBSS. Cells were then co-transfected with 3 ug of Virus coding plasmid (any one of the MV coding plasmids from pMV (Seq ID 9), pMV-GP (Seq ID 16), pMV-GC (Seq ID 17) or pMV GsPP (Seq ID 23), pMV-GsPDP (Seq ID 24), pMV-GsPC (Seq ID 25), pMV-GsPDP (Seq ID 26), or pMV-GP-ATU2 to pMV-GP-ATU5 plasmids) and Helper plasmid (pINPL) (1:1.5) in Lipofectamine 2000 according to manufacturer's protocol. Transfection was allowed to occur for 4 hrs and culture medium replaced with DMEM containing 10% FCS. Twenty four hours after transfection, culture medium was replaced with DMEM containing 2% FCS and incubation continued. The cells were observed daily for the appearance of cytopathic effect typical of MV. At the end of 7 days, cells showing the appearance of large syncytia were trypsinized and mixed with fresh Vero cells and re-plated in 6 well plates. Incubation was continued at 37 C in 5% CO2 with daily observation for the appearance of the typical cytopathic effect (CPE) characteristic of MV (FIG. 6A). Culture medium was collected after more than 75% of the plated cells showed MV cytopathic effect and used to infect fresh Vero cells. The appearance of CPE in these cultures was considered as an evidence of formation of the recombinant virus. Culture supernatant was collected and used as a seed stock for further propagation of the recombinant virus. The resultant viruses were named according to the Cloning plasmids used. Thus, virus produced from pMV-GP was called rMV-GP, that produced from pMV-GC was called rMV-GC and rMV-GP-ATU 2 to 5 when produced from plasmids pMV-GP to pMV-GC respectively. The growth curve of rMV-GP the studied by infecting freshly plated and actively growing Vero cells and harvesting culture supernatants every 24 hrs and determining the levels of pMV-GP using the TCID50 method (FIG. 6B). Culture supernatants containing the recombinant MV were concentrated by ultracentrifugation at 100,000Ćg and used to (1) prepare total viral RNA using Qiagen RNA kit (FIG. 6D) & analysed for the presence of RNA molecules coding for MV-N and MV-M and GMCSF genes and (2) negatively stained with 2% ammonium molybdate and observed under transcription electron microscope (FIG. 6E). Additionally, extracts prepared from vero cells infected with rMV-GP were also analysed for the presence of MV-N, MV-P and GMCSF proteins by western blot analysis using antibodies specific to rinderpest virus N and P proteins (which are known to cross react with MV-N and MV-P proteins and were kindly supplied by Prof. M. S. Shaila, Department of Microbiology & Cell Biology, Indian Institute of Science, Bangalore, INDIA) and human GMCSF (R&D systems, USA) (FIG. 5C). Results of the analysis for rMV-GP that codes includes a GMCSF coding additional transcriptional unit upstream of MV-N gene is shown in FIG. 6 for illustration.
Replicating MV derivatives containing tri-cistronic ATU (virus coding plasmid corresponding to Seq ID #23 and Seq ID #25) and tetra-cistronic ATU (virus coding plasmids corresponding to Seq ID #24 and Seq ID #26) inserted upstream of the N protein coding region of MV were produced using the same method.
5. Production of Non-Replicating Derivatives of Measles Virus (Virosomes)
5.1 Measles Virosomes: The VeroMFH cell line was maintained in DMEM supplemented with 10% FCS and 500 uM Geneticine. Actively growing VeroMFH cells were trypsinized and plated into 6 well plate at a density of 80000 cells/well and incubated for 24 hrs at 37 C in 5% CO2. They were then co-transfected with a Cloning plasmid that codes for MV replicon RNA (pMTX-P1T-GH) that expresses a MV replicon coding for GFP and Helper plasmid (pINPL) in Lipofectamine 2000 according to manufacturer's protocol. (3 ug DNA per well @ 2 ug pMTX-P1T-G+1 ug Helper plasmid). Transfection was allowed to occur for 2 hrs and culture medium replaced with DMEM supplemented with 10% FCS and cells were allowed to recover for 24 hrs. Culture medium was then removed and replaced with fresh DMEM containing 10% FCS and 750 uM Geneticine and incubated further. Culture medium was replaced every 48 hours.
Non-replicating measles viruses (Virosomes) were released into culture medium from day 4 onwards and the titres (as determined by the transfer of GFP expression into fresh Vero cells) was observed from day 5 and peaked after day 7. The presence of Virosomes was confirmed by (1) the ability of culture supernatant to infect fresh Vero cells and induce GFP expression by microscopy (FIG. 13), (2) analysis of the RNA contained in the culture supernatant by RT-PCR analysis (FIG. 8A) and (3) dot blot analysis with an antibody specific to the P protein of measles virus (kind gift from Prof. M. S. Shaila, Dept of Microbiology & Cell Biology, Indian Institute of Science, Bangalore, INDIA) and known to cross react with MV-P protein (FIG. 7B).
5.2 Dengue Virosomes: Similarly, virosomes coding for the Dengue virus subviral particles were also produced using the cloning plasmidsā(1) D2 Virosomesāproduced using pMTX-P1T-D2G; (3) D2-intermediate-Virosomesāproduced using pMTX-P1T-Intermediate-D2G; (4) D2-High-Virosomesāproduced using pMTX-P1T-High-D2G. Dot blot analysis of virosomes showed that both Dengue & GFP virosomes contained the MV proteins (e.g. MV-P). On the other hand, Dengue virosomes contained Dengue virus E protein but not the GFP virosomes (FIG. 7C).
5.3 Measles Virosomes
Similarly, Measles virosomes were also prepared by co-transfecting VeroMFH cells with pMTXP1T-NP-RE1-FH-RE2-RE3 (Seq ID 8) and the Helper plasmid (Seq ID 18). They were concentrated by ultra-centrifugation at 100,000Ćg and washed with PBS and used to immunize Balb/C mice. Serum isolated from these mice was found to protect Vero cells from infection with MV (FIG. 15).
5.3 Chimeric Dengue Virosomes
Chimeric Dengue virosomes that display Dengue virus E protein, but not the H and F glycoproteins and also contain a genome coding for Dengue virus prM and E proteins were produced using pMTX-P1T-D2Gdelpr Plasmid as the cloning plasmid. Briefly, freshly seeded and active growing VeroM cells were co-transfected with pMTX-P1T-D2Gdelpr and the Helper plasmid and incubated for 7 days in DMEM containing 10% fetal calf serum. Culture supernatants containing chimeric Dengue virosomes were collected. Chimeric Dengue Virosomes were concentrated by ultracentrifugation at 100,000Ćg and used to immunize mice. The presence of Dengue virus E protein in these virosomes was determined by first immunoprecipitating it with anti-Dengue virus E protein antibody followed by DS-polyacrylamide electrophoresis and detection with western blot analysis using the serum from mice immunized or vice versa (FIG. 14A & B). That these Dengue virosomes also induced anti-Dengue cell mediated immune responses was confirmed by preparing splenocytes from mice immunized with Dengue virosomes and enumerating the dengue virus reactive IFNg producing cells using ELISPOT assay (FIG. 14 C). Finally, the serum from mice immunized mice was tested for its ability to neutralize Dengue virus by PRNT test according to the method described by Liu et al (2014) [48].
5.3 Non-replicating Oncolytic Virosomes: On the other hand, non-replicating oncolytic virosomes that coded for MV-H and MV-F proteins and also the human GMCSF and PAP proteins were produced using the pNPFH_GCdnG/pNPFH-GCG plasmid.
6. rMV-GP kills cancer cells like PC-3 cells selectively but has no toxic effect on non-cancerous cells
The oncolytic effect of rMV-GP was tested using the prostate cancer cell linesāPC-3 and LnCAP. PC-3 and LnCAP cell lines were procured from the National Center for Cell Sciences, Pune, INDIA and maintained respectively in Ham's F12K medium and RPMI1640 supplemented with glutamine and 10% fetal bovine serum.
Actively growing cells were plated in 24 well plates at a density of 40000 cells/well and incubated overnight at 37 OC in 5% CO2. After the cells settled well, cells were washed with HBSS and infected with different concentrations of SBPL-0100 diluted in OptiMEM for 2 hr. Virus was then replaced with complete respective culture medium with 2% FBS and incubated at 37 C in 5% CO2 until a typical MV cytopathic effect (CPE) and/or cell death was observed. At the end of incubation, culture medium was replaced with fresh culture medium containing MTT dye (0.5 mg/mL) and incubated further for 4 hrs. Culture supernatant was then removed and replaced with DMSO to solubilize the reduced MTT formazan crystals. Plates were read of optical density at 570 nm and cytotoxicity caused by the virus was determined. As shown in FIG. 9, rMV-GP kills PC-3 cells belonging to prostate cancer in a dose dependent manner, in contrast, it has no toxic effect on non-cancerous cells like Vero cells.
6.1 Incorporation of Genes Producing Anti-Cancer Effect is Essential to Increase the Oncolytic Potency of Oncolytic MV
Replicating MV derivatives expressing 3 (rMV-GsPP coding for GMCSF, sPD-1 and PAP) and 4 (rMV-GsPPD coding for GMCSF, sPD-1, PAP and DnG1) were also synthesized as mentioned earlier. Freshly plated, actively growing Vero cells were infected with MV derivatives encoding 0 (MV), 2(rMV-GP), 3(rMV-GsPP) and 4 (rMV-GsPDP) non-MV genes and incubated for 72 hrs. At the end of this period, cell extracts were prepared, proteins separated by SDS-electrophoresis and subjected to western blot analysis for detecting proteins corresponding to human GMCSF, sPD-1, PAP and DnG1 using antibodies specific to human GMCSF (MAB215-SP, R&D Systems, USA), PD-1 (AF1086-SP, R&D Systems, USA), PAP (MAB6240-SP, R&D Systems, USA) and Cyclin G1 (SC-7865, Santacruz, USA) proteins. As expected, extracts from rMV-GsPDP infected Vero cells showed the presence of all 4 proteins; extracts from rMV-GsPP infected Vero cells showed the presence of GMCSF, sPD-1 and PAP; extracts from rMV-GP infected cells showed the presence of GMCSF and PAP and extracts from MV infected cells did not express any of the proteins GMCSF, PAP, sPD-1 and DnG1. On the other hand, all four infected cell extracts exhibited the presence of MV-H protein (FIG. 10A).
The oncolytic activity of these viruses was then tested on different cancer cell lines according to the method described above. FIG. 10B shows that rMV-GP and rMV-GsPP which are armed with GMCSF and/or sPD-1 which code for immune-regulatory genes exhibit no differences in their cytotoxicity towards PC-3, A549 and MCF-7 cell lines in contrast, inclusion of DNG1 in rMV-GsPDP increased the cytotoxic activity against cancer cells (FIG. 10C). Clearly therefore, arming MV with other genes known to have anti-cancer therapeutic effect can help increase its cancer therapeutic activity.
8. DNA Induced Oncolytic Effect
The rMV-GP produced using the 2 plasmids can induce selective oncolytic effect in cancer cell lines. The ability of DNA molecules which are useful for production of rMV-GP were then tested for their ability to induce a similar cytotoxic effect.
Actively growing PC-3 cells were trypsinized and split into 24 well plates at a density of 40000 cells/well and incubated at 37 OC in 5% CO2 overnight. After 24 hrs, cells were transfected with different quantities (3 ug/well to 0.03 ug/well) of plasmid mixture (pIN2PL+pSB-043R) in Xfect according to manufacturer's instructions. Four hours after transfection, culture medium was replaced with DMEM containing glutamine and 10% FCS and incubated over night. Twenty four hours after transfection, the culture medium was replaced by fresh culture medium containing 2% FCS and incubation continued. Every 24 hrs, cells were observed microscopically for the appearance of typical MV cytopathic effect and/or cell death. At the end of 6 days post transfection, Culture medium was replaced with fresh culture medium containing 0.5 mg/mL MTT and incubated for 4 hrs. At the end of the incubation, culture medium was removed and replaced with DMSO to solubilize the reduced MTT formazan crystals. Culture plates were then measured for optical density at 570 nm and cytotoxicity caused by the DNA molecules determined. FIG. 11 shows that co-transfection of PC-3 cells with different quantities of MV coding plasmid (rMV-GP) and the Helper plasmids induces a dose dependent toxicity in a manner similar to oncolytic MV.
9. Virosome Mediated Gene Transfer
The rMV-GP produced using the 2 plasmids can induce selective oncolytic effect in cancer cell lines. The ability of DNA molecules which are useful for production of rMV-GP were then tested for their ability to induce a similar cytotoxic effect.
Actively growing vero cells were trypsinized and seeded into chamber slides (4 chambers/slide) at a density of 40000 cells/chamber and incubated over night at 37 C in 5% CO2. Culture medium was then removed and washed with HBSS. Cells were layered with 0.5 mL of Virosomes (derived from pMTX-P1T-D2 plasmid) containing culture supernatant and incubated for 2 hrs at 37 C in 5% CO2. At the end of incubation, culture medium was replaced with fresh DMEM containing 5% fetal calf serum and incubation continued for 72 hrs. At the end of 72 hours, slides were stained with DAPI and observed under fluorescent microscope for presence of GFP. Simultaneously, culture supernatants from virosome infected vero cells was collected and centrifuged at 100,000Ćg. Pellet obtained from this supernatant was analysed for the presence of Dengue virus like particles using dot blot analysis.
GFP expression in virosome infected cells indicated successful transfer of GFP expression by Virosomes into vero cells. Similarly, a positive immunoblot with anti-Dengue virus E protein indicated that virosomes transferred Dengue VLP coding gene into vero cells and this Dengue VLP was expressed into culture medium as expected. It was further observed that virosomes derived from the different cloning plasmids (pMTX-P1T-D2 or pMTX-P1T-high-D2 expressed different levels of DVLP in culture supernatants. As expected, pMTX-P1T-D2 derived virosomes produced lower levels of DVLP than pMTX-P1t-high-D2 derived virosomes.
10: Cancer Therapeutic Effect of rMV-GP in Mice
The in vivo oncolytic effect of rMV-GP was tested in SCID mice according to the protocol described in Grote et al, (2003) [49]. Briefly, four-week-old CB17 SCID mice (procured from Vivolabs, Hyderabad, INDIA) were housed in individual ventilated cages (IVC) at INTOX Pvt. Ltd., Pune, INDIA and provided with food and water ad libidum. Mice received s.c. injections in the flank region with 107 viable PC-3 tumour cells. After the tumours had grown up to a volume of approximately 100 cubic mm, they were injected with 106 TCID50 rMV-GP in a total volume of 100 μl every 3rd day for 5 weeks. As controls, tumours were injected daily with the same volume of UV-inactivated virus. Tumour measurements were made every alternate day in two diameters, and the tumour volume was calculated according to the formula V=a2b/2 where a is the shortest and b the longest diameter. Mice whose tumours reached a volume of 2.5 cm3 or had begun to invade surrounding tissues were euthanized. The experimental protocol was approved by the Institutional Animal Ethics Committee of INTOX Pvt. Ltd. FIG. 12 (Data marked as #2) shows that rMV-GP can induce regression of xenotransplanted tumors in SCID mice. In contrast, treatment of tumors with PBS were not affected.
11: Immunopotentiating Effect of rMV-GP
The biological activity of GMCSF expressed from rMV-GP was determined using the TF-1 cell bioassay of Kitamura et al (1989). Briefly, actively growing TF-1 erythroleukemia cell line was plated at 5Ć104 cells/well in 24 well plate and incubated at 37 C in 5% CO2. Lysates of tumour cells infected with rMV-GP were then prepared in RIPA buffer and added to wells containing TF-1 cells (50 uL of cell extract). Cells were incubated at 37 C in 5% CO2 for 48 hrs and growth measured using MTT assay. Quantity of bioactive GMCSF produced by rMV-GP infected cells was estimated by mapping the results on a standard curve obtained by exposing TF-1 cells to standard GMCSF. Culture supernatants obtained from vero cells infected with rMV-GsPP and GsPPD were also found to contain GMCSF as detected by TF-1 cell bioassay (Data not shown).
12: Plasmid Induced Cancer Therapeutic Effect in Mice
The in vivo oncolytic effect of rMV-GP was tested in SCID mice according to the protocol described in Grote et al, (2003) [49]. Briefly, four-week-old CB17 SCID mice (procured from Vivolabs, Hyderabad, INDIA) were housed in individual ventilated cages (IVC) at INTOX Pvt. Ltd., Pune, INDIA and provided with food and water ad libidum. Mice received s.c. injections in the flank region with 107 viable PC-3 tumour cells. After the tumours had grown up to a volume of approximately 100 cubic mm, they were injected with 10 ug of a mixture of the Helper plasmid and pMV-GP (1.3:1) in 100 μl saline every 3rd day for 5 weeks. As controls, tumours were injected daily with the same volume of saline containing 10 ug pUC plasmid was used. Tumour measurements were made every alternate day in two diameters, and the tumour volume was calculated according to the formula V=a2b/2 where a is the shortest and b the longest diameter. Mice whose tumours reached a volume of 2.5 cm3 or had begun to invade surrounding tissues were euthanized. The experimental protocol was approved by the Institutional Animal Ethics Committee of INTOX Pvt. Ltd. FIG. 12 (data marked as #3) shows that tumors injected with plasmids which can produce rMV-GP also induced regression of tumors albeit at a slower rate and rMV-GP virus injected cells. This shows that DNA molecules producing oncolytic MV may also be useful for inducing anti-cancer effect.
1. A replicating derivative of an attenuated negative stranded RNA virus belonging to family paramyxoviridae, wherein the derivative comprises a single artificially designed additional transcriptional unit coding for two or more non-viral genes inserted in the same.
2. The replicating derivative of attenuated negative stranded RNA virus of claim 1, wherein the derivative comprises of three or more or four or more non-viral genes.
3. The replicating derivative of an attenuated negative stranded RNA virus of claim 2, wherein the virus is a Measles Virus or any other virus with equivalent attenuation, equivalent safety for a human being and with requirements for rescuing the any other virus from cDNA, the requirements comprising use of viral N, P and L proteins expressed from three distinct helper plasmids and use of a plasmid coding a viral anti-genomic RNA modified by insertion of a single additional transcriptional unit.
4. The replicating derivative of an attenuated negative stranded RNA virus of claim 3, wherein the process of making the same comprises use of (a) a two plasmid system and comprising (i) one cloning plasmid comprising the entire anti-genome of the measles virus with or without an additional transcriptional unit (ATU) coding for non-MV genes, wherein MV stands for āMeasles Virusā, (ii) one helper plasmid coding for and expressing N, P, L proteins respectively, and (b) a cell line supporting measles virus replication; the cell line may or may not be modified to express one or more of M or F or H proteins of MV stably,
but not requiring the help of exogenous vaccinia virus or exogenous T7 RNA polymerase.
5. The replicating derivative of an attenuated negative stranded RNA virus of claim 3, wherein the attenuated virus is a Measles Virus; the term āMeasles Virusā being abbreviated as MV hereafter.
6. The replicating derivative of an attenuated negative stranded RNA virus of claim 4, wherein the cloning plasmid coding for the anti-genome of replicating Measles Virus derivatives comprises a single additional transcriptional unit (ATU) that comprises two or more non-viral genes inserted in the same.
7. The replicating derivative of an attenuated negative stranded RNA virus of claim 6, wherein the cloning plasmid comprises any one selected from the group consisting of pMV-GP of SEQ ID NO: 16, pMV-GC of SEQ ID NO: 17, pMV-GsPP of SEQ ID NO: 23, pMV-GsPC of SEQ ID NO: 25, pMV-GsPDP of SEQ ID NO: 24, and pMV-GsPDC of SEQ ID NO: 26.
8. A composition comprising:
a. the replicating derivative of an attenuated negative stranded RNA virus as claimed in claim 1, wherein the virus is a Measles Virus, the term āMeasles Virusā being abbreviated as āMVā hereafter, or any other virus with equivalent attenuation, equivalent safety for a human being and with requirements for rescuing the any other virus from cDNA, the requirements comprising use of viral N, P and L proteins expressed from three distinct helper plasmids and use of a plasmid coding a viral anti-genomic RNA modified by insertion of a single additional transcriptional unit, and
b. pharmaceutically acceptable excipients,
wherein the replicating derivatives comprise two or more non-viral genes inserted in the same.
9. The composition of claim 8, wherein the replicating derivative of an attenuated virus comprises derivatives that are capable to induce the death of cancer cells but do not adversely affect non-cancerous cells.
10. The composition of claim 9, wherein the cancer cells comprise breast cancer cells, lung cancer cells or prostate cancer cells and the non-cancerous cells are human non-cancerous cells or Vero cell line.
11. The composition of claim 10, wherein the cancer cells comprise at least one of T47D, A-549 or PC-3 and human non-cancerous cells comprising at least one of human normal dermal fibroblasts or mesenchymal stem cells.
12. The composition of claim 9, wherein the replicating derivative is one or more selected from the group consisting of rMV-GP, wherein an additional transcriptional unit (ATU) comprising SEQ ID NO: 10 is inserted upstream of N protein coding region, rMV-GC, wherein an ATU comprising SEQ ID NO: 11 is inserted upstream of N protein coding region, rMV-GsPP, wherein an ATU comprising SEQ ID NO: 12 is inserted upstream of N protein coding region, rMV-GsPC, wherein an ATU comprising SEQ ID NO: 13 is inserted upstream of N protein coding region, rMV-GsPDP, wherein an ATU comprising SEQ ID NO: 14 is inserted upstream of N protein coding region or rMV-GsPDC, wherein an ATU comprising SEQ ID NO: 15 is inserted upstream of N protein coding region.
13. A composition of plasmids comprising:
a. the plasmid coding for an anti-genome of replicating Measles virus derivatives, comprising a single additional transcriptional unit (ATU),
b. a helper plasmid coding for and expressing N, P, and L proteins of the Measles Virus, and
c. pharmaceutically acceptable excipients,
wherein the ATU comprises two or more non-viral genes inserted in the same.
14. The composition of claim 13, wherein:
a. the plasmid coding for the anti-genome of replicating Measles Virus derivatives, the term āMeasles Virusā being abbreviated as āMVā hereafter, comprising a single additional transcriptional unit (ATU) coding for 2 to 4 non-Measles Virus genes comprise one or more of pMV-GP of SEQ ID NO: 16, pMV-GC of SEQ ID NO: 17, pMV-GsPP of SEQ ID NO: 23, pMV-GsPC of SEQ ID NO: 25, pMV-GsPDP of SEQ ID NO: 24, pMV-GsPDC of SEQ ID NO: 26;
b. the helper plasmid comprises a plasmid of SEQ ID NO: 18.
15. A method of reducing a number of cancer cells, wherein the cancer cells are part of a tumour, the method comprising the steps of administering:
a. an oncolytic virus, selected from the group consisting of rMV-GP, wherein an additional transcriptional unit (ATU) comprising SEQ ID NO: 10 is inserted upstream of N protein coding region, rMV-GC wherein an ATU comprising SEQ ID NO: 11 is inserted upstream of N protein coding region, rMV-GsPP wherein an ATU comprising SEQ ID NO: 12 is inserted upstream of N protein coding region, rMV-GsPC wherein an ATU comprising SEQ ID NO: 13 is inserted upstream of N protein coding region, rMV-GsPDP wherein an ATU comprising SEQ ID NO: 14 is inserted upstream of N protein coding region or rMV-GsPDC wherein an ATU comprising SEQ ID NO: 15 is inserted upstream of N protein coding region, or
b. a combination of a helper plasmid of SEQ ID NO: 18 and one or more of the plasmids selected from the group consisting of pMV-GP of sequence ID #16, pMV-GC of SEQ ID NO: 17, pMV-GsPP of SEQ ID NO: 23, pMV-GsPC of SEQ ID NO: 25, pMV-GsPDP of SEQ ID NO: 24, pMV-GsPDC of SEQ ID NO: 26.