US20240043849A1
2024-02-08
18/332,109
2023-06-09
Smart Summary: Modified viruses have been created to lessen the body's inflammatory and immune responses. These changes lead to better viral delivery and increased expression of desired genes. The modifications involve adding special sequences that attach to TLR9, a part of the immune system, without activating it. This allows the modified virus to deliver treatments more effectively to mammalian cells. Additionally, methods for creating these modified viruses and using them for medical treatments have been developed. đ TL;DR
Modified viral genomes are able to reduce induction of inflammatory and immune antiviral responses. This manifests itself in reduced NF-kB activity, increased viral transduction rates, and increased expression of transgenes. Viral genomes are modified by incorporating one or more oligonucleotide sequences which are able to bind to TLR9 but not induce activation of it. The oligonucleotide sequences may be synthetic, bacterial, human, or from any other source.
Get notified when new applications in this technology area are published.
C12N2310/17 » CPC further
Structure or type of the nucleic acid; Type of nucleic acid Immunomodulatory nucleic acids
C12N2330/51 » CPC further
Production; Biochemical production, i.e. in a transformed host cell Specially adapted vectors
C12N2750/00032 » CPC further
ssDNA viruses; Details Use of virus as therapeutic agent, other than vaccine, e.g. as cytolytic agent
C12N2750/00041 » CPC further
ssDNA viruses; Details Use of virus, viral particle or viral elements as a vector
Y02A50/30 » CPC further
in human health protection, e.g. against extreme weather Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
A61K48/00 » CPC further
Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
C12N15/117 » CPC main
Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor; Recombinant DNA-technology; DNA or RNA fragments; Modified forms thereof Nucleic acids having immunomodulatory properties, e.g. containing CpG-motifs
A61K45/06 » CPC further
Medicinal preparations containing active ingredients not provided for in groups  - Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
A61K31/7088 » CPC further
Medicinal preparations containing organic active ingredients; Carbohydrates; Sugars; Derivatives thereof Compounds having three or more nucleosides or nucleotides
A61K35/76 » CPC further
Medicinal preparations containing materials or reaction products thereof with undetermined constitution; Microorganisms or materials therefrom Viruses; Subviral particles; Bacteriophages
C12N15/86 » CPC further
Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor; Recombinant DNA-technology; Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression; Vectors or expression systems specially adapted for eukaryotic hosts for animal cells Viral vectors
C12N7/00 » CPC further
Viruses; Bacteriophages; Compositions thereof; Preparation or purification thereof
This application is continuation of PCT/US2017/036525 filed Jun. 8, 2017, which claims priority to U.S. Provisional Application No. 62/347,302 filed on Jun. 8, 2016, each of which is herein incorporated by reference in its entirety for all purposes.
This invention was made with government support under Grant No. HG008525 awarded by National Institutes of Health. The government has certain rights in the invention.
This invention is related to the area of viral based therapies. In particular, it relates to recombinant viruses.
Gene therapy has immense potential to prevent, treat, and cure multiple human diseases [1]. In 2012, Glybera⢠(alipogene tiparvovec) became the first viral gene therapy to be approved for use in the western world [2]. Glybera⢠utilizes adeno-associated virus (AAV) as a viral vector to deliver the human lipoprotein lipase (LPL) gene to muscle cells in patients with LPL deficiency [3]. Many AAV clinical trials are currently underway or being planned in the U.S. and the EU [4-6].
AAV is a small, non-enveloped virus that packages a single-stranded linear DNA genome that is approximately 5 kb long, and has been adapted for use as a gene transfer vehicle [4]. The coding regions of AAV are flanked by inverted terminal repeats (ITRs), which act as the origins for DNA replication and serve as the primary packaging signal [7, 8]. Both positive and negative strands are packaged into virions equally well and capable of infection [9-11]. In addition, a small deletion in one of the two ITRs allows packaging of self-complementary vectors, in which the genome self-anneals after viral uncoating. This results in more efficient transduction of cells but reduces the coding capacity by half [12, 13]. While AAV is not associated with any human disease, >70% of humans are seropositive for one or most serotypes [14, 15]. Typical routes of administration for AAV vectors include intravenous, intramuscular, subretinal and intracranal injections. AAV gene therapy is most often used to deliver a wild-type gene to treat monogenic diseases, and AAV vectors have been used to transduce cells in the liver, skeletal and cardiac muscle, retina and central nervous system [16-26]. In addition, there is now growing interest in using AAV to deliver CRISPR-Cas9 gene editing or to deliver broadly neutralizing antibodies against infectious diseases such as human immunodeficiency virus (HIV) and influenza A virus [27-32].
Despite several advances in gene therapy, a key concern is the inflammatory response elicited by the viral vector [33, 34]. This is best illustrated by a highly publicized case in 1999 when Jesse Gelsinger died four days after gene therapy with adenovirus in a clinical trial due to excessive inflammation [35]. While AAV has been shown to elicit much weaker inflammation in comparison to adenoviruses [36, 37], Glybera⢠therapy still includes twelve weeks of immunosuppression, beginning three days before Glybera⢠administration [38]. These immunosuppressive and anti-inflammatory drugs (cyclosporine A, mycophenolate mofetil, and methylprednisolone) compromise the patient's immune system during treatment, and all patients still developed neutralizing antibodies against AAV capsid, precluding future re-administration. Furthermore, many AAV gene therapy clinical trials do not utilize immunosuppression prophylactically and only administer corticosteroids upon signs of inflammation or tissue damage, which has been associated with variable therapeutic efficacy [22, 23]. Interestingly, in agreement with their ability to trigger inflammatory and immune responses, AAV vectors have also been developed as vaccine vehicles against infectious diseases and cancer [39-41].
Inflammation has been implicated as a critical determinant of successful AAV-mediated transgene expression. A study found that following AAV administration in mice, artificially inducing systemic inflammation such as the upregulation of tumor necrosis factor (TNF), led to a decline in transgene expression in the liver [42]. This indicates that immunological tolerance to AAV-encoded transgene can be broken given sufficient inflammatory responses. Another study characterized inflammation in the murine liver following AAV infection and found transient increases in liver enzymes in the serum, and also liver pathology consistent with portal and lobular inflammation [43]. Strikingly, the authors observed that the use of AAVrh.32.33 viruses, which induced higher liver enzymes than other tested AAV serotypes, also led to a decline in transgene expression to below detection levels, again suggesting that inflammatory and immune responses are associated with poor transgene expression.
In hemophilia B clinical trials, it has been observed that a subset of patients exhibited elevated liver enzymes, and this transient transaminitis was accompanied by declining levels of transgene-encoded factor IX [22, 23]. A tapering course of corticosteroid therapy was used on a patient with transaminitis, which subsequently normalized aminotransferase levels in the serum and rescued further decline of factor IX expression. Overall, these observations are compatible with immune-mediated destruction of AAV-transduced hepatocytes and demonstrate that inflammatory and immune responses triggered by AAV administration are a safety concern and can hamper therapeutic efficacy in humans. Thus, it would be advantageous to develop viral vectors that intrinsically evade eliciting inflammation. Furthermore, instead of systemic immunosuppression with drugs, it would be beneficial to avoid triggering specific immune responses.
It has been previously shown that the DNA genome of AAV is sensed by Toll-like receptor 9 (TLR9) during AAV's entry into the cell through the endocytic pathway [36, 44]. TLR9 is a pattern recognition receptor (PRR) found on endosomal membranes of immune cells such as B cells, monocytes, macrophages and plasmacytoid dendritic cells, and binds to unmethylated CpG motifs found in the AAV genome [45, 46]. This leads to TLR9 dimerization, which triggers a cascade of signal transduction that activates NF-kB (also known as p52-RelA complex) and induces type I interferons (IFNs). NF-kB in turn drives the transcriptional upregulation of multiple proinflammatory cytokines such as TNF leading to inflammation and immune cell recruitment, while secreted IFNs induce the expression of numerous interferon-stimulated genes (ISGs) and establish an antiviral state. Importantly, genetic ablation of TLR9 in mice abolishes induction of inflammatory cytokines upon AAV treatment in the liver, and also reduces formation of antibodies and T cells against AAV [36]. Thus, TLR9 plays a critical role in stimulating an early inflammatory and innate immune response during AAV infection, which also contributes to priming adaptive immunity. Finally, two other pattern recognition receptors, TLR2 and TLR4, have been implicated in triggering responses to AAV structural proteins [47, 48].
In the TLR9 field, a commonly used tool to block TLR9 activation in cell culture is short, single-stranded DNA oligonucleotides that bind TLR9 but do not activate it [49, 50]. Several such sequences are knownâsome synthetic and others derived from organismsâand they often bear no sequence homology [51-59]. Structural studies have revealed how an inhibitory oligonucleotide binds TLR9 tightly but does not trigger TLR9 dimerization, which is required for TLR9 activation and downstream signaling [60]. In addition to binding TLR9 directly to antagonize its activation, other mechanisms to block TLR9 activation or TLR9-mediated inflammation have been postulated or shown for other TLR9-inhibitory oligonucleotides [reviewed in 49]. These include competing for receptor-mediated endocytosis or phagocytosis, inhibition of TLR9 trafficking or TLR9 processing into a functionally active product, inhibition of endosomal acidification or activity of key proteases in endosomes, or blocking signaling proteins downstream of TLR9. When these inhibitory oligonucleotides are supplied in trans with TLR9 ligands (such as a DNA virus, or a CpG-containing oligonucleotide) in cell culture media, they are endocytosed and can bind to TLR9, preventing its activation by stimulatory ligands. Supplementation of inhibitory oligonucleotides in trans is widely adopted in immunology experiments, but it is unknown in the field if incorporation of these sequences into a viral genome allows it to evade eliciting inflammatory and immune responses.
While AAV has been shown to elicit much weaker inflammatory responses in comparison to adenoviruses, Glybera⢠alipogene tiparvovec treatment still includes twelve weeks of immunosuppression, beginning three days before Glybera⢠alipogene tiparvovec administration. These immunosuppressive drugs strongly hamper T cell activation and therefore compromise the patient's immune system during treatment. It would be advantageous to engineer viral vectors that evade and elicit diminished or no inflammatory response upon administration. Furthermore, it would be beneficial if the immune suppression was not systemic, and if it was transient. Preventing inflammatory and immune responses could also improve transgene expression and may allow the re-administration of the viral vector for future purposes.
There is a continuing need in the art to improve the efficacy of viral vectors for therapy and for in vivo production of biological products.
According to one aspect of the invention a nucleic acid molecule is provided. It comprises a viral genome covalently linked to an inhibitory nucleic acid sequence which binds to TLR9 but does not trigger TLR9 activation.
According to another aspect a recombinant virus is provided for delivery of a desired function to a mammalian cell. The recombinant virus comprises a viral genome covalently linked to an inhibitory nucleic acid sequence which binds to TLR9 but does not trigger TLR9 activation.
Another embodiment is an aspect of treating a mammal. The method comprises administering a recombinant virus to a mammal in need thereof. The recombinant virus comprises a viral genome covalently linked to an inhibitory nucleic acid sequence which binds to TLR9 but does not trigger TLR9 activation.
Still another aspect is a method of making a viral genome of a recombinant virus. An inhibitory nucleic acid sequence is inserted into a viral genome. The inhibitory nucleic acid sequence binds to TLR9 but does not trigger TLR9 activation.
According to one aspect a nucleic acid molecule is provided. It comprises an inverted terminal repeat (ITR) and a nucleic acid sequence which inhibits TLR9-mediated inflammation.
Another aspect of the invention is a nucleic acid molecule. The molecule comprises a viral genome covalently linked to an inhibitory nucleic acid sequence which inhibits TLR9-mediated inflammation.
Yet another aspect of the invention is a recombinant virus for delivery of a desired function to a mammalian cell. The recombinant virus comprises a viral genome comprising an inhibitory nucleic acid sequence which inhibits TLR9-mediated inflammation.
Still another aspect of the invention is a method of making a viral genome of a recombinant virus. A nucleic acid sequence is inserted into a viral genome. The nucleic acid sequence inhibits TLR9-mediated inflammation.
According to another aspect of the invention a nucleic acid vector is provided. The vector comprises at least one nucleic acid sequence. The nucleic acid sequence is capable of inhibiting TLR9-mediated inflammation.
Another aspect of the invention is a method of reducing immunogenicity of a modified virus having a genome. The method comprises inserting a nucleic acid sequence into the genome. The nucleic acid sequence inhibits TLR9-mediated inflammation. The modified virus causes a reduced inflammatory response in a host as compared to a virus that does not contain the inhibitory sequence.
Still another aspect of the invention is a method of increasing expression in a host cell of a virally introduced transgene. The method comprises introducing into a host a modified virus having a genome. The genome comprises a nucleic acid sequence. The nucleic acid sequence inhibits TLR9-mediated inflammation. The modified virus results in higher transgene expression in a host cell as compared to a virus that does not contain the inhibitory sequence.
Yet another aspect of the invention is a composition comprising a viral capsid encapsidating a nucleic acid sequence that inhibits TLR9-mediated inflammation.
These and other aspects and embodiments which will be apparent to those of skill in the art upon reading the specification provide the art with tools for better treating mammals with viral vectors and virions and for better using viral vectors and virions for producing products of transgenes in host cells, host tissues, and host animals.
Any and all of the above described aspects may be combined with any of the following features.
The viral genome may be adeno-associated virus (AAV) genome.
The viral genome may be selected from the group consisting of adenovirus, herpes simplex virus, varicella, variola virus, hepatitis B, cytomegalovirus, JC polyomavirus, BK polyomavirus, monkeypox virus, Herpes Zoster, Epstein-Barr virus, human herpes virus 7, Kaposi's sarcoma-associated herpesvirus, and human parvovirus B19.
The viral genome may be single stranded.
The viral genome may be packaged in a virion.
The viral genome may comprise a gene which may be expressible in a human cell.
The viral genome may be a cytotoxic virus for lysing target tumor cells.
The inhibitory nucleic acid sequence may comprise c41 oligonucleotide sequence TGGCGCGCACCCACGGCCTG (SEQ ID NO: 1).
The inhibitory nucleic acid sequence may comprise a plurality of copies of c41 sequence (SEQ ID NO: 1).
The inhibitory nucleic acid sequence may comprise two copies of c41 sequence (SEQ ID NO: 1) separated by a linker sequence.
The linker sequence is AAAAA (SEQ ID NO: 8).
The inhibitory nucleic acid sequence may be selected from the group consisting of:
| ODNâ2088: | |
| (SEQâIDâNO:â2) | |
| TCCâTGGâCGGâGGAâAGT; | |
| ODNâ4084-F: | |
| (SEQâIDâNO:â3) | |
| CCTGGATGGGAA; | |
| ODNâINH-1: | |
| (SEQâIDâNO:â4) | |
| CCTGGATGGGAATTCCCATCCAGG; | |
| ODNâINH-18: | |
| (SEQâIDâNO:â5) | |
| CCTâGGAâTGGâGAAâCTTâACCâGCTâGCA; | |
| ODNâTTAGGG: | |
| (SEQâIDâNO:â6) | |
| TTâAGGâGTTâAGGâGTTâAGGâGTTâAGGâG; | |
| and | |
| G-ODN: | |
| (SEQâIDâNO:â7) | |
| CTCâCTAâTTGâGGGâGTTâTCCâTAT. |
The inhibitory nucleic acid sequence may be a bacterial sequence.
The viral genome, recombinant virus, vector, or nucleic acid sequence may comprise a non-human gene.
The inhibitory nucleic acid sequence may be inserted downstream of or in a 3Ⲡuntranslated region of the viral genome.
The viral genome may be covalently linked to the inhibitory nucleic acid sequence by a phosphodiester bond.
The viral genome, recombinant virus, vector, or nucleic acid sequence may comprise a detectable marker.
The detectable marker may be inducible.
The inhibitory nucleic acid sequence may comprise a human telomere sequence shown in SEQ ID NO: 9.
The viral genome may be self-complementary.
The viral genome may be covalently linked to a plurality of inhibitory nucleic acid sequences.
The plurality of inhibitory nucleic acid sequences may comprise an inhibitory sequence and its reverse complement.
The inhibitory nucleic acid sequence may comprise three copies of c41 sequence (SEQ ID NO: 1), each copy separated by a linker sequence.
The inhibitory nucleic acid sequence may be selected from the group consisting of:
| ODNâ2114: | |
| (SEQâIDâNO:â16) | |
| TCCTGGAGGGGAAGT; | |
| ODNâ4024: | |
| (SEQâIDâNO:â17) | |
| TCCTGGATGGGAAGT; | |
| ODNâINH-4: | |
| (SEQâIDâNO:â18) | |
| TTCCCATCCAGGCCTGGATGGGAA; | |
| ODNâINH-13: | |
| (SEQâIDâNO:â19) | |
| CTTACCGCTGCACCTGGATGGGAA; | |
| ODNâPoly-G: | |
| (SEQâIDâNO:â20) | |
| GGGGGGGGGGGGGGGGGGGG; | |
| ODNâGpG: | |
| (SEQâIDâNO:â21) | |
| TGACTGTGAAGGTTAGAGATGA; | |
| ODNâIRS-869: | |
| (SEQâIDâNO:â22) | |
| TCCTGGAGGGGTTGT; | |
| ODNâIRS-954: | |
| (SEQâIDâNO:â23) | |
| TGCTCCTGGAGGGGTTGT; | |
| and | |
| ODNâ21158: | |
| (SEQâIDâNO:â24) | |
| CCTGGCGGGG. |
The inhibitory nucleic acid sequence may be ODN TTAGGG (SEQ ID NO: 6).
The inhibitory sequence may be covalently linked to a linker.
The inhibitory sequence may be upstream of the linker.
The inhibitory nucleic acid sequence may comprise a plurality of copies of ODN TTAGGG (SEQ ID NO: 6).
The plurality of copies of ODN TTAGGG (SEQ ID NO: 6) may each be separated by a linker.
The inhibitory nucleic acid sequence may comprise at least 2, at least 3, at least 4, or at least 5 copies of ODN TTAGGG (SEQ ID NO: 6), each copy separated by a linker.
The inhibitory nucleic acid sequence may be a human sequence.
The viral genome, recombinant virus, vector, or nucleic acid sequence may comprise a non-human nucleic acid sequence.
The viral genome, recombinant virus, vector, or nucleic acid sequence may comprise a human gene.
The viral genome, recombinant virus, vector, or nucleic acid sequence may comprise a human nucleic acid sequence.
The inhibitory nucleic acid sequence may be inserted in the 5Ⲡuntranslated region of the viral genome.
The inhibitory nucleic acid sequence may be inserted upstream of a promoter of the viral genome.
The viral genome, recombinant virus, vector, or nucleic acid sequence may comprise an inducible promoter.
The inhibitory nucleic acid sequence may comprise two repeated monomers of SEQ ID NO: 1.
The inhibitory nucleic acid sequence may comprise three repeated monomers of SEQ ID NO: 1.
The inhibitory nucleic acid sequence may comprise SEQ ID NO: 6 or SEQ ID NO: 9.
The inhibitory nucleic acid sequence may comprise three repeated monomers of SEQ ID NO: 6 or SEQ ID NO: 9.
The inhibitory nucleic acid sequence may comprise five repeated monomers of SEQ ID NO: 6 or SEQ ID NO: 9.
The step of administering may be repeated.
The viral genome may be packaged in virions.
The step of inserting may utilize a DNA ligase.
The viral genome may be single stranded when in virions.
The viral genome of the recombinant virus may comprise a gene for delivery to and expression in a human cell.
The viral genome, recombinant virus, vector, or nucleic acid sequence may comprise a linker separating each of the nucleic acid sequences.
The viral genome, recombinant virus, vector, or nucleic acid sequence may comprise at least 2, at least 3, at least 4, or at least 5 copies of the nucleic acid sequence.
The inhibitory nucleic acid may be covalently linked to a gene.
The inhibitory nucleic acid sequence may be 95% identical to c41 oligonucleotide sequence TGGCGCGCACCCACGGCCTG (SEQ ID NO: 1).
The inhibitory nucleic acid sequence may be 95% identical to SEQ ID NO: 9.
The inhibitory nucleic acid sequence may be 95% identical to a sequence selected from the group consisting of:
| ODNâ2088: | |
| (SEQâIDâNO:â2) | |
| TCCâTGGâCGGâGGAâAGT; | |
| ODNâ4084-F:â | |
| (SEQâIDâNO:â3) | |
| CCTGGATGGGAA; | |
| ODNâINH-1: | |
| (SEQâIDâNO:â4) | |
| CCTGGATGGGAATTCCCATCCAGG; | |
| ODNâINH-18: | |
| (SEQâIDâNO:â5) | |
| CCTâGGAâTGGâGAAâCTTâACCâGCTâGCA; | |
| ODNâTTAGGG: | |
| (SEQâIDâNO:â6) | |
| TTâAGGâGTTâAGGâGTTâAGGâGTTâAGGâG; | |
| and | |
| G-ODN: | |
| (SEQâIDâNO:â7) | |
| CTCâCTAâTTGâGGGâGTTâTCCâTAT. |
The inhibitory nucleic acid sequence may be 95% identical to a sequence selected from the group consisting of:
| ODNâ2114: | |
| (SEQâIDâNO:â16) | |
| TCCTGGAGGGGAAGT; | |
| ODNâ4024: | |
| (SEQâIDâNO:â17) | |
| TCCTGGATGGGAAGT; | |
| ODNâINH-4: | |
| (SEQâIDâNO:â18) | |
| TTCCCATCCAGGCCTGGATGGGAA; | |
| ODNâINH-13: | |
| (SEQâIDâNO:â19) | |
| CTTACCGCTGCACCTGGATGGGAA; | |
| ODNâPoly-G: | |
| (SEQâIDâNO:â20) | |
| GGGGGGGGGGGGGGGGGGGG; | |
| ODNâGpG: | |
| (SEQâIDâNO:â21) | |
| TGACTGTGAAGGTTAGAGATGA; | |
| ODNâIRS-869: | |
| (SEQâIDâNO:â22) | |
| TCCTGGAGGGGTTGT; | |
| ODNâIRS-954: | |
| (SEQâIDâNO:â23) | |
| TGCTCCTGGAGGGGTTGT; | |
| and | |
| ODNâ21158: | |
| (SEQâIDâNO:â24) | |
| CCTGGCGGGG. |
The inhibitory nucleic acid sequence may comprise a plurality of copies of SEQ ID NO: 6 and/or SEQ ID NO: 9
The inhibitory nucleic acid sequence may comprise two copies of SEQ ID NO: 6 and/or SEQ ID NO: 9 separated by a linker sequence.
FIG. 1. Schematic drawing of viral gene therapy and inflammatory and immune responses.
FIG. 2. Schematic drawing showing TLR9 sensing AAV DNA during viral entry and inflammatory and immune responses. From Rogers et al., 2011, Frontiers in Microbiology, âInnate Immune Responses to AAV Vectors,â vol. 2, article 194.
FIGS. 3A-3B. FIG. 3A shows nucleotide sequence of c41 (SEQ ID NO: 1), a single-stranded oligonucleotide. FIG. 3B shows organization of AAV-eGFP and AAV-eGFP-c41 genomes. ITR, inverted terminal repeat; LPA, late polyadenylation signal. Transgene of interest depicted in this case is eGFP. The insertion is of c41 sequence. Spacer depicted in FIG. 3B is shown in SEQ ID NO: 8.
FIG. 4 shows NF-kB activity in HEK293 TLR9 cells mock-infected or infected with AAV virus (DJ capsid, self-complementary AAV genome, encoding eGFP). **, p<0.005; n.s., not significant. This experiment used a crude viral preparation.
FIG. 5. Flow cytometry histograms showing GFP expression in HEK293 TLR9 cells mock-infected or infected with AAV virus with or without c41. This experiment used a crude viral preparation.
FIGS. 6A-6B. FIG. 6A shows nucleotide sequence of âtelomereâ (SEQ ID NO: 9), a single-stranded oligonucleotide containing the (TTAGGG)4 (SEQ ID NO: 6) motif from mammalian telomeres. FIG. 6B shows organization of AAV-eGFP-telomere genome. The insertion is of âtelomereâ sequence. Spacers shown in FIG. 6B are SEQ ID NO: 8.
FIGS. 7A-7B. FIG. 7A shows the percentage of transduced cells (GFP+) 2 days after infection of a B cell line with similar amounts of indicated AAV viruses, analyzed by flow cytometry. FIG. 7B shows TNF production in the supernatant of primary human CD14+ monocytes 18 hours after infection, as assayed by ELISA.
FIG. 8A-8B. Engineering a self-complementary AAV vector. (FIG. 8A) DNA sequences of âc41â and âtelomereâ. (FIG. 8B) Genome organization of an AAV vector (scAAV-eGFP) and modified vectors. LpA: polyA signal.
FIG. 9A-9C Inflammatory response to various AAV vectors in human immune cells in vitro. (FIG. 9A) Primary human macrophages were infected with AAV2 viruses (MOI: 105 vg/cell) and supernatants were collected 18 h later and analyzed by ELISA for TNF levels. Five uM ODN 2006, a CpG-containing oligonucleotide, served as a positive control. (FIG. 9B, FIG. 9C) Primary human CD14+ monocytes from two different donors were infected similar to (A) and analyzed for TNF levels. Data shown are meanÂąs.d. of n=3 technical replicates. *P<0.05 (unpaired t-test) compared to scAAV-eGFP.
FIG. 10A-10E. Further characterization of AAV vectors. (FIG. 10A) DNA sequence of âcontrolâ. (FIG. 10B) Genome organization of modified vectors. (FIG. 10C) Primary human macrophages were infected with AAV2 viruses similar to (FIG. 9A) and analyzed by ELISA for TNF levels. (FIG. 10D) Primary human monocytes were infected similar to (FIG. 9B, FIG. 9C) and analyzed by ELISA for TNF levels. Data shown (FIG. 10C, FIG. 10D) are meanÂąs.d. of n=3 technical replicates. *P<0.05 (unpaired t-test) compared to scAAV-eGFP. (FIG. 10E) Adult C57BL/6 mice were infected with indicated AAV2 viruses similar to (FIG. 12A, FIG. 12B and FIG. 12C) and a piece of the liver was analyzed for indicated gene expression by qRT-PCR. Data shown are meanÂąs.d. of n=5 mice per condition except n=3 mice for scAAV-eGFP-3xcontrol. *P<0.05 (unpaired t-test) compared to saline condition. N.s.: not significant (P>0.05).
FIG. 11A-11B. (FIG. 11A) Primary human macrophages using a different lot of both AAV2 viruses were infected similar to (FIG. 9A) and analyzed for TNF levels. (FIG. 11B) HeLa cells were infected with AAV2 viruses at indicated MOIs and cells were harvested 48 h later and analyzed by flow cytometry for GFP expression. The percentage of GFP positive cells are shown Data shown are meanÂąs.d. of n=3 technical replicates. *P<0.05 (unpaired t-test) compared to scAAV-eGFP.
FIG. 12A-12C Inflammatory response to intravenous administration of various AAV vectors in adult mice in vivo. (FIG. 12A, FIG. 12B and FIG. 12C) Adult C57BL/6 mice were infected with indicated AAV2 viruses (1011 vg per mouse) by tail vein injections. 2 h later, the animals were euthanized and a piece of the liver was analyzed for indicated gene expression by qRT-PCR. Saline injection was set to 1-fold expression for each gene. Data shown are meanÂąs.d. of n=3 mice per condition (FIG. 12A) or n=4 mice per condition (FIG. 12B and FIG. 12C). *P<0.05 (unpaired t-test) compared to saline condition. N.s.: not significant (P>0.05).
FIG. 13. Genome organization of a single-stranded AAV vector (ssAAV-eGFP) and ssAAV-eGFP-5x telomere.
FIG. 14A-14C. Inflammatory and immune response following subretinal administration of various AAV vectors in neonatal mice in vivo. (FIG. 14A, FIG. 14B and FIG. 14C) Neonatal CD1 mice (P1) received indicated AAV8 viruses (1.8Ă108 vg per mouse eye) by subretinal injections. At P21, the animals were euthanized and the eyecup was dissected out. The retina and the rest of the eyecup were analyzed for indicated gene expression by qRT-PCR. Saline injection was set to 1 fold expression for each gene. Each triangle represents an animal. Data shown are n=3 mice (saline) and n=5 mice (each virus) and mean values are indicated.
FIG. 15A-15C. Analysis of immune cell markers in the retina following subretinal administration of various AAV vectors in neonatal mice in vivo. (FIG. 15A, FIG. 15B and FIG. 15C) Similar to (FIG. 14A-14C), the retina was analyzed for indicated gene expression by qRT-PCR. AO (Ibal) is known to be expressed in microglia, while Cd4 and Cd8a are markers of helper and cytolytic T cells respectively. Saline injection was set to 1 fold expression for each gene. Each triangle represents an animal. Data shown are n=3 mice (saline) and n=5 mice (each virus) and mean values are indicated.
FIG. 16. GFP expression in the eye. Neonatal CD1 mice (P1) received indicated AAV8 viruses (1.8Ă108 vg per mouse eye) by subretinal injections. At P30, the animals were euthanized and GFP expression was visualized in flat-mounted eye cups. Data shown are n=2 mice per condition.
FIGS. 17A-17B. FIG. 17A shows nucleotide sequence of c41 (SEQ ID NO: 1), a single-stranded oligonucleotide. FIG. 17B shows organization of AAV-eGFP and AAV-eGFP-c41 genomes. ITR, inverted terminal repeat; LPA, late polyadenylation signal. Transgene of interest depicted in this case is eGFP. The insertion is of c41 sequence. Spacer depicted in FIG. 17B is shown in SEQ ID NO: 8.
FIGS. 18A-18B. FIG. 18A shows nucleotide sequence of âtelomereâ (SEQ ID NO: 9), a single-stranded oligonucleotide containing the (TTAGGG)4 (SEQ ID NO: 6) motif from mammalian telomeres. FIG. 18B shows organization of AAV-eGFP-telomere genome. The insertion is of âtelomereâ sequence. Spacers shown in FIG. 18B are SEQ ID NO: 8.
The inventors have developed viral vectors and virions that harbor their own protection against host immune and inflammatory systems. These vectors and virions carry short nucleic acid sequences which inhibit the activation of toll-like receptor 9 (TLR9), a host protein which activates inflammatory and immune responses in mammalian cells.
A short nucleotide sequence for inhibition of TLR9 may be of any origin. It can be bacterial, human, synthetic, or from other sources. One particular sequence is the 20 nucleotide long âc41â [TGGCGCGCACCCACGGCCTG (SEQ ID NO: 1)] from Pseudomonas aeruginosa. Another particular sequence is from human telomeres and comprises (TTAGGG)4 (SEQ ID NO:6). Other inhibitory sequences are shown in SEQ ID NO: 2-5, 7, 9, and 16-24. Inhibitory sequences may also be used which share at least 80% homology/identity with these sequences. Inhibitory sequences may also be used which share at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, and/or at least 99% homology/identity with these sequences. Multiple copies of the inhibitory sequence can be used, either in tandem arrays or separated in the viral vector by spacer or linker sequences or other portions of the viral genome. In some embodiments one, two, three, four, five, six, seven, eight, nine, ten, fifteen, or twenty copies are used. In some embodiments one or more copies of the inhibitory sequence are on the plus strand and some on the minus strand of the virus genome.
The inhibitory oligonucleotide sequences are introduced into host cells as part of the viral genome or virion, rather than as a separate agent. This renders the effect of the oligonucleotide sequences local rather than systemic. Moreover, the immune evasion is transient as it occurs during AAV or other virus entry, unlike immune suppression with drugs which can last for weeks. Additionally, it ensures that the beneficial antagonist activity is where it needs to beâwith the virus or viral genome. If the virus or viral genome is not replicated in the host cell, then the effect of the oligonucleotide will be transient. If the virus or viral genome is replicated, the effect will be coextensive with the replication.
An inhibitory nucleic acid sequence may be inserted into a viral genome using any means of recombinant DNA engineering. This may involve in vitro or in vivo recombination. In vitro recombination may be accomplished using a DNA ligase or other nucleic acid joining enzyme, for example. In vivo recombination may be accomplished by co-transforming a host cell with separate donor molecules that share homology by which they will recombine using host cell machinery. Alternatively, a single donor molecule may recombine in vivo with a host cell sequence. Combinations of these approaches may also be used. Typically the insertion will involve a standard linkage of one deoxyribonucleotide to another (a phosphodiester bond). However, there may be circumstances in which non-standard linkages will be used between the inhibitory nucleic acid sequence and the rest of the viral genome. Optionally, the inhibitory nucleic acid sequence is located in an untranslated region of the viral genome.
The genome may optionally contain a therapeutic gene and/or a marker gene. Typically this gene will be a non-viral gene, or a gene that is not naturally present in the viral genome. The gene may be expressible in a mammalian host cell or animal. Expression may be under the control of a viral promoter or a promoter that is introduced with the gene. Expression may be inducible, repressible, condition-responsive, or constitutive, as examples. A therapeutic gene is one which encodes an RNA or protein product beneficial to the host. The benefit may be, for example, to improve health, protect against infection, or remedy a deficiency. The marker may enable one to track the location, the level of replication, the level of propagation, the level of transcription, or the level of translation of the virus or its products or components. Suitable markers include those which are readily detectable, such as fluorescent proteins, chromogenic proteins, etc. Optionally, a second agent may be used or added for detection of the marker protein or for development of a detectable substance. Introduced genes may be human or non-human, heterologous (from another species) or homologous (from same species) or endogenous (from the same subject).
Any DNA viral genome can be used, whether single stranded or double stranded. Examples of suitable viruses which may be used, include without limitation, wild-type or variants of adeno-associated virus (AAV), adenovirus, herpes simplex virus, varicella, variola virus, hepatitis B, cytomegalovirus, JC polyomavirus, BK polyomavirus, monkeypox virus, Herpes Zoster, Epstein-Barr virus, human herpes virus 7, Kaposi's sarcoma-associated herpesvirus, human parvovirus B19, and enterovirus. The virus may be, without limitation, cytotoxic, cytolytic, or cause latent infections. Viral vectors in which viral genomes have been modified may also be used. As an example, a genome that is modified to encode fewer viral proteins may be used. As a further example, a viral genome that is modified to encode no viral proteins may be used. Viral genomes may include, by way of non-limiting example, inverted terminal repeats and/or other non-coding genetic elements that facilitate packaging of engineered viral genomes into the capsid.
Viral genomes may be delivered to a mammalian host cell as naked DNA, in a liposome, complexed to a polymer, in a condensed or compacted state, in a gold particle, in a virion, or any other means that is suitable for the application. Typically a complete viral genome will be administered, but in some situations, it may be desirable to use a partial genome. The partial genome may be complemented by helper functions provided by the host cell or another genomic or viral entity. Partial genomes may be used, for example, if the therapeutic payload is large and some essential viral functions must be omitted to package.
Recombinant viruses may be administered to a mammal or mammalian cells according to any route which is effective for the purpose. The administration may be systemic, e.g., via the blood. It may be delivered orally, subcutaneously, topically, bucally, anally, intramuscularly, intravenously, intratumorally, intracranially, intrathecally, subretinally, etc. Any suitable carrier or vehicle may also be used for administration. It may be desirable to pre-treat the cells or mammal to render them more permeable to or receptive to the recombinant virus. A mammal âin need ofâ a recombinant virus may be one for whom the virus will be beneficial. It may be a mammal with a disease or deficiency. It may be one for whom a diagnosis or analysis will be made. It may be one who can benefit from the administered recombinant virus, even though it does not have a disease or deficiency.
Taken together, our results show that incorporation of c41 or human telomeric sequences into the AAV genome (a) does not lower viral packaging and infectivity, (b) prevents TLR9-mediated inflammation, (c) reduces induction of pro-inflammatory cytokines, and (d) increases transgene expression. The increased transgene expression may be due to a reduced immune response, as TLR9 activation also induces interferon expression, which triggers an antiviral state. The engineered immune-evasion property we show below is specific (against TLR9), transient (e.g., may occur during viral entry), and does not result in systemic immune suppression (only targets AAV-infected immune cells).
The inhibitory nucleic acid sequences we used, as well as others known in the art, may be incorporated into other viruses that, like AAV, have potential utility for humans and other mammals but elicit inflammatory/immune responses that may be undesirable. For example, oncolytic viruses that preferentially infect and lyse cancer cells are used to kill or shrink tumors. These viruses are replicative (unlike AAV vectors used for gene therapy) so they can release new virions to shrink the remaining tumor. Examples include wild-type or variants of herpes simplex virus, adenovirus, and enterovirus. Some reports have shown that immunosuppression by chemotherapy can enhance oncolytic virus therapy, as the immune system normally attempts to inactivate the oncolytic virus, which would prevent it from infecting cancer cells. Therefore, it is possible that incorporating inhibitory oligonucleotides in the genomes of oncolytic viruses like herpes simplex virus may allow it to evade immune clearance and persist longer for oncolysis.
The above disclosure generally describes the present invention. All references disclosed herein are expressly incorporated by reference. A more complete understanding can be obtained by reference to the following specific examples which are provided herein for purposes of illustration only, and are not intended to limit the scope of the invention. The disclosure of the invention includes all embodiments explicitly recited in the claims. Additionally, all features disclosed in the dependent claims apply equally to the independent claim from which they are based as to the other independent claims. Thus such combinations of dependent claims with other independent claims are expressly contemplated and disclosed.
To engineer an AAV vector that has the ability to specifically evade TLR9 activation in immune cells, we inserted two copies of c41 separated by a 5-nucleotide-long spacer (AAAAA; SEQ ID NO: 8) into the 3Ⲡuntranslated region of AAV vector encoding enhanced green fluorescent protein (eGFP) (FIG. 3B). Subsequently, we produced wild-type AAV-eGFP virus and AAV-eGFP-c41 virus (harboring two c41 insertions). Infectious titers of both viruses were comparable (Ë109 infectious units/ml, as determined by titering on HeLa cells), suggesting that addition of c41 into the viral genome did not hamper viral packaging and infectivity, an important consideration for viral vectors that have to be mass-produced for gene therapy.
To measure the inflammatory response, we used HEK293 cells stably expressing TLR9 (HEK293 TLR9 cells), which senses AAV DNA genomes, and also expressing alkaline phosphatase under the transcriptional control of NF-kB. When NF-kB is activated, which indicates inflammation, alkaline phosphatase is secreted into the media and acts on a provided substrate, leading to a change in color of the media that can be measured on a plate reader. We mock-infected HEK293 TLR9 cells or infected them with either AAV-eGFP or AAV-eGFP-c41. In agreement with the literature, AAV-eGFP infection induced a small but statistically significant increase in NF-kB activity (FIG. 4). In contrast, AAV-eGFP-c41 infection was not significantly different compared to mock-infected cells, indicating that the virus was able to evade eliciting an inflammatory response.
We analyzed the above three conditions (described in FIG. 4) for eGFP expression using flow cytometry. We found that AAV-eGFP-c41 transduced more cells than AAV-eGFP (52.7% GFP+ compared to 34.6% GFP+) (FIG. 5). In addition, GFP+ cells from AAV-eGFP-c41 infection expressed âtwice as much eGFP as GFP+ cells from AAV-eGFP infection (mean fluorescence intensity [MFI] of 5335 compared to 2749).
In summary, we engineered an AAV vector to evade TLR9-mediated inflammation by incorporating an inhibitory oligonucleotide in the viral genome.
We inserted three copies of âtelomere,â a sequence derived from mammalian telomeres that contains the suppressive (TTAGGG)4 motif (SEQ ID NO: 6), which has been shown to block TLR9 signaling (FIG. 6A and FIG. 6B). AAV-eGFP-telomere virus yielded similar viral titers as AAV-eGFP and AAV-eGFP-c41 when titered on HeLa cells, demonstrating that incorporation of âtelomereâ does not hinder viral packaging and infectivity.
When we infected a B cell line with similar amounts of AAV-eGFP or AAV-eGFP-c41 or AAV-eGFP-telomere virus, both AAV-eGFP-c41 and AAV-eGFP-telomere viruses transduced more cells than AAV-eGFP (FIG. 7A). This finding suggests too that incorporation of inhibitory sequences in the genome of AAV increases transgene expression.
Subsequently, we harvested primary human CD14+ monocytes from blood and subjected them to similar infection conditions as above. We performed ELISA on the supernatant to analyze TNF production, as TNF is a prototypical pro-inflammatory cytokine induced by NF-kB activation. AAV-eGFP infection increased TNF production compared to mock-infection, while AAV-eGFP-c41 and AAV-eGFP-telomere infections showed no or little increase in TNF production (FIGS. 7A-7B), showing that the two viruses were able to evade eliciting inflammatory responses.
Investigators often use short inhibitory oligonucleotides (typically 10-30 nucleotides in length) to antagonize TLR9 signaling in cell culture. However, it is unknown if these inhibitory oligonucleotides retain functionality in the context of a much larger viral genome (i.e., the sequence is covalently linked on both ends to much longer sequences). To test this possibility, we utilized a self-complementary (sc) AAV vector encoding enhanced green fluorescent protein (eGFP), and inserted 3 copies of âc41â or âtelomereâ, derived from bacteria and mammalian telomeres respectively [52, 57, 58, 61], into a plasmid harboring the vector genome (FIGS. 8A and 8B). We started with sc AAV vectors as they have been shown to be more efficient at triggering TLR9 activation and inducing more inflammation in the mouse liver than single-stranded (ss) AAV vectors. As âc41â and âtelomereâ are predicted to have strong secondary structure, we used an AAAAA linker between copies of the inhibitory oligonucleotide. In addition, 3xc41 and 3x telomere sequences were placed after the polyA sequence and upstream of the right inverted terminal repeat (ITR) so they would be present in the DNA genome during viral entry, but would be absent from subsequent mRNA transcripts upon successful transduction (âscAAV-eGFP-3xc41â and âscAAV-eGFP-3x telomereâ). Finally, to determine if the location of inhibitory oligonucleotide in the viral genome matters, we also created a vector where 3x telomere was located between the left ITR and the promoter (âscAAV-3x telomere-eGFPâ).
We packaged the various AAV vectors into AAV2 serotype and infected primary human monocyte-derived macrophages at a multiplicity of infection (MOI) of 105 viral genomes (vg) per cell. As expected, we found that scAAV-eGFP infection of macrophages elicited robust induction of TNF in the supernatant, a prototypical inflammatory cytokine with well-described roles in stimulating fever, apoptosis and inflammation, and is produced upon TLR9 signaling and NF-kB activation (FIG. 9A). In contrast, both scAAV-eGFP-3x41 and scAAV-eGFP-3x telomere markedly decreased TNF induction by >95%, indicating that incorporation of âc41â or âtelomereâ in these viruses could evade eliciting inflammatory responses compared to the wild-type (WT) vector. Furthermore, scAAV-3x telomere-eGFP was also able to prevent TNF induction by >95%, demonstrating that the inserted inhibitory oligonucleotides can be placed in other parts of the viral genome and retain the ability to block inflammation. Mock infection with phosphate-buffered saline (PBS) and treatment with ODN 2006, a commercially available CpG-containing oligonucleotide that is known to strongly activate TLR9/NF-kB and inflammation, served as negative and positive controls respectively. We tested primary human CD14+ monocytes and found that again, scAAV-eGFP triggered robust TNF induction while scAAV-eGFP-3xc41 and scAAV-eGFP-3x telomere negated most of the TNF induction (FIG. 9B). scAAV-3x telomere-eGFP likewise reduced TNF induction, although inhibition was Ë85%, which may be due to differences between cell types or donor tissue. The evasion of TNF induction was also reproduced in primary CD14+ monocytes obtained from another donor (FIG. 9C).
As further characterization, we inserted 3 copies of âcontrol,â a random sequence that does not block TLR9, or 1 copy of âtelomereâ, into a plasmid harboring the vector genome (FIG. 10A, FIG. 10B). We picked the sequence âcontrolâ as it has been used as a negative control oligonucleotide in TLR9 experiments. We found that scAAV-eGFP-1x telomere was able to reduce TNF induction compared to scAAV-eGFP in human macrophages, but not as efficiently as scAAV-eGFP-3x telomere (FIG. 10C). This indicates that 1 copy of telomere can reduce inflammation. We also observed that scAAV-eGFP-3xcontrol elicited TNF secretion as efficiently as scAAV-eGFP in human monocytes, suggesting that insertion of sequences that inhibit TLR9 are required to block inflammation (FIG. 10D).
As AAV vectors are considered biologics and may exhibit lot-to-lot variability, we produced another batch of both scAAV-eGFP and scAAV-eGFP-3x telomere AAV2 viruses, and found that scAAV-eGFP-3x telomere was able to reduce â75% of TNF induction compared to the WT vector (FIG. 11A). Based on the multiple viral preps and donor monocytes and macrophages (FIGS. 9A-9C, FIGS. 10A-10E and FIGS. 11A-11B), we conclude that our engineered vectors containing 3 copies of âc41â or âtelomereâ reduce TNF induction by approximately 75-98% compared to the WT vector. On average, scAAV-eGFP-3x telomere reduced Ë85% of TNF induction compared to scAAV-eGFP. Importantly, we did not observe differences in viral titers (assayed by qPCR for viral genomes) obtained from producing any of the above AAV2 vectors, suggesting that the engineered vectors are not defective in packaging (data not shown). Furthermore, when we infected HeLa cells, a permissive cell line widely used to titer AAV infectivity, with a range of MOIs of scAAV-eGFP and scAAV-eGFP-3x telomere, we did not observe differences in transduction (% GFP+ cells) over 4 logs of viral titers, demonstrating that the engineered vector is equally competent at transducing cells (FIG. 11B).
Intravenous delivery of AAV is often used to transduce hepatocytes for gene therapy. Previous work has shown that upon intravenous administration of AAV, Kupffer cells (resident hepatic antigen-presenting cells) in the liver of mice are capable of sensing sc AAV genomes and triggering inflammatory and innate immune responses 1-9 h later [36]. These responses include induction of proinflammatory cytokines such as TNF and IL6 and type I interferons such as IFN-β. TLR9â/â mice do not exhibit these inflammatory and innate immune responses in the liver, demonstrating a central role for TLR9 in vivo as an innate immune sensor. In addition, immune cells such as neutrophils, macrophages and natural killer (NK) cells infiltrate the liver 2 h after AAV administration. To determine if our engineered vectors can reduce inflammation in the liver in vivo, we administered PBS or equal amounts of scAAV-eGFP or scAAV-eGFP-3x telomere via tail vein injection. We selected scAAV-eGFP-3x telomere for in vivo characterization as âtelomereâ is derived from human sequences and might be preferable for clinical use. In agreement with previous work, scAAV-eGFP stimulated increased Tnf and 116 expression in the liver (approximately 3 to 10 fold, compared to saline), indicating inflammation (FIG. 12A). In contrast, scAAV-eGFP-3x telomere showed little to no increase in inflammatory markers. We tested more mice in subsequent experiments and found that scAAV-eGFP stimulated statistically significant Tnf induction in the liver compared to saline, while scAAV-eGFP-3x telomere and scAAV-eGFP-3xc41 did not (FIGS. 12B and 12C), demonstrating their ability to evade eliciting inflammation in the liver. Finally, we confirmed that scAAV-eGFP-3xcontrol is not able to prevent inflammation in the liver compared to scAAV-eGFP (FIG. 10E).
Next, we engineered a single-stranded AAV vector, ssAAV-eGFP, by inserting 5 copies of âtelomereâ with AAAAA linkers, followed by another 5 copies but in anti-sense orientation, into the plasmid, giving ssAAV-eGFP-5x telomere (FIG. 13). Since both positive and negative strands of the viral genome are equally likely to be packaged into a viral particle, this ensures that each packaged viral genome would have 5 copies of âtelomereâ in the correct orientation. Two AAV8 viruses were produced and purified. Again, we did not observe differences in titers between the two vectors, suggesting similar packaging efficiency (data not shown). ssAAV-eGFP was selected as it has been previously used for subretinal injections in mice and efficiently transduces photoreceptors in the eye [62].
Several studies have suggested that AAV gene therapy in the eye and brain appears to be generally safe [63]. While the eye is often assumed to be an immune-privileged site, it is known to harbor microglia, resident macrophages of the central nervous system which have been reported to express TLR9 and respond to CpG motifs [64-67]. A recent study delivering AAV vectors by subretinal injection in cynomolgus macaques reported dose-related anterior and posterior segment inflammation in the animals, and a macaque was euthanized prematurely due to severe ocular inflammation [68]. Furthermore, vitreous aspirate from the euthanized animal demonstrated the presence of neutrophils and macrophages. Another study utilizing canine models similarly observed anterior and posterior uvetitis upon subretinal injection of AAV vectors, and 3 of 17 eyes developed a multifocal chorioretinitis, which was likewise associated with higher vector doses [69]. These findings strongly suggest that AAV vectors are subject to innate immune surveillance in the eye and can trigger deleterious inflammatory and immune responses.
Saline or similar amounts of ssAAV-eGFP or ss-AAV-eGFP-5x telomere were delivered via subretinal injection into neonates eyes and measured the expression of inflammatory and immune genes. The three mice that received saline injections were uniformly low for Tnf expression in the retina and were set to 1 fold expression (FIG. 14A). In contrast, of the five mice that received ssAAV-eGFP, two exhibited mild upregulation of Tnf (1.9 fold and 8.3 fold), while three animals demonstrated large induction of Tnf (62.2 fold, 534 fold, and 1003 fold), with a mean of 321 fold for the five animals. This finding indicates that while there is variability in inflammation, some animals mount a very strong inflammatory response in the retina upon ssAAV-eGFP subretinal injection. The variability may be due to differences in each injection procedure or the immune status of each animal. Strikingly, the five animals receiving ssAAV-eGFP-5x telomere had a mean Tnf induction of 5.6 fold with much less variability, suggesting that ssAAV-eGFP-5x telomere was able to avoid eliciting strong inflammation. Similar results were observed in the rest of the eyecup but at a lower magnitude, indicating inflammation was not restricted to the retina (FIG. 14B). We also measured Ifng expression in the retina, a type II interferon critical for antiviral immune responses [70], and observed a similar pattern (FIG. 14C). Prior studies have suggested that subretinal injection of AAV may trigger immune cell infiltration in the eye. Therefore, we also analyzed expression of genes that are known to be expressed specifically in different types of immune cells. We found 18.2 fold higher expression of AO (encoding Ibal, a specific marker for microglia [71, 72]) in ssAAV-eGFP injections compared to saline, suggesting microglia proliferation and/or activation in the retina (FIG. 15A). In contrast, ssAAV-eGFP-5x telomere only showed 1.9 fold induction of AO expression. In addition, we found 45.8 fold and 41.8 fold induction of Cd4 and Cd8a, markers of CD4+ helper T cells and CD8+ cytolytic T cells respectively, by ssAAV-eGFP, while ssAAV-eGFP-5x telomere only showed 1.5 fold and 3.4 fold induction (FIGS. 15B and 15C). Again, there was considerable variability among mice treated with ssAAV-eGFP with a subset of animals showing robust induction. These results demonstrate that subretinal injection of ssAAV-eGFP administration can stimulate T cells infiltration in the retina, while ssAAV-eGFP-5x telomere strongly diminishes it. Taken together, our data indicate that while ssAAV-eGFP induces robust inflammatory and immune responses in the retina and the surrounding tissue, and significant variability is observed, ssAAV-eGFP-5x telomere is capable of mitigating a large portion of these responses.
Given the marked differences in inflammation both in vitro and in vivo, we sought to determine if there are any differences in long-term gene expression. We examined flat-mounted eye cups at P30, 29 d after subretinal injection of the mice, and found that more cells were GFP+ and GFP expression was stronger in ssAAV-eGFP-5x telomere treated eyes compared to ssAAV-eGFP, suggesting enhanced gene expression (FIG. 16). Thus, the engineered vector is able to reduce inflammatory and immune responses in the retina and also augment transgene expression.
C57BL/6 mice (male, 7-9 weeks old) were purchased from the Jackson Laboratory and CD1 mice were purchased from Charles River Laboratories.
Self-complementary (sc) or single-stranded (ss) AAV vectors were used in this study. Self-complementary vectors lack the terminal resolution sequence in one ITR. All vector genomes were flanked by AAV2 ITRs. scAAV-eGFP was purchased from Cell Biolabs (VPK-430) and has been previously described [73]. scAAV-eGFP expressed enhanced green fluorescent protein (eGFP) from the cytomegalovirus (CMV) promoter, and included an SV40 intron and SV40 polyA sequence. ssAAV-eGFP has been previously described and was originally obtained from the Harvard DF/HCC DNA Resource Core (clone ID: EvN000061595). ssAAV-eGFP contained a CMV enhancer/promoter, human (3-globin intron, eGFP, and (3-globin polyA sequence. The sequences of âc41â (5â˛-TGGCGCGCACCCACGGCCTG-3â˛; SEQ ID NO: 1) derived from Pseudomonas aeruginosa and âtelomereâ (5â˛-TTTAGGGTTAGGGTTAGGGTTAGGG-3â˛; SEQ ID NO: 9; initial T nucleotide is optional for function) derived from mammalian telomeres have been described [52, 57, 58, 61]. A widely used âtelomereâ oligonucleotide (manufactured by Invivogen, catalog code âtlrl-ttagâ) harbored an additional T (in bold) compared to published studies and thus was included in the sequence. During the course of this study, Invivogen removed the additional T in their manufactured âtelomereâ oligonucleotide (catalog code âtlrl-ttag151â). In addition, âcontrolâ (5â˛-GCTAGATGTTAGCGT-3â˛; SEQ ID NO: 34) was used as a negative control sequence that does not inhibit TLR9 activation (Invivogen, catalog code ât1r1-2088câ).
To engineer scAAV-eGFP, sequences were inserted into the unique SpeI site found immediately 5Ⲡof the right ITR. To facilitate sub-cloning, a unique ClaI site was created immediately 5Ⲡof the inserted sequences, thus allowing ClaI/SpeI sub-cloning of sequences. 3 copies of âc41,â âtelomere,â or âcontrolâ were inserted, separated by AAAAA linkers, giving scAAV-eGFP-3xc41, scAAV-eGFP-3x telomere and scAAV-eGFP-3x control, respectively. Alternatively, one copy of âtelomereâ was inserted, with an AAAAA linker (SEQ ID NO: 8), giving scAAV-eGFP-lx telomere. We also inserted 3x telomere between the left ITR and CMV promoter using the unique AvrII site, giving scAAV-3x telomere-eGFP.
To engineer ssAAV-eGFP, Kpnl-5x telomere(sense)-5x telomere(anti-sense)-NheI was inserted immediately 5Ⲡof the Xbal site adjacent to the right ITR. Again, AAAAA was used as a linker between copies of âtelomereâ. Both sense and anti-sense sequences of âtelomereâ were added as single-stranded AAV vectors have an equal chance of packaging positive or negative strands of the viral genome, thus ensuring that all packaged AAV genomes will carry 5 copies of âtelomereâ in the right orientation.
Self-complementary vectors were packaged into AAV2 (Vigene Biosciences) by triple transfection of HEK293 cells and purified using iodixanol gradient ultracentrifugation and then concentrated to 500 ul using Amicon Ultra-15 columns in PBS. The purified viruses were titered by qPCR using primers derived from ITR and an AAV standard. The final yield of the viruses ranged from 0.5â3Ă1013 vg.
Single-stranded vectors were packaged into AAV8 based on previously described protocols [74, 75]. Briefly, AAV vector, rep2-cap8 packaging plasmid and adenoviral helper plasmid were transfected into HEK293T cells with polyethylenimine and supernatant was collected 72 h after transfection. AAV8 viruses were precipitated with 8.5% w/v PEG8000 and 0.4M NaCl and centrifuged at 7000 g. The pellet was resuspended in lysis buffer (150 mM NaCl and 20 mM Tris, pH 8.0) and MgCl2 was added to a final concentration of 1 mM. The resuspended viruses were incubated with 25U/ml Benzonase (Sigma) at 37° C. for 15 min and run on an iodixanol gradient. Recovered AAV vectors were washed 3 times with PBS using Amicon 100K columns (EMD Millipore) and concentrated to 100-500 ul of PBS. Protein gels were run to determine virus titers, using serial dilutions of previous AAV standards for comparison.
Human peripheral blood mononuclear cells (PBMCs) from unidentified healthy donors were purchased (ZenBio). This study was done in accordance with the ethical guidelines of Harvard Medical School. CD14+ monocytes were positively selected from PBMCs using anti-CD14 magnetic microbeads according to the manufacturer's instructions (Miltenyi Biotec) or purchased from Stemcell Technologies. To obtain monocyte-derived macrophages, monocytes were cultured with 50 ng/ml of recombinant human macrophage colony stimulation factor (rhM-CSF, purchased from Peprotech) for 5 to 6 d to allow differentiation into macrophages. Monocytes and macrophages were either used fresh or cryopreserved for subsequent studies.
1Ă105 monocytes or macrophages were seeded in 190 ul of RPMI growth media per well in 96 well round bottom plates or 96 well flat bottom plates respectively, and infected with 10 ul AAV2 viruses at indicated MOIs in PBS. Mock infection (addition of 10 ul PBS) and ODN 2006 (final concentration of 5 uM, Invivogen), a CpG-containing oligonucleotide known to activate TLR9 and trigger inflammation, served as negative and positive controls. 18 h after infection, supernatants were collected and clarified by low speed centrifugation, followed by ELISA for human TNF (Thermo Scientific).
HeLa cells are highly permissive for AAV2 vectors and are commonly used to determine the transducing titer of AAV2 vector preparations [76]. Briefly, HeLa cells were seeded overnight in 12 wells and were approximately 80% confluent at time of infection (Ë3Ă105 cells). Cells were infected with serial ten-fold dilutions of viruses at indicated MOIs and incubated for 48 h before fixing with 1% paraformaldehyde in PBS and followed by flow cytometry analysis for GFP+ cells. PBS mock-infected cells were used to determine GFP+ signal.
Adult C57BL/6 mice were injected intravenously with 100 ul PBS or AAV2 viruses (1011 vg per animal) by tail vein injection as previously described [36]. 2 h later, the animals were sacrificed and a portion of the right median lobe of the liver was saved in RNAlater solution (Thermo Scientific). Total RNA was extracted from 10-30 mg of mechanically disrupted liver sample by using an RNA extraction kit (OMEGA Bio-Tek). Similar amounts of RNA were reverse transcribed into cDNA with a high-capacity RNA-to-cDNA kit (Thermo Scientific) and similar amounts of cDNA were assayed with quantitative PCR (qPCR) using TaqMan Fast Advanced Master Mix (Thermo Scientific) and commercially available pre-designed primers/probes with FAM reporter dye for the indicated target genes (IDT). Expression level for each gene was calculated by normalizing against the housekeeping genes Actb or Gapdh using the MET method and expressed as fold levels compared to saline-injected mice. All qPCR reactions were run on a realplex4 Mastercycle (Eppendorf).
Subretinal injection into postnatal day 1 (P1) CD1 neonate eyes were performed as previously described [74, 5]. Approximately 0.2 ul AAV8 virus (1.8Ă108 vg per eye) was introduced into the subretinal space using a pulled angled glass pipette controlled by a FemtoJet (Eppendorf). At P21, animals were sacrificed and the eyecup was dissected out. The retina and the rest of the eyecup were subjected to RNA extraction, reverse transcription, and qPCR as described in the liver studies. To visualize GFP expression by histology, eyes were excised at P30, fixed in 4% paraformaldehyde for 2 h, and washed in PBS 3 times. Eye cups were dissected out by removing the cornea, lens, iris, vitreous body and peripheral muscles. Images of flat-mounted eye cups were taken using a x10 objective on a Keyence BZ-x700 microscope. Images used for comparison between groups were taken at the same imaging settings in the same imaging session.
Unpaired two-tailed Student's t-tests were used to compare differences between two unpaired experimental groups in all cases. A P value of <0.05 was considered statistically significant. No pre-specified effect size was assumed and in general three to five replicates for each condition was used.
1. A nucleic acid molecule comprising:
a viral genome covalently linked to an inhibitory nucleic acid sequence which binds to TLR9 but does not trigger TLR9 activation; or
an inverted terminal repeat and a nucleic acid sequence that inhibits TLR9-mediated inflammation.
2. A recombinant virus for delivery of a desired function to a mammalian cell, comprising:
the nucleic acid molecule of claim 1.
3.-44. (canceled)
45. A method of treating a mammal, comprising:
administering the recombinant virus of claim 2 to a mammal in need thereof.
46.-58. (canceled)
59. A method of making a viral genome of a recombinant virus, comprising:
inserting an inhibitory nucleic acid sequence into a viral genome, wherein the inhibitory nucleic acid sequence binds to TLR9 but does not trigger TLR9 activation; or
inserting a nucleic acid sequence into a viral genome, wherein the nucleic acid sequence inhibits TLR9-mediated inflammation.
60.-80. (canceled)
81. A method of increasing expression in a host cell of a virally introduced transgene, the method comprising introducing into a host the recombinant virus of claim 2, whereby the modified virus results in higher transgene expression in a host cell as compared to a virus that does not contain the nucleic acid sequence.
82. A composition comprising a viral capsid encapsidating the nucleic acid molecule of claim 1.
83.-90. (canceled)
91. A method of reducing an inflammatory response in a subject in need thereof, the method comprising:
administering to the subject a recombinant adeno-associated virus (AAV) comprising a viral genome, wherein the viral genome comprises a therapeutic transgene and a nucleic acid molecule comprising three tandem repeat monomers of SEQ ID NO: 6 or SEQ ID NO: 9, thereby reducing an inflammatory response in the subject, relative to a control.
92. The method of claim 91, wherein the AAV is a self-complementary AAV (scAAV).
93. The method of claim 91, wherein the AAV is an AAV2 or AAV8.
94. The method of claim 91, wherein the viral genome further comprises a 5Ⲡuntranslated region, and wherein the nucleic acid molecule is in the 5Ⲡuntranslated region.
95. The method of claim 91, wherein the viral genome further comprises a 3Ⲡuntranslated region, and wherein the nucleic acid molecule is in the 3Ⲡuntranslated region.
96. The method of claim 91, wherein the therapeutic gene is a human gene.
97. The method of claim 91, wherein the recombinant scAAV is administered systemically the subject.
98. The method of claim 91, wherein the recombinant scAAV is administered subretinally to the subject.
99. The method of claim 91, wherein the recombinant AAV is administered in an amount effective to prevent TLR-mediated inflammation in the subject.
100. The method of claim 91, wherein the recombinant AAV is administered in an amount effective to reduce induction of pro-inflammatory cytokines in the subject, relative to a control.
101. The method of claim 91, wherein the recombinant AAV is administered in an amount effective to increase expression of the therapeutic transgene in the subject, relative to a control.