Patent application title:

Vascular therapeutics

Publication number:

US20050222065A1

Publication date:
Application number:

10/950,013

Filed date:

2004-09-23

Abstract:

The present invention provides a method of preventing or reducing restenosis, neointima formation, graft failure, atherosclerosis, angiogenesis and/or solid tumour growth in a subject. The method comprises administering to the subject a prophylactically effective dose of a nucleic acid which decreases the level of c-Jun mRNA, c-Jun mRNA translation or nuclear accumulation or activity of c-Jun. It is preferred that the nucleic acid is a DNAzyme that targets c-Jun mRNA.

Inventors:

Interested in similar patents?

Get notified when new applications in this technology area are published.

Classification:

C07H21/04 »  CPC main

Compounds containing two or more mononucleotide units having separate phosphate or polyphosphate groups linked by saccharide radicals of nucleoside groups, e.g. nucleic acids with deoxyribosyl as saccharide radical

A61K31/7088 »  CPC further

Medicinal preparations containing organic active ingredients; Carbohydrates; Sugars; Derivatives thereof Compounds having three or more nucleosides or nucleotides

A61P9/00 »  CPC further

Drugs for disorders of the cardiovascular system

A61P9/10 »  CPC further

Drugs for disorders of the cardiovascular system for treating ischaemic or atherosclerotic diseases, e.g. antianginal drugs, coronary vasodilators, drugs for myocardial infarction, retinopathy, cerebrovascula insufficiency, renal arteriosclerosis

A61P27/02 »  CPC further

Drugs for disorders of the senses Ophthalmic agents

A61P35/00 »  CPC further

Antineoplastic agents

A61P37/06 »  CPC further

Drugs for immunological or allergic disorders; Immunomodulators Immunosuppressants, e.g. drugs for graft rejection

A61P43/00 »  CPC further

Drugs for specific purposes, not provided for in groups -

C12N15/1135 »  CPC further

Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor; Recombinant DNA-technology; DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides against oncogenes or tumor suppressor genes

C12N2310/11 »  CPC further

Structure or type of the nucleic acid; Type of nucleic acid Antisense

C12N2310/12 »  CPC further

Structure or type of the nucleic acid; Type of nucleic acid catalytic nucleic acids, e.g. ribozymes

C12N2310/14 »  CPC further

Structure or type of the nucleic acid; Type of nucleic acid interfering N.A.

C12N2310/317 »  CPC further

Structure or type of the nucleic acid; Chemical structure of the backbone with an inverted bond, e.g. a cap structure

C12N2310/341 »  CPC further

Structure or type of the nucleic acid; Chemical structure; Spatial arrangement of the modifications Gapmers, i.e. of the type ===---===

Description

FIELD OF THE INVENTION

The present invention relates to methods and compositions for reducing or preventing c-Jun mediated cellular processes. In particular, the present invention relates to methods of reducing or preventing neointima formation, atherosclerosis, restenosis, graft failure or angiogenesis involving the use of DNAzymes.

BACKGROUND OF THE INVENTION

The initiating event in the pathogenesis of atherosclerosis and restenosis following angioplasty is injury to cells in the artery wall1. Injury or stress stimulates signalling and transcriptional pathways in vascular smooth muscle cells, stimulating their migration and proliferation and the eventual formation of a neointima. Smooth muscle cell proliferation is a key feature of neointima formation, atherosclerosis, restenosis and graft failure.

c-Jun, a prototypical member of the basic region-leucine zipper protein family, is transiently induced following arterial injury in animal models2,3. c-Jun forms both homodimers and heterodimers with other bZIP proteins to form the AP-1 transcription factor. While investigations over the last decade have linked AP-1 with proliferation, tumorigenesis and apoptosis, AP-1 has also been implicated in tumor suppression and cell differentiation4. Thus, gene-targeting strategies that down-regulate c-Jun expression do not necessarily inhibit cell proliferation.

Kanatani et al, (1996)5 have shown that antisense oligonuclecotides targeting c-Jun dose-dependently reduce the growth-inhibitory effect of dexamethasone and TGFβ. Recent reports indicate that c-Jun NH2-terminal kinase/stress activated protein kinase (JNK), an upstream activator of c-Jun and numerous other transcription factors, is expressed by SMCs in human and rabbit atherosclerotic plaques6,7 and that dominant negative JNK inhibits neointima formation after balloon injury8. c-Jun, however, has not been localised in human atherosclerotic lesions, nor has it been shown to play a functional role in arterial repair after injury

It is clear, however, that the finding that c-Jun, or any other given gene, is inducibly expressed in the artery wall following balloon angioplasty does not necessarily translate to it playing a positive regulatory role in transcription, proliferation or neointima formation. For example, it has been shown that three transcriptional repressors (NAB2, GCF2, and YY1) are activated in vascular smooth muscle cells by mechanical injury in vitro, as well as in the rat artery wall. NAB2 directly binds the zinc finger transcription factor Egr-1 and represses Egr-1-mediated transcription9. GCF2 is a potent repressor of the expression of PDGF-A, a well-established mitogen for vascular smooth muscle cells, and inhibits smooth muscle cell proliferation10. Similarly, YY1 overexpression blocks smooth muscle cell growth without affecting endothelial cell proliferation11.

c-Jun can repress, as well as activate transcription. c-Jun binds the corepressor TG-interacting factor (TGIF) to suppress Smad2 transcriptional activity12. c-Jun also blocks transforming growth factor beta-mediated transcription by repressing the transcriptional activity of Smad313.

c-Jun can inhibit, as well as stimulate proliferation. Using antisense oligonucleotides to c-Jun, Kanatani and colleagues demonstrated that inhibition of human monocytoid leukemia cell growth by TGF-beta and dexamethasone is mediated by enhanced c-Jun expression5.

c-Jun, however, has not been directly linked to the complex process of angiogenesis, which underlies many common human diseases including solid tumor growth and corneal disease. Angiogenesis is a complex multi-step process involving proteolytic degradation of the basement membrane and surrounding extracellular matrix, microvascular endothelial cell proliferation, migration, tube formation and structural re-organisation14.

DNAzymes

In human gene therapy, antisense nucleic acid technology has been one of the major tools of choice to inactivate genes whose expression causes disease and is thus undesirable. The anti-sense approach employs a nucleic acid molecule that is complementary to, and thereby hybridizes with, an mRNA molecule encoding an undesirable gene. Such hybridization leads to the inhibition of gene expression by mechanisms including nucleolytic degradation or steric blockade of the translational machinery.

Anti-sense technology suffers from certain drawbacks. Anti-sense hybridization results in the formation of a DNA/target mRNA heteroduplex. This heteroduplex serves as a substrate for RNAsc H-mediated degradation of the target mRNA component. Here, the DNA anti-sense molecule serves in a passive manner, in that it merely facilitates the required cleavage by endogenous RNAse H enzyme. This dependence on RNAse H confers limitations on the design of anti-sense molecules regarding their chemistry and ability to form stable heteroduplexes with their target mRNA's. Anti-sense DNA molecules also suffer from problems associated with non-specific activity and, at higher concentrations, even toxicity.

As an alternative to anti-sense molecules, catalytic nucleic acid molecules have shown promise as therapeutic agents for suppressing gene expression, and are widely discussed in the literature15-21. Thus, unlike a conventional anti-sense molecule, a catalytic nucleic acid molecule functions by actually cleaving its target mRNA molecule instead of merely binding to it. Catalytic nucleic acid molecules can only cleave a target nucleic acid sequence If that target sequence meets certain minimum requirements. The target sequence must be complementary to the hybridizing regions of the catalytic nucleic acid, and the target must contain a specific sequence at the site of cleavage.

Catalytic RNA molecules (“ribozymes”) are well documented15,22,23, and have been shown to be capable of cleaving both RNA15 and DNA20 molecules. Indeed, the development of in vitro selection and evolution techniques has made it possible to obtain novel ribozymes against a known substrate, using either random variants of a known ribozyme or random-sequence RNA as a starting point16,24,25.

Ribozymes, however, are highly susceptible to enzymatic hydrolysis within the cells where they are intended to perform their function. This in turn limits their pharmaceutical applications.

Recently, a new class of catalytic molecules called “DNAzymes” was created26,27. DNAzymes are single-stranded, and cleave both RNA16,27, and DNA21. A general model for the DNAzyme has been proposed, and is known as the “10-23” model. DNAzymes following the “10-23” model, also referred to simply as “10-23 DNAzymes”, have a catalytic domain of 15 deoxyribonucleotides, flanked by two substrate-recognition domains of variable deoxyribonucleotide arm length. In vitro analyses show that this type of DNAzyme can effectively cleave its substrate RNA at purine:pyrimidine junctions under physiological conditions27.

DNAzymes show promise as therapeutic agents. However, DNAzyme success against a disease caused by the presence of a known mRNA molecule is not predictable. This unpredictability is due, in part, to two factors. First, certain mRNA secondary structures can impede a DNAzyme's ability to bind to and cleave its target mRNA. Second, the uptake of a DNAzyme by cells expressing the target mRNA may not be efficient enough to permit therapeutically meaningful results.

Investigation of the precise regulatory role of c-Jun in the injured artery wall and indeed, in other disease settings such as angiogenesis, has been hampered by the lack of a specific pharmacological inhibitor. DNAzymes represent a new class of gene targeting agent with specificity conferred by the sequence of nucleotides in the two arms flanking a catalytic core27, with advantages over ribozymes of substrate specificity and stability27,28. To date, neither c-Jun nor indeed any other Jun family member has been targeted using catalytic nucleic acid strategies.

SUMMARY OF THE INVENTION

The present inventors have demonstrated using a DNAzyme targeting c-Jun, that c-Jun plays a positive role in restenosis, neointima formation, atherosclerosis, graft failure and angiogenesis.

In a first aspect the present invention consists in a method of preventing or reducing angiogenesis and/or neovascularisation in a subject, the method comprising administering to the subject a prophylactically effective dose of a nucleic acid which decreases the level of c-Jun mRNA, c-Jun mRNA translation or nuclear accumulation or activity of c-Jun.

In a second aspect the present invention consists in a method of treating or inhibiting a condition selected from the group consisting of restenosis, neointima formation, graft failure and atherosclerosis in a subject, the method comprising administering to the subject a prophylactically effective dose of a nucleic acid which decreases the level of c-Jun mRNA, c-Jun mRNA translation or nuclear accumulation or activity of c-Jun.

In a third aspect the present invention consists in a method of treating or inhibiting solid tumour growth in a subject, the method comprising administering to the subject a prophylactically effective dose of a nucleic acid which decreases the level of c-Jun mRNA, c-Jun mRNA translation or nuclear accumulation or activity of c-Jun.

In a preferred embodiment of the present invention, the nucleic acid is selected from the group consisting of a DNAzyme targeted against c-Jun, a c-Jun antisense oligonucleotide, a ribozyme targeted against c-Jun, and a ssDNA targeted against c-Jun dsDNA such that the ssDNA forms a triplex with the c-Jun dsDNA. In an alternative embodiment the nucleic acid is dsRNA targeted against c-Jun mRNA, a nucleic acid molecule which results in production of dsRNA targeted against c-Jun mRNA or small interfering RNA molecules targeted against c-Jun mRNA.

In a fourth aspect, the present invention provides a method of screening for an agent which inhibits restenosis, neointima formation, graft failure, atherosclerosis, angiogenesis, and/or solid tumour growth the method comprising testing a putative agent for the ability to inhibit induction of c-Jun, decrease expression of c-Jun or decrease the nuclear accumulation or activity of c-Jun.

In a fifth aspect, the present Invention consists in a catalytic nucleic acid which specifically cleaves c-Jun mRNA in the region of residues A287 to A1501.

In a sixth aspect the present invention consists in an antisense oligonucleotide which specifically binds c-Jun mRNA in the region of residues U1296 to G1497.

In a seventh aspect the present invention consists in a pharmaceutical composition comprising the catalytic nucleic acid of the fifth aspect of the invention or the antisense oligonucleotide of the sixth aspect of the invention and a pharmaceutically acceptable carrier.

In an eighth aspect the present invention consists in an angioplastic stent for inhibiting onset of restenosis comprising an angioplastic stent operably coated with a prophylactically effective dose of a nucleic acid which decreases the level of c-Jun mRNA, c-Jun mRNA translation or nuclear accumulation or activity of c-Jun.

In a ninth aspect, the present invention consists in a method for inhibiting the onset of restenosis, neointima formation, graft failure and/or atherosclerosis in a subject undergoing angioplasty comprising topically administering a stent according to the eighth aspect of the invention to the subject at around the time of angioplasty.

BRIEF DESCRIPTION OF FIGURES

FIG. 1. c-Jun and Sp1 expression in human atherosclerotic lesions. Immunohistochemical staining for c-Jun and Sp1 in 5 μm sections of human carotid atherosclerotic lesions. The intima and media are indicated in the figure; L denotes lumen. Staining is representative of three independent samples.

FIG. 2. Cleavage of in vitro transcribed c-Jun RNA and inhibition of c-Jun induction by c-Jun DNAzymes. a, Representation of DNAzyme cleavage sites (arrows) in c-Jun RNA and sizes of expected products. The specific purine hosting the 3′ cleavage is indicated for each candidate DNAzyme. Numbering is based on the human c-Jun complete cds (Accession J04111, NID g186624). The expression vector used for the T7 RNA polymerase-dependent generation of c-Jun RNA is indicated. b, Integrity analysis of DNAzyme (34 nt) (upper panel) and 668 nt c-Jun RNA (middle panel) and panning for nucleolytic activity of candidate DNAzymes after 1 h at 37° C. (lower panel). DNAzyme integrity was determined by 5′-end labelling with γ32P-dATP and T4 RNA polymerase prior to resolution on 12% denaturing polyacrylamide gels, Transcript integrity was determined by random labelling with α32P-UTP and T7 polynucleotide kinase prior to resolution on 12% denaturing polyacrylamide gels. The figure shows the 668 nt transcript after the reaction was allowed to proceed for the times indicated. Subsequent experiments used the 30 min run-off. c, Time-and dose-dependence of Dz13 cleavage of c-Jun RNA. The 474 and 194 nt products are indicated. d, Western blot analysis for c-Jun protein. Extracts of smooth muscle cells (10 μg) transfected with 0.5 μM of DNAzyme (Dz13 or Dz13scr) were assessed for c-Jun immunoreactivity (39 kDa) using rabbit polyclonal anti-peptide antibodies (Santa Cruz Biotechnology). The Coomassie blue-stain gel shows unbiased loading.

FIG. 3. c-Jun DNAzyme inhibition of smooth muscle cell proliferation. a, Schematic representation of c-Jun DNAzyme Dz13 and target site (G1311T) in human c-Jun mRNA (upper panel), comparison of Dz13 target site in human, porcine and rat c-Jun mRNA (middle panel), and comparison of As13 and Dz13 (lower panel). The translational start site of human c-Jun mRNA is located at A1261TG. b, Effect of c-Jun DNAzymes (0.5 μM) on serum-inducible primary human smooth muscle cell (HASMC) proliferation inhibited by Dz13. Sequence of Dz13scr is 5′-GCG ACG TGA GGC TAG CTA CAA CGA GTG GAG GAG X-3′, where X is a 3′-3′-linked inverted T. c, Serum-inducible porcine smooth muscle cell proliferation (PASMC) inhibited by 0.5 μM of Dz13. d, Human smooth muscle cell proliferation is inhibited by Dz13 and As13 in a dose-dependent manner. The concentrations of DNAzyme (0.1-0.4 μM) are indicated in the figure. The sequence of As13scr is 5′-GCG ACG TGA C GTG GAG GAG X-3′, where X is a 3′-3′-linked inverted T.

FIG. 4. c-Jun DNAzyme inhibition of smooth muscle cell repair. Smooth muscle cell regrowth in the denuded zone three days after scraping and transfection with 0.5 μM of Dz13 or Dz13scr. The cells were fixed and stained with hematoxylin and eosin prior to micrography.

FIG. 5 Blockade of neointimal thickening in rat common carotid arteries. a, Neointima/media ratios for each group (vehicle alone, vehicle containing Dz13, vehicle containing Dz13scr) 21d after injury. * indicates P<0.05 compared with vehicle and vehicle containing Dz13scr groups using Student's t-test. The vehicle and vehicle containing Dz13scr groups were not statistically different. b, Representative cross-sections stained with haematoxylin-eosin. N and single line denotes neointima, M and triple line denotes media, arrow denotes preinjured intima. Thrombosis was occasionally observed and not confined to any particular group. c, Immunoperoxidase staining for c-Jun protein six hours after arterial injury. d, Immunoperoxidase staining for Sp1 six hours after arterial injury. DNAzyme in vehicle (FuGENE6, MgCl2, PBS, pH 7.4) was applied to the carotid in Pluronic gel (BASF) at the times of injury. Three weeks subsequently the arteries were perfusion-fixed and 5 μm sections taken for immunohistochemical and morphometric analysis.

FIG. 6. Dz13 inhibits microvascular endothelial microtubule formation on reconstituted basement membranes. HMEC-1 cells, transfected previously with the indicated concentrations of Dz13 and Dz13scr, were plated into 96 wps containing matrigel and tubule formation was quantitated after 8 h. Asterisk indicates p<0.05 by Student's t-test relative to control. Western and EMSA revealed that Dz13 inhibits c-Jun expression and DNA-binding activity in microvascular endothelial cells (data not shown). (FBS denotes foetal bovine serum)

FIG. 7. A, c-Jun cDNA sequence (Accession J04111, NTD g186624). B, Location of DNAzyme target sites in c-Jun mRNA.

FIG. 8. Dz13 inhibits microvascular endothelial cell proliferation. A, Growth-quiescent HMEC-1 cells pre-treated with DNAzyme (0.2 μM) were exposed to serum and total cell counts were determined after 3 days using a Coulter counter. B, Dz13 inhibition of microvascular endothelial cell proliferation is dose-dependent. C, Effect of Dz13 variants (shorter and longer arm length) on proliferation. Sequences of Dz13(11+11), Dz13(10+10) and Dz13(8+8) are 5′-GA CGG GAG GAA ggc tag cta caa cga GAG GCG TTG AG-Ti-3′,5′-A CGG GAG GAA ggc tag cta caa cga GAG GCG TTG A-Ti-3′ and 5′-GG GAG GAA ggc tag cta caa cga GAG GCG TT-Ti-3′, respectively. Sequences of Dz13(11+11)scr, Dz13(10+10)scr and Dz13(8+8)scr are 5′-GA GCG ACG TGA ggc tag cta caa cga GTG GAG GAG AG-Ti-3′,5′-A GCG ACG TGA ggc tag cta caa cga GTG GAG GAG A-Ti-3′ and 5′-CG ACG TGA ggc tag cta caa cga GTG GAG GA-Ti-3′, respectively. Ti is a 3′-3′linked inverted T. Asterisk indicates p<0.05 by Student's t-test relative to control.

FIG. 9. Dz13 inhibits microvascular endothelial regrowth after scraping in vitro and migration in modified Boyden chambers. A, Growth-quiescent HMEC-1cells pre-treated with DNAzyme (0.2, 0.3 or 0.4 μM) were scraped and the number of cells in the denuded zone was quantitated under microscopy. B, HMEC-1 were plated in modified Boyden chambers coated with matrigel or collagen type I (chemoattractant in lower chamber was FGF-2, 20 ng/ml) and the number of cells on the underside of the membrane was quantitated after 24 h. Asterisk indicates p<0.05 by Student's t-test relative to control.

FIG. 10. Dz13 blocks MMP-2 expression and proteolysis. MMP-2 protein expresssion was quantitated by enzyme-linked immunosorbent assay. Gelatin zymography demonstrated Dz13 inhibition of MMP-2 proteolysis and rescue by overexpression of c-Jun cDNA (data not shown). RT-PCR demonstrated that Dz13 blocked c-Jun mRNA expression (data not shown).

FIG. 11. Dz13 inhibits VEGF165-induced neovascularization in rat cornea. A, HMEC-1 cells (pre-transfected with 0.4 μM Dz13, and in medium containing 200 ng/ml of VEGF165) were plated into 96 wps containing matrigel and tubule formation was quantitated under microscopy after 8 h. Quantitation of B, the number of blood vessels in the rat cornea and C, the corneal surface area occupied by these new vessels. Asterisk indicates p<0.05 by Student's t-test relative to control. Western blot analysis using polyclonal c-Jun antibodies and extracts of growth-quicscent HMEC-1 cells pre-treated with DNAzyme (0.4 μM) 2 h after exposure to VEGF165 (100 μg/ml) demonstrated inhibition of c-Jun expression with no change in Sp1 expression (data not shown).

FIG. 12. Dz13 blockade of solid melanoma growth in mice. A, Dz13 inhibition of solid malignant B16 tumor growth in a sequence-specific manner. Tumour volumes were evaluated as indicated on the x-axis. B, Mean total body weight in the DNAzyme and vehicle-treated cohorts. C, Proliferation 2 days after exposure of growth-quiescent cultured microvascular endothelial cells pre-treated with DNAzyme (0.4 μM) to serum. Seventeen of the 18 nucleotides in the Dz13 target site in human c-Jun mRNA (5′-CAA CGC CUC G1311 I UUC CUC CcG-3′) are conserved in murine c-Jun mRNA (5′-CAA CGC CUC GI UUC CUC CaG-3′). Asterisk indicates p<0.05 by Student's t-test relative to control. Immunohistochemical analysis in vascularized human malignant cutaneous melanoma tissue revealed that c-Jun and MMP-2 are expressed in CD31+ endothelium and surrounding melanoma cells (data not shown). Western blot analysis demonstrated Dz13 inhibition of c-Jun protein 2 h after exposure of the cells to serum (data not shown).

FIG. 13. Dz13 localizes vascular endothelium and inhibits vascular leakiness/permeability in the passive cutaneous anaphylaxis model. A, Six week-old Balb/c mice were injected with 25 ng of mouse monoclonal anti-dinitrophenyl (DNP) IgE (Sigma) in PBS, pH 7.4 in one ear or with PBS, pH 7.4, alone in the other ear. Mouse monoclonal antidinitrophenyl (DNP) IgE in saline was co-administered with 100 μg DNAzyme or scrambled DNAzyme in 25 μl of vehicle (PBS, pH 7.4, FuGENE6 (3:20 vol:vol) containing 1 mM MgCl2) in one ear and the same volume of vehicle in the other car. After 20 h, the mice were injected intravenously with 100 μl of PBS containing 100 μg DNP-human serum albumin and 1% Evans Blue dye. The mice were euthanased 30 min after the intravenous injection and a 6 mm diameter disc of tissue was cut from the centre of each ear. Each disc was incubated in 200 μl of 10% formamide solution at 55° C. for 6 h. Dye extravazation was quantitated at 610 nm, blanked with formamide, and corrected for background absorbance using an untreated patch of skin of identical size.

FIG. 14. Dz13 inhibits VEGF165-induced vascular leakiness/permeability in the miles assay. Six-week-old female athymic nude Balb/c mice were anaesthetised, and 150 μl of 1% Evans Blue solution was injected into the tail vein. After 5 minutes, DNAzyme or scrambled DNAzyme (10 or 100 μg, as indicated by the thickness of the line beneath the plot) in 20 μl of vehicle (PBS, pH 7.4, FuGENE6 (3:20 vol:vol) containing 1 mM MgCl2), or vehicle alone, was delivered into the mid dorsum by intradermal injection. After 1 hour, 50 ng VEGF165 in 20 μL of PBS, pH 7.4, was injected Into an adjacent location. Extravasation of Evans Blue was determined after 90 min by carefully excising the skin around the VEGF165 injection site and incubating the skin in 200 μl of 10% formamide for 24 h at 55° C. As a negative control, 50 ng of BSA was injected in lieu of VEGF165, in 20 μl of PBS, pH 7.4. The formamide was assessed for absorbance at 610 nm using a plate reader, blanked with formamide, and values were corrected for background absorbance using an untreated patch of skin of identical size.

FIG. 15. Dz13 inhibits ocular neovascularization. Postnatal Day 6 pups and their mother were exposed to 75% O2 for 4 days. Each mouse was then injected, intravitreally, with 20 μg of either Dz13 or Dz13scr, 0.2 μl FuGENE6 and 1 mM MgCl2 using microvolume syringes with a 26 G needle in a final volume of 1.5 μl. Control mice were injected with FuGENE6 and 1 mM MgCl2 and the final injectate volume was made with water. Following injections, mice were placed in normoxia for 7 days. At P17, eyes were harvested and fixed immediately in PBS containing 10% formalin. Cross sections were made 0, 50 and 100 μm away from the optic nerve, stained with hematoxylin and eosin, and examined using light microscopy.

FIG. 16. Dz13 inhibits inflammation in cytokine-induced rat peritoneal mesenteric venules. The small bowel and mesentery of male Sprague-Dawley rats were continuously superfused with modified Krebs-Henseleit solution at 37° C. One hundred μL of either vehicle (PBS, pH 7.4, containing FuGENE6 and 1 mM MgCl2) or vehicle containing DNAzyme was applied topically and left undisturbed for 10 min during which superfusion and suction were stopped. Superfusion was resumed with either buffer (PBS, pH7.4, containing 0.1% BSA) or buffer containing IL-lbeta (20 ng/ml). The parameters of leukocyte A, flux, B, adhesion and C, extravazation were quantitated off-line at the conclusion of the experiment.

FIG. 17. c-Jun siRNA suppresses c-Jun protein expression in murine microvascular endothelial cells. Growth-quiescent bEND-3 cells transfected with 0.2 μM c-Jun siRNA, siRNAscr or mock-transfected and incubated in medium containing serum for 2 h prior to Western blot analysis (for c-Jun beta-actin) of whole cell extracts.* indicates P<0.05 compared with the mock-transfected or scrambled control.

FIG. 18. c-Jun siRNA inhibits growth of murine microvascular endothelial cells. Growth-quiescent bEnd-3 cells transfected with 0.02 or 0.05 μM of c-Jun siRNA, siRNAscr or mock-transfected were incubated in medium containing serum for 48 h prior to quantitation of cell numbers using a Coulter counter. * indicates P<0.05 compared with the mock-transfected or scrambled control.

FIG. 19. c-Jun siRNA inhibits murine microvascular endothelial cell regrowth from the wound edge. bEnd-3 cells transfected with c-Jun siRNA, siRNAscr or mock-transfected. Injury was performed by scraping and incubated in medium containing serum for 48 h prior to fixation, H&E staining and quantitation of cell numbers in the denuded zone. * indicates P<0.05 compared with the mock-transfected or scrambled control.

FIG. 20. c-Jun siRNA inhibits murine microvascular endothelial tubule formation. bEnd-3 cells transfected with c-Jun siRNA, siRNAscr or mock-transfected were seeded onto matrigel-coated wells. Spontaneous tubule formation was quantitated (A) following transfection with 0.1 μM siRNA, or (B) after 9 h using various siRNA amounts. * indicates P<0.05 compared with the mock-transfected or scrambled control.

FIG. 21. c-Jun siRNA inhibits angiogenesis in mice. C57BL/6 mice were implanted subcutaneously with matrigel plugs containing 0.5 μg of FGF2 and 100 μg of c-Jun siRNA or c-Jun siRNAscr. Blood vessels in the cross-sectioned plugs were quantitated by light microscopy 14 d after implantation. (A) c-Jun siRNA inhibit host angiogenesis of the plugs; (B) no adverse effect on mouse body weights by siRNA treatment. * indicates P<0.05 compared with the no siRNA or scrambled control.

DETAILED DESCRIPTION OF THE INVENTION

The present inventors have demonstrated c-Jun expression by smooth muscle cells in the human atheromatous lesion (FIG. 1). c-Jun is poorly, if at all, expressed by smooth muscle cells in the normal media. In contrast, the zinc finger transcription factor Sp1 is expressed in both the intima and media (FIG. 1).

Neointima formation is a characteristic feature of common vascular pathologies, such as atherosclerosis and post-angioplasty restenosis, and involves smooth muscle cell proliferation.

In addition to its expression by smooth muscle cells, the present inventors have also demonstrated that c-Jun is linked to the complex process of angiogenesis and is involved in ocular angiogenesis as is reviewed in Adamis et al., (1999)29. Ocular angiogenesis is responsible for the majority of irreversible blindness in the developed world. This debilitating complication affects all age groups and characterizes such diverse and widespread diseases as trachoma, retinopathy of prematurity, diabetic retinopathy, neovascular glaucoma and age-related macular degeneration.

Expression of c-Jun was also found in vascularized primary human melanoma which has not been previously described.

A gene-specific DNAzyme targeting c-Jun (designated Dz13; SEQ ID No:5) was generated. Dz13 cleaves c-Jun RNA and inhibits inducible c-Jun protein expression in vascular smooth muscle cells with a potency exceeding its exact non-catalytic antisense oligodeoxynucleotide equivalent. Moreover, Dz13 abrogated smooth muscle cell repair after injury in vitro and neointima formation in rat carotid arteries in vivo.

Dz13 also blocked endothelial proliferation, migration and microtubule formation with a potency exceeding its exact non-catalytic antisense oligodeoxynucleotide equivalent. It inhibited neovascularisation in rat cornea and melanoma growth in mice.

These findings demonstrate the pivotal regulatory role of c-Jun in neointima formation in the injured artery wall, as well as angiogenesis.

In a first aspect the present invention consists in a method of preventing or reducing angiogenesis and/or neovascularisation in a subject, the method comprising administering to the subject a prophylactically effective dose of a nucleic acid which decreases the level of c-Jun mRNA, c-Jun mRNA translation or nuclear accumulation or activity of c-Jun.

In a second aspect the present invention consists in a method of treating or inhibiting a condition selected from the group consisting of restenosis, neointima formation, graft failure and atherosclerosis in a subject, the method comprising administering to the subject a prophylactically effective dose of a nucleic acid which decreases the level of c-Jun mRNA, c-Jun mRNA translation or nuclear accumulation or activity of c-Jun.

In a third aspect the present invention consists in a method of treating or inhibiting solid tumour growth in a subject, the method comprising administering to the subject a prophylactically effective dose of a nucleic acid which decreases the level of c-Jun mRNA, c-Jun mRNA translation or nuclear accumulation or activity of c-Jun.

In a preferred embodiment of the first aspect of the invention the angiogeneis is ocular angiogenesis.

In one embodiment the subject is suffering from a condition selected from the group consisting of trachoma, retinopathy or prematurity, diabetic retinopathy, neovascular glaucoma and age-related macular degeneration. In particular the subject is suffering from age-related macular degeneration.

In a preferred embodiment of the third aspect of the invention the solid tumour is melanoma.

Although the subject may be any animal or human, it is preferred that the subject is a human.

As will be recognised by those skilled in this field there are a number of means by which the method of the present invention may be achieved.

In a preferred embodiment, the method is achieved by cleavage of c-Jun mRNA by a sequence-specific DNAzyme. In a further preferred embodiment, the DNAzyme comprises

    • (i) a catalytic domain which cleaves mRNA at a purine:pyrimidine cleavage site;
    • (ii) a first binding domain contiguous with the 5′ end of the catalytic domain; and
    • (iii) a second binding domain contiguous with the 3′ end of the catalytic domain,
    • wherein the binding domains are sufficiently complementary to two regions immediately flanking a purine:pyrimidine cleavage site within the c-Jun mRNA such that the DNAzyme cleaves the c-Jun mRNA.

As used herein, “DNAzyme” means a DNA molecule that specifically recognizes and cleaves a distinct target nucleic acid sequence, which may be either DNA or RNA.

In a preferred embodiment, the binding domains of the DNAzyme are complementary to the regions immediately flanking the cleavage site. It will be appreciated by those skilled in the art, however, that strict complementarity may not be required for the DNAzyme to bind to and cleave the c-Jun mRNA.

The binding domain lengths (also referred to herein as “arm lengths”) can be of any permutation, and can be the same or different. In a preferred embodiment, the binding domain lengths are at least 6 nucleotide. Preferably, both binding domain have a combined total length of at least 14 nucleotides. Various permutations in the length of the two binding domains, such as 7+7, 8+8 and 9+9, are envisioned. Preferably, the length of the two binding domains are 9+9.

The catalytic domain of a DNAzyme of the present invention may be any suitable catalytic domain. Examples of suitable catalytic domains are described in Santoro and Joyce, 199727 and U.S. Pat. No. 5,807,718. In a preferred embodiment, the catalytic domain has the nucleotide sequence GGCTAGCTACAACGA (SEQ ID No:4).

It is preferred that the DNAzyme cleavage site is within the region of residues A287 to A1501, more preferably U1296 to G1497, of the c-Jun mRNA. It is particularly preferred that the cleavage site within the c-Jun mRNA is the GU site corresponding to nucleotides 1311-1312.

In a further preferred embodiment, the DNAzyme has the sequence 5′-cgggaggaaGGCTAGCTACAACGAgaggcgttg-3′ (SEQ ID No:5).

In applying DNAzyme-based treatments, it is preferable that the DNAzymes be as stable as possible against degradation in the intra-cellular milieu. One means of accomplishing this is by incorporating a 3′-3′ inversion at one or more termini of the DNAzyme. More specifically, a 3′-3′ inversion (also referred to herein simply as an “inversion”) means the covalent phosphate bonding between the 3′ carbons of the terminal nucleotide and its adjacent nucleotide. This type of bonding is opposed to the normal phosphate bonding between the 3′ and 5′ carbons of adjacent nucleotides, hence the term “inversion”. Accordingly, in a preferred embodiment the 3′-end nucleotide residue is inverted in the building domain contiguous with the 3′ end of the catalytic domain. In addition to inversions, the instant DNAzymes may contain modified nucleotides. Modified nucleotides include, for example, N3′-P5′ phosphoramidate linkages, and peptide-nucleic acid linkages. These are well known in the art.

In a particularly preferred embodiment, the DNAzyme includes an inverted T at the 3′ position.

In order to increase resistance to exonucleolytic degradation and helical thermostability locked nucleic acid analogues can be produced. Further information regarding these analogues is provided in Vester et al, J. Am. Chem. Soc., 2002, 124, 13682-13683, the disclosure of which is incorporated herein by cross reference.

In another embodiment, the method is achieved by inhibiting translation of the c-Jun mRNA using synthetic antisense DNA molecules that do not act as a substrate for RNase and act by sterically blocking gene expression.

In another embodiment, the method is achieved by inhibiting translation of the c-Jun mRNA by destabilising the mRNA using synthetic antisense DNA molecules that act by directing the RNase degradation of the c-Jun mRNA present in the heteroduplex formed between the antisense DNA and mRNA.

In one preferred embodiment of the present invention, the antisense oligonucleotide comprises a sequence which hybridises to c-Jun within the region of residues U1296 to C1497.

It will be understood that the antisense oligonucleotide need not hybridise to this whole region. It is preferred that the antisense oligonucleotide has the sequence CGGGAGGAACGAGGCGTTG (SEQ ID No:6).

In another embodiment, the method is achieved by inhibiting translation of the c-Jun mRNA by cleavage of the mRNA by sequence-specific hammerhead ribozymes and derivatives of the hammerhead ribozyme such as the Minizymes or Mini-ribozymes or where the ribozyme is derived from:

    • (i) the hairpin ribozyme,
    • (ii) the Tetrahymena Group I intron,
    • (iii) the Hepatitis Delta Viroid ribozyme or
    • (iv) the Neurospera ribozyme.

It will be appreciated by those skilled in the art that the composition of the ribozyme may be;

    • (i) made entirely of RNA,
    • (ii) made of RNA and DNA bases, or
    • (iii) made of RNA or DNA and modified bases, sugars and backbones

Within the context of the present invention the ribozyme may also be either;

    • (i) entirely synthetic or
    • (ii) contained within a transcript from a gene delivered within a virus-derived vector, expression plasmid, a synthetic gene, homologously or heterologously integrated into the patients genome or delivered into cells ex vivo, prior to reintroduction of the cells of the patient, using one of the above methods.

It is preferred that the ribozyme cleaves the c-Jun mRNA in the region of residues U1296 to G1497.

In another embodiment, the method is achieved by inhibition of the ability of the c-Jun gene to bind to its target DNA by expression of an antisense c-Jun mRNA.

In a still further embodiment the nucleic acid is dsRNA targeted against c-Jun mRNA, a nucleic acid molecule which results in production of dsRNA targeted against c-Jun mRNA or small interfering RNA molecules targeted against c-Jun mRNA. So called “RNA interference” or “RNAi” is well known and further information regarding RNAi is provided in Hannon, Nature, Vol 418, 2002, 244-251, and McManus et al, Nature Reviews: Genetics, Vol 3, 2002, 737-747, the disclosures of which are incorporated herein by cross-reference.

In one embodiment, the method is achieved by targeting the c-Jun gene directly using triple helix (triplex) methods in which a ssDNA molecule can bind to the dsDNA and prevent transcription.

In another embodiment, the method is achieved by inhibiting transcription of the c-Jun gene using nucleic acid transcriptional decoys. Linear sequences can be designed that form a partial intramolecular duplex which encodes a binding site for a defined transcriptional factor.

In another embodiment, the method is achieved by inhibition of c-Jun activity as a transcription factor using transcriptional decoy methods.

In another embodiment, the method is achieved by inhibition of the ability of the c-Jun gene to bind to its target DNA by drugs that have preference for GC rich sequences. Such drugs include nogalamycin, hedamycin and chromomycin A330.

Preferably, the small interfering RNA molecule targeted against c-Jun mRNA has the sequence 5′-r(AACAGCUUCCUGCCUUUGUAA)dTT-3′.

Administration of the inhibitory nucleic acid may be effected or performed using any of the various methods and delivery systems known to those skilled in the art. The administering can be performed, for example, intravenously, orally, via implant, transmucosally, transdermally, topically, intramuscularly, subcutaneously or extracorporeally. In addition, the instant pharmaceutical compositions ideally contain one or more routinely used pharmaceutically acceptable carriers. Such carriers are well known to those skilled in the art. The following delivery systems, which employ a number of routinely used carriers, are only representative of the many embodiments envisioned for administering the instant composition. In one embodiment the delivery vehicle contain. Mg2+ or other cation(s) to serve as co-factor(s) for efficient DNAzyme bioactivity.

Transdermal delivery systems include patches, gels, tapes and creams, and can contain excipients such as solubilizers, permeation enhancers (e.g., fatty acids, fatty acid esters, fatty alcohols and amino acids), hydrophilic polymers (e.g., polycarbophil and polyvinylpyrolidone), and adhesives and tackifiers (e.g., polyisobutylenes, silicone-based adhesives, acrylates and polybutene).

Transmucosal delivery systems include patches, tablets, suppositories, pessaries, gels and creams, and can contain excipients such as solubilizers and enhancers (e.g., propylene glycol, bile salts and amino acids), and other vehicles (e.g., polyethylene glycol, fatty acid esters and derivatives, and hydrophlic polymers such as hydroxypropylmethylcellulose and hyaluronic acid).

Oral delivery systems include tablets and capsules. These can contain excipients such as binders (e.g., hydroxypropylmethylcellulose, polyvinyl pyrilodone, other cellulosic materials and starch), diluents (e.g., lactose and other sugars, starch, dicalcium phosphate and cellulosic materials), disintegrating agents (e.g., starch polymers and cellulosic materials) and lubricating agents (e.g., stearates and talc).

Solutions, suspensions and powders for reconstitutable delivery systems include vehicles such as suspending agents (e.g., gums, xanthans, cellulosics and sugars), humectants (e.g., sorbitol), solubilizers (e.g., ethanol, water, PEG and propylene glycol), surfactants (e.g., sodium lauryl sulfate, Spans, Tweens, and cetyl pyridine), preservatives and antioxidants (e.g., parabens, vitamins E and C, and ascorbic acid), anti-caking agents, coating agents, and chelating agents (e.g., EDTA).

Topical delivery systems include, for example, gels and solutions, and can contain excipients such as solubilizers, permeation enhancers (e.g., fatty acids, fatty acid esters, fatty alcohols and amino acids), and hydrophilic polymers (e.g., polycarbophil and polyvinylpyrolidone). In the preferred embodiment, the pharmaceutically acceptable carrier is a liposome or a biodegradable polymer. Examples of carriers which can be used in this invention include the following: (1) Fugene6® (Roche); (2) SUPERFECT®(Qiagen); (3) Lipofectamine 2000® (GIBCO BRL); (4) CellFectin, 1:1.5 (M/M) liposome formulation of the cationic lipid N,NI,NII,NIII-tetramethyl-N,NI,NII,NIII-tetrapalmitylspermine and dioleoyl phosphatidyl-ethanolamine (DOPE)(GIBCO BRL); (5) Cytofectin GSV, 2:1 (M/M) liposome formulation of a cationic lipid and DOPE (Glen Research); (6) DOTAP (N-[1-(2,3-dioleoyloxy)-N,N,N-trimethyl-ammoniummethylsulfate) (Boehringer Mannheim); and (7) Lipofectamine, 3:1 (M/M) liposome formulation of the polycationic lipid DOSPA and the neutral lipid DOPE (GIBCO BRL).

Delivery of the nucleic acids described may also be achieved via one or more, of the following non-limiting examples of vehicles:

    • (a) liposomes and liposome-protein conjugates and mixtures;
    • (b) non-liposomal lipid and cationic lipid formulations;
    • (c) activated dendrimer formulations;
    • (d) within a polymer formulation such as polyethylenimine (PEI) or pluronic gels or within ethylene vinyl acetate copolymer (EVAc). The polymer is preferably delivered intra-luminally;
    • (e) within a viral-liposome complex, such as Sendai virus;
    • (f) as a peptide-DNA conjugate;
    • (g) using catheters to deliver intra-luminal formulations of the nucleic acid as a solution or in a complex with a liposome;
    • (h) catheter delivery to adventitial tissue as a solution or in a complex with a liposome;
    • (i) the nucleic acid may be bound to a delivery agent such as a targeting moiety, or any suitable carrier such as a peptide or fatty acid molecule;
    • (j) the nucleic acid may be delivered by a double angioplasty balloon device fixed to catheter; or
    • (k) the nucleic acid could be delivered on a specially prepared stent of the Schatz-Palmaz or derivative type. The stent could be coated with a polymer or agent impregnated with nucleic acid that allows controlled release of the molecules at the vessel wall.

Determining the prophylactically effective dose of the instant pharmaceutical composition can be done based on animal data using routine computational methods. In one embodiment, the prophylactically effective does contains between about 0.1 mg and about 1 g of the instant DNAzyme. In another embodiment, the prophylactically effective dose contains between about 1 mg and about 100 mg of the instant DNAzyme. In a further embodiment, the prophylactically effective does contains between about 10 mg and about 50 mg of the instant DNAzyme. In yet a further embodiment, the prophylactically effective does contains about 25 mg of the instant DNAzyme.

In the case of the prevention or reduction of angiogenesis or inhibition of solid tumour growth, in a preferred embodiment, the agent is injected into or proximal the tumour.

Injectable drug delivery systems include solutions, suspensions, gels, microspheres and polymeric injectables, and can comprise excipients such as solubility-altering agents (e.g., ethanol, propylene glycol and sucrose) and polymers (e.g., polycaprylactones and PLGA's). Implantable systems include rods and discs, and can contain excipients such as PLGA and polycaprylactone.

It is also envisaged that nucleic acid agents targeting c-Jun may be administered by ex vivo transfection of cell suspensions, thereby inhibiting angiogenesis.

In a fourth aspect, the present invention provides a method of screening for an agent which inhibits restenosis, neointima formation, atherosclerosis, graft failure and/or angiogenesis, the method comprising testing a putative agent for the ability to inhibit induction of c-Jun, decrease expression of c-Jun or decrease the nuclear accumulation or activity of c-Jun.

The putative agent may be tested for the ability to inhibit c-Jun by any suitable means. For example, the test may involve contacting a cell which expresses c-Jun with the putative agent and monitoring the production of c-Jun mRNA (by, for example, Northern blot analysis) or c-Jun protein (by, for example, immunohistochemical analysis or Western blot analysis or electrophoretic mobility shift assay). Other suitable tests will be known to those skilled in the art.

In a fifth aspect the present invention consists in a catalytic nucleic acid which specifically cleaves c-Jun mRNA in the region of residues A287 to A1501, preferably U1296 to G1497.

In a preferred embodiment, the catalytic nucleic acid is a sequence-specific DNAzyme comprising

    • (i) a catalytic domain which cleaves mRNA at a purine:pyrimidine cleavage site;
    • (ii) a first binding domain contiguous with the 5′ end of the catalytic domain; and
    • (iii) a second binding domain contiguous with the 3′ end of the catalytic domain,
    • wherein the binding domains are sufficiently complementary to two regions immediately flanking a purine:pyrimidine cleavage site within the c-Jun mRNA such that the DNAzyme cleaves the c-Jun mRNA in the region of residues U1296 to G1497.

It is particularly preferred that the cleavage site within the c-Jun mRNA is the GU site corresponding to nucleotides 1311-1312.

In a preferred embodiment, the binding domains of the DNAzyme are complementary to the regions immediately flanking the cleavage site. It will be appreciated by those skilled in the art, however, that strict complementarity may not be required for the DNAzyme to bind to and cleave the c-Jun mRNA.

The binding domain lengths (also referred to herein as “arm lengths”) can be of any permutation, and can be the same or different. In a preferred embodiment, the binding domain lengths are at least 6 nucleotides. Preferably, both binding domains have a combined total length of at least 14 nucleotides. Various permutations in the length of the two binding domains, such as 7+7, 8+8 and 9+9, are envisioned. Preferably, the length of the two binding domains are 9+9.

The catalytic domain of a DNAzyme of the present invention may be any suitable catalytic domain. Examples of suitable catalytic domains are described in Santoro and Joyce, 199727 and U.S. Pat. No. 5,807,718. In a preferred embodiment, the catalytic domain has the nucleotide sequence GGCTAGCTACAACGA (SEQ ID No:4).

In a further preferred embodiment, the DNAzyme has the sequence 5′-cgggaggaaGGCTAGCTACAACGAgaggcgttg-3′ (SEQ ID No:5).

In applying DNAzyme-based treatments, it is preferable that the DNAzymes be as stable as possible against degradation in the intra-cellular milieu. One means of accomplishing this is by incorporating a 3′-3′ inversion at one or more termini of the DNAzyme. More specifically, a 3′-3′ inversion (also referred to herein simply as an “inversion”) means the covalent phosphate bonding between the 3′ carbons of the terminal nucleotide and its adjacent nucleotide. This type of bonding is opposed to the normal phosphate bonding between the 3′ and 5′ carbons of adjacent nucleotides, hence the term “inversion”. Accordingly, in a preferred embodiment, the 3′-end nucleotide residue is inverted in the building domain contiguous with the 3′ end of the catalytic domain. in addition to inversions, the instant DNAzymes may contain modified nucleotides. Modified nucleotides include, for example, N3′-P5′ phosphoramidate linkages, and peptide-nucleic acid linkages. These are well known in the art.

In a particularly preferred embodiment, the DNAzyme includes an inverted T at the 3′ position.

In another embodiment, the catalytic nucleic acid is a sequence-specific hammerhead ribozyme and derivatives of the hammerhead ribozyme such as the Minizymes or Mini-ribozymes or where the ribozyme is derived from:

    • (i) the hairpin ribozyme,
    • (ii) the Tetrahymena Group I intron,
    • (iii) the Hepatitis Delta Viroid ribozyme or
    • (iv) the Neurospera ribozyme
      wherein the ribozyme cleaves the c-Jun mRNA in the region of residues U1296 to G1497.

It will be appreciated by those skilled in the art that the composition of the ribozyme may be;

    • (i) made entirely of RNA,
    • (ii) made of RNA and DNA bases, or
    • (iii) made of RNA or DNA and modified bases, sugars and backbones.

Within the context of the present invention, the ribozyme may also be either;

    • (i) entirely synthetic or
    • (ii) contained within a transcript from a gene delivered within a virus-derived vector, expression plasmid, a synthetic gene, homologously or heterologously integrated into the patients genome or delivered into cells ex vivo, prior to reintroduction of the cells of the patient, using one of the above methods.

In a sixth aspect the present invention consists in an antisense oligonucleotide which specifically binds c-Jun mRNA in the region of residues U1296 to G1497.

It will be understood that the antisense oligonucleotide need not hybridise to this whole region. It is preferred that the antisense oligonucleotide has the sequence CGGGAGGAACGAGGCGTTG (SEQ ID No:6).

In a seventh aspect the present invention consists in a pharmaceutical composition comprising the catalytic nucleic acid of the fifth aspect of the invention or the antisense oligonucleotide of the sixth aspect of the invention and a pharmaceutically acceptable carrier.

In an eighth aspect the present invention consists in an angioplastic stent for inhibiting onset of restenosis comprising an angioplastic stent operably coated with a prophylactically effective dose of a nucleic acid which decreases the level of c-Jun mRNA, c-Jun mRNA translation or nuclear accumulation or activity of c-Jun.

It is preferred that the agent is the catalytic nucleic acid of the fifth aspect of the invention or the antisense oligonucleotide of the sixth aspect of the invention.

In a ninth aspect the present invention consists in a method for inhibiting the onset of restenosis in a subject undergoing angioplasty comprising topically administering a stent according to the eighth aspect of the invention to the subject at around the time of angioplasty.

Angioplastic stents, also known by other terms such as “intravascular stents” or simple “stents”, are well known in the art. They are routinely used to prevent vascular closure due to physical anomalies such as unwanted inward growth of vascular tissue due to surgical trauma. They often have a tubular, expanding lattice-type structure appropriate for their function, and can optionally be biodegradable.

In this invention, the stent can be operably coated with the instant pharmaceutical composition using any suitable means known in the art. Here, “operably coating” a stent means coating it in a way that permits the timely release of the pharmaceutical composition into the surrounding tissue to be treated once the coated stent is administered. Such coating methods, for example, can use the polymer polypyrrole.

As used herein, administration “at around the time of angioplasty” can be performed during the procedure, or immediately before or after the procedure. The administering can be performed according to known methods such as catheter delivery.

Throughout this specification the word “comprise”, or variations such as “comprises” or “comprising”, will be understood to imply the inclusion of a stated element, integer or step, or group of elements, integers or steps, but not the exclusion of any other element, integer or step, or group of elements, integers or steps.

All publication mentioned in this specification are herein incorporated by reference.

In order that the nature of the present invention may be more clearly understood, preferred forms thereof will now be described with reference to the following non-limiting and Examples.

Methods

DNAzymes, In Vitro Transcript and Cleavage Experiments

DNAzyme were synthesized by Oligos Etc. or TriLink with a 3′-3′-linked inverted T and purified by HPLC. A 32P-labeled 668 nt c-Jun RNA transcript was prepared by in vitro transcription (using T7 polymerase) of pBluescript containing the insert, cut previously with XbaI. Reactions were performed in a total volume of 20 μl containing 10 mM MgCl2, 5 mM Tris pH 7.5, 150 mM NaCl, 0.5 pmol of in vitro transcribed substrate and 10 pmol DNAzyme, unless dose-dependent cleavage experiments were performed, where stoichiometry is indicated in the figure. Reactions were allowed to proceed for various times at 37° C. and quenched by transferring an aliquot to tubes containing formamide loading buffer. Samples were run on 12% denaturing polyacrylamide gels and autoradiographed overnight at −80° C.

Smooth Muscle Cell Culture, Transfection, Proliferation and Wounding assays

Smooth muscle cells derived from human and porcine coronary arteries were obtained from Cell Applications, Inc (San Diego, Calif.), and cultured in Waymouth's medium, pH 7.4, containing 10% fetal bovine serum, 50 μg/ml streptomycin and 50 IU/ml penicillin at 37° C. in a humidified atmosphere of 5% CO2. In all in vitro experiments, smooth muscle cells were not used beyond passage 7. Transfections were performed in smooth muscle cells six h after the change of medium to serum-free, and again at the time of serum-stimulation 24 h after the start of arrest, using FuGENE6 according to the manufacturer's instructions (Roche). In proliferation assays, growth-arrested smooth muscle cells in 96 well plates (Nunc-InterMed) were transfected with the indicated concentration of DNAzyme or oligonucleotide, then exposed to 5% FBS at 37° C. for 72 h. The cells were trypsinized and the suspension quantitated in an automated Coulter counter. In wounding assays, confluent smooth muscle cells in chamber slides (Nunc-InterMed) transfected with DNAzyme were injured by scraping with a sterile toothpick. Cells were treated with mitomycin C (Sigma) (20 μM) for 2 h prior to injury to block proliferation. Seventy-two h after injury, the cells were washed with PBS, pH 7.4, fixed with formaldehyde and stained with hematoxylin and eosin.

Antibodies

Western immunoblot, and immunohistochemical analysis on human carotid endarterectomy specimens, were performed using rabbit polyclonal anti-peptide antibodies targeting c-Jun and Sp1 (Santa Cruz Biotechnology) essentially as described11,31.

Common Carotid Injury and Evaluation of Neointima Formation

Sprague Dawley rats (450 g males) were anaesthetised using ketamine (60 mg/kg, i.p.) and xylazine (8 mg/kg, i.p.). The left common and external carotid arteries were exposed via a midline neck incision, and a ligature was applied to the external carotid proximal to the bifurcation. Two hundred μl (at 4° C.) containing DNAzyme (750 μg), of FuGENE6 (30 μl), MgCl2 (1 mM) and P127 Pluronic gel (BASF) was applied around the vessel, 6h prior to and again at the time of ligation. The solution gelified after contact with the vessel at 37° C. The incision was sutured and the rats allowed to recover. Animals were sacrificed 21 days after injury by lethal injection of ketamine/xylazine, and perfusion fixed with 10% (v:v) formaldehyde at 120 mm Hg. Carotids were placed in 10% formaldehyde, embedded in 3% (w:v) agarose, fixed in paraffin and sectioned 1000 μm from the tie. Neointimal and medial areas in 5 μm sections stained with hematoxylin and eosin were determined morphometrically and expressed as a mean ratio per group of 6 rats.

Endothelial Cell Culture and Transfection

Human microvascular endothelial cells-1 (HMEC-1) were grown in MCDB131 medium (GIBCO BRL) containing 10% fetal bovine serum (FBS), 2 mM L-glutamine, 10 ng/ml epidermal growth factor, 1 μg/ml hydrocortisone, and 5U/ml penicillin/streptomycin. Murine brain microvascular endothelial cells (bEND-3) were cultured in Dulbecco's modified Eagles medium (DMEM, GIBCO BRL) containing 10% fetal calf serum, 2 mM L-glutamine and 5 U/ml penicillin/streptomycin. DNAzyme transfections were performed with FuGENE6 using subconfluent cells (60-70%) 6 h after the initiation of growth-arrest in scrum-free medium. The cells were transfected a second time in medium containing scrum 18 h after the initial transfection.

Western Blot Analysis

Growth-quiescent endothelial cells transfected twice with DNAzyme were incubated in serum for 2 h prior to the preparation of total cell extracts in 150 mM NaCl, 50 mM Tris-HCl (pH 7.5),1% sodium deoxycholate, 0.1% SDS, 1% Triton X-100, 5 mM EDTA, 10 μg/ml leupeptin, 1% aprotinin and 2 mM PMSF. These extracts were resolved on 12% PAGE gels, transferred onto PVDF nylon membranes and probed with the indicated antibodies (Santa Cruz Biotechnology). Proteins were detected by chemiluminescence (NEN).

Preparation of Nuclear Extracts and EMSA

Cells were scraped into ice-cold phosphate-buffered saline (PBS), pelleted and resuspended in lysis buffer containing 10 mM Hepes, pH 7.9, 1.5 mM MgCl2, 10 mM KCl, 0.5% NP-40, 1mM DTT, 0.5 mM PMSF, 4 μg/ml aprotinin and 10 μg/ml leupeptin. After incubation on ice for 5 min, the pellets were resuspended in 20 mM Hepes, pH7.9, 1.5 mM MgCl2, 420 mM NaCl, 0.2 mM EDTA, 1 mM DTT, 0.5 mM PMSF, 4 μg/ml aprotinin and 10 μg/ml leupeptin, shaking at low speed for 20 min. The supernatant was mixed with an equal volume of 20 mM Hepes, pH 7.9, 100 mM KCl, 0.2 mM EDTA, 20% glycerol, 1 mM DTT, 0.5 mM PMSF, 4 μg/ml aprotinin and 10 μg/ml leupeptin. Double-stranded oligonucleotides were 5′-end-labeled with [γ32P]ATP using T4 polynucleotide kinase (NEB). Reactions were performed in the presence of 10 mM Tris-HCl, pH7.5, 50 mM NaCl, 0.5 mM DTT, 0.5 mM EDTA, 1 mM MgCl2, 5% glycerol, 2.5 μg poly dI-dC with 150,00 cpm of probe for 20min at room temperature. Bound complexes were resolved by non-denaturing 8% PAGE in tris-borate-EDTA buffer system. For supershift studies nuclear extracts were incubated with 2 μg of c-Jun antibody 10 min prior to the addition of the 32P-labeled probe.

Endothelial Proliferation and Wounding Assays

Growth-quiescent endothelial cells treated with DNAzyme were incubated in medium containing serum for 2 days prior to trypsinization, resuspension in Isoton II (Coulter Electronics) and quantitation using a Coulter counter (Coulter Z series). Endothelial cells transfected with DNAzyme were grown to confluence and injured by scraping with a P200 tip. Two days after injury, the cells were washed twice in PBS, pH 7.4, fixed in 4% paraformaldehyde (v/v), and stained in hematoxylin and eosin prior to photomicroscopy. Cell numbers in the denuded zone of each group were determined under 100× magnification in triplicate in a blinded manner.

Microtubule Formation Assay

Endothelial cells were grown in 100 mm petri-dishes were transfected with DNAzyme then trypsinized and resuspended (30,000 cells per well) into 96 well plates coated with 100 μl of matrigel (BD Biosciences). Microtubule formation was quantified by microscopy under 400× magnification in a blinded manner.

HMEC-1 Migration and Invasion

Polycarbonate membranes (12 μm pore size) were coated overnight with matrigel (1 mg/ml) (BD Biosciences) or collagen type I (1 mg/ml) (Sigma) and air-dried. A suspension of endothelial cells (4×105/ml) previously transfected with DNAzyme was placed in the upper chamber of modified Boyden chambers. Media in the lower chamber was supplemented with FGF-2 (20 ng/ml). After a 24 h incubation at 37° C., filters were fixed in methanol, stained with hematoxylin and cells that had migrated to the underside of the membrane were quantitated under 400× magnification.

RT-PCR

Cells were transfected with 0.4 μM of Dz13 or Dz13scr 6 h after arrest. Eighteen h later, the cells were incubated with TGF-beta1 (10 ng/ml, Promega) and transfected again with 0.4 μM Dz13 or Dz13scr. Total RNA was prepared using Trizol (Invitrogen) after 24 h. Single strand cDNA was synthesized from 4 μg total RNA in a 20-μl volume reaction with 200 U reverse transcriptase (Superscript II), 500 μM dNTPs, and 0.5 μg oligo (dT)15 (Life Technologies). PCR was performed in a 20 μL volume with 1 U DNA polymerase, 100 μM dNTPs, 30 mM MgCl2 (Invitrogen) and 0.1 μM primers. MMP-2 PC was performed at 95° C. for 30s, 57° C. for 30s, and 72° C. for 40s over 22 cycles. The predicted MMP-2 amplification product was 446 bp. cDNA samples were normalized to GAPDH (452 bp product). Primers were as follows: MMP-2: Forward 5′-GGG ACA AGA ACC AGA TCA CAT AC-3′, Reverse 5′-CTT CTC AAA GTT GTA GGT GGT GG-3′; GAPDH: Forward 5′-ACC ACA GTC CAT GCC ATC AC-3′, Reverse 5′-TCC ACC ACC CTG TTG CTG TA-3′.

MMP-2 ELISA

Endothelial cells transfected with DNAzyme were incubated with 10 ng/ml TGF-beta1 for 2 days in medium supplemented with 0.1% FBS. Conditioned media was harvested, centrifuged, normalized for equal protein, and levels of MMP-2 determined using commercial ELISA (Amersham Biosciences).

SDS-PAGE and Gelatin Zymography

Bovine type B gelatin (Sigma) was impregnated into a standard 10% PAGE resolving gel mixture (4% stacking) at a final concentration of 1 mg/ml. Where indicated, endothelial cells transfected with DNAzyme were co-transfected with 10 μg of a c-Jun expression vector. Equal amounts of protein were loaded and electrophoresis was performed at 4 ° C. Gels were then soaked in 2.5% Triton X-100 (Sigma) and incubated in substrate buffer (50 mM Tris HCl, pH 7.6, 10 mM CaCl2, and 0.02%o NaN3) overnight at 37° C. The gels were stained for 1 h in 0.2% Coomassie Blue R-250 (Bio-Rad) in water, methanol and glacial acetic acid as 5:4:1, then gels were finally destained to reveal gelatinolytic activity and photographed.

Immunohistochemistry

Sections of formalin-fixed, paraffin-embedded human cutaneous malignant melanoma in paraffin were stained with rabbit anti-peptide polyclonal antibodies to c-Jun or CD31 or goat anti-peptide antibodies to MMP-2, as previously described32. Immunoreactivity was revealed following incubation of the sections with either biotinylated-secondary anti-rabbit or anti-goat antibody, as appropriate.

Rat Corneal Neovascularization Model

The corneas of 7 w.o. Sprague Dawley rats were implanted with 0.57 mm diameter nitrocellulose filter disks that had previously been soaked for at least 30 min in 30 μM VEGF165 in 82 mM Tris-HCl (pH 6.9). DNAzyme (100 μg) or vehicle alone was subsequently administered into the conjunctiva adjacent to the disk following implantation. Corneas were carefully removed prior to quantitation of the (i) area of occupied by neovascularization (calculated as 0.2×π×clock hours occupied by vascularization×maximum vessel length) and (ii) the number of vessels growing within the cornea 5 d after implantation.

Tumor Xenograft Mouse Models

B16F10 cells (5×104) were injected s.c. into the dorsal midback region of C57BL/J6 (6 w.o.) mice with 750 μg of DNAzyme in 200 μl of matrigel. Body weight and tumour dimensions were measured digitally at the times indicated in the figure. Tumor volumes (mm3) were determined using the equation length×width×height×0.52.

Murine Passive Cutaneous Anaphylaxis Model

The passive Cuaneous anaphylaxis model was performed in mice using a modification of the method described by Maekawa et al33. This model, and indeed all other models described herein, were approved by the UNSW Animal Care and Ethics Committee. Female six week-old Balb/c mice were injected with 25 ng of mouse monoclonal anti-dinitrophenyl (DNP) IgE (Sigma) in PBS, pH 7.4 in one ear or with PBS, pH 7.4, alone in the other ear. Where indicated, mouse monoclonal anti-dinitrophenyl (DNP) IgE in saline was co-administered with 100 ug DNAzyme or scrambled DNAzyme in 25 μl of vehicle (PBS, pH 7.4, FuGENE6 (Roche Diagnostics) (3:20 vol:vol) containing 1 mM MgCl2) in one ear and the same volume of vehicle in the other ear. After 20 h, the mice were injected intravenously with 100 μl of PBS containing 100 μg DNP-human serum albumin and 1% Evans Blue dye (Sigma). The mice were euthanased 30 min after the intravenous injection and a 6 mm diameter disc of the ear was cut with the injection site in the epicentre. Each disc was incubated in 200 μl of 10% formamide at 55° C. for 6 h. Dye extravazation was quantitated by spectrophotometric analysis at 610 nm, blanked with formamide. Values were corrected for background absorbance using an untreated patch of skin of identical size.

Murine Miles Assay

The Miles assay was performed using a modification of the protocol described by Eriksson and colleagues using shaven Balb/c mice34. It was found that nude mice are more reliable subjects in this assay than shaven mice because of the artefact introduced by even careful scraping. Six-week-old female athymic nude Balb/c mice were anaesthetised, and 150 μl of 1% Evans Blue solution was injected into the tail vein. After 5 minutes, DNAzyme or scrambled DNAzyme in 20 μl of vehicle (PBS, pH 7.4, FuGENE6 (3:20 vol:vol) containing 1 mM MgCl2), or vehicle alone, was delivered into the mid dorsum by intradermal injection. After 1 hour, 50 ng VEGF165 in 20 μL of PBS, pH 7.4, was injected into an adjacent location. Extravasation of Evans Blue was determined after 90 min by carefully excising the skin around the VEGF165 injection site and incubating the skin in 200 μl of 10% formamide for 24 h at 55° C. As a negative control, 50 ng of BSA was injected in lieu of VEGF165 in 20 μL of PBS, pH 7.4. The formamide was assessed for absorbance at 610 nm using a plate reader, blanked with formamide. Values were corrected for background absorbance using an untreated patch of skin of identical size.

Murine Retinopathy of Prematurity Model

The retinopathy of prematurity model was performed essentially as described35. Briefly, C57BL/6 mice were obtained from the Animal Research Centre (Perth, Australia). Postnatal Day 6 pups and their mother were exposed to 75% O2 for 4 days in Quantum-Air Maxi-Seal filtered cages (Arrowmight Biosciences, UK). An oxygen analyzer with an externally mounted sensor (Sensidyne, model 5000-AE, Clearwater, Fla., USA) was used to monitor O2 levels in cages. Following exposure to hyperoxia, each mouse was injected, intravitreally, with 20 μg of either Dz13 or Dz13scr, 0.2 μl FuGENE6 and 1 mM MgCl2 using microvolume syringes with a 26 G needle (SGE International, Australia) in a final volume of 1.5 μl. Control mice were injected with FuGENE6 and 1 mM MgCl2 and the final injectate volume was made with water. Mice were anaesthetized with 20 mg/kg ketamine and 2.7 mg/kg xylazine intraperitoneally prior to intravitreal injections. Following injections, mice were placed in normoxia for 7 days. At P17, eyes were harvested and fixed immediately in PBS containing 10% formalin. Cross sections were made 0, 50 and 100 μm away from the optic nerve, stained with hematoxylin and eosin, and examined using light microscopy.

Rat Peritoneal Mesenteric Venule Inflammation Model

The mesenteric ventule inflammation model was performed essentially as described36. Briefly, male Sprague-Dawley rats, weighing between 230-300 g, were anaesthetized with sodium thiobutabarbital (Inactin, 100 mg/kg injected intraperitoneally). A tracheostomy was performed for airway management throughout the experiment. A catheter was inserted into the right femoral artery for intravenous saline administration and blood pressure monitoring. Following midline abdominal incision, part of the mesentery from the small bowel was exteriorised and placed on a temperature controlled Plexiglass chamber for observation of the mesenteric microcirculation via intravital microscopy. The small bowel and mesentery were continuously superfused with modified Krebs-Henseleit solution at 37° C. Mesenteric venules between 25-50 μm in diameter and >100 μm were selected for this study. An Olympus microscope was used to visualise the mesenteric microcirculation. The image was projected by a high-resolution colour video camera (JVC) into a colour high-resolution video-monitor and the image was recorded on Super-VHS tapes. All images were analysed offline for 3 parameters of inflammation: leukocyte flux, adhesion and extravazation. Flux of rolling leukocytes was measured by counting cells rolling past a defined reference point within the 100 μm vessel length of the venule per minute. Leukocyte adhesion was assessed by counting the number of leukocytes that remained stationary for at least 30 sec per 100 μm of length of vessel. The number of adherent leukocytes was calculated per 100 μm of vessel length. The number of leukocytes in tissue adjacent to the venule per microscopic field of view was used to quantitate leukocyte extravazation. Venules were monitored for baseline flux, adhesion and extravazation 20-30 min prior to the commencement of each treatment. One hundred μL of either vehicle.(PBS, pH 7.4, containing FuGENE6 and 1 mM MgCl2) or vehicle containing DNAzyme was applied topically and left undisturbed for 10 min during which time superfusion and suction were temporarily stopped. Superfusion was resumed with either buffer (PBS, pH7.4, containing 0.1% BSA) or buffer containing IL-1 beta (20 ng/ml). Video recordings were made for each treatment at the time of application of vehicle or vehicle plus DNAzyme, and again at 60 min after application. The following exclusion criteria were used prior to the addition of vehicle or IL-1: flux of leukocytes greater than 35 cells/min; the presence of more than 3 adherent cells per 100 μm of vessel; greater than 10 extravasated leukocytes in the field of view.

Cell Culture and siRNA Transfection

Murine brain endothelial cells (bEnd-3) were cultured in Dulbecco's modified Eagle's medium (DMEM), Gibco) with 2 mM glutamine, 5 U/mL penicillinstreptomycin and 10% fetal bovine serum (FBS) at 37° C., 5% CO2. c-Jun siRNA was synthesized with the sequence, 5′-r(AACAGCUUCCUGCCUUUGUAA)dTT-3′. The scrambled counterpart c-Jun siRNAscr had the sequence 5′-r(AAGAUUACUAGCCGUCUUCCU)dTT-3′. RNAifect transfection reagent (Qiagen) was used to deliver the siRNA according to the manufacturer's instruction 6 h after the change of the culture medium to serum-free to initiate growth arrest (at 60% confluence). The “No siRNA” group was mock-transfected with vehicle alone. Eighteen h after transfection, the cells were transfected again and the medium was replaced to one containing 10% serum.

Western Blot Analysis

Serum-starved bEnd-3 cells transfected twice with siRNA, siRNAscr or mock-transfected with vehicle alone were incubated in 10% FBS for the indicated time. The cells were washed in phosphate-buffered saline (PBS), and then harvested into RIPA buffer containing 150 mM NaCl, 50 mM Tris-HCl (pH 7.5), 1% sodium deoxycholate, 0.1% sodiumdodecyl sulfate (SDS), 1% Triton X-100, 5 mM EDTA, 1% aprotinin 2 mM phenylmethyl sulphonyl fluoride (PMSF), followed by 2 freeze-thaw cycles and centrifugation at 8000 g in a microfuge (Sigma, Germany) for 10 minutes at 4° C. to remove cell debris. Two μg of protein was resolved on 12% polyacrylamide gels and transferred to polyvinylidene fluoride (PVDF) nylon membranes (Millipore, Bedford, Mass.). The membranes were then probed with rabbit polyclonal c-Jun antibodies (1:1000 (2 μg/ml), Santa Cruz Biotechnology, Calif.) in TPBS (0.5% Tween 20 in PBS (v/v)) and incubated with horseradish peroxidase-conjugated swine and rabbit 1 gG (1:1000, DAKO, Denmark). The protein bands were visualized using the Western Lightning chemiluminescence kit (PerkinElmer Life Sciences, Boston, Mass.).

Cell Proliferation Assay

Growth-quiescent bEnd-3 cells in 96-well titre plates were transfected with siRNA or siRNAscr and incubated in 10% serum for 3 days. The cells were harvested by trypsinization and resuspended in Isoton II (Coulter Electronics, Brookvale, New South Wales, Australia). Total cells suspensions were quantitated using a Coulter counter (Z series; Counter Electronics).

bEnd-3 Scraping Assay

Cells (3×104) were seeded into 8-well chambers (Nalgene None international, Copenhagen, Denmark) and grown to 60-70% confluence. Cells were transfected (as indicated) and the monolayers were scraped using a P200 micropipette tip. Two days after wounding, the cells were washed twice in PBS, fixed in 5% paraformaldehyde (vol:vol), and stained in hematoxylin-eosin. The cells were counted at 100× magnification. Different fields of view in each slide was counted three times.

Tube Formation Assay

bEnd-3 cells grown in 100-mm petri dishes were transfected once with siRNA or siRNAscr, trypsinized and resuspended in medium containing 10% serum. The cells (2.6×104) were seeded wells of 96-well plates each containing 100 μl of matrigel (BD Biosciences, Mass.). Tubule formation was assessed at the times indicated by washing the wells with PBS, fixing in 10% paraformaldehyde and quantitation under 400× magnification.

Matrigel Plug Assay

Six-to-eight week old female C57BL/6 mice were injected subcutaneously (right flanks) with 500μ of matrigel containing FGF-2 (0.5 μg) (Sigma, Mich.), 100 μg siRNA or siRNAscr and FuGENE6 (2.5 μl). Fourteen days later, plugs were resected and fixed in 10% paraformaldehyde. Five μm cross-sections were stained with hematoxylin-eosion. Animal experiments were approved by the University of New South Wales Animal Care and Ethics Committee.

Results

Dz13 Cleaves c-Jun RNA and Blocks Inducible c-Jun Expression in Vascular Smooth Muscle Cells

Seven DNAzymes (FIG. 2A), bearing two nine nucleotide hybridising arms and a single 15 nt catalytic motif27 targeting various regions of low free energy37 were evaluated for their capacity to cleave 32P-labeled in vitro transcribed c-Jun RNA. The seven DNAzymes and c-Jun transcript were first resolved by denaturing electrophoresis to ensure structural integrity (FIG. 2B). The 668 nt c-Jun transcript was cleaved by DNAzymes Dz10, Dz12, Dz13, Dz14 and Dz15, but not by Dz9 and Dz11 within 1 h at 37° C. under physiological conditions (FIG. 2B). One of the active DNAzymes, Dz13, targeting the G1311U junction (where the translational start site in human c-Jun mRNA is located at A1261UG), cleaved the transcript within 15 min in both a time-dependent (FIG. 2C, upper panel) and dose-dependent (FIG. 2C, lower panel) manner, generating 474 and 194 nt products. DNAzyme Dz13scr (SEQ ID No:2), in which the hybridizing arms of Dz13 were scrambled without disturbing the integrity of the catalytic domain failed to cleave the substrate at any time or stoichiometric ratio (FIG. 2C). To demonstrate Dz13 inhibition of endogenous c-Jun in primary human arterial smooth muscle cells, we performed Western blot analysis on growth-quiescent cells previously transfected with 0.5 μM Dz13 or Dz13scr and exposed to serum for 2 h at 37° C. Serum-inducible c-Jun immunoreactivity (39 kDa) was strongly inhibited by Dz13, whereas its scrambled counterpart had no effect (FIG. 2D).

All of the c-Jun DNAzymes screened targeted regions in the mRNA likely to be exposed in solution, based on a Zukerian prediction of regions of low free energy in the mRNA, and preference for the 5′ end of the mRNA, where the translational apparatus attaches and moves along the chain. The present study shows that Zuker analysis does not guarantee the efficacy of any given DNAzyme in intact cells, since only some, but not all the DNAzyme sequences that cleave in vitro transcribed c-Jun mRNA could actually inhibit cell proliferation. This may be due (although not confined) to differences in conformation and site accessiblity between in vitro transcribed mRNA and endogenous mRNA, DNAzyme transfection efficiency, the concentration of ions and other DNAzyme cofactors in the local cellular millieu, and the possible existence of DNA-binding proteins (such as growth factors, signalling molecules, etc) having unintended preference for certain nucleotide sequences thereby reducing the amount of bioavailable DNAzyme.

The inability of the Zuker analysis to accurately predict DNAzyme efficiency does not hinder the design of effective DNAzyme. Once a particular target is selected, eg c-Jun it is a routine task to design and test a range of DNAzymes which target the particular mRNA, as shown in FIG. 2.

Dz13 Blocks Vascular Smooth Muscle Cell Proliferation

We next determined the influence of Dz13 and the panel of c-Jun DNAzymes on the growth of primary vascular smooth muscle cells derived from human and porcine arteries. The Dz13 target site in c-Jun RNA is conserved between human, pig and rat except for a single C nt at position 1319 which is an A in pig and rat c-Jun RNA (FIG. 3A, upper and middle panels). DNAzyme catalytic efficiency is largely unaffected by substitution of a single pyrimidine nt in the substrate with a purine38, as in this case. Dz13 (0.5 μM) completely blocked serum-inducible proliferation in both cell types (FIGS. 3B & C) and was the most potent of the entire DNAzyme panel. Dz13 inhibition was dose-dependent and detectable at concentrations as low as 100 nM (FIG. 3D). In contrast, Dz13scr failed to inhibit smooth muscle cell proliferation (FIG. 3B), consistent with its inability to affect serum-inducible c-Jun protein (FIG. 2D). Surprisingly, some DNAzymes (Dz9, Dz11, Dz15) stimulated proliferation beyond the effect of serum alone (FIGS. 3B & C). Additionally, Dz10, which cleaved the c-Jun transcript as effectively as Dz13 (FIG. 2B) failed to modulate smooth muscle cell proliferation in either cell type, unlike Dz13 (FIGS. 3B & C). To demonstrate greater potency of the c-Jun DNAzyme compared to its exact antisense oligonucleotide counterpart, we generated As13 which, like Dz13, comprises a phosphodiester backbone and a 3′-3′ linked inverted T, but has no catalytic core (FIG. 3A). As13 produced dose-dependent inhibition, however, Dz13 was twice as potent an inhibitor (FIG. 3D).

Dz13 Inhibits Vascular Smooth Muscle Cell Repair After Injury in Vitro and Intimal Thickening in Rat Carotid Arteries

Smooth muscle cell regrowth at the wound edge following mechanical scraping in an in vitro model39 was abolished by the presence of 0.5 μM Dz13 (FIG. 4), whereas repair in the presence of Dz13scr was not different from wells without oligonucleotide (FIG. 4). Since smooth muscle cell proliferation and repair are processes negatively regulated by Dz13, we next determined whether the c-Jun DNAzyme could influence intimal thickening after ligation injury to rat carotid arteries. The arterial response to injury in rats has provided critical insights on the cellular and molecular events underlying the formation of lesions40. Neointima formation three weeks after injury and local administration of Dz13scr was not significantly different from that observed in the vehicle alone group (FIGS. 5A & B). However, intimal thickening was suppressed by Dz13 of the order of 60% (FIGS. 5A & B) Immunohistochemical analysis revealed that Dz13 blocked the induction of c-Jun immunoreactivity in the smooth muscle cells of the arterial media, whereas Dz13scr had no effect (FIG. 5C). In contrast, neither DNAzyme had any influence on levels of Sp1 (FIG. 5C). Together, these data demonstrate a crucial role for c-Jun in smooth muscle cell proliferation, wound repair and neointima formation.

Arterial neointima formation has previously been inhibited by phosphorothioate-linked antisense oligonucleotides directed against certain transcription factors and cell cycle regulatory molecules, including the p65 subunit of NFκ-B41, c-myb42, c-myc43, and cdc2 kinase/proliferating-cell nuclear antigen (PCNA)44. By directly comparing a phosphodiester-linked DNAzyme with an antisense oligonucleotide targeting the same sequence in c-Jun mRNA, each of identical arm length and bearing a 3′-3′-inverted T, this study demonstrates superior inhibition by the former molecule at any given concentration. c-Jun DNAzymes could serve as new, more potent gene-specific tools to probe the precise function(s) of this transcription factor in a wide array of fundamental cellular processes.

Since c-Jun has been implicated In the pathogenesis of other fibroproliferative-inflammatory processes, such as arthritis45, neoplasia46, acute lung injury47. scarring48, UV-induced corneal damage49 and osteoperosis50, DNAzymes targeting c-Jun and other key regulatory molecules39 may, alone or in combination, show promise in efforts to inhibit proliferative vascular disease and other pathological processes.

Involvement of c-Jun in Angiogenesis

Microvascular endothelial cells have become an important target in cancer therapy, since angiogenesis, the formation of new blood vessels, is an absolute requirement for tumor cell growth and metastasis. It is also a key process in the pathogenesis of other common human diseases such as arthritis and diabetic retinopathy. Angiogenesis is a complex processes involving endothelial cell proliferation, migration, and microtubule formation.

Dz13 Inhibits c-Jun Protein Expression, DNA-Binding Activity, Migration, Proliferation and Tubule Formation by Microvascular Endothelial Cells.

c-Jun unlike the zinc finger transcription factor Sp1, is poorly expressed in growth-quiescent human microvascular endothelial cells but is induced within 2 h of exposure to scrum. Dz13, a DNAzyme targeting the G1311U junction in the coding region of human c-Jun mRNA, blocked c-Jun protein expression at a concentration of 0.4 μM. In contrast, c-Jun activation was not affected by the same concentration of Dz13scr, which bears the active catalytic domain of Dz13 flanked by scrambled 9+9 nt arms but retaining the 3′-3′-linked inverted T that confers stability39. As13, the antisense oligonucleotide counterpart of Dz13 (including the 3′ inverted T) lacking the catalytic domain of the DNAzyme, also inhibited inducible c-Jun protein expression, whereas the scrambled version, As13scr, had no effect. Sp1 levels were not changed by any of the molecules tested (data not shown).

A faint nucleoprotein complex was produced following electrophoretic mobility shift analysis using a 32P-labeled oligonucleotide bearing a consensus binding element for c-Jun and nuclear extracts from quiescent microvascular endothelial cells. The intensity of this complex increased with in 2 h of exposure to serum. Inducible DNA-binding activity was abolished either by Dz13 (0.4 μM) and preincubation of the extracts with c-Jun antibodies (2 μg), whereas Dz13scr had no effect (data not shown).

The preceding findings revealed the capacity of c-Jun DNAzymes to block c-Jun protein expression and DNA-binding activity in a sequence-specific manner. We next determined the effect of these molecules on endothelial tubule formation, proliferation and migration.

Endothelial cells spontaneously form a three-dimensional microtubular capillary-like network on matrigel. Endothelial cells align on the matrigel and form cords within hours of plating. Dz13 blocked tubulogenesis in a dose-dependent manner (FIG. 6). This process was unchanged by the presence of Dz13scr (FIG. 6). These findings demonstrate that c-Jun is required for endothelial network formation. The target site of Dz13 and other DNAzymes are shown in FIG. 7B.

Endothelial cell growth in the presence of serum was inhibited by Dz13 (FIG. 8A) but not by Dz13scr (FIG. 8A). Dz13 inhibition was sequence-specific and dose-dependent maximal at 0.3 μM (FIG. 8B). As13 also attenuated endothelial proliferation (FIG. 8A), although with less potency than the c-Jun DNAzyme at the same concentration (FIG. 8A), consistent with the effect of these agents on the expression of c-Jun.

To determine effect of arm length on the biological activity of Dz13, bearing 9+9 nt arms, we synthesized a nested series of DNAzymes with 10+10, 11+11 and 8+8 nt arms (each with an 3′ inverted T), together with their scrambled arm counterparts. At a concentration of 0.4 μM, Dz13(11+11) and Dz13(8+8) inhibited endothelial proliferation as effectively as native Dz13 (FIG. 8C). However, when these DNAzymes were used at a lower concentration (0.2 μM), it became apparent that Dz 13(11+11) and Dz13(8+8) were less potent inhibitors of endothelial proliferation than Dz13 (FIG. 8C). Dz13(10+10), in comparison to Dz13, Dz13(11+11) or Dz13(8+8), was a poor inhibitor.

Western blot analysis revealed that Dz13(11+11) and Dz13(8+8), like Dz 13, inhibited serum-inducible c-Jun expression, whereas Dz13(10+10), Dz13(11+11)scr and Dz13(8+8)scr had little effect. Reprobing the stripped blot with antibodies to Sp1 revealed unaltered levels of this nuclear protein. In support of these data, Dz13(11+11) and Dz13(8+8), like Dz13, cleaved their 40 nt 32P-labeled synthetic RNA substrate in a time-dependent manner, whereas Dz13(10+10), Dz13(11+11)scr and Dz13(8+8)scr failed to cleave (data not shown).

To demonstrate a role for c-Jun In microvascular endothelial cell migration, we scraped an endothelial monolayer in vitro and quantitated the population of cells in the denuded zone after 2 days, in the absence and presence of DNAzyme. Dz13 inhibited this reparative response to injury in a dose- and sequence-dependent manner. Modest inhibition of regrowth was apparent in the presence of 0.2 μM Dz13 (FIG. 9A) with almost complete inhibition observed at 0.4 μM (FIG. 9A). Dz13scr did not interfere with endothelial regrowth in this concentration range (FIG. 9A). These findings were confirmed using modified Boyden chambers coated with a reconstituted basement membrane (matrigel). Microvascular endothelial cell invasion through matrigel to the underside of the membrane was blocked 50% by Dz13 but not Dz13scr (FIG. 9B). Cell migration through filters coated with collagen type I was greater than with matrigel and also inhibited by 50% by Dz13, but not Dz13scr (FIG. 9B).

Dz13 Inhibits Microvascular Endothelial Cell MMP-2 mRNA, Protein Expression and Proteolytic Activity.

Matrix metalloproteinases (MMPs), proteinases that cleave basement membrane and extracellular matrix molecules, are key to the process of angiogenesis51. For example, mice deficient in MMP-2 (also known as gelatinase A) have compromised tumor-inducible angiogenesis and progression52. We hypothesised that Dz13 activity is mediated by its capacity to inhibit the expression of MMP-2. Assessment of MMP-2 mRNA and protein expression by semi-quanitative RT-PCR and enzyme-linked immunosorbent assay, respectively, demonstrated reduced MMP-2 expression upon treatment with Dz13 but no change using Dz13scr (FIG. 10). Analysis of MMP-2 activity secreted into the culture medium by gelatin zymography revealed significantly reduced MMP-2 proteolysis of gelatin by Dz13, which was rescued by overexpression of c-Jun. There was no change in MMP-2 activity in the presence of Dz13scr.

Dz13 Inhibits VEGF165-Induced Neovascularization in Rat Cornea.

Corneal neovascularization is a sight-threatening condition usually associated with inflammatory or infectious disorders53. A hallmark process in corneal disease is the invasion of blood vessels into what is normally avascular tissues54. We evaluated the capacity of Dz13 to inhibit angiogenesis in rat model of corneal neovascularization, a process involving MMP-2 expressions55. Implantation of vascular endothelial growth factor (VEGF)165-soaked disks in the normally avascular rat cornea stimulates new blood vessel growth from the limbus toward the implant within 5 days. This growth factor is also strongly implicated in the pathogenesis of human corneal neovascularization56. Western blot analysis demonstrates that VEGF165 can induce c-Jun expression and that this is blocked by Dz13 but not by Dz13scr (data not shown). Sp1 levels were unchanged. Dz13 also inhibited VEGF165 -inducible microvascular tubule formation in vitro. Slit lamp biomicroscopic visualization demonstrated that Dz13 blocked the corneal angiogenic response to VEGF165 following its conjunctival administration in a sequence-specific manner. Quantitative determination of neovascularization revealed 81% inhibition in the number of blood vessels (FIG. 11A). Dz13 inhibited the corneal surface area occupied by these new vessels by 74% (FIG. 11B).

Dz13 Inhibits Solid Melanoma Growth in Mice.

Aggressive melanoma lesions are associated with a significant increase in blood vessel density57. Previous studies have demonstrated that the in vivo growth of solid B16 melanoma is blocked by administration of anti-Flk-1 monoclonal antibodies58 and MMP-2 inhibitors59,60 indicating the dependence of tumor growth on angiogenesis and matrix degradation. Immunohistochemical analysis of primary human cutaneous malignant melanoma demonstrates that c-Jun is strongly expressed in endothelial cell-specific CD31+ blood vessels and in surrounding melanoma cells (data not shown). Intense cytoplasmic staining in both cell types was also apparent using antibodies to MMP-2 (data not shown). c-Jun expression in primary melanoma has hitherto not been described.

Dz13 blocked solid B16 growth in C57BL/J6 mice in both a time-dependent and sequence-specific manner (FIG. 12A). The c-Jun DNAzyme inhibited tumor growth by approximately 70% within 14 days, whereas Dz13scr-treated tumors were indistinguishable from the vehicle group (FIG. 12A). Dz13 efficacy was not associated with any difference in body weight relative to the other treatment groups (FIG. 12B). There was also no evidence of lethargy, ruffled fur, skin erythema, and soft faeces, consistent with the lack of a toxic effect. Dz13 blocked c-Jun protein expression (data not shown) and proliferation (FIG. 12C) of murine microvascular endothelial cells, whereas Dz13scr failed to inhibit either process.

Dz13 Localizes Vascular Endothelium and Inhibits Vascular Leakiness/Permeability in the Passive Cutaneous Aanaphylaxis Model

The passive cutaneous anaphylaxis model in mice33 was used to determine whether Dz13 could influence vascular leakiness/permeability. In this model, Evans Blue dye extravazation is used to detect vascular leakage caused by IgE-DNP/DNP-induced passive cutaneous anaphylaxis. Local injection of a single dose (100 μg) of Dz13 was sufficient to Inhibit this anaphylactic response in the cars of Balb/c mice (FIG. 13). In contrast, an identical amount of the Dz13scr, in which the catalytic domain of Dz13 is retained but the hybridising arms of Dz13 are scrambled, had no inhibitory effect (FIG. 13). Confocal fluorescence microscopy of the ear following administration of DNAzyme bearing a fluorescein isothiocyanate (FITC) moiety at the 5′ end of the molecule confirmed delivery of the DNAzyme to the endothelial lining (data not shown). No fluorescence signal was detected when DNAzyme devoid of any FITC group was used thereby excluding artefact caused by autofluorescence.

Dz13 Inhibits VEGF165-Induced Vascular Leakiness/Permeability in the Miles Assay

The capacity of Dz13 to inhibit vascular leakiness/permeability in athymic Balb/c nude mice was investigated using the Miles assays34. In this model, the intradermal administration of VEGF165, causes leakage of Evans Blue dye from the circulating blood into the tissue, which can be measured at 610 nm. It was found that intradermal injection of VEGF165 induced dye leakage within 90 min (FIG. 14). This was blocked by prior administration of a single dose (100 μg) of Dz13, but not Dz13scr (FIG. 14). In contrast, 10 μg of Dz13 or Dz13scr in the same volume of vehicle had no effect on dye leakage (FIG. 14) indicating therefore that Dz13 inhibition of vascular leakiness/permeability is dose-dependent.

DZ13 Inhibits Ocular Neovascularization in the Retinopathy of Prematurity Model

Placement of pup mice into a hyperoxic environment (75% O2) for 4 days prior to normoxia (21% O2) for a further 7 days causes retinal neovascularization during this period of relative “hypoxia”61. To determine whether Dz13 influenced the process of retinal neovascularization, 20 μg of the DNAzyme, scrambled DNAzyme, or the vehicle alone, was Injected directly into the vitreous on the fourth day of 75% O2. Hyperoxia-normoxia caused a 3-fold increase in retinal neovascularization over normoxia alone when vehicle was administered (FIG. 15, compare bars 4 to 2). Dz13 inhibited this angiogenic response (FIG. 15, compare bars 5 to 4), whereas Dz13scr had no effect (FIG. 15, compare bars 6 to 4). Dz13 had no significant effect on the number of retinal blood vessels in normoxic mice (FIG. 15, compare bars 3 to 2).

Dz13 Inhibits Inflammation in Cytokine-Challenged Mesenteric Venules

The capacity of Dz13 to inhibit inflammation in the peritoneal mesenteric venule model was investigated in rats36. Like vascular leakiness/permeability, endothelial cells play a central role in the inflammation processes of leukocyte rolling, adhesion and extravazation. Inflammation contributes to the initial phase of atherogenesis involving endothelial activation62. c-Jun has been described by others as an “inflammatory transcription factor”63. Intravenous infusion of interleukin-1-beta (IL-1-beta) induced leukocyte flux (FIG. 16A), adhesion (FIG. 16B) and extravazation (FIG. 16C) within 60 min of administration. All three processes were completely abrogated by prior local administration of a single dose (35 μg) of Dz13, whereas the same amount of Dz13scr had no effect whatsoever (FIGS. 16A-C). These data demonstrate that c-Jun DNAzymes inhibit key inflammatory processes such as leukocyte rolling, adhesion and extravazation in this well-established microcirculatory inflammation model.

c-Jun siRNA Molecules Inhibit c-Jun Protein Expression and Proliferation of Murine Microvascular Endothelial Cells

Synthetic siRNA targeting nts 2465-2485 of murine c-Jun mRNA (Genbank J04115) 5′-r(AACAGCUUCCUGCCUUUGUAA)dTT-3′ were introduced into growth-quiescent bEnd-3 cells using the commercial transfection agent, RNAifect before stimulating the cells with 10% serum for 1 h. Serum induced c-Jun immunoreactivity was inhibited by the c-Jun siRNA but not by its scrambled counterpart c-Jun siRNAscr relative to levels of beta-actin (FIG. 17). Coomassie bluestained total protein levels were unaltered by exposure to serum nor incubation with siRNA (data not shown).

The effect of siRNA on bEnd-3 proliferation was examined by quantitating cell numbers 2 days following serum stimulation of growth-quiescent cells. bEnd-3 proliferation was strongly induced by serum (FIG. 18). Serum-inducible bEnd-3 proliferation was significantly inhibited by c-Jun siRNA in a dose-dependent fashion, whereas siRNAscr did not inhibit at either concentration (FIG. 18). Cell counts in the scrambled siRNA cohort were not different from those in the mock-transfected group (FIG. 18).

c-Jun siRNA Inhibits bEnd-3 Regrowth

The capacity of c-Jun siRNA to block bEnd-3 cell regrowth was assessed in an in vitro scraping model by quantitating cell numbers in the denuded zone. The cells re-covered the denuded zone virtually completely within 2 days in the absence of siRNA (FIG. 19).

This reparative process, however, was inhibited by the c-Jun siRNA. siRNA inhibition was both sequence-specific and dose-dependent. Cell counts in the scrambled siRNA cohort did not differ from those in the mock-transfected pup (FIG. 19).

c-Jun siRNA Blocks bEnd-3 Tubular Formation

Seeding an endothelial cell suspension onto matrigel (basement membrane extract) facilitates the relatively rapid formation of a three-dimensional tubular capillary-like network. The c-Jun siRNA inhibited tubule formation within 4-6 h (FIG. 20A), whereas the rate of network formation in the presence of c-Jun siRNAscr was indistinguishable from the vehicle control (FIG. 20A). Further experiments showed that tubular formation was dose-dependent (FIG. 20B).

c-Jun siRNA Inhibits Angiogenesis in Mice

Subcutaneous matrigel implants in C57BL/6 mice triggers an angiogenic response and the eventual colonization of the plugs within 14 days64. c-Jun siRNA inhibited neovascularization in the plug by approximately 50% (FIG. 21A). In contrast, c-Jun siRNAscr possessed no inhibitory effect on new blood vessel formation within the plug (FIG. 21A) indicating again sequence-specific inhibition by c-Jun siRNA. There was no observable adverse effect on body weight in any treatment group (FIG. 21B).

Discussion

Strategies that target specific genes in complex biological milieu may be achieved with synthetic agents including ribozymes, minizymes, antisense oligonucleotides, RNA interference and DNAzymes. DNAzymes have been used as versatile tools that tease out the precise functions of the targeted gene in a variety of cellular processes65. These molecules have also been used as inhibitors of restenosis and in-stent restenosis, processes involving vascular smooth muscle cell hyperplasia39,66,67. This study has shown that DNAzymes targeting c-Jun can serve as potent inhibitors of microvascular endothelial cell mitogenesis, migration, corneal neovascularization and solid tumor growth. Accordingly, we provide here the first direct evidence for the key role of c-Jun in angiogenesis.

In addition, this study has shown that a DNAzyme targeting c-Jun blocked vascular leakiness/permeability in the passive cutaneous anaphylaxis model. These DNAzymes also blocked vascular leakage induced by VEGF165 in the Miles assay. Furthermore, DNAzymes targeting c-Jun inhibit leukocyte rolling, adhesion and extravazation in mesenteric venules of rats challenged with interleukin-I beta.

The present study also demonstrates that c-Jun siRNA blocks angiogenic processes by microvascular endothelium in vitro and neovascularization in vivo. c-Jun siRNA inhibited serum-inducible endothelial cell replication and blocked regrowth in an in vitro model of cell scraping. It also suppressed three-dimensional tubular formation on basement membrane extracts in this, and these other models in a dose-dependent manner. Additionally, c-Jun siRNA blocked angiogenesis in mice implanted with subcutancous matrigel plugs without affecting body weight. That the scrambled counterpart had no effect in any of these systems indicating the sequence-specificity of the c-Jun siRNA.

Most notably, a DNZyme targeting c-Jun inhibited retinal neovascularization in pup mice in the retinopathy of maturity model.

The DNAzymes used in this study were composed of native internucleotide phosphodiester linkages, rather than negative-charged phosphorothioates commonly used in antisense oligonucleotides, thereby reducing the propensity for sequence-independent inhibition via nonspecific charge effects. DNAzymes have prima face advantages over RNA-based agents and proteins (like the RNA aptamer Macugen, antibody approaches such as rhuFab and the VEGF receptor ribozyme ANGIOZYME) such as lower cost of synthesis, minimal modification, smaller size, target site flexibility and greater stability.

It will be appreciated by persons skilled in the art that numerous variations and/or modifications may be made to the invention as shown in the specific embodiments without departing from the spirit or scope of the invention as broadly described. The present embodiments are, therefore, to be considered in all respects as illustrative and not restrictive.

References

  • 1. Ross, R., Glomset, J. A., Kariya, B. & Harker, L. A platelet-dependent serum factor that stimulates the proliferation of arterial smooth muscle cells in vitro. Proc. Natl. Acad. Sc. USA 71, 1207-1210 (1974).
  • 2. Miano, J. M., Tota, R. R, Vlasic, N., Danishefsky, K. J. & Stemerman, M. B. Early proto-oncogene expression in rat aortic smooth muscle cells following endothelial removal. Am. J. Pathol. 137, 761-765 (1990).
  • 3. Watson, L. et al. JNK and c-Jun but not ERK and c-Fos are associated with sustained neointima-formation after balloon injury. Eur. J. Clin. Invest 30, 11-17 (2000).
  • 4. Wagner, E. F. AP-1. Oncogene 20, 2334-2335 (2001).
  • 5. Kanatani et al., Transforming growth factor beta and dexamethasone cooperatively enhance c-Jun gene expression and inhibit the growth of human monocytoid leukemia cells. Cell Growth Differ 1996;7:187-196.
  • 6. Nishio, H., Matsui, K., Tsuji, H. & Suzuki, K. Immunohistochemical study of the phosphoylated and activated form of c-Jun NH2-terminal kinase in human aorta. Histochem. J. 33, 167-171 (2001).
  • 7. Metzler, B., Hu, Y., Dietrich, H. & Xu, Q. Increased expression and activation of stress-activated protein kinases/c-Jun NH2-terminal protein kinases in atherosclerotic lesions coincide with p53. Am. J. Pathol. 156, 1875-1886 (2000).
  • 8. Izumi, Y. et al. Gene transfer of dominant-negative mutants of extracellular signal-regulated kinase and c-Jun NH2-terminal kinase prevents neointimal formation in balloon-injured rat artery. Cir. Res. 88(2001).
  • 9. Silverman et al., Vascular smooth muscle cells express the transcriptional corepressor NAB2 in response to injury. Am J Pathol 1999;155:1311-1317.
  • 10. Khachigian et al., GC factor 2 represses platelet-derived growth factor A-chain gene transcription and is itself induced by arterial injury. Circ Res. 1999;11;84:1258-1267.
  • 11. Santiago et al., Induction of the transcriptional repressor Yin Yang-1 by vascular cell injury. Autocrine/paracrine role of endogenous fibroblast growth factor-2. J Biol Chem. 2001;276:41143-1149.
  • 12. Pessah et al., c-Jun interacts with the corepressor TG-interacting factor (TGIF) to suppress Smad2 transcriptional activity. Proc Natl Acad Sci USA 2001;98:6198-6203.
  • 13. Dennler et al., c-Jun inhibits transforming growth factor beta-mediated transcription by repressing Smad3 transcriptional activity. J Biol Chem. 2000;275:28858-28865.
  • 14. Hanahan, D., and Folkman, J. (1996). Patterns and emerging mechanisms of the angiogenic switch during tumorigenesis. Cell 86, 353-364.
  • 15. Haseloff, J., Gerlach, W. L. (1988) Nature (334):585-591.
  • 16. Breaker, R. R. and Joyce, G. (1994) Chemistry and Biology 1:223-229.
  • 17. Koizumi, M, et al. (1989) Nucleic Acids Research 17:7059-7069.
  • 18. Otsuka and Koizumi JP4235919.
  • 19. Kashani-Sabet, M., et al. (1992) Antisense Research and Development 2:3-15.
  • 20. Raillard, S. A. and Joyce, C. F. (1996) Biochemistry 35:11693-11701.
  • 21. Carmi, N., et al. (1996) Chemistry and Biology 3:1039-1046.
  • 22. Symons, R. H. (1992) Annu. Rev. Biochem. 61, 641-671.
  • 23. Sun, L. Q., et al. (1997) Mol. Biotechnology 7:241-251.
  • 24. Pan, T. and Uhlenbeck, O. C. (1996) Biochemistry 31:3887-3895.
  • 25. Tsang, J. and Joyce, G. F. (1994) Biochemistry 33:5966-5973.
  • 26. Breaker, R. R. and Joyce, G. F. (1995) Chem. Biol. 2, 655-660.
  • 27. Santoro, S. W. & Joyce, C. F. A general purpose RNA-cleaving DNA enzyme. Proc. Natl. Acad. Sci. USA 94, 4262-4266 (1997).
  • 28. Kuwabara, T. et al. Comparison of the specificities and catalytic activities of hammerhead ribozymes and DNA enzymes with respect to the cleavage of BCR-ABL chimeric L6 (b2a2) mRNA. Nucleic Acid Res. 25, 3074-3091 (1997).
  • 29. Adamis, A. P, L. P Aiello and R. A. D' Amato. Angiogenesis and ophthalmic disease. Angiogenesis 3, 9-14 (1999).
  • 30. Chiang et al. (1996) J Biol Chem 271:23999.
  • 31. Lowe, H. C. et al. Catalytic oligodeoxynucleotides define a critical regulatory role for early growth response factor-1 in the porcine coronary artery model of in-stent restenosis. Circulation Research 89, 670-677 (2001).
  • 32. Khachigian, L. M., Fahmy, R. G., Zhang, G., Bobryshev, Y. V., and Kaniaros, A (2002). C-Jun regulates vascular smooth muscle cell growth and neointima formation after arterial injury: inhibition by a novel DNAzyme targeting c-Jun. J Biol Chem. 277, 22985-22991.
  • 33. Maekawa, A., Austen, K. F. & Kanaoka, Y. Targeted gene disruption reveals the role of cysteinyl leukotriene 1 receptor in the enhanced vascular permeability of mice undergoing acute inflammatory responses. J Biol Chem 277, 20820-4 (2002).
  • 34. Eriksson, A. et al. Small GTP-binding protein Rae is an essential mediator of vascular endothelial growth factor-induced endothelial fenestrations and vascular permeability. Circulation 107, 1532-8 (2003).
  • 35. Eyetech. Preclinical and phase IA clinical evaluation of an anti-VEGF pegylated aptamer (EYE001) for the treatment of exudative age-related macular degeneration. Retina 22, 143-52 (2002).
  • 36. Dudman, N. P., Temple, S. E., Guo, X. W., Fu, W. & Perry, M. A. Homocysteine enhances neutrophil-endothelial interactions in both cultured human cells and rats In vivo. Circ Res 84, 409-16 (1999).
  • 37. Zuker, M. On finding all suboptimal foldings of an RNA molecule. Science 244, 48-52 (1989).
  • 38. Santoro, S. W. & Joyce, G. F. Mechanism and utility of an RNA-cleaving DNA enzyme. Biochemistry 37, 13330-13342 (1998).
  • 39. Santiago, F. S. et al. New DNA enzyme targeting Egr-1 mRNA inhibits vascular smooth muscle proliferation and regrowth factor injury. Nature Med. 11, 1264-1269 (1999).
  • 40. Clowes, A. W., Reidy, M. A. & Clowes, M. M. Kinetics of cellular proliferation after arterial injury. Lab. Invest. 49, 327-333 (1983).
  • 41. Autieri, M. V., Yue, T.-L., Ferstein, G. Z. & Ohlstein, E. Antisense oligonucleotides to the p65 subunit of NF-kB inhibit human vascular smooth muscle cell adherence and proliferation and prevent neointima formation in rat carotid arteries. Biochem. Biophys. Res. Commun. 213, 827-836 (1995).
  • 42. Simons, M, Edelman, E. R., DeKeyser, J.-L., Langer, R. & Rosenberg, R. Antisense c-myb oligonucleotides inhibit Intimal arterial smooth muscle cell accumulation in vivo. Nature 359, 67-70 (1992).
  • 43. Bennett, M. R. et al Inhibition of vascular smooth muscle cell proliferation in vitro and in vivo by c-mycantisense oligodeoxynucleotides. J. Clin. Invest. 93,820-828 (1994).
  • 44. Morishita, R. et al Single intraluminal delivery of antisense cdc2 kinase and proliferating-cell nuclear antigen oligonucleotides results in chronic inhibition of neointimal hyperplasia. Proc. Natl. Acad. Sci. USA 90, 8474-8478 (1993).
  • 45. Wakisaka, S. et al. Involvement of simultaneous multiple transcription factor expression, including cAMP responsive element binding protein and OCT-1, for synovial cell outgrowth in patients with rheumatoid arthritis Ann. Rheum. Dis. 57, 487-494 (1998).
  • 46. van Dam, H. & Castellazzi, M. Distinct roles of Jun:Fos and Jun:ATF dimers in oncogenesis. Oncogene 20, 2453-2464 (2001).
  • 47. Chen, B. et al. Mesenchymal cells isolated after acute lung injury manifest an enhanced proliferative phenotype. J Clin. Invest. 90, 1778-1785 (1992).
  • 48. Kondo, T., Ohshima. T., Sato, Y., Mayama, T. & Eisenmenger, W. Immunohistochemical study on the expression of c-Fos and c-Jun in human skin wounds. Histochem. J. 32, 509-514 (2000).
  • 49. Gillardon, F., Zimmermann, M. & Uhlmann, E. Expression of c-Fos and c-Jun in the cornea, lens, and retina after ultraviolet irradiation of the rat eye and effects of topical antisense oligodeoxynucleotides. Br. J. Ophthalmol. 79, 277-281 (1995).
  • 50. Shevde, N. K., Bendixen, A. C., Dienger, K. M. & Pike, J. W. Estrogens suppress RANK ligand-induced osteoclast differentiation via a stromal cell independent mechanism involving c-Jun repression. Proc. Natl.. Acad. Sci. USA 97,7829-7834 (2000).
  • 51. Haas, T. L., and Madri, J. A. (1999). Extracellular matrix-driven matrix metalloproteinase production in endothelial cells: implications for angiogenesis. Trends Cardiovasc. Med. 9, 70-77.
  • 52. Itoh T., Tanioka, M., Yoshida, H., Yoshioka, T., Nishimoto, H., and Itohara, S. (1998). Reduced angiogenesis and tumor progression in gelatinase A-deficient mice. Cancer Res. 58, 1048-1051.
  • 53. Chang, J. H., Gabison, E. E., Kato, T., and Azar, D. T. (2001). Corneal neovascularization. Curr. Opin. Ophthalmol. 12, 242-249.
  • 54. Klintworth, G. K. (1977). The contribution of morphology to our understanding of the pathogenesis of experimentally produced corneal vascularization. Invest. Ophthalmol. Vis. Sci. 16, 281-285.
  • 55. Kvanta, A., Sarman, S., Fagerholm, P., Seregard, S., and Steen, B. (2000). Expression of matrix metalloproteinase-2 (MMP-2) and vascular endothelial growth factor (VEGF) in inflammation-associated corneal neovascularization Exp Eye Res 70, 419-428.
  • 56. Lai, C. M., Spilsbury, K., Brankov, M., Zaknich, T., and Rakoczy, P. E. (2002). inhibition of corneal neovascularization by recombinant adenovirus mediated antisense VEGF RNA. Exp Eye Res 75, 625-634.
  • 57. de Waal, R. M., van Altena, M. C., Erhard, H., Weidle, U. H., Nooijen, P. T., and Ruiter, D. J. (1997). Lack of lymphangiogenesis in human primary cutaneous melanoma. Consequences for the mechanism of lymphatic dissemination. Am. J. Pathol. 150, 1951-1957.
  • 58. Prewett, M., Huber, J., Li, Y., Santiago, A., O'Connor, W., King, K., Overholser, J., Hooper, A., Pytowski, B., Witte, L., Bohlen, P., and Hicklin, D.J. (1999). Antivascular endothelial growth factor receptor (fetal liver kinase 1) monoclonal antibody inhibits tumor angiogenesis and growth of several mouse and human tumors. Cancer Res. 59, 5209-5218.
  • 59. Maekawa, R., Maki, H., Yoshida, H., Hojo, K., Tanaka, H., Wada, T., Uchida, N., Takeda, Y., Kasai, H., Okamoto, H., Tsuzuki, H., Kambayash, Y., Watanabe, F., Kawada, K., Toda, K., Ohtani, M., Sugita, K., and Yoshioka, T. (1999). Correlation of antiangiogenic and antitumor efficacy of N-biphenyl sulfonyl-phenylalanine hydroxiamic acid (BPHA), an orally-active, selective matrix metalloproteinase inhibitor. Cancer Res 59, 1231-1235.
  • 60. Shalinsky, D. R., Brekken, J., Zou, H., McDermott, C. D., Forsyth, P., Edwards, D., Margosiak, S., Bender, S., Truitt, G., Wood, A., Varki, N. M., and Appelt, K. (1999). Broad antitumor and antiangiogenic activities of AG3340, a potent and selective MMP inhibitor undergoing advanced oncology clinical trials. Ann N Y Acad Sci 878, 236-270.
  • 61. Smith, L. E. et al. Oxygen-induced retinopathy in the mouse. Invest Ophthalmol Vis Sci 35,101-11 (1994).
  • 62. Ross, R. Atherosclerosis: an inflammatory disease. N. Engl. J. Med. 340, 115-126 (1999).
  • 63. Dichtl, W. et al. HMG-CoA reductase inhibitors regulate inflammatory transcription factors in human endothelial and vascular smooth muscle cells. Arterioscler Thromb Vase Biol 23, 58-63 (2003).
  • 64. Fahmy, R. G., Dass, C. R., Sun, L. Q., Chesterman, C. N. and Khachigian, L. M. (2003) Transcription factor Egr-1 supports FGF-dependent angiogenesis during neovascularizaltion and tumor growth. Nat Med. 9, 1026-1032.
  • 65. Khachigian, L. M. (2002). DNAzymes: cutting a path to a new class of therapeutics. Curr. Opin. Mol. Therap. 4,119-121.
  • 66. Lowe, H. C., Fahmy, R. G., Kavurma, M. M., Baker, A., Chesterman, C. N., and Khachigian, L. M. (2001). Catalytic oligodeoxynucleotides define a key regulatory role for early growth response factor-1 in the porcine model of coronary in-stent restenosis. Circulation Research 89, 670-677.
  • 67. Lowe, H. C., Chesterman, C. N., and Khachigian, L. M. (2002). Catalytic antisense DNA molecules targeting Egr-1 inhibit neointima formation following permanent ligation of rat common cartoid arteries. Thromb. Haemost. 87,134-140.

Claims

1. A method of preventing or reducing angiogenesis and/or neovascularisation in a subject, the method comprising administering to the subject a prophylactically effective dose of a nucleic acid which decreases the level of c-Jun mRNA, c-Jun mRNA translation or nuclear accumulation or activity of c-Jun.

2. A method according to claim 1 wherein the angiogenesis is ocular angiogenesis.

3. A method according to claim 1 wherein the subject is suffering from a condition selected from the group consisting of trachoma, retinopathy of prematurity, diabetic retinopathy, neovascular glaucoma and age-related macular degeneration

4. A method according to claim 3 wherein the condition is age-related macular degeneration.

5. A method according to claim 1 wherein the nucleic acid is selected from the group consisting of a DNAzyme targeted against c-Jun, a c-Jun antisense oligonucleotide, a ribozyme targeted against c-Jun, and a ssDNA targeted against c-Jun dsDNA such that the ssDNA forms a triplex with the c-Jun dsDNA.

6. A method according to claim 1 wherein the nucleic acid is dsRNA targeted against c-Jun mRNA, a nucleic acid molecule which results in production of dsRNA targeted against c-Jun mRNA or small interfering RNA molecules targeted against c-Jun mRNA.

7. A method according to claim 1 wherein the method is achieved by cleavage of c-Jun mRNA by a sequence-specific DNAzyme.

8. A method according to claim 7 wherein the DNAzyme comprises:

(i) a catalytic domain which cleaves mRNA at a purine:pyrimidine cleavage site;

(ii) first binding domain contiguous with the 5 ′ end of the catalytic domain; and

(iii) a second binding domain contiguous with the 3′ end of the catalytic domain;

wherein the binding domains are sufficiently complementary to two regions immediately flanking a purine:pyrimidine cleavage site within the c-Jun mRNA such that the DNAzyme cleaves the c-Jun mRNA.

9. A method according to claim 8 wherein the binding domains have a length of at least 6 nucleotides.

10. A method according to claim 8 wherein both binding domains have a combined total length of at least 14 nucleotides.

11. A method according to claim 8 wherein the binding domain lengths are 9 nucleotides.

12. A method according to claim 8 wherein the catalytic domain has a nucleotide sequence GGCTAGCTACAACGA.

13. A method according to claim 8 wherein the cleavage site is within the region of residues A287 to A1501 of the c-Jun mRNA.

14. A method according to claim 8 wherein the cleavage site is within the region of residues U1296 to G1497 of the c-Jun mRNA.

15. A method according to claim 14 wherein the cleavage site is the GU site corresponding to nucleotides 1311-1312.

16. A method according to claim 7 wherein the DNAzyme has the sequence 5′-cgggaggaaGGCTAGCTACAACGAgaggcgttg-3′.

17. A method according to claim 7 wherein the DNAzyme incorporates a 3′-3′ inversion at one or more termini.

18. A method according to claim 5 wherein the c-Jun antisense oligonucleotide comprises a sequence which hybridises to c-Jun within the region of residues U1296 to G1497.

19. A method according to claim 18 wherein the antisense oligonucleotide has the sequence CGGGAGGAACGAGGCGTTG.

20. A method according to claim 5 wherein the ribozyme cleaves the c-Jun mRNA in the region of residues A287 to A1501.

21. A method according to claim 20 wherein the ribozyme cleaves the c-Jun mRNA in the region of residues U1296 to G1497.

22. A method according to claim 6 wherein the dsRNA targets c-Jun mRNA in the region of residues A287 to A1501.

23. A method according to claim 22 wherein the dsRNA targets c-Jun mRNA in the region of residues U1296 to G1497.

24. A method according to claim 6 wherein the small interfering RNA molecule targeted against c-Jun mRNA has the sequence 5′-r(AACAGCUUCCUGCCUUUGUAA)dTT3′.

Resources

Images & Drawings included:

Sources:

Similar patent applications:

Recent applications in this class: