US20120134969A1
2012-05-31
13/322,195
2010-05-24
With an aim to provide a novel factor inducing proliferation of neural stem cells and differentiation of these cells into nerve cells, a pharmaceutical composition comprising 1) CRBN, 2) a nucleic acid encoding CRBN, or 3) a stem cell or a neural progenitor cell in which CRBN is expressed, a method including administering the pharmaceutical composition to a non-human animal and inducing proliferation of neural stem cells or neural progenitor cells of the non-human animal and differentiation of these cells into nerve cells, and a method for screening for a therapeutic drug for a disease of cerebral cortex or a surgical injury of cerebral cortex, using CRBN, are provided.
Get notified when new applications in this technology area are published.
C12N9/48 » CPC main
Enzymes; Proenzymes; Compositions thereof ; Processes for preparing, activating, inhibiting, separating or purifying enzymes; Hydrolases (3) acting on peptide bonds (3.4)
A61K38/45 » CPC further
Medicinal preparations containing peptides; Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof; Enzymes; Proenzymes; Derivatives thereof Transferases (2)
C07K14/4705 » CPC further
Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used; Regulators; Modulating activity stimulating, promoting or activating activity
C07K14/475 » CPC further
Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans Growth factors; Growth regulators
C07K19/00 » CPC further
Hybrid peptides
C12N9/93 » CPC further
Enzymes; Proenzymes; Compositions thereof ; Processes for preparing, activating, inhibiting, separating or purifying enzymes Ligases (6)
G01N33/5058 » CPC further
Investigating or analysing materials by specific methods not covered by groups -; Biological material, e.g. blood, urine ; Haemocytometers; Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics involving specific cell types Neurological cells
A61K38/00 » CPC further
Medicinal preparations containing peptides
C07K2319/43 » CPC further
Fusion polypeptide containing a tag for immunodetection, or an epitope for immunisation containing a FLAG-tag
C12Y304/00 » CPC further
Hydrolases acting on peptide bonds, i.e. peptidases (3.4)
C12Y603/02019 » CPC further
Ligases forming carbon-nitrogen bonds (6.3); Acid—amino-acid ligases (peptide synthases)(6.3.2) Ubiquitin-protein ligase (6.3.2.19), i.e. ubiquitin-conjugating enzyme
G01N2500/04 » CPC further
Screening for compounds of potential therapeutic value Screening involving studying the effect of compounds C directly on molecule A (e.g. C are potential ligands for a receptor A, or potential substrates for an enzyme A)
G01N2800/28 » CPC further
Detection or diagnosis of diseases Neurological disorders
A61K35/12 IPC
Medicinal preparations containing materials or reaction products thereof with undetermined constitution Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
C12N9/00 IPC
Enzymes; Proenzymes; Compositions thereof ; Processes for preparing, activating, inhibiting, separating or purifying enzymes
A61K48/00 IPC
Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
A61P25/28 » CPC further
Drugs for disorders of the nervous system for treating neurodegenerative disorders of the central nervous system, e.g. nootropic agents, cognition enhancers, drugs for treating Alzheimer's disease or other forms of dementia
A61P25/16 » CPC further
Drugs for disorders of the nervous system for treating abnormal movements, e.g. chorea, dyskinesia Anti-Parkinson drugs
A61P25/00 » CPC further
Drugs for disorders of the nervous system
A61P25/14 » CPC further
Drugs for disorders of the nervous system for treating abnormal movements, e.g. chorea, dyskinesia
C12N15/63 IPC
Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor; Recombinant DNA-technology Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
C12Q1/00 IPC
Measuring or testing processes involving enzymes, nucleic acids or microorganisms ; Compositions therefor; Processes of preparing such compositions
C12Q1/02 IPC
Measuring or testing processes involving enzymes, nucleic acids or microorganisms ; Compositions therefor; Processes of preparing such compositions involving viable microorganisms
A61K35/30 IPC
Medicinal preparations containing materials or reaction products thereof with undetermined constitution; Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells Nerves; Brain; Eyes; Corneal cells; Cerebrospinal fluid; Neuronal stem cells; Neuronal precursor cells; Glial cells; Oligodendrocytes; Schwann cells; Astroglia; Astrocytes; Choroid plexus; Spinal cord tissue
C12Q1/68 IPC
Measuring or testing processes involving enzymes, nucleic acids or microorganisms ; Compositions therefor; Processes of preparing such compositions involving nucleic acids
G01N33/566 IPC
Investigating or analysing materials by specific methods not covered by groups -; Biological material, e.g. blood, urine ; Haemocytometers; Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing; Immunoassay; Biospecific binding assay; Materials therefor using specific carrier or receptor proteins as ligand binding reagents where possible specific carrier or receptor proteins are classified with their target compounds
A61K38/17 IPC
Medicinal preparations containing peptides; Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
The present invention relates to a pharmaceutical composition used for treating a disease of cerebral cortex and the like, a method comprising administering the pharmaceutical composition to a non-human animal and inducing proliferation of neural stem cells or neural progenitor cells of the non-human animal and differentiation of these cells into nerve cells, and a method for screening for a therapeutic drug for a disease of cerebral cortex and the like.
The recent advancements in research on nerve cells have given rise to the possibility of regenerating brain that is lost by Alzheimer's disease, trauma, and the like. In such brain regeneration, elucidation of the factor inducing differentiation into nerve cells is important.
With regard to induction of differentiation into nerve cells, Mangale et al. have recently reported that a protein called Lhx2 induces neural stem cells or neural progenitor cells to become the cortex, while inhibiting induction of those cells to become the hippocampus (Non Patent Literature 1).
As described above, if a factor that induces differentiation into nerve cells can be newly discovered, it would enable regenerating nerve cells, and using them for treating a disease of cerebral cortex such as Alzheimer's disease.
The present invention was completed under the foregoing technical background with an aim to provide a novel factor that induces differentiation into nerve cells.
The present inventors conducted intensive studies to solve the aforementioned problem. As a result, the present inventors have found that 1) a protein called CRBN (cereblon) functions to differentiate stem cells into neural stem cells or neural progenitor cells, and further into nerve cells, 2) CRBN induces proliferation of central nervous stem cells or neural progenitor cells, and 3) CRBN functions downstream of Lhx2, which is a known cerebral cortex selector factor.
CRBN is a protein that forms a ubiquitin ligase complex and its amino acid sequence is also publicly known; however, it has never been known before that CRBN functions to induce proliferation of central nervous stem cells or neural progenitor cells and differentiation of these cells into nerve cells.
There is a report by Higgins et al. describing the relationship between CRBN and the brain (J. J. Higgins et al., (2004), Neurology, 63, 1927-1931). Higgins et al. have reported that a family lineage involving mild mental retardation is observed to bear a mutated crbn gene. However, this report does not suggest that CRBN has the aforementioned functions.
The present invention was accomplished based on the foregoing findings.
That is, the present invention provides the following [1] to [11].
[1] A pharmaceutical composition comprising 1) CRBN, 2) a nucleic acid encoding CRBN, or 3) a stem cell or a neural progenitor cell in which CRBN is expressed.
[2] The pharmaceutical composition according to [1], wherein the nucleic acid encoding CRBN is inserted in a virus vector.
[3] The pharmaceutical composition according to [1], comprising CRBN and a protein that forms a ubiquitin ligase complex with CRBN.
[4] The pharmaceutical composition according to [1] or [2], comprising the nucleic acid encoding CRBN and a nucleic acid encoding a protein that forms a ubiquitin ligase complex with CRBN.
[5] The pharmaceutical composition according to [1], comprising a stem cell or a neural progenitor cell in which CRBN and a protein that forms a ubiquitin ligase complex with CRBN are expressed.
[6] The pharmaceutical composition according to any of [1] to [5], used for treating a disease of cerebral cortex or a surgical injury of cerebral cortex.
[7] The pharmaceutical composition according to any of [1] to [5], used for regenerating cerebral cortex.
[8] A method for comprising administering the pharmaceutical composition according to any of [1] to [7] to a non-human animal and proliferating a neural stem cell or a neural progenitor cell of the non-human animal.
[9] A method comprising administering the pharmaceutical composition according to any of [1] to [7] to a non-human animal and differentiating a neural stem cell or a neural progenitor cell of the non-human animal into a nerve cell.
[10] A method for screening for a therapeutic drug for a disease of cerebral cortex or a surgical injury of cerebral cortex, comprising contacting a test substance with a ubiquitin ligase complex containing CRBN and measuring a ubiquitin ligase activity of the ubiquitin ligase complex to select a test substance with an increased ubiquitin ligase activity.
[11] A method for screening for a therapeutic drug for a disease of cerebral cortex or a surgical injury of cerebral cortex, comprising culturing a neural stem cell or a neural progenitor cell in the presence of a test substance and measuring an expression level of CRBN in the neural stem cell or the neural progenitor cell to select a test substance with an increased expression level of CRBN.
CRBN contained in the pharmaceutical composition of the present invention induces proliferation of central nervous stem cells or neural progenitor cells and differentiation of these cells into nerve cells. Accordingly, the pharmaceutical composition of the present invention is useful as a therapeutic drug for a disease of cerebral cortex such as Alzheimer's disease. Further, CRBN is also useful as a target substance for the development of a novel therapeutic drug for a disease of cerebral cortex.
FIG. 1 shows fluorescence microscopic pictures of zebrafish embryos. In these pictures, the upper left shows a normal embryo, the upper right shows an embryo in which the crbn gene is overexpressed, the lower left shows an embryo in which the lhx2 gene is knocked down, and the lower right shows an embryo in which the lhx2 gene is knocked down while the crbn gene is overexpressed.
FIG. 2 shows microscopic pictures of zebrafish embryos. The picture on the right shows an embryo in which the crbn gene is overexpressed and the picture on the left shows an untreated embryo. Both pictures were taken at the same magnification.
FIG. 3 shows microscopic pictures of zebrafish, into which crbn gene-overexpressing cells (fluorescently labeled with rhodamine) are transplanted. The top pictures and the bottom pictures were taken at 200-fold magnification and 100-fold magnification, respectively. Also, the pictures on the left column are bright-field images and the pictures on the right column are fluorescent images.
FIG. 4 shows electrophoresis images for the detection of the ubiquitin ligase activity of a CRBN complex (FH-CRBN complex) using an in vitro reaction system. The images on the left, middle, and right show ubiquitin, Cul4A, which is a CRBN complex-forming factor, and ubiquitinated CRBN, respectively, each detected by immunoblotting. Mock indicates the case of the use of a control experimental sample.
FIG. 5 shows an electrophoresis image for the detection of the ubiquitin ligase activity of the CRBN complex in live cells.
FIG. 6 shows close-up pictures of zebrafish heads in which glia cells were fluorescently stained. The left part of the picture corresponds to the front end portion. The picture on the left shows a normal individual and the picture on the right shows an individual with overexpressed CRBN.
FIG. 7 shows close-up pictures of zebrafish heads in which serotonin-producing cells were fluorescently stained. These pictures were taken from the dorsal side of the brain. The top part of the picture corresponds to the front end portion. The picture on the left shows a normal individual and the picture on the right shows an individual with overexpressed CRBN. In the Figure, numbers 1, 2, and 3 indicates the pineal gland, the ventral posterior tuberculum, and the raphe nucleus, respectively.
FIG. 8 shows pictures of zebrafish in which undifferentiated cells are transplanted into the cerebral ventricle. Pictures A to D show the cases in which cells that do not express CRBN are transplanted, and pictures E to H show the cases in which cells that express CRBN are transplanted. Pictures A and E are bright-field images, pictures B and E are fluorescence images of Alexa Fluor (R) (indicating the distribution of tubulin), pictures C and G are fluorescence images of rhodamine (indicating the distribution of donor cells), and pictures D and H are fluoresce images of Alexa Fluor (R) and rhodamine.
Hereinbelow, the present invention will be described in detail.
The pharmaceutical composition of the present invention comprises 1) CRBN, 2) a nucleic acid encoding CRBN, or 3) a stem cell or a neural progenitor cell in which CRBN is expressed.
CRBN is a known protein, and the base sequence of the gene encoding CRBN (crbn gene) is also published in a database. For example, the base sequences of human-derived crbn gene, mouse-derived crbn gene, rat-derived crbn gene, and zebrafish-derived crbn gene are registered in Entrez Gene under Gene ID: 51185, Gene ID: 58799, Gene ID: 297498, and Gene ID: 445491, respectively. Naturally-derived CRBN and crbn gene may be used, while modified CRBN capable of forming an active ubiquitin ligase complex, being composed of an amino acid sequence resulting from deletion, substitution, or addition of one or several amino acids in the amino acid sequence of naturally-derived CRBN and a gene encoding this modified form may be used.
The pharmaceutical composition of the present invention may contain any of CRBN, a nucleic acid encoding CRBN, and a stem cell or a neural progenitor cell in which CRBN is expressed as an active ingredient. The pharmaceutical composition containing these substances as an active ingredient can be prepared and used in a similar manner to a known drug containing a protein, a nucleic acid, a stem cell, and a progenitor cell as an active ingredient.
The nucleic acid encoding CRBN may be either DNA or RNA. The nucleic acid is preferably inserted in an appropriate vector so that it can act on neural stem cells in the brain. Examples of such a vector include a virus vector. Specific examples of the virus vector include an adenovirus vector, a retrovirus vector, and a lentivirus vector.
The stem cell in which CRBN is expressed is preferably an iPS cell derived from the patient him/her-self so as to be able to avoid rejection; however, other stem cells such as ES cells, adult stem cells, and cord blood stem cells may also be used. CRBN may be expressed in stem cells, and it is preferably overexpressed. A method for expressing or overexpressing CRBN can be carried out in accordance with, for example, the method of Ando et al. (Ando and Okamoto, Mar. Biotechnol. 8(3): 295-303, 2006), while it may also be carried out by other methods such as other microinjection methods, the caged RNA method (Ando et al., Nat. Genet. 28: 317-325, 2001), the electroporation method, the calcium phosphate method, the DEAE dextran method, the virus method, sonoporation method, and the transposon method.
No particular limitation is imposed on the administration method of the pharmaceutical composition of the present invention, and it can be appropriately determined according to the kind of the active ingredient, and the like. When CRBN or a nucleic acid encoding CRBN is used as active ingredients, the pharmaceutical composition can be administered by injection, drip infusion, and the like into the cerebral ventricle, the skin, the intraperitoneal cavity, the vein, the artery, or the spinal marrow fluid. Given that CRBN acts on the neural stem cells or neural progenitor cells in the brain, except for the case in which it is administered into the cerebral ventricle, it is preferable to provide such a treatment that would enable passage of CRBN through the blood brain barrier. As such a treatment, methods such as binding CRBN with essential endogenous substances that are actively taken up, carrying out structural modification of CRBN so as to avoid recognition by efflux transporters, and reducing the molecular weight to such a size that contains only a minimum functional domain may be possible. When stem cells or neural progenitor cells are used as active ingredients, the pharmaceutical composition is directly administered into the cerebral ventricle.
No particular limitation is imposed on the dose of the pharmaceutical composition of the present invention, and it can be appropriately determined according to the kind of the active ingredient, and the like. As for the daily dose for adults, when CRBN is administered, it is preferably administered in an amount of approximately 0.5 mg to 100 mg; when a nucleic acid encoding CRBN is administered, it is preferably administered in an amount of approximately 1 mg to 200 mg; and when a stem cell or a neural progenitor cell in which CRBN is expressed is administered, preferably 500 cells to 5000 cells are administered in a volume of approximately 50 μl to 500 μl.
When the pharmaceutical composition of the present invention is administered by injection or drip infusion, the injection fluid and the drip infusion fluid may contain components that are normally contained in these solutions. Examples of such a component include a liquid carrier (such as potassium phosphate buffer, physiological saline, Ringer's solution, distilled water, polyethylene glycol, plant oil and fat, ethanol, glycerin, dimethyl sulfoxide, and polypropylene glycol), antimicrobial agents, local anesthetics (such as procaine hydrochloride and dibucaine hydrochloride), buffer (such as tris-HCl buffer and hepes buffer), and osmotic pressure regulators (such as glucose, sorbitol, and sodium chloride).
The pharmaceutical composition of the present invention may contain: 1) in addition to CRBN, a protein that forms a ubiquitin ligase complex with CRBN, 2) in addition to a nucleic acid encoding CRBN, a nucleic acid encoding a protein that forms a ubiquitin ligase complex with CRBN, and 3) in addition to CRBN, a stem cell or a neural progenitor cell in which a protein that forms a ubiquitin ligase complex with CRBN are expressed. Examples of the protein that forms a ubiquitin ligase complex with CRBN include DDB1 (Damaged DNA Binding protein), Cul4A (Cullin 4A), Cul4B (Cullin 4B), and Rod (RBX1). Similarly to CRBN, these proteins are known proteins, and the base sequences of the genes encoding these proteins (i.e., ddb1 gene, cul4a gene, cul4b gene, and roc1 gene) are also published in a database. For example, the base sequences of human-derived ddb1 gene, mouse-derived ddb1 gene, rat-derived ddb1 gene, and zebrafish-derived ddb1 gene are registered in Entrez Gene under Gene ID: 1642, Gene ID: 13194, Gene ID: 64470, and Gene ID: 393599, respectively; the base sequences of human-derived cul4a gene, mouse-derived cul4a gene, rat-derived cul4a gene, and zebrafish-derived cul4a gene are registered in Entrez Gene under Gene ID: 8451, Gene ID: 99375, Gene ID: 361181, and Gene ID: 394002, respectively; the base sequences of human-derived cul4b gene, mouse-derived cul4b gene, rat-derived cul4b gene, and zebrafish-derived cul4b gene are registered in Entrez Gene under Gene ID: 8450, Gene ID: 72584, Gene ID: 302502, and Gene ID: 560313, respectively; and the base sequences of human-derived roc1 gene, mouse-derived roc1 gene, rat-derived roc1 gene, and zebrafish-derived roc1 gene are registered in Entrez Gene under Gene ID: 9978, Gene ID: 56438, Gene ID: 300084, and Gene ID: 449846, respectively. Each of these proteins and genes may be naturally-derived one, while a modified protein capable of forming an active ubiquitin ligase complex, being composed of an amino acid sequence resulting from deletion, substitution, or addition of one or several amino acids in the amino acid sequence of a naturally-derived protein and a gene encoding this modified protein may be used. The ubiquitin ligase complex contains, in addition to CRBN, three kinds of proteins, which are DDB1, CuL4A, and Roc1, or DDB1, CuL4B, and Roc1. Although the pharmaceutical composition of the present invention preferably contains (or expresses) all these three kinds of proteins (or nucleic acids encoding these proteins), it may contain only one or some of them.
The pharmaceutical composition of the present invention can be used for the treatment of a disease of cerebral cortex or a surgical injury of cerebral cortex, or for regenerating cerebral cortex. Examples of the disease of cerebral cortex include Alzheimer's disease, Parkinson's disease, Creutzfeldt-Jakob disease, Huntington's disease, progressive supranuclear palsy, and corticobasal degeneration.
Although the pharmaceutical composition of the present invention is intended to be used for humans, it may be administered to an animal other than humans to induce proliferation of the neural stem cells or neural progenitor cells or differentiation of these cells into nerve cells in these animals. The target animals are mainly vertebrates, and examples thereof include mice, rats, monkeys, dogs, ferrets, hamsters, chickens, xenopus, zebrafish, and medaka.
It has been confirmed only in zebrafish that CRBN induces proliferation of neural stem cells or neural progenitor cells and differentiation of these cells into nerve cells, as described in Examples. However, 70 to 80% of the genome synteny is conserved between humans and zebrafish (Nature Reviews Genetics 8, 353-367 (May 2007)). Accordingly, it is predicted that CRBN exhibits similar effects as those confirmed in zebrafish also in other vertebrates including humans.
Because CRBN induces proliferation of neural stem cells or neural progenitor cells and differentiation of these cells into nerve cells, the protein can be used for screening for a therapeutic drug for a disease of cerebral cortex or a surgical injury of cerebral cortex. This is specifically exemplified by the following methods (A) and (B).
(A) A method for screening for a therapeutic drug for a disease of cerebral cortex or a surgical injury of cerebral cortex, comprising the steps of contacting a test substance with a ubiquitin ligase complex containing CRBN and measuring a ubiquitin ligase activity of the ubiquitin ligase complex to select a test substance with an increased ubiquitin ligase activity.
(B) A method for screening for a therapeutic drug for a disease of cerebral cortex or a surgical injury of cerebral cortex, comprising the steps of culturing a neural stem cell or a neural progenitor cell in the presence of a test substance and measuring an expression level of CRBN in the neural stem cell or the neural progenitor cell to select a test substance with an increased expression level of CRBN.
In the method (A), the ubiquitin ligase activity can be measured in accordance with, for example, the method of Angers et al. (Nature, 443, 590-593, 2006) and the method of Groisman et al. (Cell, 113, 357-367, 2003).
In the method (A), whether or not the test substance has increased the ubiquitin ligase activity can be judged by measuring the ubiquitin ligase activity of a ubiquitin ligase complex containing CRBN without contacting with the test substance and making a comparison with the value thus obtained.
The substance thus selected by the method (A) acts to increase the ubiquitin ligase activity of the CRBN-containing ubiquitin ligase complex present in neural stem cells or neural progenitor cells in the living body. It is speculated that proliferation of neural stem cells or neural progenitor cells and differentiation of these cells into nerve cells effected by CRBN are mediated by the ubiquitin ligase activity possessed by this complex. Accordingly, it is assumed that the substance that is selected by the method (A) facilitates proliferation of neural stem cells or neural progenitor cells and differentiation of these cells into nerve cells effected by CRBN, and thus is therapeutically effective for a disease of cerebral cortex and a surgical injury of cerebral cortex.
In the method (B), as the neural stem cells to be used, basically cells such as ES cells, iPS cells, and adult stem cells that are subjected to neuronal differentiation induction are employed. Further, neural stem cells such as ones derived from the subventricular zone of adult mice or the hippocampus of adult rats may also be used.
In the method (B), a method for measuring the expression level of CRBN can be carried out by, for example, a method using an antibody against CRBN, in situ hybridization method, the RT-PCR method, and Northern blotting method.
In the method (B), whether or not the test substance has increased the expression level of CRBN can be judged by culturing neural stem cells or neural progenitor cells in the absence of the test substance and measuring the expression level of CRBN, and then making a comparison with the value thus obtained.
The substance that is selected by the method (B) acts to increase the expression level of CRBN in neural stem cells or neural progenitor cells in the living body. Accordingly, it is assumed that the substance that is selected by the method (B) facilitates proliferation of neural stem cells or neural progenitor cells and differentiation of these cells into nerve cells effected by CRBN, and thus is therapeutically effective for a disease of cerebral cortex and a surgical injury of cerebral cortex.
Hereinbelow, the present invention will be described in more detail with reference to Examples.
Adult fish were reared at a constant temperature of 28.5° C. and maintained and bred under a diurnal cycle of 14 hours of light-on and 10 hours of light-off. Fertilized eggs were secured by natural mating between males and females, and an aqueous solution of 600 ng/μl capped RNA synthesized in vitro was injected into the cytoplasm of the embryos before the first cleavage (1-cell stage) under conditions of a nitrogen gas pressure of 30 psi and a valve opening time of 30 msec (millisecond). Because the expression of all the genes except the lhx2 gene (i.e., the crbn gene, the six3.2 gene, and a gene encoding a protein composing an E3 ubiquitin ligase complex with crbn) has little impact on the embryonic development, even when systemically expressed, this method was used to obtain the first data.
For studying the lhx2 gene, which exhibits non-specific dorsalization of the embryo when systemically expressed, and for precise experiments specifically examining the effect exerted on the brain volume, in vivo RNA lipofection into the prospective head region of the embryo was carried out. The method of lipofection was entirely in accordance with the technique developed and published by Ando et al. (Ando and Okamoto, Efficient transfection strategy for the spatiotemporal control of gene expression in zebrafish. Mar. Biotechnol. 8(3): 295-303, 2006).
An aqueous solution of a 25-mer antisense morpholino oligonucleotide (AMO, Gene Tools, LLC) corresponding to the vicinity of the translation initiation codon in the cDNA sequence of the gene to be knocked down (700 ng/μl injection conditions were the same as those used for RNA) was injected into the embryos at the 1-cell stage. The sequence of AMO used for crbn gene knockdown is 5′ AGAGCTGTAGCTGGTTCCCCATTTC 3′, and that used for lhx2 gene knockdown is 5′ TCTGCAACCCAAGATTTCCGTGAGA 3′.
This process was carried out entirely in accordance with the technique of Ando et al. (H. Ando et al., Lhx2 mediates the activity of Six3 in zebrafish forebrain growth. Dev. Biol. 287(2): 456-468, 2005) except for the following procedure. Head-specific gene expression was performed by the in vivo lipofection method described in (2) above instead of RNA uncaging (Japanese Patent Laid-Open No. 2002-315576, H. Ando et al., Photo-mediated gene activation using caged RNA/DNA in zebrafish embryos. Nat. Genet. 28, 317-325, 2001). The basic principle is as follows: embryos in which one (A) of the two kinds of genes suggested to have a functional association is knocked down by the method described in (3) above are cultured up to six hours after fertilization (gastrula stage), and in the prospective forebrain region of the embryos, the expression of the other gene (B) is induced by the in vivo lipofection method described in (2) above. When the effect of knocking down of A is rescued, whereas the effect of knocking down of B is not rescued by an inverted combination of A and B, within a 24-hour period after fertilization, it is determined that A lies functionally upstream of B.
Antibody staining of early neurons of zebrafish was performed by the following technique. The embryos 24 to 28 hours after fertilization were fixed at 4° C. for 12 hours in a 4% paraformaldehyde/phosphate buffer (pH 8.0). After washing four times with phosphate buffer, where each wash was performed for 15 minutes, blocking was carried out at normal temperature for one hour in a 5% newborn goat serum dissolved in 0.5% Triton X-100/phosphate buffer. Primary antibody reaction was carried out using a monoclonal anti-acetylated tubulin antibody diluted at 1:1000 in the same solution at 4° C. for 12 hours. Then, after washing the embryos similarly with phosphate buffer, secondary antibody reaction was carried out using an anti-mouse antibody conjugated with Alexa Fluoro 488 (Molecular Probes) under the same conditions as those applied in the primary antibody reaction. The embryos were then washed with phosphate buffer and transparentized in 30%/50%/70% glycerol (dissolved in phosphate buffer), and then observed with a fluorescent microscope under excitation at 488 nm.
This process was carried out basically in accordance with the technique of Thisse et al. (Nat. Protcol. 3 (1) 59-69, 2008). The differences are that a 5 mg/ml Torula yeast RNA was used as a blocker in the probe hybridization solution and a 0.5% Blocking Reagent (Roche) was used as a blocker in the antibody reaction solution. The cDNA of the genes used as the probe (the six3.2 gene, the emx1 gene, the pax2.1 gene, the foxg1 gene, and the otx2 gene) are presents of the original provider. As the probe for the lhx2 gene, the one initially cloned by Ando was used. For the probes of the crbn gene and related genes, primers were designed based on the EST database of zebrafish and the probes were cloned from a cDNA library.
Nuclease-free water in which an appropriate concentration of rhodamine dextran (molecular weight 10,000) and a final centration of 600 ng/μl crbn RNA were dissolved was injected into the zebrafish embryos at the 1-cell stage under the conditions of the method described in (1) above, and the resulting embryos served as the donors. At three to four hours after fertilization of the donors, 10 to 50 cells were suctioned by a glass microcapillary under fluorescent microscopic observation, which were transplanted into the animal pole of the host embryos at the same stage. After culturing the host embryos for two days without adding any modification, localization of differentiation of the CRBN-expressing donor-derived cells was observed under a fluorescent microscope. Also, as a negative control, cells in which green fluorescence protein (GFP), which was assumed to have no effect on the embryonic development, was expressed were transplanted under the same conditions, and localization of the differentiation was compared between the experimental and control embryos.
This process was carried out basically in accordance with the method of Groisman et al. Firstly, CRBN and a binding protein (referred to as a CRBN complex) were purified from a cell lysate solution of mammalian cells expressing CRBN fused with a FLAG epitope tag using M2 FLAG agarose beads (SIGMA). Subsequently, the CRBN complex thus purified was mixed with an aqueous solution containing Uba1 (E1), UbcH5b (E2), and a recombinant GST fusion ubiquitin (Ub) protein, and after addition of ATP, the mixture was left to stand at 30 to 37° C. for two hours. Thereafter, the reaction was terminated by SDS, and self-ubiquitination and ubiquitination of the binding protein were visualized by polyacrylamide gel electrophoresis and immunoblotting, whereby the ubiquitin ligase activity was detected and measured.
This process was carried out basically in accordance with the method of Ohtake et al. MG132, which is a proteasome inhibitor, was applied to mammalian cells expressing CRBN fused with a FLAG epitope tag, and the cells were left still. Subsequently, the cells were disrupted, and from the resulting cell lysate solution, FLAG was purified and CRBN was extracted, and then immunoblotting was performed under similar, but stricter, conditions to the above, whereby the self-ubiquitination was detected and measured.
Two-day-old zebrafish were used (for glia cell staining and serotonin-producing cell staining, zebrafish 56 hours and 49 hours after fertilization were used, respectively). Zebrafish were fixed with 4% paraformaldehyde (PFA) and then washed with phosphate buffer (PBS), followed by treatment with 10 μg/ml protease K for partial digestion of the epidermis. After the digestion reaction, the zebrafish were washed with PEST (PBS+0.5% Triton X-100) for 20 minutes and then fixed with PFA again. The fixed zebrafish were washed with PBST at room temperature for one hour, followed by blocking using PBST+5% goat serum. The resulting specimens were reacted with a monoclonal anti-glia antibody (zrf-1/zrf-2) or a rabbit anti-serotonin antibody at 4° C. overnight (12 to 18 hours). Subsequently, the specimens were washed with PBST+5% goat serum for one hour at room temperature, and secondary antibody reaction was carried out by substituting the antibody for a goat anti-mouse IgG antibody (Cy-2 conjugate for glia cell staining) or a goat anti-rabbit IgG antibody (Cy-5 conjugate for serotonin-producing cell staining) at 4° C. overnight (12 to 18 hours). Subsequently, the specimens were washed with PBST at room temperature for one hour. After washing, PBST was replaced by 30%, 50%, 70% glycerol/PBS and the whole zebrafish were mounted on glass slides to obtain preparations. Fluorescence was observed under excitation wavelength of Cy-2 and Cy-5 and the distribution of the glia cells or the serotonin-producing cells was recorded. It is to be noted that glia cells were observed from the lateral side of zebrafish, while the serotonin-producing cells were photographed from the dorsal side in order to observe the distribution of the cells along the midline.
(11) Transplantation of CRBN-Expressing Cells into the Diencephalic Ventricle
A mixed solution of CRBN-coding RNA (700 ng/μl) and 2% rhodamine dextran was injected into the zebrafish embryos at the 1-cell stage immediately after fertilization. The embryos were cultured up to four hours after fertilization and 10 to 20 cells were collected by a suction capillary, which were injected into the diencephalic ventricle of embryos 30 hours after fertilization, whereby the cells were transplanted. Zebrafish having undergone transplantation were reared up to three days after fertilization in zebrafish physiological saline (E3 Ringer) and then fixed with 4% paraformaldehyde. Following the ordinary method, primary antibody reaction and secondary antibody reaction were carried out using a monoclonal anti-acetylated tubulin antibody and an anti-mouse IgG antibody conjugated with Alexa Fluor (R) (excited at 488 nm), respectively. Then, while observing the fluorescently-labeled nerve cell axon, distribution of the transplanted cells labeled with rhodamine dextran (excited at 543 nm) was studied.
Compared to the normal embryo (FIG. 1, upper left panel), brain shrinkage was observed in the lhx2 gene-knockdown embryo (FIG. 1, lower left panel). Meanwhile, similarly to the crbn gene-overexpressing embryo (FIG. 1, upper right panel), brain enlargement was observed in the embryo in which lhx2 gene was knocked down while crbn gene was overexpressed (FIG. 1, lower right panel). From this observation, it is considered that CRBN functions downstream of Lhx2, directly inducing proliferation of central nervous stem cells and differentiation of these cells into nerve cells.
In order to verify induction of differentiation into neural stem cells by CRBN in the cerebrum, a CRBN overexpression experiment was carried out in the forebrain and midbrain of the zebrafish embryos. As a result, both brains enlarged approximately 1.5 times in volume, while retaining their shape (FIG. 2, right). Moreover, the neuron network in the brain was morphologically normal (FIG. 2, right).
Firstly, mRNA encoding CRBN and a fluorescent substance (rhodamine) were injected together into donor embryos so that CRBN was overexpressed. The resulting blastula was transplanted into another individual and differentiation of donor-derived cells distributed in the cerebral ventricle was observed under a fluorescent microscope. As a result, the transplanted donor-derived cells were significantly differentiated into the olfactory bulb, which is the telencephalon tissue of fish (FIG. 3, arrowhead). This indicates that when the CRBN-expressing cells were distributed into the cerebral ventricle, they differentiated into neural stem cells and migrated along a cell migration pathway called Rostral Migratory Stream (RMS) and differentiated into the brain tissue in the dorsal telencephalon, where the cerebral cortex develops in mammals.
When CRBN (FH-CRBN complex) was added to an aqueous solution containing Uba1 (ubiquitin activating enzyme), UbcH5b (ubiquitin transfer enzyme), and a recombinant GST fusion ubiquitin protein (Ub/E1/E2), proteins that would not be detected in the absence of addition of CRBN were detected (FIG. 4, lane 2 in the left, middle, and right images). For ubiquitination of a protein, in addition to ubiquitin, three kinds of enzymes, namely a ubiquitin activating enzyme, a ubiquitin transfer enzyme, and a ubiquitin ligase are needed. Ubiquitinated proteins were not existent in lane 1 of the left, middle, and right images because no ubiquitin ligase was present. Meanwhile, in lane 2 of the left, middle, and right images, it is speculated that CRBN acted as a ubiquitin ligase to produce ubiquitinated proteins, which were detected by electrophoresis.
When MG132 was added, a number of bands representing the CRBN-containing proteins were detected (FIG. 5, the right lane). In contrast, when MG132 was not added, very few bands representing the CRBN-containing proteins were detected (FIG. 5, the left lane).
It is considered that CRBN in live cells undergoes self-ubiquitination in cooperation with other factors and yields ubiquitinated proteins of various molecular weights. However, most of them are assumed to be degraded by intracellular proteasome. In the left lane of FIG. 5, it is speculated that proteasome was inhibited by MG132, enabling proteins produced through self-ubiquitination to remain, leading to detection of a number of bands. In contrast, in the right lane of FIG. 5, it is speculated that very few bands were detected because most of the proteins produced were degraded by proteasome.
In the CRBN-overexpressing individual, glia cells (FIG. 6, the left picture) and serotonin-producing cells (FIG. 7, the left picture) were increased, while normal spatial distribution was maintained. This means that CRBN acts to proliferate and differentiate cells, while normally recognizing the spatial pattern of the brain.
(7) Transplantation of CRBN-Expressing Cells into the Diencephalic Ventricle
When the cells that do not express CRBN were transplanted, the cells did not differentiate into the brain tissue (FIG. 8A to D), whereas when the cells that express CRBN were transplanted, the cells differentiated into the brain tissue (FIG. 8E to H).
The present invention is useful as a therapeutic drug for a disease of cerebral cortex such as Alzheimer's disease. Further, it is also useful for the development of a novel therapeutic drug for a disease of cerebral cortex.
1. A pharmaceutical composition comprising 1) CRBN, 2) a nucleic acid encoding CRBN, or 3) a stem cell or a neural progenitor cell in which CRBN is expressed.
2. The pharmaceutical composition according to claim 1, wherein the nucleic acid encoding CRBN is inserted in a virus vector.
3. The pharmaceutical composition according to claim 1, comprising CRBN and a protein that forms a ubiquitin ligase complex with CRBN.
4. The pharmaceutical composition according to claim 1, comprising the nucleic acid encoding CRBN and a nucleic acid encoding a protein that forms a ubiquitin ligase complex with CRBN.
5. The pharmaceutical composition according to claim 1, comprising a stem cell or a neural progenitor cell in which CRBN and a protein that forms a ubiquitin ligase complex with CRBN are expressed.
6. The pharmaceutical composition according to claim 1, used for treating a disease of cerebral cortex or a surgical injury of cerebral cortex.
7. The pharmaceutical composition according to claim 1, used for regenerating cerebral cortex.
8. A method comprising administering the pharmaceutical composition according to claim 1 to a non-human animal and proliferating a neural stem cell or a neural progenitor cell of the non-human animal.
9. A method comprising administering the pharmaceutical composition according to claim 1 to a non-human animal and differentiating a neural stem cell or a neural progenitor cell of the non-human animal into a nerve cell.
10. A method for screening for a therapeutic drug for a disease of cerebral cortex or a surgical injury of cerebral cortex, comprising contacting a test substance with a ubiquitin ligase complex comprising CRBN and measuring a ubiquitin ligase activity of the ubiquitin ligase complex to select a test substance with an increased ubiquitin ligase activity.
11. A method for screening for a therapeutic drug for a disease of cerebral cortex or a surgical injury of cerebral cortex, comprising culturing a neural stem cell or a neural progenitor cell in the presence of a test substance and measuring an expression level of CRBN in the neural stem cell or the neural progenitor cell to select a test substance with an increased expression level of CRBN.