US20120252086A1
2012-10-04
13/515,890
2010-12-22
The present invention provides a composition comprising a polypeptide comprising or consisting of an X46 domain and further a starch degrading enzyme and uses of such composition. The polypeptide comprising or consisting of an X46 domain can boost the activity of a starch-degrading enzyme.
Get notified when new applications in this technology area are published.
C12N9/2451 » CPC main
Enzymes; Proenzymes; Compositions thereof ; Processes for preparing, activating, inhibiting, separating or purifying enzymes; Hydrolases (3) acting on glycosyl compounds (3.2) hydrolysing O- and S- glycosyl compounds (3.2.1); Glucanases acting on alpha-1,6-glucosidic bonds
C12N9/2457 » CPC further
Enzymes; Proenzymes; Compositions thereof ; Processes for preparing, activating, inhibiting, separating or purifying enzymes; Hydrolases (3) acting on glycosyl compounds (3.2) hydrolysing O- and S- glycosyl compounds (3.2.1); Glucanases acting on alpha-1,6-glucosidic bonds Pullulanase (3.2.1.41)
C12N9/246 » CPC further
Enzymes; Proenzymes; Compositions thereof ; Processes for preparing, activating, inhibiting, separating or purifying enzymes; Hydrolases (3) acting on glycosyl compounds (3.2) hydrolysing O- and S- glycosyl compounds (3.2.1); Glucanases acting on alpha-1,6-glucosidic bonds Isoamylase (3.2.1.68)
C12P7/06 » CPC further
Preparation of oxygen-containing organic compounds containing a hydroxy group acyclic Ethanol, i.e. non-beverage
C12P19/14 » CPC further
Preparation of compounds containing saccharide radicals produced by the action of a carbohydrase , e.g. by alpha-amylase
C12P19/16 » CPC further
Preparation of compounds containing saccharide radicals produced by the action of an alpha-1, 6-glucosidase, e.g. amylose, debranched amylopectin
C12Y302/01041 » CPC further
Hydrolases acting on glycosyl compounds, i.e. glycosylases (3.2); Glycosidases, i.e. enzymes hydrolysing O- and S-glycosyl compounds (3.2.1) Pullulanase (3.2.1.41)
C12Y302/01068 » CPC further
Hydrolases acting on glycosyl compounds, i.e. glycosylases (3.2); Glycosidases, i.e. enzymes hydrolysing O- and S-glycosyl compounds (3.2.1) Isoamylase (3.2.1.68)
Y02E50/10 » CPC further
Technologies for the production of fuel of non-fossil origin Biofuels, e.g. bio-diesel
Y02E50/10 » CPC further
Technologies for the production of fuel of non-fossil origin Biofuels, e.g. bio-diesel
C12N9/24 IPC
Enzymes; Proenzymes; Compositions thereof ; Processes for preparing, activating, inhibiting, separating or purifying enzymes; Hydrolases (3) acting on glycosyl compounds (3.2)
C12P7/14 IPC
Preparation of oxygen-containing organic compounds containing a hydroxy group acyclic; Ethanol, i.e. non-beverage Multiple stages of fermentation; Multiple types of microorganisms or re-use of microorganisms
C12N15/63 IPC
Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor; Recombinant DNA-technology Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
This application contains a Sequence Listing in computer readable form. The computer readable form is incorporated herein by reference.
The present invention relates to compositions comprising a starch degrading enzyme activity boosting polypeptide and further a starch-degrading enzyme. The invention also relates to boosting polypeptides, polynucleotides encoding boosting polypeptides, nucleic acid constructs comprising the polynucleotides, recombinant expression vectors comprising the nucleic acid construct, recombinant host cell comprising the nucleic acid construct or the vector, methods for producing the boosting polypeptides and the use of compositions of the invention for starch convention processes include processes for producing a fermentation product, such as especially ethanol.
Starch can be hydrolyzed into simpler carbohydrates by acids, various enzymes, or a combination thereof. The primary enzymes used to hydrolyze starch into simpler carbohydrates are endoamylases, exoamylases, and debranching enzymes, which hydrolyze amylose and amylopectin. Amylose is hydrolyzed mainly by amylases, while amylopectin also requires debranching enzymes such as pullulanases (E.C. 3.2.1.41) for complete hydrolysis. The endoamylases, the most common being alpha-amylases (E.C. 3.2.1.1), are specific for alpha-1,4-linkages of amylose and amylopectin. Exoamylases have the ability to hydrolyze both alpha-1,4-linkages and alpha-1,6-linkages of amylose and amylopectin. A common example is amyloglucosidase (often referred to as glucoamylase) (E.C. 3.2.1.20). Beta-amylase is an enzyme that has the ability to hydrolyze the alpha-1,4-linkages of amylose. Debranching enzymes, e.g., pullulanases, hydrolyze alpha-1,6-linkages in amylopectin. Hydrolysis products of debranching enzymes are mainly maltotriose and maltose.
It would be advantageous to boost the enzymatic activity of starch-degrading enzymes and to improve conversion of starch-containing materials into sugars, especially fermentable sugars that can be converted to fermentation products, such as ethanol.
The present invention provides compositions comprising a starch-degrading enzyme activity boosting polypeptide and a starch-degrading activity. A composition of the invention results in increased starch degrading activity compared to the same composition without a starch-degrading activity boosting polypeptide. A composition of the invention comprises at least two components, a boosting polypeptide and a starch-degrading enzyme. However, it should be understood that the composition may comprise more than one of each components.
In the first aspect the invention relates to compositions comprising a polypeptide comprising or consisting of an X46 domain and further a starch-degrading enzyme.
The polypeptide comprising or consisting of an X46 domain may in an embodiment not have starch-degrading activity by itself. In another embodiment the polypeptide comprising an X46 domain also has starch-degrading activity, as will be described further below. In a preferred embodiment the X46 domain comprising polypeptide has pullulanase, amylopullulanase and/or amylase, such as alpha-amylase activity.
In an embodiment the polypeptide comprising or consisting of an X46 domain is selected from the group of:
i) a polypeptide comprising or consisting of the amino acid sequence shown in any of SEQ ID NOS: 2, 4, 6-81, 85, 87 and 89; or
ii) an amino acid sequence having at least 60% identity to any of SEQ ID NOS: 2, 4, 6-81, 85, 87 and 89; or
iii) a polypeptide determined by Hidden Markov Model (HMM) using SEQ ID NOS: 7-81, 85, 87 and 89 having a HMM score of at least 150;
iv) a variant thereof (i.e., of i), ii) or iii)) comprising an alteration at one or more (several) positions in any of SEQ ID NOS: 2, 4, 6-81, 85, 87 and 89.
In another embodiment the invention relates to a process for producing a fermentation product, especially ethanol, from starch-containing material comprising the steps of:
(a) liquefying starch-containing material in the presence of a composition of the invention and optionally an alpha-amylase;
(b) saccharifying the liquefied material obtained in step (a) using a carbohydrate-source generating enzyme;
(c) fermenting using a fermenting organism.
The invention also relates to polypeptides consisting of an X46 domain. In an embodiment the polypeptide consisting of an X46 domain does not have starch-degrading activity.
The invention also relates to an isolated polynucleotide encoding an X46 domain of the invention as well as a nucleic acid construct comprising the polynucleotide of the invention operably linked to one or more (several) control sequences which direct the production of the polypeptide in an expression host. The invention also relates to a recombinant expression vector comprising the nucleic acid construct of the invention and a recombinant host cell comprising the nucleic acid construct of the invention or the vector of the invention. The invention furthermore relates to a method for producing a polypeptide consisting of an X46 domain comprising (a) cultivating the recombinant host cell of the invention under conditions conducive for production of an X46 domain; and (b) recovering the X46 domain.
Finally the invention relates to the use of a composition of the invention in a process of producing sweeteners from starch or in a process of producing a fermentation product, such as ethanol, from gelatinized.
FIG. 1 shows Appendix A listing X46 domains identified by Hidden Markov Models (HMM)
FIG. 2 shows Appendix C which displays a multiple alignment of X46 domains.
For instance SWISSPROT:CIQSR8:898..1122/1-225 indicates that the sequences is from Swissprot, database, has identification number “C1QSR8”, the X46 domain is located from amino acid 898 to 1122 and is 225 amino acids long.
FIG. 3 shows Appendix D showing that the DUF2223 domain consists of 16 seed sequences in the current release of Pfam (version 24.0, October 2009). Appendix D displays a multiple alignment of DUF2223 domain (or X46 domain) sequences.
The present invention relates to compositions comprising a polypeptide that boosts the enzymatic activity of starch-degrading enzymes. The invention also relates to processes of converting starch-containing materials into sugars and/or fermentation product, such as especially ethanol.
The inventors have identified an uncharacterized polypeptide located upstream of the amylopullulanase gene Apu from Dictyoglomus thermophilum DSM 3960 (Uniprot: □9Y818). The translated product of SEQ ID:1 is SEQ ID:2 (Uniprot: B5YCY6) and was identified to have a domain DUF2223 according to the Pfam nomenclature. The inventors found that a composition comprising a polypeptide including an X46 domain boosts the starch hydrolyzing activity of starch-degrading enzymes. For instance, the inventors found that when incubating a polypeptide comprising an X46 domain (SEQ ID NO: 89) from Dictyoglomus thermophilum pullulanase shown in SEQ ID NO: 6 the pullulanase activity was boosted even though the X46 domain did not have pullulanase activity on its own. The Thermococcus litoralis/Thermococcus hydrothermalis X4 chimer pullulanase (SEQ ID NO: 83) has been shown to produce an increase in ethanol yield of +0.6 g/L (versus control) at pH 5.0 using LIQUEZYME™ SC DS (i.e., commercial Bacillus stearothermophilus alpha-amylase variant from Novozymes). Mash treated with an X46 domain containing polypeptide alone produced +0.9 g/L more ethanol than the control. When tested in combination with the X46 domain containing polypeptide (SEQ ID NO: 89), it boosted ethanol yield by +1.2 g/L relative to the control. The inventors also found an activity boosting effect to an alpha-amylase. Specifically the inventors found that the Subulispora sp (AM3162-P8GR) alpha-amylase disclosed in WO 2009/140504 boosted the ethanol yield as can also be seen in the Examples.
In the first aspect the invention relates to compositions comprising a polypeptide comprising or consisting of an X46 domain and further a starch-degrading enzyme. A composition of the invention results in increased (i.e., boosted) starch-degrading activity compared to a corresponding composition without said polypeptide comprising or consisting of an X46 domain. In an embodiment the polypeptide comprising or consisting of an X46 domain increases (i.e., boosts) the activity of pullulanases, preferably pullulanases of type I of Family GH13 and/or amylopullulanases of type II of Family GH57. In a preferred embodiment said pullulanase (EC.3.2.1.41) of type I of Family GH13, is a pullulanase derived from a strain of Bacillus, such as a strain of the species Bacillus deramificans, in particular the pullulanase shown in SEQ ID NO: 2 in WO 00/01796 or a strain of the pullulanase of the species Bacillus acidopullulyticus, in particular the pullulanase shown in SEQ ID NO: 1 in WO 00/01796 (which are hereby incorporated by reference). The X46 domain may also be derived from a bacteria, preferably a strain of Dictyoglomus, especially a strain of the species Dictiglomus thermophilum, or a strain of Fervido bacterium, especially a strain of the species F. nodosum; a strain of Pyrococcus, especially a strain of Pyrococcus woesie, or a strain of the genus Thermococcus, including Thermococcus litoralis, Thermococcus hydrothermalis. Is should be understood that the X46 domain may also be from other microorganism, such as from genera, especially species of the X46 domain found by HMM (as will be described further). These include: Pyrococcus furiosus, Staphylothermus marinus, Pyrobaculum aerophilum, Pyrobaculum aerophilum, Thermoplasma acidophilum, Pyrococcus abyssi, Staphylothermus hellenicus, Staphylothermus marinus, Pyrococcus woesei, Artheobacter globiformis, Scardovia inopinata, Parascardovia denticolens, Thermosphaera aggregans, Thermosphaera aggregans, Thermincola potens, Staphylothermus hellenicus, Ktedonobacter racemifer, Pyrobaculum calidifontis, Acetohalobium arabaticum, Pyrobaculum calidifontis, Pyrobaculum arsenaticum, Pyrobaculum arsenaticum, Fervidobacterium nodosum, Anaeromyxobacter dehalogenans, Pyrobaculum islandicum, Pyrobaculum islandicum, Psychroflexus torques, Halothermothrix Anaeromyxobacter sp., Arthrobacter globiformis, Thermus thermophilus, Arthrobacter globiformis, Stigmatefla aurantiaca, Arthrobacter globiformis, Anaeromyxobacter dehalogenans, Thermoproteus neutrophilus, Pyrococcus furiosus, Thermus aquaticus, Thermococcus barophilus, Coprothermobacter proteolyticus, Dictyoglomus thermophilum, Thermococcus hydrothermalis, Dictyoglomus turgidum, Thermococcus sp., Kosmotoga olearia, Thermococcus onnurineus, Desulfurococcus kamchatkensis, Thermococcus litoralis, Thermosipho melanesiensis, Catenulispora acidiphila, Thermococcus gammatolerans, Thermococcus gammatolerans, Thermus thermophilus, Thermococcus kodakaraensis, and Catenulispora acidiphila.
In another embodiment the polypeptide comprising or consisting of an X46 domain increases (i.e., boosts) the activity of alpha-amylases. In an embodiment the X46 domain comprising polypeptide has pullulanase, amylopullulanase and/or amylase activity.
In an embodiment the ratio between the polypeptide comprising or consisting of an X46 domain and the starch-degrading enzyme(s) in the composition of the invention is between 10:1 to 1:10, in particular between 5:1 to 1:5, especially between 2:1 to 1:2, such as around 1:1.
A composition of the invention comprises a polypeptide comprising or consisting of an
X46 domain and further a starch-degrading enzyme. The polypeptide comprising or consisting of an X46 domain may be selected from the group of:
Polypeptides comprising or consisting of an X46 domain can be found by the method described in the “Identification of X46 domains by Hidden Markov Models”-section below. According to the invention such polypeptide(s) increase(s) the starch hydrolyzing activity of starch-degrading enzymes. When using HMM for identifying an X46 domain containing polypeptide the HMM score may preferably be at least 200, such as in the range between 150-400 or 200-400, such as between 220-350 or 170-350.
In a preferred embodiment the X46 domain containing polypeptide may comprise or consist of:
In an embodiment the polypeptide comprising an X46 domain has an amino acid sequence having at least 70%, preferable at least 80%, more preferably at least 90%, even more preferably at least 95%, such as at least 96%, such as at least 97% such as at least 98%, such as at least 99% identity to the polypeptide shown in SEQ ID NOS: 2, 4, 6-81, 85, 87 and 89.
In an embodiment the variant of the polypeptide comprising an X46 domain has at least 60% identity at least 70%, preferable at least 80%, more preferably at least 90%, even more preferably at least 95%, such as at least 96%, such as at least 97% such as at least 98%, such as at least 99% identity, but less than 100% identity to the parent polypeptide shown in any of SEQ ID NOS: 2, 4, and 6.
In an embodiment the polypeptide consisting of an X46 domain has an amino acid sequence having at least 70%, preferable at least 80%, more preferably at least 90%, even more preferably at least 95%, such as at least 96%, such as at least 97% such as at least 98%, such as at least 99% identity, but less than 100% identity to the parent polypeptide shown in any of SEQ ID NOS: 7-81, 85, 87, and 89.
In an embodiment the polypeptide consisting of an X46 domain may consists of:
As mentioned above a composition of the invention comprises a polypeptide comprising or consisting of an X46 domain and further a starch-degrading enzyme. The starch-degrading enzymes may preferably be of family GH13 or family GH57. The starch-degrading enzymes may be selected from the group of: pullulanases, amylopullulanases, and alpha-amylases, isoamylases, beta-amylases, glucoamylases, and CGTases. According to the invention the starch-degrading enzymes may in preferred embodiments be selected from the group consisting of pullulanases, amylopullulanases, and alpha-amylases. In a preferred embodiment the starch-degrading enzyme has increased hydrolyzing activity (i.e., boosted enzyme activity) when combined with a polypeptide comprising or consisting of an X46 domain in accordance with the present invention.
Family GH13 is defined by the CAZy-team and an updated list can be found on the CAZy-server (see “www.cazy.org”). Family GH13 enzymes include alpha-amylase (EC 3.2.1.1); pullulanase (EC 3.2.1.41); cyclomaltodextrin glucanotransferase (EC 2.4.1.19); cyclomaltodextrinase (EC 3.2.1.54); trehalose-6-phosphate hydrolase (EC 3.2.1.93); oligoalpha-glucosidase (EC 3.2.1.10); maltogenic amylase (EC 3.2.1.133); neopullulanase (EC 3.2.1.135); alpha-glucosidase (EC 3.2.1.20); maltotetraose-forming alpha-amylase (EC 3.2.1.60); isoamylase (EC 3.2.1.68); glucodextranase (EC 3.2.1.70); maltohexaose-forming alpha-amylase (EC 3.2.1.98); maltotriose-forming alpha-amylase (EC 3.2.1.116); branching enzyme (EC 2.4.1.18); trehalose synthase (EC 5.4.99.16); 4-alpha-glucanotransferase (EC 2.4.1.25); maltopentaose-forming alpha-amylase (EC 3.2.1.-); amylosucrase (EC 2.4.1.4); sucrose phosphorylase (EC 2.4.1.7); malto-oligosyltrehalose trehalohydrolase (EC 3.2.1.141); isomaltulose synthase (EC 5.4.99.11); amino acid transporter. In a preferred embodiment the Family 13 enzymes contemplated according to the present invention are starch-degrading enzymes, in particular of classified under EC 3.2.1.41 (pullulanase) and EC 3.2.1.1 (alpha-amylase).
Family GH57 is defined by the CAZy-team and an updates list can be found on the CAZy-server (see “www.cazy.org”). Family GH57 enzymes include alpha-amylase (EC 3.2.1.1); 4-alpha-glucanotransferase (EC 2.4.1.25); alpha-galactosidase (EC 3.2.1.22); amylopullulanase (EC 3.2.1.41); branching enzyme (EC 2.4.1.18).
Preferred are pullulanase of Family GH57 which include pullulanases classified under EC 3.2.1.41 and are often referred to as pullulanase of type II or sometimes “amylopullulanases”. Type II pullulanases are in contrast to type I pullulanases (which specifically attack alpha-1,6 linkages), also hydrolyze alpha-1,4 linkages. A collection of family GH57 pullulanases are described in Zone et al. (2004) Eur. J. Biochem. 271, 2863-2872 (incorporated by reference). In context of the invention family GH57 pullulanases are not limited to those described in there.
Preferred family GH57 pullulanases of type II include UNIPROT: Q9Y818 and UNIPROT: Q8NKS8 which are derived from strains of the hyperthermophile bacteria Thermococcus hydrothermalis (SEQ ID NO: 2) and Thermococcus litoralis, respectively. Hybrids thereof, preferably truncated GH57 pullulanases are also contemplated according to the invention. A preferred example is the Thermococcus litoralis/Thermococcus hydrothermalis X4 chimer pullulanase shown in SEQ ID NO: 83.
Family GH57 pullulanases may be obtained from any source, such as a microorganism, preferably a bacterium or fungal organism, such as yeast and a filamentous fungus. In an embodiment the family GH57 pullulanase is a wild-type enzyme. In a preferred embodiment the pullulanase is derived from a bacterium, preferably of the genus Thermococcus or Pyrococcus, including the ones in the table below.
| Thermococcus hydrothermalis. | SWISSPROT: Q9Y8I8 |
| Thermococcus sp. HJ21. | SWISSPROT: B6SED6 |
| Thermococcus onnurineus (strain NA1). | SWISSPROT: B6YV54 |
| Thermococcus kodakaraensis). | SWISSPROT: Q5JJ55 |
| Thermococcus sp. AM4. | SWISSPROT: B7QZQ4 |
| Pyrococcus furiosus. | SWISSPROT: Q8TZQ1 |
| Pyrococcus furiosus DSM 3638. | SWISSPROT: Q3HUR3 |
| Pyrococcus furiosus. | SWISSPROT: O30772 |
| Thermococcus gammatolerans | SWISSPROT: C5A4E3 |
| (strain DSM 15229/JCM 11827/EJ3). | |
| Thermococcus barophilus MP. | SWISSPROT: B5IRL5 |
| Thermococcus litoralis. | SWISSPROT: Q8NKS8 |
| Pyrococcus abyssi. | SWISSPROT: Q9V294 |
X46 domains are also referred to a “DUF2223 domains” (“Domain of Unknown Function”) which until now have no known function. The DUF2223 members, as of Pfam release 24, 13. October 2009, are found in various prokaryotic membrane-anchored proteins predicted to be involved in the regulation of pullulanases (see http://pfam.sanger.ac.uk/family/DUF2223).
According to the invention HMM (Hidden Markov Models) may advantageously be used for identifying polypeptides comprising or consisting of an X46 domain. The HMM score may be at least 150, but preferably the HMM score is at least 200 or in the range between 150-400 or 200-400, such as between 170-350 or 220-350. Polypeptides comprising or consisting of X46 domains were identified by HMM as will be explained further below. All the polypeptide shown in FIG. 2 (Appendix C) has been found by HMM as described below.
Software: The two programs hmmbuild and hmmsearch from the software package hmmer version 3.0b3 (ftp://selab.janelia.org/pub/software/hmmer3) were used to construct Hidden Markov Models (HMMs) describing the X46 domain.
Claim: eFAM X46 Annotation
A total of 59 polypeptide/protein sequences have been identified to contain one or more X46 domains (FIG. 1 or appendix A) and from these, a total of 67×46 domains have been identified. A multiple alignment of the 67 domain sequences has been constructed using Muscle version 3.7, with default parameters (FIG. 2 or appendix C). An HMM is constructed as follows, where appendix_c.selex denotes the alignment file in SELEX format:
hmmbuild -informat selex appendix_c.hmm appendix_c.selex
A given query sequence provided in file query.fsa in fasta format, can be queried against the HMM by using hmmsearch program:
hmmsearch appendix_c.hmm query.fsa
The claim covers sequences that give a domain alignment score of 150 or better when search against the appendix_c.hmm model using hmmsearch.
The DUF2223 domain consists of 16 seed sequences in the current release of Pfam (version 24.0, October 2009, see appendix D or FIG. 3).
The Hidden Markov Model is constructed from this alignment as follows, where appendix_c.stockholm represents the input alignment file in Stockolm format:
hmmbuild -informat stockholm appendix_d.hmm appendix_d.stockholm
A given query sequence provided in file query.fsa in fasta format, can be queried against the HMM by using hmmsearch program:
hmmsearch appendix_d.hmm query.fsa
The claim covers sequences that give a domain alignment score of 150 or better when search against the appendix_d.hmm model using hmmsearch.
FIG. 1 (appendix a) lists sequences comprising an X46 domain. All sequences are hereby incorporated by reference. The location of the X46 domain is mentioned after the species name. For instance, the Pyrococcus furiosus X46 domain is located from amino acids 798 and 982.
Variant: The term “variant” is defined herein as a polypeptide, e.g., polypeptide comprising or consisting of an X46 domain, having an alteration, such as a substitution, insertion, deletion, truncation, of one or more (several) amino acid residues at one or more (several) specific positions of the mature parent polypeptide or enzyme. The variant has the activity of the parent polypeptide or enzyme, e.g., “enzyme activity boosting effect” or “starch-degrading activity”. The altered polynucleotide is obtained through human intervention by modification of the polynucleotide sequence encoding the polypeptide or enzyme or a homologous sequence thereof.
A variant may have at least 20%, at least 40%, at least 50%, at least 60%, at least 70%, least 80%, at least 90%, at least 95%, or at least 100% of the enzyme activity of the mature parent enzyme.
A variant may have, e.g., at least 20%, at least 40%, at least 50%, at least 60%, at least 70%, least 80%, at least 90%, at least 95%, or at least 100% of the enzyme activity boosting activity of the mature parent polypeptide.
Wild-Type polypeptide or enzyme: The term “wild-type” polypeptide or enzyme denotes a polypeptide, e.g., X46 domain, expressed by a naturally occurring microorganism, such as a bacterium, yeast, or filamentous fungus found in nature.
Parent Enzyme: The term “parent” polypeptide or enzyme as used herein means a polypeptide, e.g., polypeptide comprising or consisting of an X46 domain, e.g., starch-degrading enzyme, to which a modification, e.g., substitution(s), insertion(s), deletion(s), and/or truncation(s), is made to produce polypeptide or enzyme variants. This term also refers to the polypeptides or enzymes with which a variant is compared and aligned. The parent may be a naturally occurring (wild-type) polypeptide or enzyme or a variant. For instance, the parent polypeptide may be a variant of a naturally occurring polypeptide which has been modified or altered in the amino acid sequence. A parent may also be an allelic variant, which is a polypeptide or enzyme encoded by any of two or more alternative forms of a gene occupying the same chromosomal locus.
Isolated variant or polypeptide: The term “isolated variant” or “isolated polypeptide” as used herein refers to a variant or a polypeptide that is isolated from a source. In one aspect, the variant or polypeptide is at least 1% pure, preferably at least 5% pure, more preferably at least 10% pure, more preferably at least 20% pure, more preferably at least 40% pure, more preferably at least 60% pure, even more preferably at least 80% pure, and most preferably at least 90% pure, as determined by SDS-PAGE.
Substantially pure variant or polypeptide: The term “substantially pure variant” or “substantially pure polypeptide” denotes herein a variant or polypeptide preparation that contains at most 10%, preferably at most 8%, more preferably at most 6%, more preferably at most 5%, more preferably at most 4%, more preferably at most 3%, even more preferably at most 2%, most preferably at most 1%, and even most preferably at most 0.5% by weight of other polypeptide material with which it is natively or recombinantly associated. It is, therefore, preferred that the substantially pure variant or polypeptide is at least 92% pure, preferably at least 94% pure, more preferably at least 95% pure, more preferably at least 96% pure, more preferably at least 96% pure, more preferably at least 97% pure, more preferably at least 98% pure, even more preferably at least 99%, most preferably at least 99.5% pure, and even most preferably 100% pure by weight of the total variant or polypeptide material present in the preparation. The variant and polypeptide is preferably in a substantially pure form. This can be accomplished, for example, by preparing the variant or polypeptide by well-known recombinant methods or by classical purification methods.
Mature polypeptide: The term “mature polypeptide” is defined herein as a polypeptide that is in its final form following translation and any post-translational modifications, such as N-terminal processing, C-terminal truncation, glycosylation, phosphorylation, etc. In one preferred embodiment, the mature polypeptide is any of the amino acid sequences shown in SEQ ID NOS: 2, 4, 6-81, 85, 87 or 89.
Mature polypeptide coding sequence: The term “mature polypeptide coding sequence” is defined herein as a nucleotide sequence that encodes a mature polypeptide. In one embodiment, the mature polypeptide coding sequence is the nucleotides identified as “mat_peptide” in any of SEQ ID NOS: 1, 3, 5, 84, 86 or 88. For instance, the mature polypeptide in SEQ ID NO: 1 is located from nucleotide 82 to 3804.
Alignment: Alignment of two amino acid sequence in order to identify corresponding position may be done by using the MUSCLE (MUltiple Sequence Comparison by Log-Expectation) alignment program (Edgar, Robert C. (2004), MUSCLE: multiple sequence alignment with high accuracy and high throughput, Nucleic Acids Research 32(5), 1792-97.) with 16 iterations of the protein sequence alignments. Alternatively, another alignment program is identified.
Identity: The relatedness between two amino acid sequences or between two nucleotide sequences is described by the parameter “identity”. For purposes of the present invention, the degree of identity between two amino acid sequences is determined using the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453) as implemented in the Needle program of the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends in Genetics 16: 276-277; http://emboss.org), preferably version 3.0.0 or later. The optional parameters used are gap open penalty of 10, gap extension penalty of 0.5, and the EBLOSUM62 (EMBOSS version of BLOSUM62) substitution matrix. The output of Needle labeled “longest identity” (obtained using the -nobrief option) is used as the percent identity and is calculated as follows:
(Identical Residues×100)/(Length of Alignment−Total Number of Gaps in Alignment)
For purposes of the present invention, the degree of identity between two deoxyribonucleotide sequences is determined using the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, supra) as implemented in the Needle program of the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, supra; http://emboss.org), preferably version 3.0.0 or later. The optional parameters used are gap open penalty of 10, gap extension penalty of 0.5, and the EDNAFULL (EMBOSS version of NCBI NUC4.4) substitution matrix. The output of Needle labeled “longest identity” (obtained using the -nobrief option) is used as the percent identity and is calculated as follows:
(Identical Deoxyribonucleotides×100)/(Length of Alignment−Total Number of Gaps in Alignment)
Alternatively, another identity program is identified.
Isolated polynucleotide: The term “isolated polynucleotide” as used herein refers to a polynucleotide that is isolated from a source. In one aspect, the isolated polynucleotide is at least 1% pure, preferably at least 5% pure, more preferably at least 10% pure, more preferably at least 20% pure, more preferably at least 40% pure, more preferably at least 60% pure, even more preferably at least 80% pure, and most preferably at least 90% pure, and even most preferably at least 95% pure, as determined by agarose electrophoresis.
Substantially pure polynucleotide: The term “substantially pure polynucleotide” as used herein refers to a polynucleotide preparation free of other extraneous or unwanted nucleotides and in a form suitable for use within genetically engineered polypeptide production systems. Thus, a substantially pure polynucleotide contains at most 10%, preferably at most 8%, more preferably at most 6%, more preferably at most 5%, more preferably at most 4%, more preferably at most 3%, even more preferably at most 2%, most preferably at most 1%, and even most preferably at most 0.5% by weight of other polynucleotide material with which it is natively or recombinantly associated. A substantially pure polynucleotide may, however, include naturally occurring 5′ and 3′ untranslated regions, such as promoters and terminators. It is preferred that the substantially pure polynucleotide is at least 90% pure, preferably at least 92% pure, more preferably at least 94% pure, more preferably at least 95% pure, more preferably at least 96% pure, more preferably at least 97% pure, even more preferably at least 98% pure, most preferably at least 99%, and even most preferably at least 99.5% pure by weight. The polynucleotides of the present invention are preferably in a substantially pure form, i.e., that the polynucleotide preparation is essentially free of other polynucleotide material with which it is natively or recombinantly associated. The polynucleotides may be of genomic, cDNA, RNA, semisynthetic, synthetic origin, or any combinations thereof.
Coding sequence: When used herein the term “coding sequence” means a polynucleotide, which directly specifies the amino acid sequence of its polypeptide product. The boundaries of the coding sequence are generally determined by an open reading frame, which usually begins with the ATG start codon or alternative start codons such as GTG and TTG and ends with a stop codon such as TAA, TAG, and TGA. The coding sequence may be a DNA, cDNA, synthetic, or recombinant polynucleotide.
Nucleic acid construct: The term “nucleic acid construct” as used herein refers to a nucleic acid molecule, either single- or double-stranded, which is isolated from a naturally occurring gene or is modified to contain segments of nucleic acids in a manner that would not otherwise exist in nature or which is synthetic. The term nucleic acid construct is synonymous with the term “expression cassette” when the nucleic acid construct contains the control sequences required for expression of a coding sequence of the present invention.
Control sequences: The term “control sequences” is defined herein to include all components necessary for the expression of a polynucleotide encoding a polypeptide. Each control sequence may be native or foreign to the polynucleotide encoding the polypeptide or native or foreign to each other. Such control sequences include, but are not limited to, a leader, polyadenylation sequence, propeptide sequence, promoter, signal peptide sequence, and transcription terminator. At a minimum, the control sequences include a promoter, and transcriptional and translational stop signals. The control sequences may be provided with linkers for the purpose of introducing specific restriction sites facilitating ligation of the control sequences with the coding region of the polynucleotide encoding a polypeptide.
Operably linked: The term “operably linked” denotes herein a configuration in which a control sequence is placed at an appropriate position relative to the coding sequence of the polynucleotide sequence such that the control sequence directs the expression of the coding sequence of a polypeptide.
Expression: The term “expression” includes any step involved in the production of a polypeptide including, but not limited to, transcription, post-transcriptional modification, translation, post-translational modification, and secretion.
Expression vector: The term “expression vector” is defined herein as a linear or circular DNA molecule that comprises a polynucleotide encoding a polypeptide and is operably linked to additional nucleotides that provide for its expression.
Host cell: The term “host cell”, as used herein, includes any cell type that is susceptible to transformation, transfection, transduction, and the like with a nucleic acid construct or expression vector comprising a polynucleotide of the present invention. The term “host cell” encompasses any progeny of a parent cell that is not identical to the parent cell due to mutations that occur during replication.
Hybridization: The polynucleotide may be able to hybridize with the mature polypeptide coding sequence. The hybridization may be done by prehybridization and hybridization at 42° C. in 5×SSPE, 0.3% SDS, 200 μg/ml sheared and denatured salmon sperm DNA, and either 25% formamide (for very low and low stringencies), 35% formamide (for medium and medium-high stringencies), or 50% formamide (for high and very high stringencies), following standard Southern blotting procedures for 12 to 24 hours optimally. The carrier material is finally washed three times each for 15 minutes using 2×SSC, 0.2% SDS preferably at 45° C. (very low stringency), 50° C. (low stringency), 55° C. (medium stringency), 60° C. (medium-high stringency), 65° C. (high stringency), or 70° C. (very high stringency).
In one aspect the invention relates to polypeptides consisting of an X46 domain. In a preferred embodiment the polypeptide consists of an X46 domain selected from the group of:
In an embodiment the X46 domain has at least 60% identity at least 70%, preferable at least 80%, more preferably at least 90%, even more preferably at least 95%, such as at least 96%, such as at least 97% such as at least 98%, such as at least 99% identity to any of the X46 domains shown in any of SEQ ID NOS: 7-81, 85, 87 and 89.
In an embodiment the variant of the X46 domain has at least 60% identity at least 70%, preferable at least 80%, more preferably at least 90%, even more preferably at least 95%, such as at least 96%, such as at least 97% such as at least 98%, such as at least 99% identity, but less than 100% identity to any of the X46 domains shown in any of SEQ ID NOS: 7-81, 85, 87 and 89.
In a preferred embodiment the X46 domain has a total number of amino acid substitutions, deletions and/or insertions compared to any of the parent X46 domain shown of SEQ ID NO: 7-81, 85, 87 and 89 of 10, preferably 9, more preferably 8, more preferably 7, more preferably at most 6, more preferably 5, more preferably 4, even more preferably 3, most preferably 2, and even most preferably 1.
In a preferred embodiment the variant of the X46 domain has a total number of amino acid substitutions, deletions and/or insertions compared to any of the X46 domain polypeptides shown of SEQ ID NO: 7-81, 85, 87 and 89 of 10, preferably 9, more preferably 8, more preferably 7, more preferably at most 6, more preferably 5, more preferably 4, even more preferably 3, most preferably 2, and even most preferably 1.
In an embodiment the X46 domain of the invention is derived from a microorganism, in particular a bacterium, fungal organism, preferably a yeast or a filamentous fungus.
More specifically the X46 domain may be derived from a bacteria, especially one selected from a strain of the species: Pyrococcus furiosus, Staphylothermus marinus, Pyrobaculum aerophilum, Pyrobaculum aerophilum, Thermoplasma acidophilum, Pyrococcus abyssi, Staphylothermus hellenicus, Staphylothermus marinus, Pyrococcus woesei, Artheobacter globiformis, Scardovia inopinata, Parascardovia denticolens, Thermosphaera aggregans, Thermosphaera aggregans, Thermincola potens, Staphylothermus hellenicus, Ktedonobacter racemifer, Pyrobaculum calidifontis, Acetohalobium arabaticum, Pyrobaculum calidifontis, Pyrobaculum arsenaticum, Pyrobaculum arsenaticum, Fervidobacterium nodosum, Anaeromyxobacter dehalogenans, Pyrobaculum islandicum, Pyrobaculum islandicum, Psychroflexus torques, Halothermothrix orenii, Anaeromyxobacter sp., Arthrobacter globiformis, Thermus thermophilus, Arthrobacter globiformis, Stigmatefla aurantiaca, Arthrobacter globiformis, Anaeromyxobacter dehalogenans, Thermoproteus neutrophilus, Pyrococcus furiosus, Thermus aquaticus, Thermococcus barophilus, Coprothermobacter proteolyticus, Dictyoglomus thermophilum, Thermococcus hydrothermalis, Dictyoglomus turgidum, Thermococcus sp., Kosmotoga olearia, Thermococcus onnurineus, Desulfurococcus kamchatkensis, Thermococcus litoralis, Thermosipho melanesiensis, Catenulispora acidiphila, Thermococcus gammatolerans, Thermococcus gammatolerans, Thermus thermophilus, Thermococcus kodakaraensis, and Catenulispora acidiphila.
The invention also relates to an isolated polynucleotide comprising a nucleotide sequence which encodes an X46 domain. In a preferred embodiment the polynucleotide encodes the X46 shown in any of SEQ NOS: 7-81, 85, 87 and 89.
In a preferred embodiment the invention relates to an isolated polynucleotide encoding an X46 domain selected from the consisting of:
The present invention also relates to nucleic acid constructs comprising the polynucleotide described above, operably linked to one or more (several) control sequences that direct the expression of the coding sequence in a suitable host cell under conditions compatible with the control sequences. The control sequence may include an appropriate promoter sequence, a nucleotide sequence that is recognized by a host cell for expression of a polynucleotide encoding an X46 domain of the present invention. The promoter sequence contains transcriptional control sequences that mediate the expression of the X46 domain. The promoter may be any nucleotide sequence that shows transcriptional activity in the host cell of choice including mutant, truncated, and hybrid promoters, and may be obtained from genes encoding extracellular or intracellular polypeptides either homologous or heterologous to the host cell. The control sequence may also include a suitable transcription terminator sequence, a sequence recognized by a host cell to terminate transcription. The terminator sequence is operably linked to the 3′ terminus of the nucleotide sequence encoding the X46 domain. Any terminator that is functional in the host cell of choice may be used in the present invention. The control sequence may also include a suitable leader sequence, a nontranslated region of an mRNA that is important for translation by the host cell. The leader sequence is operably linked to the 5′ terminus of the nucleotide sequence encoding the X46 domain of the invention. Any leader sequence that is functional in the host cell of choice may be used in the present invention. The control sequence may also be a polyadenylation sequence, a sequence operably linked to the 3′ terminus of the nucleotide sequence and, when transcribed, is recognized by the host cell as a signal to add polyadenosine residues to transcribed mRNA. Any polyadenylation sequence that is functional in the host cell of choice may be used in the present invention. The control sequence may also include a signal peptide coding sequence that codes for an amino acid sequence linked to the amino terminus of a X46 domain and directs the encoded X46 domain into the cell's secretory pathway. The 5′ end of the coding sequence of the nucleotide sequence may inherently contain a signal peptide coding sequence naturally linked in translation reading frame with the segment of the coding sequence that encodes the secreted polypeptide in question. Alternatively, the 5′ end of the coding sequence may contain a signal peptide coding sequence that is foreign to the coding sequence. The foreign signal peptide coding sequence may be required where the coding sequence does not naturally contain a signal peptide coding sequence. Alternatively, the foreign signal peptide coding sequence may simply replace the natural signal peptide coding sequence in order to enhance secretion of the polypeptide in question. However, any signal peptide coding sequence that directs the expressed polypeptide into the secretory pathway of a host cell of choice, i.e., secreted into a culture medium, may be used in the present invention. The control sequence may also include a propeptide coding sequence that codes for an amino acid sequence positioned at the amino terminus of a polypeptide. The resultant polypeptide is known as a proenzyme or propolypeptide (or a zymogen in some cases). A propeptide is generally inactive and can be converted to a mature active polypeptide by catalytic or autocatalytic cleavage of the propeptide from the propolypeptide in question. It may also be desirable to add regulatory sequences that allow the regulation of the expression of the polypeptide relative to the growth of the host cell. Examples of regulatory systems are those that cause the expression of the gene to be turned on or off in response to a chemical or physical stimulus, including the presence of a regulatory compound. Examples of useful control sequences are described in WO2007090402.
The present invention also relates to recombinant expression vectors comprising a polynucleotide of the present invention, a promoter, and transcriptional and translational stop signals. The various nucleic acids and control sequences described herein may be joined together to produce a recombinant expression vector that may include one or more (several) convenient restriction sites to allow for insertion or substitution of the nucleotide sequence encoding the polypeptide at such sites. Alternatively, a polynucleotide sequence of the present invention may be expressed by inserting the nucleotide sequence or a nucleic acid construct comprising the sequence into an appropriate vector for expression. In creating the expression vector, the coding sequence is located in the vector so that the coding sequence is operably linked with the appropriate control sequences for expression. Examples of vector systems are described in WO2007090402.
The present invention also relates to recombinant host cells, comprising an isolated polynucleotide of the present invention, which are advantageously used in the recombinant production of the polypeptides. A vector comprising a polynucleotide of the present invention is introduced into a host cell so that the vector is maintained as a chromosomal integrant or as a self-replicating extra-chromosomal vector as described earlier. The term “host cell” encompasses any progeny of a parent cell that is not identical to the parent cell due to mutations that occur during replication. The choice of a host cell will to a large extent depend upon the gene encoding the polypeptide and its source. Examples of host cells are described in WO2007090402.
The present invention relates to methods of producing an X46 domain of the present invention, comprising: (a) cultivating a recombinant host cell, as described herein, under conditions conducive for production of the polypeptide in question; and (b) recovering the polypeptide in question. The production may be carried out as described in WO2007090402.
Processes for Producing Fermentation Products from Gelatinized Starch-Containing Material
In this aspect the invention relates to processes for producing fermentation products, especially ethanol, from starch-containing material, which process includes a liquefaction step and sequentially or simultaneously performed saccharification and fermentation steps. Consequently, the invention relates to processes for producing fermentation products from starch-containing material comprising the steps of:
(a) liquefying starch-containing material in the presence of a composition of the invention and optionally an alpha-amylase;
(b) saccharifying the liquefied material obtained in step (a) using a carbohydrate-source generating enzyme;
(c) fermenting using a fermenting organism.
In a preferred embodiment the composition comprises a polypeptide comprising or consisting of an X46 domain and a pullulanase. In another preferred embodiment the composition comprises a polypeptide comprising or consisting of an X46 domain and an alpha-amylase. Examples of suitable and preferred pullulanases are described above.
In an embodiment a protease, such as an acid fungal protease or a metallo protease is added before, during and/or after liquefaction. The protease may be any of the ones mentioned in the “Protease”-section below. In a preferred embodiment the metallo protease is derived from a strain of the genus Thermoascus, preferably a strain of Thermoascus aurantiacus, especially Thermoascus aurantiacus CGMCC No. 0670. The alpha-amylase may be any of the ones mentioned in the “Alpha-Amylase”-section below. In a preferred embodiment the alpha-amylase is a fungal alpha-amylase, preferably derived from the genus Aspergillus, especially a strain of A. niger, A. oryzae, A. awamoti, or A. kawachii, or of the genus Rhizomucor, preferably a strain the Rhizomucor pusillus, or the genus Meripilus, preferably a strain of Meripilus giganteus or the alpha-amylase disclosed in Richardson et al. (2002), The Journal of Biological Chemistry, Vol. 277, No 29, Issue 19 July, pp. 267501-26507, referred to as BD5088. The carbohydrate-source generating enzymes may be any of the ones mentioned below in the Carbohydrate-Source Generating Enzyme”-section. In a preferred embodiment the carbohydrate-source generating enzyme is a glucoamylase derived from a strain of Aspergillus, preferably Aspergillus niger or Aspergillus awamori, a strain of Talaromyces, especially Talaromyces emersonii; or a strain of Athelia, especially Athelia rolfsii; a strain of Trametes, preferably Trametes cingulata; a strain of the genus Pachykytospora, preferably a strain of Pachykytospora papyracea; or a strain of the genus Leucopaxillus, preferably Leucopaxillus giganteus; or a strain of the genus Peniophora, preferably a strain of the species Peniophora rufomarginata; or a mixture thereof.
Saccharification step (b) and fermentation step (c) may be carried out either sequentially or simultaneously. The pullulanase and/or metallo protease may be added during liquefaction, saccharification and/or fermentation. The pullulanase and/or metallo protease may also advantageously be added before liquefaction (pre-liquefaction treatment), i.e., before or during step (a), and/or after liquefaction (post liquefaction treatment), i.e., after step (a). The pullulanase is most advantageously added during liquefaction, i.e., during step (a). The fermentation product, such as especially ethanol, may optionally be recovered after fermentation, e.g., by distillation. Suitable starch-containing starting materials are listed in the section “Starch-Containing Materials”-section below. Contemplated enzymes are listed in the “Enzymes”-section below. The liquefaction is preferably carried out in the presence of at least an alpha-amylase, preferably a bacterial alpha-amylase or acid fungal alpha-amylase. The fermenting organism is preferably yeast, preferably a strain of Saccharomyces cerevisiae. Suitable fermenting organisms are listed in the “Fermenting Organisms”-section below. In a particular embodiment, the process of the invention further comprises, prior to step (a), the steps of:
x) reducing the particle size of the starch-containing material, preferably by milling (e.g., using a hammer mill);
y) forming a slurry comprising the starch-containing material and water.
In a preferred embodiment the particle size is smaller than a #7 screen, preferably a smaller than a #6 screen. A #7 screen is usually used in conventional prior art processes. The aqueous slurry may contain from 10-55 w/w-% dry solids (DS), preferably 25-45 w/w-% dry solids (DS), more preferably 30-40 w/w-% dry solids (DS) of starch-containing material. The slurry is heated to above the gelatinization temperature and alpha-amylase, preferably bacterial and/or acid fungal alpha-amylase may be added to initiate liquefaction (thinning). The slurry may in an embodiment be jet-cooked to further gelatinize the slurry before being subjected to alpha-amylase in step (a). Liquefaction may in an embodiment be carried out as a three-step hot slurry process. The slurry is heated to between 60-95° C., preferably between 70-90° C., such as preferably between 80-90° C., preferably around 85° C., at pH 4-6, preferably 4.5-5.0, and alpha-amylase, together with pullulanase and/or protease, preferably metallo protease, are added to initiate liquefaction (thinning). In an embodiment the slurry may then be jet-cooked at a temperature between 95-140° C., preferably 100-135° C., such as 105-125° C., for about 1-15 minutes, preferably for about 3-10 minutes, especially around about 5 minutes. The slurry is cooled to 60-95° C. and alpha-amylase and pullulanase and/or protease, preferably metallo protease, may be added to finalize hydrolysis (secondary liquefaction). The liquefaction process is usually carried out at pH 4-6, in particular at a pH from 4.5 to 5. Saccharification step (b) may be carried out using conditions well-known in the art. For instance, a full saccharification process may last up to from about 24 to about 72 hours, however, it is common only to do a pre-saccharification of typically 40-90 minutes at a temperature between 30-65° C., typically about 60° C., followed by complete saccharification during fermentation in a simultaneous saccharification and fermentation process (SSF process). Saccharification is typically carried out at temperatures from 20-75° C., preferably from 40-70° C., typically around 60° C., and at a pH between 4 and 5, normally at about pH 4.5. The most widely used process in fermentation product, especially ethanol, production is the simultaneous saccharification and fermentation (SSF) process, in which there is no holding stage for the saccharification, meaning that fermenting organism, such as yeast, and enzyme(s), may be added together. SSF may typically be carried out at a temperature from 25° C. to 40° C., such as from 28° C. to 35° C., such as from 30° C. to 34° C., preferably around about 32° C. In an embodiment fermentation is ongoing for 6 to 120 hours, in particular 24 to 96 hours.
“Fermentation media” or “fermentation medium” refers to the environment in which fermentation is carried out and which includes the fermentation substrate, that is, the carbohydrate source that is metabolized by the fermenting organism. The fermentation medium may comprise nutrients and growth stimulator(s) for the fermenting organism(s). Nutrient and growth stimulators are widely used in the art of fermentation and include nitrogen sources, such as ammonia; urea, vitamins and minerals, or combinations thereof.
The term “fermenting organism” refers to any organism, including bacterial and fungal organisms, suitable for use in a fermentation process and capable of producing the desired fermentation product. Especially suitable fermenting organisms are able to ferment, i.e., convert, sugars, such as glucose or maltose, directly or indirectly into the desired fermentation product. Examples of fermenting organisms include fungal organisms, such as yeast. Preferred yeast includes strains of Saccharomyces spp., in particular, Saccharomyces cerevisiae. In one embodiment the fermenting organism is added to the fermentation medium so that the viable fermenting organism, such as yeast, count per mL of fermentation medium is in the range from 105 to 1012, preferably from 107 to 1010, especially about 5×107. Commercially available yeast includes, e.g., RED STAR™ and ETHANOL RED™ yeast (available from Fermentis/Lesaffre, USA), FALI (available from Fleischmann's Yeast, USA), SUPERSTART and THERMOSACC™ fresh yeast (available from Ethanol Technology, WI, USA), BIOFERM AFT and XR (available from NABC—North American Bioproducts Corporation, GA, USA), GERT STRAND (available from Gert Strand AB, Sweden), and FERMIOL (available from DSM Specialties).
Any suitable starch-containing material may be used according to the present invention. The starting material is generally selected based on the desired fermentation product. Examples of starch-containing materials, suitable for use in a process of the invention, include whole grains, corn, wheat, barley, rye, milo, sago, cassava, tapioca, sorghum, rice, peas, beans, or sweet potatoes, or mixtures thereof or starches derived there from, or cereals. Contemplated are also waxy and non-waxy types of corn and barley. The term “granular starch” means raw uncooked starch, i.e., starch in its natural form found in cereal, tubers or grains. Starch is formed within plant cells as tiny granules insoluble in water. When put in cold water, the starch granules may absorb a small amount of the liquid and swell. At temperatures up to 50° C. to 75° C. the swelling may be reversible. However, with higher temperatures an irreversible swelling called “gelatinization” begins. Granular starch to be processed may be a highly refined starch quality, preferably at least 90%, at least 95%, at least 97% or at least 99.5% pure or it may be a more crude starch-containing materials comprising (e.g., milled) whole grains including non-starch fractions such as germ residues and fibers. The raw material, such as whole grains, may be reduced in particle size, e.g., by milling, in order to open up the structure and allowing for further processing. Two processes are preferred according to the invention: wet and dry milling. In dry milling whole kernels are milled and used. Wet milling gives a good separation of germ and meal (starch granules and protein) and is often applied at locations where the starch hydrolysate is used in production of, e.g., syrups. Both dry and wet milling is well known in the art of starch processing and is equally contemplated for a process of the invention. In an embodiment the particle size is reduced to between 0.05 to 3.0 mm, preferably 0.1-0.5 mm, or so that at least 30%, preferably at least 50%, more preferably at least 70%, even more preferably at least 90% of the starch-containing material fit through a sieve with a 0.05 to 3.0 mm screen, preferably 0.1-0.5 mm screen.
The term “fermentation product” means a product produced by a process including a fermentation step using a fermenting organism. Fermentation products contemplated according to the invention include alcohols (e.g., ethanol, methanol, butanol); organic acids (e.g., citric acid, acetic acid, itaconic acid, lactic acid, succinic acid, gluconic acid); ketones (e.g., acetone); amino acids (e.g., glutamic acid); gases (e.g., H2 and CO2); antibiotics (e.g., penicillin and tetracycline); enzymes; vitamins (e.g., riboflavin, B12, beta-carotene); and hormones. In a preferred embodiment the fermentation product is ethanol, e.g., fuel ethanol; drinking ethanol, i.e., potable neutral spirits; or industrial ethanol or products used in the consumable alcohol industry (e.g., beer and wine), dairy industry (e.g., fermented dairy products), leather industry and tobacco industry. Preferred beer types comprise ales, stouts, porters, lagers, bitters, malt liquors, happoushu, high-alcohol beer, low-alcohol beer, low-calorie beer or light beer. Preferred fermentation processes used include alcohol fermentation processes. The fermentation product, such as ethanol, obtained according to the invention, may preferably be used as fuel. However, in the case of ethanol it may also be used as potable ethanol.
Subsequent to fermentation the fermentation product may be separated from the fermentation medium. The slurry may be distilled to extract the desired fermentation product or the desired fermentation product may be extracted from the fermentation medium by micro or membrane filtration techniques. Alternatively the fermentation product may be recovered by stripping. Methods for recovery are well known in the art.
A composition of the invention comprising a polypeptide comprising or consisting of an X46 and further a starch-degrading enzyme may be used in the conversion of starch, e.g., for the production of dextrose, sweeteners, syrup (such as high-fructose syrup), edible products (such as snack pellets), ethanol or beer, e.g. as described in WO 2000/001796, WO 2001/051620, 2006-213132, or WO2003024242. Thus, it may be used in the liquefaction of starch (WO 2006/028897), in beer brewing (WO 2007/144393), or for saccharification in combination with a glucoamylase (EP 63909).
In a preferred embodiment the invention relates to the use of a composition of the invention in a process of producing a fermentation product, such as ethanol, from gelatinized, especially fuel ethanol.
According to the present invention the protease used may be of any origin. In a preferred embodiment the protease may be an acid fungal protease or a metallo protease. In a preferred embodiment the protease is a metallo protease derived from a strain of the genus Thermoascus, preferably a strain of Thermoascus aurantiacus, especially Thermoascus aurantiacus CGMCC No. 0670 disclosed in WO 2003/048353 (Novozymes). According to the invention a peptidase and other protein degrading enzymes are referred to as proteases. In a preferred embodiment the protease is an endo-protease and/or an exo-protease. Suitable proteases may be of fungal, bacterial, including filamentous fungi and yeast, and plant origin. In an embodiment the protease is an acidic protease, i.e., a protease characterized by the ability to hydrolyze proteins under acidic conditions below pH 7, e.g., at a pH between 2-7. In an embodiment the acidic protease has an optimum pH in the range from 2.5 and 3.5 (determined on high nitrogen casein substrate at 0.7% w/v at 37° C.) and a temperature optimum between 5 to 50° C. at an enzyme concentration of 10 mg/mL at 30° C. for one hour in 0.1 M piperazine/acetate/glycine buffer). In another embodiment the protease is an alkaline protease, i.e., a protease characterized by the ability to hydrolyze proteins under alkaline conditions above pH 7, e.g., at a pH between 7 and 11. In an embodiment the alkaline protease is derived from a strain of Bacillus, preferably Bacillus licheniformis. In an embodiment the alkaline protease has an optimum temperature in the range from 7 and 11 and a temperature optimum around 70° C. determined at pH 9. In another embodiment the protease is a neutral protease, i.e., a protease characterized by the ability to hydrolyze proteins under conditions between pH 5 and 8. In an embodiment the alkaline protease is derived from a strain of Bacillus, preferably Bacillus amyloliquefaciens. In an embodiment the alkaline protease has an optimum pH in the range between 7 and 11 (determined at 25° C., 10 minutes reaction time with an enzyme concentration of 0.01-0.2 AU/L) and a temperature optimum between 50° C. and 70° C. (determined at pH 8.5, minutes reaction time and 0.03-0.3 AU/L enzyme concentration. In an embodiment the protease is a metallo protease. In a preferred embodiment the protease is derived from a strain of the genus Thermoascus, preferably a strain of Thermoascus aurantiacus, especially Thermoaccus aurantiacus CGMCC No. 0670 having the sequence shown in the mature part of SEQ ID NO: 2 in WO 2003/048353 hereby incorporated by reference. The Thermoaccus aurantiacus protease is active from 20-90° C., with an optimum temperature around 70° C. Further, the enzyme is activity between pH 5-10 with an optimum around pH 6. Suitable plant proteases may be derived from barley. Suitable bacterial proteases include Bacillus proteases derived from Bacillus amyloliquefaciens and Bacillus licheniformis. Suitable filamentous bacterial proteases may be derived from a strain of Nocardiopsis, preferably Nocardiopsis prasina NRRL 18262 protease (or Nocardiopsis sp. 10R) and Nocardiopsis dassonavilla NRRL 18133 (Nocardiopsis dassonavilla M58-1) both described in WO 1988/003947 (Novozymes). Suitable acid fungal proteases include fungal proteases derived from Aspergillus, Mucor, Rhizomucor, Rhizopus, Candida, Coriolus, Endothia, Enthomophtra, lrpex, Penicillium, Sclerotium, Thermoaccus, and Torulopsis. Especially contemplated are proteases derived from Aspergillus niger (see, e.g., Koaze et al., (1964), Agr. Biol. Chem. Japan, 28, 216), Aspergillus saitoi (see, e.g., Yoshida, (1954) J. Agr. Chem. Soc. Japan, 28, 66), Aspergillus awamori (Hayashida et al., (1977) Agric. Biol. Chem., 42(5), 927-933, Aspergillus aculeatus (WO 95/02044), or Aspergillus oryzae; proteases from Mucor pusillus or Mucor miehei disclosed in U.S. Pat. No. 4,357,357 and U.S. Pat. No. 3,988,207; and Rhizomucor mehei or Rhizomucor pusillus disclosed in, e.g., WO 94/24880 (hereby incorporated by reference). Aspartic acid proteases are described in, for example, Hand-book of Proteolytic Enzymes, Edited by A. J. Barrett, N. D. Rawlings and J. F. Woessner, Aca-demic Press, San Diego, 1998, Chapter 270). Suitable examples of aspartic acid protease include, e.g., those disclosed in R. M. Berka et al. Gene, 96, 313 (1990)); (R. M. Berka et al. Gene, 125, 195-198 (1993)); and Gomi et al. Biosci. Biotech. Biochem. 57, 1095-1100 (1993), which are hereby incorporated by reference. Commercially available products include ALCALASE®, ESPERASE™, NEUTRASE®, RENILASE®, NOVOZYM™ FM 2.0L, and NOVOZYM™ 50006 (available from Novozymes A/S, Denmark) and GC106™ and SPEZYME™ FAN from Genencor Int., Inc., USA. The protease may be present in concentrations in the range from 0.0001 to 1.0 wt.-% of TS, preferably 0.001 to 0.1 wt.-% of TS.
According to the invention any alpha-amylase may be used, such as of fungal, bacterial or plant origin. In a preferred embodiment the alpha-amylase is an acid alpha-amylase, e.g., acid fungal alpha-amylase or acid bacterial alpha-amylase. The term “acid alpha-amylase” means an alpha-amylase (E.C. 3.2.1.1) which added in an effective amount has activity optimum at a pH in the range of 3 to 7, preferably from 3.5 to 6, or more preferably from 4-5.
According to the invention a bacterial alpha-amylase is preferably derived from the genus Bacillus. In a preferred embodiment the Bacillus alpha-amylase is derived from a strain of Bacillus licheniformis, Bacillus amyloliquefaciens, Bacillus subtilis or Bacillus stearothermophilus, but may also be derived from other Bacillus sp. Specific examples of contemplated alpha-amylases include the Bacillus licheniformis alpha-amylase shown in SEQ ID NO: 4 in WO 99/19467, the Bacillus amyloliquefaciens alpha-amylase SEQ ID NO: 5 in WO 99/19467 and the Bacillus stearothermophilus alpha-amylase shown in SEQ ID NO: 3 in WO 99/19467 (all sequences hereby incorporated by reference). In an embodiment the alpha-amylase may be an enzyme having a degree of identity of at least 60%, preferably at least 70%, more preferred at least 80%, even more preferred at least 90%, such as at least 95%, at least 96%, at least 97%, at least 98% or at least 99% to any of the sequences shown in SEQ ID NOS: 1, 2 or 3, respectively, in WO 99/19467. The Bacillus alpha-amylase may also be a variant and/or hybrid, especially one described in any of WO 96/23873, WO 96/23874, WO 97/41213, WO 99/19467, WO 00/60059, and WO 02/10355 (all documents hereby incorporated by reference). Specifically contemplated alpha-amylase variants are disclosed in U.S. Pat. No. 6,093,562, 6,297,038 or U.S. Pat. No. 6,187,576 (hereby incorporated by reference) and include Bacillus stearothermophilus alpha-amylase (BSG alpha-amylase) variants having a deletion of one or two amino acid in positions R179 to G182, preferably a double deletion disclosed in WO 1996/023873—see e.g., page 20, lines 1-10 (hereby incorporated by reference), preferably corresponding to delta(181-182) compared to the wild-type BSG alpha-amylase amino acid sequence set forth in SEQ ID NO:3 disclosed in WO 99/19467 or deletion of amino acids R179 and G180 using SEQ ID NO:3 in WO 99/19467 for numbering (which reference is hereby incorporated by reference). Even more preferred are Bacillus alpha-amylases, especially Bacillus stearothermophilus alpha-amylase, which have a double deletion corresponding to delta(181-182) and further comprise a N193F substitution (also denoted I181*+G182*+N193F) compared to the wild-type BSG alpha-amylase amino acid sequence set forth in SEQ ID NO:3 disclosed in WO 99/19467.
A hybrid alpha-amylase specifically contemplated comprises 445 C-terminal amino acid residues of the Bacillus licheniformis alpha-amylase (shown in SEQ ID NO: 4 of WO 99/19467) and the 37 N-terminal amino acid residues of the alpha-amylase derived from Bacillus amyloliquefaciens (shown in SEQ ID NO: 5 of WO 99/19467), with one or more, especially all, of the following substitution: G48A+T49I+G107A+H156Y+A181T+N190F+I201F+A209V+Q264S (using the Bacillus licheniformis numbering in SEQ ID NO: 4 of WO 99/19467). Also preferred are variants having one or more of the following mutations (or corresponding mutations in other Bacillus alpha-amylase backbones): H154Y, A181T, N190F, A209V and Q264S and/or deletion of two residues between positions 176 and 179, preferably deletion of E178 and G179 (using the SEQ ID NO: 5 numbering of WO 99/19467). In an embodiment the bacterial alpha-amylase is dosed in an amount of 0.0005-5 KNU per g DS, preferably 0.001-1 KNU per g DS, such as around 0.050 KNU per g DS.
Fungal alpha-amylases include alpha-amylases derived from a strain of the genus Aspergillus, such as Aspergillus oryzae, Aspergillus niger and Aspergillis kawachii alpha-amylases.
A preferred acidic fungal alpha-amylase is a Fungamyl-like alpha-amylase which is derived from a strain of Aspergillus otyzae. According to the present invention, the term “Fungamyl-like alpha-amylase” indicates an alpha-amylase which exhibits a high identity, i.e. at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or even 100% identity to the mature part of the amino acid sequence shown in SEQ ID NO: 10 in WO 96/23874. Another preferred acid alpha-amylase is derived from a strain Aspergillus niger. In a preferred embodiment the acid fungal alpha-amylase is the one from Aspergillus niger disclosed as “AMYA_ASPNG” in the Swiss-prot/TeEMBL database under the primary accession no. P56271 and described in WO 89/01969 (Example 3—incorporated by reference). A commercially available acid fungal alpha-amylase derived from Aspergillus niger is SP288 (available from Novozymes A/S, Denmark). Other contemplated wild-type alpha-amylases include those derived from a strain of the genera Rhizomucor and Meripilus, preferably a strain of Rhizomucor pusillus (WO 2004/055178 incorporated by reference) or Meripilus giganteus. In a preferred embodiment the alpha-amylase is derived from Aspergillus kawachii and disclosed by Kaneko et al. J. Ferment. Bioeng 81:292-298 (1996) “Molecular-cloning and determination of the nucleotide-sequence of a gene encoding an acidstable alpha-amylase from Aspergillus kawachii, and further as EMBL: #AB008370. The fungal alpha-amylase may also be a wild-type enzyme comprising a starch-binding domain (SBD) and an alpha-amylase catalytic domain (i.e., none-hybrid), or a variant thereof. In an embodiment the wild-type alpha-amylase is derived from a strain of Aspergillus kawachii. The alpha-amylase may also be derived from a strain of Subulispora, preferably the one disclosed as SEQ ID NO: 2 in WO 2009/140504.
In a preferred embodiment the fungal acid alpha-amylase is a hybrid alpha-amylase. Preferred examples of fungal hybrid alpha-amylases include the ones disclosed in WO 2005/003311 or U.S. Patent Publication no. 2005/0054071 (Novozymes) or U.S. patent application No. 60/638,614 (Novozymes) which is hereby incorporated by reference. A hybrid alpha-amylase may comprise an alpha-amylase catalytic domain (CD) and a carbohydrate-binding domain/module (CBM), such as a starch binding domain, and optional a linker. Specific examples of contemplated hybrid alpha-amylases include those disclosed in Table 1 to 5 of the examples in U.S. patent application No. 60/638,614, including Fungamyl variant with catalytic domain JA118 and Athelia rolfsii SBD (SEQ ID NO:100 in U.S. 60/638,614), Rhizomucor pusillus alpha-amylase with Athelia rolfsii AMG linker and SBD (SEQ ID NO:101 in U.S. 60/638,614), Rhizomucor pusillus alpha-amylase with Aspergillus niger glucoamylase linker and SBD (which is disclosed in Table 5 as a combination of amino acid sequences SEQ ID NO:20, SEQ ID NO:72 and SEQ ID NO:96 in U.S. application Ser. No. 11/316,535) or as V039 in Table 5 in WO 2006/069290, and Meripilus giganteus alpha-amylase with Athelia rolfsii glucoamylase linker and SBD (SEQ ID NO:102 in U.S. 60/638,614). Other specifically contemplated hybrid alpha-amylases are any of the ones listed in Tables 3, 4, 5, and 6 in Example 4 in U.S. application Ser. No. 11/316,535 and WO 2006/069290 (hereby incorporated by reference). Other specific examples of contemplated hybrid alpha-amylases include those disclosed in U.S. Patent Publication no. 2005/0054071, including those disclosed in Table 3 on page 15, such as Aspergillus niger alpha-amylase with Aspergillus kawachii linker and starch binding domain. Contemplated are also alpha-amylases which exhibit a high identity to any of above mention alpha-amylases, i.e., at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or even 100% identity to the mature enzyme sequences. An acid alpha-amylases may according to the invention be added in an amount of 0.001 to 10 AFAU/g DS, preferably from 0.01 to 5 AFAU/g DS, especially 0.3 to 2 AFAU/g DS or 0.001 to 1 FAU-F/g DS, preferably 0.01 to 1 FAU-F/g DS.
Preferred commercial compositions comprising alpha-amylase include MYCOLASE™ from DSM (Gist Brocades), BAN™, TERMAMYL™ SC, FUNGAMYL™, LIQUOZYME™ X, LIQUOZYME™ SC and SAN™ SUPER, SAN™ EXTRA L (Novozymes A/S) and CLARASE™ L-40,000, DEX-LO™, SPEZYME™ FRED, SPEZYME™ AA, and SPEZYME™ DELTA AA, SPEZYME™ XTRA, SPEZYME ALPHA™, GC358 (Genencor Int.), FUELZYME™-LF (Verenium Inc), and the acid fungal alpha-amylase sold under the trade name SP288 (available from Novozymes A/S, Denmark).
The term “carbohydrate-source generating enzyme” includes glucoamylase (being glucose generators), beta-amylase and maltogenic amylase (being maltose generators) and also alpha-glucosidase. A carbohydrate-source generating enzyme is capable of producing a carbohydrate that can be used as an energy-source by the fermenting organism(s) in question, for instance, when used in a process of the invention for producing a fermentation product, such as ethanol. The generated carbohydrate may be converted directly or indirectly to the desired fermentation product, preferably ethanol. According to the invention a mixture of carbohydrate-source generating enzymes may be used. Especially contemplated blends are mixtures comprising at least a glucoamylase and an alpha-amylase, especially an acid amylase, even more preferred an acid fungal alpha-amylase. The ratio between glucoamylase activity (AGU) and fungal alpha-amylase activity (FAU-F) (i.e., AGU per FAU-F) may in a preferred embodiment of the invention be between 0.1 and 100 AGU/FAU-F, in particular between 2 and 50 AGU/FAU-F, such as in the range from 10-40 AGU/FAU-F, especially when doing one-step fermentation (Raw Starch Hydrolysis—RSH), i.e., when saccharification and fermentation are carried out simultaneously (i.e. without a liquefaction step). In a conventional starch-to-ethanol process (i.e., including a liquefaction step (a)) the ratio may preferably be as defined in EP 140,410-B1, especially when saccharification in step (b) and fermentation in step (c) are carried out simultaneously.
A glucoamylase used according to the invention may be derived from any suitable source, e.g., derived from a microorganism or a plant. Preferred glucoamylases are of fungal or bacterial origin, selected from the group consisting of Aspergillus glucoamylases, in particular Aspergillus niger G1 or G2 glucoamylase (Boel et al. (1984), EMBO J. 3 (5), p. 1097-1102), or variants thereof, such as those disclosed in WO 92/00381, WO 00/04136 and WO 01/04273 (from Novozymes, Denmark); the A. awamori glucoamylase disclosed in WO 84/02921, Aspergillus oryzae glucoamylase (Agric. Biol. Chem. (1991), 55 (4), p. 941-949), or variants or fragments thereof. Other Aspergillus glucoamylase variants include variants with enhanced thermal stability: G137A and G139A (Chen et al. (1996), Prot. Eng. 9, 499-505); D257E and D293E/Q (Chen et al. (1995), Prot. Eng. 8, 575-582); N182 (Chen et al. (1994), Biochem. J. 301, 275-281); disulphide bonds, A246C (Fierobe et al. (1996), Biochemistry, 35, 8698-8704; and introduction of Pro residues in position A435 and S436 (Li et al. (1997), Protein Eng. 10, 1199-1204. Other glucoamylases include Athelia rolfsii (previously denoted Corticium rolfsii) glucoamylase (see U.S. Pat. No. 4,727,026 and (Nagasaka et al. (1998) “Purification and properties of the raw-starch-degrading glucoamylases from Corticium rolfsii, Appl Microbiol Biotechnol 50:323-330), Talaromyces glucoamylases, in particular derived from Talaromyces emersonii (WO 99/28448), Talaromyces leycettanus (U.S. Pat. No. Re. 32,153), Talaromyces duponti, Talaromyces thermophilus (U.S. Pat. No. 4,587,215). Bacterial glucoamylases contemplated include glucoamylases from the genus Clostridium, in particular C. thermoamylolyticum (EP 135,138), and C. thermohydrosulfuricum (WO 86/01831) and Trametes cingulata, Pachykytospora papyracea; and Leucopaxillus giganteus all disclosed in WO 2006/069289; or Peniophora rufomarginata disclosed in WO2007/124285; or a mixture thereof. Also hybrid glucoamylase are contemplated according to the invention. Examples the hybrid glucoamylases disclosed in WO 2005/045018. Specific examples include the hybrid glucoamylase disclosed in Table 1 and 4 of Example 1 (which hybrids are hereby incorporated by reference). Contemplated are also glucoamylases which exhibit a high identity to any of above mention glucoamylases, i.e., at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or even 100% identity to the mature enzymes sequences mentioned above. Commercially available compositions comprising glucoamylase include AMG 200L; AMG 300 L; SAN™ SUPER, SAN™ EXTRA L, SPIRIZYME™ PLUS, SPIRIZYME™ FUEL, SPIRIZYME™ B4U, SPIRIZYME™ ULTRA and AMG™ E (from Novozymes A/S); OPTIDEX™ 300, GC480, GC417 (from Genencor Int.); AMIGASE™ and AMIGASE™ PLUS (from DSM); G-ZYME™ G900, G-ZYME™ and G990 ZR (from Genencor Int.). Glucoamylases may in an embodiment be added in an amount of 0.0001-20 AGU/g DS, preferably 0.001-10 AGU/g DS, especially between 0.01-5 AGU/g DS, such as 0.1-2 AGU/g DS.
A beta-amylase (E.C 3.2.1.2) is the name traditionally given to exo-acting maltogenic amylases, which catalyze the hydrolysis of 1,4-alpha-glucosidic linkages in amylose, amylopectin and related glucose polymers. Maltose units are successively removed from the non-reducing chain ends in a step-wise manner until the molecule is degraded or, in the case of amylopectin, until a branch point is reached. The maltose released has the beta anomeric configuration, hence the name beta-amylase. Beta-amylases have been isolated from various plants and microorganisms (W. M. Fogarty and C. T. Kelly, Progress in Industrial Microbiology, vol. 15, pp. 112-115, 1979). These beta-amylases are characterized by having optimum temperatures in the range from 40° C. to 65° C. and optimum pH in the range from 4.5 to 7. A commercially available beta-amylase from barley is NOVOZYM™ WBA from Novozymes A/S, Denmark and SPEZYME™ BBA 1500 from Genencor Int., USA.
The amylase may also be a maltogenic alpha-amylase. A “maltogenic alpha-amylase” (glucan 1,4-alpha-maltohydrolase, E.C. 3.2.1.133) is able to hydrolyze amylose and amylopectin to maltose in the alpha-configuration. A maltogenic amylase from Bacillus stearothermophilus strain NCIB 11837 is commercially available from Novozymes A/S. Maltogenic alpha-amylases are described in U.S. Pat. Nos. 4,598,048, 4,604,355 and 6,162,628, which are hereby incorporated by reference. The maltogenic amylase may in a preferred embodiment be added in an amount of 0.05-5 mg total protein/gram DS or 0.05-5 MANU/g DS.
Bacillus deramificans pullulanase is disclosed in SEQ ID NO: 96
Thermococcus litoralis and Thermococcus hydrothermalis amylopullulanase X4 chimer is disclosed in SEQ ID NO: 83
BMSY Medium:
(1% yeast extract, 2% peptone, 100 mM potassium phosphate buffer, pH 6.0, 1.34% YNB, 4×10-5% biotin, 2% sorbitol)
The strategy for creating the Hidden Markov Model is described above in the section “Identification of X46 domains by Hidden Markov Models.
The amylolytic activity may be determined using potato starch as substrate. This method is based on the break-down of modified potato starch by the enzyme, and the reaction is followed by mixing samples of the starch/enzyme solution with an iodine solution. Initially, a blackish-blue color is formed, but during the break-down of the starch the blue color gets weaker and gradually turns into a reddish-brown, which is compared to a colored glass standard.
One Kilo Novo alpha amylase Unit (KNU) is defined as the amount of enzyme which, under standard conditions (i.e., at 37° C.+/−0.05; 0.0003 M Ca2+; and pH 5.6) dextrinizes 5260 mg starch dry substance Merck Amylum solubile. A folder EB-SM-0009.02/01 describing this analytical method in more detail is available upon request to Novozymes A/S, Denmark, which folder is hereby included by reference.
Determination of FAU activity
One Fungal Alpha-Amylase Unit (FAU) is defined as the amount of enzyme, which breaks down 5.26 g starch (Merck Amylum solubile Erg. B.6, Batch 9947275) per hour based upon the following standard conditions:
| Substrate | Soluble starch | |
| Temperature | 37° C. | |
| pH | 4.7 | |
| Reaction time | 7-20 minutes | |
Acid alpha-amylase activity is measured in AFAU (Acid Fungal Alpha-amylase Units), which are determined relative to an enzyme standard. The standard used is AMG 300 L (from Novozymes A/S, Denmark, glucoamylase wild-type Aspergillus niger G1, also disclosed in Boel et al. (1984), EMBO J. 3 (5), p. 1097-1102) and WO 92/00381). The neutral alpha-amylase in this AMG falls after storage at room temperature for 3 weeks from approx. 1 FAU/mL to below 0.05 FAU/mL.
The acid alpha-amylase activity in this AMG standard is determined in accordance with the following description. In this method, 1 AFAU is defined as the amount of enzyme, which degrades 5.260 mg starch dry matter per hour under standard conditions. Iodine forms a blue complex with starch but not with its degradation products. The intensity of color is therefore directly proportional to the concentration of starch. Amylase activity is determined using reverse colorimetry as a reduction in the concentration of starch under specified analytic conditions.
Standard conditions/reaction conditions: (per minute)
Substrate: Starch, approx. 0.17 g/L
Buffer: Citate, approx. 0.03 M
Iodine (I2): 0.03 g/L
CaCl2: 1.85 mM
pH: 2.50±0.05
Incubation temperature: 40° C.
Reaction time: 23 seconds
Wavelength: lambda=590 nm
Enzyme concentration: 0.025 AFAU/mL
Enzyme working range: 0.01-0.04 AFAU/mL
If further details are preferred these can be found in EB-SM-0259.02/01 available on request from Novozymes A/S, Denmark, and incorporated by reference.
The Novo Glucoamylase Unit (AGU) is defined as the amount of enzyme, which hydrolyzes 1 micromole maltose per minute under the standard conditions 37° C., pH 4.3, substrate: maltose 23.2 mM, buffer: acetate 0.1 M, reaction time 5 minutes. An autoanalyzer system may be used. Mutarotase is added to the glucose dehydrogenase reagent so that any alpha-D-glucose present is turned into beta-D-glucose. Glucose dehydrogenase reacts specifically with beta-D-glucose in the reaction mentioned above, forming NADH which is determined using a photometer at 340 nm as a measure of the original glucose concentration.
| AMG incubation: |
| Substrate: | maltose 23.2 mM | |
| Buffer: | acetate 0.1M | |
| pH: | 4.30 ± 0.05 | |
| Incubation temperature: | 37° C. ± 1 | |
| Reaction time: | 5 minutes | |
| Enzyme working range: | 0.5-4.0 AGU/mL | |
| Color reaction: |
| GlucDH: | 430 | U/L | |
| Mutarotase: | 9 | U/L | |
| NAD: | 0.21 | mM |
| Buffer: | phosphate 0.12M; 0.15M NaCl | |
| pH: | 7.60 ± 0.05 | |
| Incubation temperature: | 37° C. ± 1 |
| Reaction time: | 5 | minutes | |
| Wavelength: | 340 | nm | |
A folder (EB-SM-0131.02/01) describing this analytical method in more detail is available on request from Novozymes A/S, Denmark, which folder is hereby included by reference.
One MANU (Maltogenic Amylase Novo Unit) may be defined as the amount of enzyme required to release one micro mole of maltose per minute at a concentration of 10 mg of maltotriose (Sigma M 8378) substrate per ml of 0.1 M citrate buffer, pH 5.0 at 37° C. for 30 minutes.
The following assays for protease activity were used:
A solution of 0.2% of the blue substrate AZCL-casein is suspended in Borax/NaH2PO4 buffer pH9 while stirring. (For pH profile the buffer system pH 3 to pH 11 is used instead). The solution is distributed while stirring to microtiter plate (100 microL to each well), 30 microL enzyme sample is added and the plates are incubated in an Eppendorf Thermomixer for 30 minutes at 45° C. and 600 rpm. Denatured enzyme sample (100° C. boiling for 20 min) is used as a blank. After incubation the reaction is stopped by transferring the microtiter plate onto ice and the coloured solution is separated from the solid by centrifugation at 3000 rpm for 5 minutes at 4° C. 60 microL of supernatant is transferred to a microtiter plate and the absorbance at 595 nm is measured using a BioRad Microplate Reader.
pNA-Assay
50 microL protease sample is added to a microtiter plate and the assay is started by adding 100 microL 1 mM pNA substrate (5 mg dissolved in 100 microL DMSO and further diluted to 10 mL with Borax/NaH2PO4 buffer pH9.0). The increase in OD405 at room temperature is monitored as a measure of the protease activity.
One MANU (Maltogenic Amylase Novo Unit) may be defined as the amount of enzyme required to release one micro mole of maltose per minute at a concentration of 10 mg of maltotriose (Sigma M 8378) substrate per ml of 0.1 M citrate buffer, pH 5.0 at 37° C. for 30 minutes.
Pullulanase activity is determined as described in Example 2 below.
A synthetic gene based on the X46 domain (DUF2223 domain) containing polypeptide sequence of Dictyoglomus thermophilum DSM 3960 gene locus DICTH—0512 (Uniprot: B5YCY6) was designed and the gene was codon optimized for Bacillus subtilis as described in EP patent application no. 10173848.2. The amino terminus of the respective polypeptide Uniprot: B5YCY6 was corrected and the sequence MISKKLKGGENSPPLKRFKEGYK (amino acids 1-23 in SEQ ID NO: 92) was predicted to be part of the signal peptide. Therefore, the amino acids 1-41 of SEQ ID NO: 92 were not part of the designed synthetic gene (SEQ ID NO: 93) and the respective translated protein (SEQ ID NO: 94). The synthetic gene comprises the signal peptide of the amyL gene from B. licheniformis (amino acids 1-28 SEQ ID NO: 94) and an affinity tag (amino acids 29-35 in SEQ ID NO: 94) which enabled purification of the mature peptide by affinity chromatography.
The synthetic gene was extracted by double-digestion according to the manufacturer's manual (FastDigest®, Fermentas, Germany) from a plasmid carrying the synthetic gene. The synthetic gene (SEQ ID NO: 93) was cloned in an E. coli/Bacillus subtilis shuttle plasmid described in shuttle vector described in Example 1 in EP patent application no. 10173848.2 which is hereby incorporated by reference). The derived construct (denoted C624V) was transformed into a suitable B. subtilis host and the gene SEQ ID NO: 93 integrated into the Bacillus subtilis chromosome by homologous recombination into the pectate lyase (pel) locus. The gene was expressed under the control of the a triple promoter system consisting of the promoters from Bacillus licheniformis alpha-amylase gene (amyL), Bacillus amyloliquefaciens alpha-amylase gene (amyQ), and the Bacillus thuringiensis cryIIIA promoter including a stabilizing sequence (as described in WO 99/43835). The gene coding for chloramphenicol acetyltransferase was used as maker (as described in (Diderichsen et al., 1993, Plasmid 30: 312-315). Chloramphenicol resistant clones were analyzed by DNA sequencing to verify the correct DNA sequence of the construct. One expression clone denoted O5BG5 was selected and was cultivated on a rotary shaking table in 500 mL baffled Erlenmeyer flasks each containing 100 mL casein based media supplemented with 6 mg/L chloramphenicol. B. subtilis O5BG5 was cultivated for 5-7 days at 37° C. and successful expression of the mature protein (SEQ ID NO: 94, amino acids 29-284) was observed by SDS-PAGE gel electrophoresis. To partially purify the recombinantly expressed protein from the culture supernatant of a B. subtilis O5BG5 culture, the cell free culture supernatant was subjected to incubation for 30 minutes at 80° C., following a centrifugation at 10.000 rpm for 30 minutes at 4° C. This procedure partially separates the precipitated B. subtilis endogenous polypeptides from the recombinant X46 polypeptide which remains in the water phase of the solution. The treatment did not lead to loss of intact X46 polypeptide as judged by SDS-PAGE analysis, indicating that X46 domain containing polypeptide of Dictyoglomus thermophilum DSM 3960 is a heat stable protein.
Petri dishes with AZCL-pullulan (Megazyme) were used for detection of pullulanase activity in culture supernatants or in preparations containing purified pullulanase and were prepared as follows. 115.2 mL Britton-Robinson buffer and 284.8 mL deionized water were mixed and pH was adjusted to 4.5 adding 2 N NaOH. Subsequently 4 g agarose type II (Sigma A6877) was added and the solution was heated with stirring until the agarose was dissolved. After cooling down (to around 55° C.) with stirring, approx. 0.025% AZCL-pullulan (Megazyme) was added and 70 mL was poured in a 14 cm diameter Petri dish. Wells of 4 mm diameter were punched out after solidification of the agarose.
Alternatively, Petri dishes containing amylopectin were used and prepared as follows. 400 ml BT-agar (6.25 g/L tryptone, 6.25 g/L amylopectin hydrate, 25 g/L granulated agar in deionized water) was mixed at 55° C. with 100 ml Ba2-solution (1 g/L (NH4)2SO4, 2.5 g/L MgSO4.7H2O, 1.25 g/L CaCl2.2H2O, 15 g/L KH2PO4 in deionized water) and 70 mL was poured in a 14 cm diameter Petri plate.
500 microL samples were taken from the cultures described in the previous example and centrifuged at 10.000 rpm for 10 minutes at 12° C. 10-20 micro l of the supernatant (or purified pullulanase preparations or assay mixtures) was spotted on the different activity plates and incubated at 40° C. for 16 hours. The formation of halos, i.e. clearing of the amylopectin precipitate or blue color formation around the punched holes indicated pullulanase activity. The activity was scored by measuring the cross diameter of the halos (number 0 in the tables always indicated no pullulanase activity was observed).
Two chromatographic steps were used to purify the recombinantly expressed HQ-tagged X46 domain. Briefly, for the first affinity step, the pH of the culture liquid was set to 8.0 and the liquid filtered through a 0.22 micro m bottle top filter. The pH adjusted culture liquid was then applied to a Ni-NTA column pre equilibrated with Buffer A (25 mM Tris/HCl, 5 mM Imidazole, pH 8.0). The X46 domain was eluted from the column by a linear gradient from 0 to 100% Buffer B (25 mM Tris/HCl buffer, 500 mM Imidazole, pH 8.0). After elution, fractions containing X46 domain, as measured by SDS-PAGE, were pooled and concentrated using a VivaCell 250 (Sartorius Stedim) ultrafiltration unit. The concentrate was then diluted with water to the desired volume and pH adjusted to 8.0. After pH adjustment the sample was applied to a Source15Q (GE Healthcare) anion exchange column pre equilibrated with Buffer C (25 mM Tris/Acetate, pH 8.0). Elution was by a linear gradient from 0 to 100% Buffer D (25 mM Tris/Acetate, 1M NaCl, pH 8.0). Fractions containing X46 domain as measured by SDS-PAGE were then collected and pooled.
A combination of pullulanase and amylopullulanase and the X46 domain-containing polypeptide from Dictyoglomus thermophilum DSM 3960 from Example 1 was incubated at different temperatures in order to assess the boosting effect on the debranching activity of (i) amylopullulanase that already contains two native X46 domains, (ii) amylopullulanase that were missing X46 domains and (iii) pullulanases of type I that do not have X46 domains by nature.
Different combinations of 1 micro g of the Thermococcus litoralis and Thermococcus hydrothermalis amylopullulanase X4 chimer (SEQ ID NO: 83) (construct C629Z), also described in U.S. patent application No. 61/289,040 (Novozymes), or 1 micro g of the Thermococcus hydrothermalis amylopullulanase as described in Example 5 of U.S. patent application No. 61/289,040 (Novozymes), or 1 micro g of the purified Bacillus deramificans pullulanase (SEQ ID NO: 97) were spotted together with 5 micro g of purified X46 domain polypeptide from Example 3 in a total volume of 20 microL on screening plates as described in Example 2. Water was used as a negative control to compensate for a possible protein-protein interaction effect, 5 micro g of bovine serum albumin (BSE) (from Sigma) was used instead of X46 domain polypeptide. The following table summarized the observed halo diameters. The Bacillus deramificans pullulanase was not incubated at temperatures 70° C. and 80° C., because the pullulanase is not stable at those temperatures under the assay conditions chosen.
| O/N incl. Temp. | 60° C. | 70° C. | 80° C. |
| X46 domain | 0 | 0 | 0 |
| X4 Chimer | 5 mm | 5.5 mm | 6.25 mm |
| X4 Chimer + BSA | 4 mm | 5.5 mm | 6 mm |
| X4 Chimer + X46 Domain | 6 mm | 8 mm | 8.75 mm |
| T. hydrothermalis | 4 mm | 5 mm | 4 mm |
| amylopullulanase | |||
| T. hydrothermalis | 4 mm | 5.25 mm | 4 mm |
| amylopullulanase + BSA | |||
| T. hydrothermalis | 5 mm | 6 mm | 5 mm |
| amylopullulanase + X46 Domain | |||
| Bacillus deramificans | 7 mm | Nd | nd |
| pullulanase | |||
| Bacillus deramificans | 7 mm | Nd | nd |
| pullulanase + BSA | |||
| Bacillus deramificans | 9 mm | Nd | nd |
| pullulanase + X46 Domain | |||
In all cases, the addition of X46 domain polypeptide enhanced the activity of the debranching enzymes, especially pronounced for Bacillus deramificans pullulanase at 60° C. and the X4 chimer at 80° C., where both pullulanase enzymes are close to their optimal temperature. The X46 domain alone does not display any debranching activity (0) and must therefore work in synergy with starch-degrading enzymes. Notably, the increased enzyme activity was detected for both types of pullulanases, type I pullulanase (Bacillus deramificans pullulanase) and type II pullulanase (X4 chimer and Thermococcus hydrothermalis amylopullulanase). X46 domain polypeptide in combination with Thermococcus hydrothermalis amylopullulanase, which itself has two X46 domains resulted in a slight enhancement (i.e., up to 1 mm difference).
| Oligo | |||
| Gene | name | Oligo seq | |
| X46 | C1QBX46F | AGGGGTATCTCTCGAGAAAAGAACAGACC | |
| domain | (SEQ ID | CAGAGGGTGACG | |
| NO: 95) | |||
| C1QBR | GGTGCTGATGGAATTCTGGCTCCTCTCCA | ||
| (SEQ ID | CCAGTTC | ||
| NO: 96) | |||
The synthetic gene described as SEQ ID NO: 14 in U.S. patent application No. 61/289,040 (Novozymes) and SEQ ID NO: 98 herein, was used as template to amplify the isolated domain of the amylopullulanase from Thermococcus hydrothermalis. The X46 (DUF2223b) domain was amplified with Phusion polymerase using oligo pairs mentioned in above table and cloned in Pichia pastoris as described in U.S. patent application No. 61/289,040 (Novozymes).
The sequence of the resulting expression construct (the coding region of the expressed X46 domain and alpha signal peptide is shown in SEQ ID NO: 100 (DNA) and SEQ ID NO: 101 (Peptide) was confirmed and named pX46. The plasmid was transformed into Pichia pastoris using standard electroporation protocol (see WO 2004/069872-A1 hereby incorporated by reference). The resulting transformants (named X46) were grown in BMSY media for 2 days at 28° C. with vigorous shaking. Then cells were induced for 3 days with a daily supplement of 0.5% methanol. The culture supernatant was applied to Invitrogen SDS-polyacrylamide gel electrophoresis. The transformant with strongest band was chosen for further fermentation and subsequent purification.
The pH of the Pichia pastoris culture expressing the isolated X46 domain was adjusted to 7.0 with NaOH then filtered through a 0.45 micro m filter. The solution was applied to a 30 mL Ni-sepharose High Performance column (GE Healthcare) which was equilibrated with 20 mM Tris-HCl containing 0.3 M NaCl at pH 7.0. The protein was eluted with a linear imidazole gradient (0-500 mM). Fractions from the column were analyzed by SDS-PAGE.
10 micro g amylopullulanase derived from Thermococcus hydrothermalis shown in SEQ ID NO: 2 (P6VK), different amounts of X46 domain, 100 microL 0.4% AZCL-HE-pullulan (Megazyme International Ireland Ltd.) and 150 microL buffer at pH 4.5, and different amounts of milliQ water (to give the same final volume for the different ratios) were mixed and incubated at corresponding temperature for 50 minutes with shaking at 900 rpm. The tubes were put on ice after reaction and 100 microL supernatant was transferred to a microtiter plate. OD595 was read as a measure of pullulanase activity. For each sample the reaction was performed triplicate.
Results for different ratio (the amount of amylopullulanase was kept at 10 micro g for each reaction). The activity of the 10 micro g amylopullulanase alone was set to 100%.
| Sam- | X46 Domain | 1 | 1 | 1 | 1 | 2 | 5 | 10 |
| ple | Thermococcus | 10 | 5 | 2 | 1 | 1 | 1 | 1 |
| ratio | hydrothermalis | |||||||
| amylo- | ||||||||
| pullulanase |
| Relative activity (%) | 111 | 88 | 109 | 119 | 117 | 111 | 135 |
| Sam- | X46 Domain | 1 | 1 | 1 | 1 | 2 | 5 | 10 |
| ple | Thermococcus | 10 | 5 | 2 | 1 | 1 | 1 | 1 |
| ratio | hydrothermalis | |||||||
| amylo- | ||||||||
| pullulanase |
| Relative activity (%) | 103 | 124 | 139 | 136 | 118 | 133 | 104 |
10 micro g pullulanase derived from Thermococcus hydrothermalis shown in SEQ ID NO: 2 (P6VK), 20 micro g X46 domain, 100 micro L 0.4% AZCL-HE-pullulan and 150 micro L buffer at pH 4.5 were mixed and incubated at corresponding temperature for 50 minutes with shaking at 900 rpm. The tubes were put on ice after reaction and 100 microL supernatant was transferred to a microtiter plate. OD595 was read as a measure of pullulanase. For each sample the reaction was performed triplicate.
| Temperature | 50° C. | 60° C. | 70° C. | 80° C. |
| Relative activity (%) | 100 | 114 | 126 | 178 |
pH buffers: 100 mM Succinic acid, HEPES, CHES, CAPSO, 1 mM CaCl2, 150 mM KCl, 0.01% Triton X-100, pH adjusted to 3.5, 4.0, 4.5, 5.0, 6.0 7.0, and 8.0 with HCl and NaOH.
10 micro g pullulanase derived from Thermococcus hydrothermalis shown in SEQ ID NO: 2 (P6VK), 20 micro g X46 domain, 100 microL 0.4% AZCL-HE-pullulan (in MilliQ) and 150 microL 50 mM pH buffer (3.5-8) were mixed and incubated at 50° C. for 30 minutes with shaking at 900 rpm. 100 microL supernatant was transferred to a new microtiter plate. OD595 was read as a measure of pullulanase activity. For each enzyme the reaction was performed triplicate.
| pH | 3.5 | 4 | 4.5 | 5 | 6 | 7 | 8 |
| Relative activity (%) | 100 | 146 | 183 | 162 | 157 | 164 | 162 |
1 micro g alpha-amylase from Subulispora disclosed as SEQ ID NO: 2 in WO 2009/140504 (Novozymes); different amounts of X46 domain; 100 microL 0.4% AZCL-HE-amylose (Megazyme International Ireland Ltd.) at pH 4.5, and different amount of milliQ water (to give the same final volume for different ratio) were mixed and incubated at 37° C. for 30 minutes with shaking at 900 rpm. The tubes were put on ice after reaction and 100 microL supernatant was transferred to a microtiter plate. OD595 was read as a measure for pullulanase activity. For each sample the reaction was performed triplicate.
Results for different ratio (the amount of alpha-amylase was kept at 1 micro g for each reaction)
The activity of the 1 micro g amylase alone was set to 100%.
| Sample ratio | Amylase | 1 | 1 | 1 | 1 | 2 | 5 | 10 |
| X46 Domain | 10 | 5 | 2 | 1 | 1 | 1 | 1 |
| Relative activity (%) | 81 | 133 | 113 | 89 | 133 | 137 | 81 |
The present invention is further described in the following numbered paragraphs:
[1] A composition comprising a polypeptide comprising or consisting of an X46 domain and further a starch-degrading enzyme.
[2] A composition of paragraph 1, wherein the polypeptide comprising or consisting of an X46 domain is selected from the group of:
[3] The composition of paragraphs 1 or 2, wherein the polypeptide(s) increase(s) the starch hydrolyzing activity of the starch-degrading enzyme(s).
[4] The composition of paragraphs 1-3, wherein the starch-degrading enzyme(s) is(are) selected from the group consisting of pullulanases, amylopullulanases, alpha-amylases, isoamylases, beta-amylases, glucoamylases, and CGTases.
[5] The composition of any of paragraphs 1-4, wherein the HMM score is at least 200.
[6] The composition of any of paragraphs 1-5, wherein the polypeptide comprising or consisting of an X46 domain is found by HMM selected from the group consisting of any of SEQ ID NOS: 7-81, 85, 87 and 89.
[7] The composition of any of paragraphs 1-6, wherein the polypeptide comprising or consisting of an X46 domain is selected from the group consisting of:
[8] The composition of any of paragraphs 1-7, wherein the polypeptide comprising or consisting of an X46 domain increases the activity of pullulanases, especially pullulanases of type I of Family GH13 and/or amylopullulanases, especially amylopullulanases of type II of Family GH57.
[9] The composition of paragraph 8, wherein the pullulanase (EC.3.2.1.41) is of type I of Family GH13, in particular a pullulanase derived from a strain of Bacillus, such as a strain of the species Bacillus deramificans, in particular the pullulanase shown in SEQ ID NO: 97 or a strain of the pullulanase of the species Bacillus acidopullulyticus, in particular the pullulanase shown in SEQ ID NO: 1 in WO 00/01796.
[10] The composition of any of paragraphs 1-9, wherein the X46 domain containing polypeptide has an amino acid sequence having at least 70%, preferable at least 80%, more preferably at least 90%, even more preferably at least 95%, such as at least 96%, such as at least 97% such as at least 98%, such as at least 99% identity to the polypeptide shown in SEQ ID NOS: 2, 4, and 6, wherein the variant has at least 60% identity at least 70%, preferable at least 80%, more preferably at least 90%, even more preferably at least 95%, such as at least 96%, such as at least 97% such as at least 98%, such as at least 99% identity, but less than 100% identity to the parent polypeptide shown in any of SEQ ID NOS: 2, 4, and 6.
[11] The composition of any of paragraphs 1 to 10, wherein the polypeptide consisting of an X46 domain or variant thereof has at least 60% identity at least 70%, preferable at least 80%, more preferably at least 90%, even more preferably at least 95%, such as at least 96%, such as at least 97% such as at least 98%, such as at least 99% identity, but less than 100% identity to the parent polypeptide shown in any of SEQ ID NOS: 7-81, 85, 87 and 89.
[12] The composition of any of paragraphs 1-10, wherein the X46 domain comprising polypeptide is derived from a bacteria, preferably a strain of Dictyoglomus, especially a strain of the species Dictiglomus thermophilum, or a strain of Fervido bacterium, especially a strain of the species F. nodosum; a strain of Pyrococcus, especially a strain of Pyrococcus woesie, or a strain of the genus Thermococcus, including Thermococcus litoralis, Thermococcus hydrothermalis.
[13] The composition of any of paragraphs 1-12, wherein the X46 domain containing polypeptide does not have any starch-degrading activity, in particular does not have pullulanase activity, alpha-amylase activity, isoamylase activity, beta-amylase activity, glucoamylase activity or CGTase activity.
[14] The composition of any of paragraphs 1-13, wherein the X46 domain polypeptide consists of:
[15] The composition of any of paragraphs 1-14, wherein the ratio between the polypeptide comprising or consisting of an X46 domain and the starch-degrading enzyme(s) is between 10:1 to 1:10, in particular between 5:1 to 1:5, especially between 2:1 to 1:2, such as around 1:1.
[16] A polypeptide consisting of an X46 domain selected from the group of:
[17] The polypeptide of paragraph 16, wherein the X46 domain has at least 60% identity at least 70%, preferable at least 80%, more preferably at least 90%, even more preferably at least 95%, such as at least 96%, such as at least 97% such as at least 98%, such as at least 99% identity, but less than 100% identity to any of the X46 domains shown in any of SEQ ID NOS: 7-81, 85, 87 and 89.
[18] The polypeptide of paragraphs 16 or 17, wherein the polypeptide consisting of an X46 domain or a variant thereof has a total number of amino acid substitutions, deletions and/or insertions compared to any of the X46 domain shown of SEQ ID NO: 7-81, 85, 87 and 89 of 10, preferably 9, more preferably 8, more preferably 7, more preferably at most 6, more preferably 5, more preferably 4, even more preferably 3, most preferably 2, and even most preferably 1.
[19] The polypeptide of any of paragraphs 16-18, wherein the X46 domain is derived from a strain selected from the group consisting of: Pyrococcus furiosus, Staphylothermus marinus, Pyrobaculum aerophilum, Pyrobaculum aerophilum, Thermoplasma acidophilum, Pyrococcus abyssi, Staphylothermus hellenicus, Staphylothermus marinus, Pyrococcus woesei, Artheobacter globiformis, Scardovia inopinata, Parascardovia denticolens, Thermosphaera aggregans, Thermosphaera aggregans, Thermincola potens, Staphylothermus hellenicus, Ktedonobacter racemifer, Pyrobaculum calidifontis, Acetohalobium arabaticum, Pyrobaculum calidifontis, Pyrobaculum arsenaticum, Pyrobaculum arsenaticum, Fervidobacterium nodosum, Anaeromyxobacter dehalogenans, Pyrobaculum islandicum, Pyrobaculum islandicum, Psychroflexus torques, Halothermothrix orenii, Anaeromyxobacter sp., Arthrobacter globiformis, Thermus thermophilus, Arthrobacter globiformis, Stigmatefla aurantiaca, Arthrobacter globiformis, Anaeromyxobacter dehalogenans, Thermoproteus neutrophilus, Pyrococcus furiosus, Thermus aquaticus, Thermococcus barophilus, Coprothermobacter proteolyticus, Dictyoglomus thermophilum, Thermococcus hydrothermalis, Dictyoglomus turgidum, Thermococcus sp., Kosmotoga olearia, Thermococcus onnurineus, Desulfurococcus kamchatkensis, Thermococcus litoralis, Thermosipho melanesiensis, Catenulispora acidiphila, Thermococcus gammatolerans, Thermococcus gammatolerans, Thermus thermophilus, Thermococcus kodakaraensis, and Catenulispora acidiphila.
[20] An isolated polynucleotide encoding an X46 domain of any of paragraphs 16-19 selected from the consisting of:
[21] A nucleic acid construct comprising the polynucleotide of paragraphs 20 operably linked to one or more (several) control sequences which direct the production of the polypeptide in an expression host.
[22] A recombinant expression vector comprising the nucleic acid construct of paragraph 21.
[23] A recombinant host cell comprising the nucleic acid construct of paragraph 21 or the vector of paragraph 22.
[24] A method for producing an X46 domain of any of paragraphs 16-19 comprising (a) cultivating the recombinant host cell of paragraph 23 under conditions conducive for production of an X46 domain; and (b) recovering the X46 domain.
[25] A process for producing a fermentation product from starch-containing material comprising the steps of:
[26] The process of paragraph 25, wherein the alpha-amylase is of bacterial origin, in particular a Bacillus alpha-amylase.
[27] The process of paragraphs 25 or 26, wherein the alpha-amylase is a bacterial alpha-amylase derived from a strain of Bacillus, such as Bacillus stearothermophilus, in particular the Bacillus stearothermophilus as disclosed in WO99/019467 as SEQ ID NO: 3 with the double deletion I181+G182 and substitution N193F and/or a hybrid alpha-amylase comprises 445 C-terminal amino acid residues of the Bacillus licheniformis alpha-amylase (shown in SEQ ID NO: 4 of WO 99/19467) and the 37 N-terminal amino acid residues of the alpha-amylase derived from Bacillus amyloliquefaciens (shown in SEQ ID NO: 5 of WO 99/19467), with the following substitution: G48A+T49I+G107A+H156Y+A181T+N190F+I201F+A209V+Q264S (using the Bacillus licheniformis numbering in SEQ ID NO: 4 of WO 99/19467).
[28] The process of any of paragraphs 25-27, wherein the alpha-amylase is dosed in an amount of 0.0005-5 KNU per g DS, preferably 0.001-1 KNU per g DS, such as around 0.050 KNU per g DS.
[29] The process of any of paragraphs 25-28, wherein the alpha-amylase is a fungal alpha-amylase, preferably an acid fungal alpha-amylase or a bacterial alpha-amylase.
[30] The process of any of paragraphs 25-29, wherein the alpha-amylase is a fungal alpha-amylase, preferably derived from the genus Aspergillus, especially a strain of A. niger, A. otyzae, A. awamori, or Aspergillus kawachii, or of the genus Rhizomucor, preferably a strain the Rhizomucor pusillus, or the genus Meripilus, preferably a strain of Meripilus giganteus.
[31] The process of any of paragraphs 25-30, wherein the alpha-amylase is present in an amount of 0.001 to 10 AFAU/g DS, preferably 0.01 to 5 AFAU/g DS, especially 0.3 to 2 AFAU/g DS or 0.001 to 1 FAU-F/g DS, preferably 0.01 to 1 FAU-F/g DS.
[32] The process of any of paragraphs 25-31, further wherein a polypeptide comprising or consisting of an X46 domain, preferably of SEQ ID NO: 2, 4, 6-81, 85, 87 and 89 is present during step (a), step (b) or step (c).
[33] The process of any of paragraphs 25-32, wherein polypeptide comprising an X46 is a pullulanase, preferably a pullulanase of type I of Family GH13 or an amylopullulanase of type II of family GH57.
[34] The process of paragraph 25-33, wherein pullulanase is the X4 chimer pullulanase shown in SEQ ID NO: 83.
[35] The process of any of paragraphs 25-34, wherein the polypeptide comprising or consisting of an X46 domain is derived from a bacteria, preferably a strain of Dictyoglomus, especially a strain of the species Dictiglomus thermophilum, or a strain of Fervido bacterium, especially a strain of the species F. nodosum.
[36] The process of any of paragraphs 25-35, wherein the polypeptide comprising or consisting of an X46 domain is derived from a strain from the genus Thermococcus, including Thermococcus litoralis and Thermococcus hydrothermalis; or is obtained from a strain of the genus Pyrococcus, such as Pyrococcus woesei.
[37] The process of any one of paragraphs 25-36, further wherein a protease, in particular an acid fungal protease or a metallo protease is added before, during and/or after liquefaction.
[38] The process paragraph 37, wherein the metallo protease is derived from a strain of the genus Thermoascus, preferably a strain of Thermoascus aurantiacus, especially Thermoascus aurantiacus CGMCC No. 0670.
[39] The process of any of paragraphs 25-38, wherein the carbohydrate-source generating enzyme is selected from the group consisting of glucoamylase, alpha-glucosidase, maltogenic amylase, and beta-amylase.
[40] The process of any of paragraphs 25-39, wherein the carbohydrase-source generating enzyme is glucoamylase and is present in an amount of 0.001 to 10 AGU/g DS, preferably from 0.01 to 5 AGU/g DS, especially 0.1 to 0.5 AGU/g DS.
[41] The process of any of paragraphs 25-40, wherein the glucoamylase is derived from a strain of Aspergillus, preferably Aspergillus niger or Aspergillus awamori, a strain of Talaromyces, especially Talaromyces emersonii; or a strain of Athelia, especially Athelia rolfsii; a strain of Trametes, preferably Trametes cingulata; a strain of the genus Pachykytospora, preferably a strain of Pachykytospora papyracea; or a strain of the genus Leucopaxillus, preferably Leucopaxillus giganteus; or a strain of the genus Peniophora, preferably a strain of the species Peniophora rufomarginata; or a mixture thereof.
[42] The process of any of paragraphs 25-41, wherein step (a) is carried out at pH 4-6, preferably at a pH from 4.5 to 5.0, such as around pH 4.5.
[43] The process of any of paragraphs 25-41, wherein the fermentation product is recovered after fermentation, preferably by distillation.
[44] The process of any of paragraphs 25-43, wherein the step (b) and (c) are carried out sequentially or simultaneously (i.e., SSF process).
[45] The process of any of paragraphs 25-44, wherein the fermentation product is a beverage, in particular beer, or alcohol, preferably ethanol, especially fuel ethanol, potable ethanol and/or industrial ethanol.
[46] The process of any of paragraphs 25-45, wherein the starch-containing starting material is whole grain.
[47] The process of any of paragraphs 25-46, wherein the starch-containing material is derived from corn, wheat, barley, rye, milo, sago, cassava, manioc, tapioca, sorghum, rice or potatoes.
[48] The process of any of paragraphs 25-47, wherein the fermenting organism is a strain of Saccharomyces, preferably a strain of Saccharomyces cerevisae.
[49]. The process of any of paragraphs 25-47, further comprising, prior to the step (a), the steps of:
[50] The process of any of paragraphs 25-49, wherein the slurry in step (a) is heated to above the gelatinization temperature, preferably to a temperature between 70-95° C., preferably 80-90° C., such as around 85° C.
[51] The process of any of paragraphs 25 or 50, wherein the slurry is jet-cooked at a temperature between 95-140° C., such as 110-135° C., or 105-125° C., for 1-15 minutes, preferably for 3-10 minutes, especially around 5 minutes.
[52] The use of a composition as defined in any one of paragraphs 1-15 in a process of producing sweeteners from starch.
[53] The use of a composition of any of paragraphs 1-15, in a process of producing a fermentation product, such as ethanol, from gelatinized.
1-14. (canceled)
15. A composition comprising a polypeptide comprising or consisting of an X46 domain and a starch-degrading enzyme.
16. The composition of claim 15, wherein the polypeptide has at least 60% identity to any of SEQ ID NOS: 2, 4, 6-81, 85, 87 and 89.
17. The composition of claim 15, wherein the polypeptide has at least 70% identity to any of SEQ ID NOS: 2, 4, 6-81, 85, 87 and 89.
18. The composition of claim 15, wherein the polypeptide has at least 80% identity to any of SEQ ID NOS: 2, 4, 6-81, 85, 87 and 89.
19. The composition of claim 15, wherein the polypeptide has at least 90% identity to any of SEQ ID NOS: 2, 4, 6-81, 85, 87 and 89.
20. The composition of claim 15, wherein the polypeptide has at least 95% identity to any of SEQ ID NOS: 2, 4, 6-81, 85, 87 and 89.
20. The composition of claim 15, wherein the polypeptide comprises any of SEQ ID NOS: 2, 4, 6-81, 85, 87 and 89.
21. The composition of claim 15, wherein the starch-degrading enzyme(s) is(are) selected from the group consisting of alpha-amylases, beta-amylases, CGTases, glucoamylases, isoamylases, amylopullulanases, and pullulanases.
22. The composition of claim 15, wherein the X46 domain containing polypeptide does not have any starch-degrading activity.
23. A polypeptide consisting of an X46 domain having at least 60% identity to any of SEQ ID NOS: 7-81, 85, 87 and 89.
24. The polypeptide of claim 23, wherein the X46 domain has at least 70% identity to any of SEQ ID NOS: 7-81, 85, 87 and 89.
25. The polypeptide of claim 23, wherein the X46 domain has at least 80% identity to any of SEQ ID NOS: 7-81, 85, 87 and 89.
26. The polypeptide of claim 23, wherein the X46 domain has at least 90% identity to any of SEQ ID NOS: 7-81, 85, 87 and 89.
27. The polypeptide of claim 23, wherein the X46 domain has at least 95% identity to any of SEQ ID NOS: 7-81, 85, 87 and 89.
28. A process for producing a fermentation product comprising the steps of:
(a) liquefying a starch-containing material in the presence of a composition of claim 15;
(b) saccharifying the liquefied material obtained in step (a) using a carbohydrate-source generating enzyme; and
(c) fermenting using a fermenting organism.
29. The process of claim 28, wherein the starch-degrading enzyme is an alpha-amylase.
30. An isolated polynucleotide encoding an X46 domain of claim 19 selected from the consisting of:
(a) a polynucleotide having at least 60% identity with the X46 domain coding part shown in SEQ ID NO: 84, 86 or 88 or a complementary strand thereof; and
ii) a polynucleotide which hybridizes under low stringency with the X46 domain coding part of SEQ ID NO: 84, 86 or 88 or a complementary strand thereof.
31. A nucleic acid construct comprising the polynucleotide of claim 30 operably linked to one or more (several) control sequences which direct the production of the polypeptide in an expression host.
32. A recombinant expression vector comprising the nucleic acid construct of claim 31.
33. A recombinant host cell comprising the nucleic acid construct of claim 31.
34. A method for producing an X46 domain comprising
(a) cultivating the recombinant host cell of claim 33 under conditions conducive for production of an X46 domain; and
(b) recovering the X46 domain.