Patent application title:

COMPOUNDS AND METHODS FOR MODULATION OF DYSTROPHIA MYOTONICA-PROTEIN KINASE (DMPK) EXPRESSION

Publication number:

US20160304877A1

Publication date:
Application number:

14/911,248

Filed date:

2014-08-11

Abstract:

Provided herein are methods, compounds, and compositions for reducing expression of a DMPK mRNA and protein in an animal. Also provided herein are methods, compounds, and compositions for preferentially reducing CUGexp DMPK RNA, reducing myotonia or reducing spliceopathy in an animal. Such methods, compounds, and compositions are useful to treat, prevent, delay, or ameliorate type 1 myotonic dystrophy, or a symptom thereof.

Inventors:

Assignee:

Interested in similar patents?

Get notified when new applications in this technology area are published.

Classification:

C12N15/1137 »  CPC main

Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor; Recombinant DNA-technology; DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides against enzymes

C12Y207/11001 »  CPC further

Transferases transferring phosphorus-containing groups (2.7); Protein-serine/threonine kinases (2.7.11) Non-specific serine/threonine protein kinase (2.7.11.1), i.e. casein kinase or checkpoint kinase

C12N2310/11 »  CPC further

Structure or type of the nucleic acid; Type of nucleic acid Antisense

C12N2310/3341 »  CPC further

Structure or type of the nucleic acid; Chemical structure of the base; Modified C 5-Methylcytosine

C12N2310/315 »  CPC further

Structure or type of the nucleic acid; Chemical structure of the backbone Phosphorothioates

C12N2310/32 »  CPC further

Structure or type of the nucleic acid; Chemical structure of the sugar

C12N2310/3231 »  CPC further

Structure or type of the nucleic acid; Chemical structure of the sugar modified ring structure having an additional ring, e.g. LNA, ENA

C12N2320/30 »  CPC further

Applications; Uses Special therapeutic applications

C12N15/113 IPC

Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor; Recombinant DNA-technology; DNA or RNA fragments; Modified forms thereof Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides

Description

SEQUENCE LISTING

The present application is being filed along with a Sequence Listing in electronic format. The Sequence Listing is provided as a file entitled BIOL0171WOSEQ_ST25.txt created Aug. 1, 2014, which is approximately 276 Kb in size. The information in the electronic format of the sequence listing is incorporated herein by reference in its entirety.

FIELD

Provided herein are methods, compounds, and compositions for reducing expression of DMPK mRNA and protein in an animal. Also, provided herein are methods, compounds, and compositions comprising a DMPK inhibitor for preferentially reducing CUGexp DMPK RNA, reducing myotonia, or reducing spliceopathy in an animal. Such methods, compounds, and compositions are useful, for example, to treat, prevent, or ameliorate type 1 myotonic dystrophy (DM1) in an animal.

BACKGROUND

Myotonic dystrophy type 1 (DM1) is the most common form of muscular dystrophy in adults with an estimated frequency of 1 in 7,500 (Harper P S., Myotonic Dystrophy. London: W.B. Saunders Company; 2001). DM1 is an autosomal dominant disorder caused by expansion of a non-coding CTG repeat in DMPK1. DMPK1 is a gene encoding a cytosolic serine/threonine kinase (Brook J D, et al., Cell., 1992, 68(4):799-808). The physiologic functions and substrates of this kinase have not been fully determined. The expanded CTG repeat is located in the 3′ untranslated region (UTR) of DMPK1. This mutation leads to RNA dominance, a process in which expression of RNA containing an expanded CUG repeat (CUGexp) induces cell dysfunction (Osborne R J and Thornton C A., Human Molecular Genetics., 2006, 15(2): R162-R169).

The DMPK gene normally has 5-37 CTG repeats in the 3′ untranslated region. In myotonic dystrophy type I, this number is significantly expanded and is, for example, in the range of 50 to greater than 3,500 (Harper, Myotonic Dystrophy (Saunders, London, ed. 3, 2001); Annu. Rev. Neurosci. 29: 259, 2006; EMBO J. 19: 4439, 2000; Curr Opin Neurol. 20: 572, 2007).

The CUGexp tract interacts with RNA binding proteins including muscleblind-like (MBNL) protein, a splicing factor, and causes the mutant transcript to be retained in nuclear foci. The toxicity of this RNA stems from sequestration of RNA binding proteins and activation of signaling pathways. Studies in animal models have shown that phenotypes of DM1 can be reversed if toxicity of CUGexp RNA is reduced (Wheeler T M, et al., Science., 2009, 325(5938):336-339; Mulders S A, et al., Proc Natl Acad Sci USA., 2009, 106(33):13915-13920).

In DM1, skeletal muscle is the most severely affected tissue, but the disease also has important effects on cardiac and smooth muscle, ocular lens, and brain. The cranial, distal limb, and diaphragm muscles are preferentially affected. Manual dexterity is compromised early, which causes several decades of severe disability. The median age at death is 55 years, usually from respiratory failure (de Die-Smulders C E, et al., Brain., 1998, 121(Pt 8):1557-1563).

Antisense technology is emerging as an effective means for modulating expression of certain gene products and may therefore prove to be uniquely useful in a number of therapeutic, diagnostic, and research applications for the modulation of DMPK1. Intramuscular injection of fully modified oligonucleotides targeting with the CAG-repeat were shown in mice to block formation of CUGexp-MBNL1 complexes, disperse nuclear foci of CUGexp transcripts, enhance the nucleocytoplasmic transport and translation of CUGexp transcripts, release MBNL proteins to the nucleoplasm, normalize alternative splicing of MBNL-dependent exons, and eliminate myotonia in CUGexp-expressing transgenic mice (Wheeler T M, et al., Science., 2009, 325(5938):336-339; WO2008/036406).

Presently there is no treatment that can modify the course of DM1. The burden of disease, therefore, is significant. It is, therefore, an object herein to provide compounds, compositions, and methods for treating DM1

SUMMARY

Provided herein are methods, compounds, and compositions for inhibiting expression of DMPK and treating, preventing, delaying or ameliorating a DMPK related disease and or a symptom thereof. In certain embodiments, the compounds and compositions disclosed herein inhibit mutant DMPK or CUGexp DMPK.

Certain embodiments provide a method of reducing DMPK expression in an animal comprising administering to the animal a compound comprising a modified oligonucleotide as further described herein targeted to DMPK.

Certain embodiments provide a method of preferentially reducing CUGexp DMPK relative to wild-type DMPK, reducing myotonia, or reducing spliceopathy in an animal comprising administering to the animal a compound comprising a modified oligonucleotide, as further described herein, targeted to CUGexp DMPK. In certain instances, CUGexp DMPK transcripts are believed to be particularly sensitive to antisense knockdown via nuclear ribonucleases (such as RNase H), because of their longer residence time in the nucleus, and this sensitivity is thought to permit effective antisense inhibition of CUGexp DMPK transcripts in relevant tissues such as muscle despite the biodistribution barriers to tissue uptake of antisense oligonucleotides. Antisense mechanisms that do not elicit cleavage via nuclear ribonucleases, such as the CAG-repeat ASOs described in, for example, Wheeler T M, et al., Science., 2009, 325(5938):336-339 and WO2008/036406, do not provide the same therapeutic advantage.

Certain embodiments provide a method of treating an animal having type 1 myotonic dystrophy. In certain embodiments, the method includes administering to the animal a therapeutically effective amount of a compound comprising a modified oligonucleotide as further described herein targeted to DMPK. In certain embodiments, the method includes identifying an animal with type 1 myotonic dystrophy.

Certain embodiments provide a method of treating, preventing, delaying, or ameliorating symptoms and outcomes associated with development of DM1 including muscle stiffness, myotonia, disabling distal weakness, weakness in face and jaw muscles, difficulty in swallowing, drooping of the eyelids (ptosis), weakness of neck muscles, weakness in arm and leg muscles, persistent muscle pain, hypersomnia, muscle wasting, dysphagia, respiratory insufficiency, irregular heartbeat, heart muscle damage, apathy, insulin resistance, and cataracts. Certain embodiments provide a method of treating, preventing, delaying, or ameliorating symptoms and outcomes associated with development of DM1 in children, including, developmental delays, learning problems, language and speech issues, and personality development issues.

Certain embodiments provide a method of administering an antisense oligonucleotide to counteract RNA dominance by directing the cleavage of pathogenic transcripts.

In certain embodiments, the DMPK has a sequence as set forth in GenBank Accession No. NM_001081560.1 (incorporated herein as SEQ ID NO: 1). In certain embodiments, the DMPK has the sequence as set forth in GenBank Accession No. NT_011109.15 truncated from nucleotides 18540696 to Ser. No. 18/555,106 (incorporated herein as SEQ ID NO: 2). In certain embodiments, the DMPK has the sequence as set forth in GenBank Accession No. NT_039413.7 truncated from nucleotides 16666001 to Ser. No. 16/681,000 (incorporated herein as SEQ ID NO: 3). In certain embodiments, the DMPK has the sequence as set forth in GenBank Accession No. NM_032418.1 (incorporated herein as SEQ ID NO: 4). In certain embodiments, the DMPK has the sequence as set forth in GenBank Accession No. AI007148.1 (incorporated herein as SEQ ID NO: 5). In certain embodiments, the DMPK has the sequence as set forth in GenBank Accession No. AI304033.1 (incorporated herein as SEQ ID NO: 6). In certain embodiments, the DMPK has the sequence as set forth in GenBank Accession No. BC024150.1 (incorporated herein as SEQ ID NO: 7). In certain embodiments, the DMPK has the sequence as set forth in GenBank Accession No. BC056615.1 (incorporated herein as SEQ ID NO: 8). In certain embodiments, the DMPK has the sequence as set forth in GenBank Accession No. BC075715.1 (incorporated herein as SEQ ID NO: 9). In certain embodiments, the DMPK has the sequence as set forth in GenBank Accession No. BU519245.1 (incorporated herein as SEQ ID NO: 10). In certain embodiments, the DMPK has the sequence as set forth in GenBank Accession No. CB247909.1 (incorporated herein as SEQ ID NO: 11). In certain embodiments, the DMPK has the sequence as set forth in GenBank Accession No. CX208906.1 (incorporated herein as SEQ ID NO: 12). In certain embodiments, the DMPK has the sequence as set forth in GenBank Accession No. CX732022.1 (incorporated herein as SEQ ID NO: 13). In certain embodiments, the DMPK has the sequence as set forth in GenBank Accession No. S60315.1 (incorporated herein as SEQ ID NO: 14). In certain embodiments, the DMPK has the sequence as set forth in GenBank Accession No. S60316.1 (incorporated herein as SEQ ID NO: 15). In certain embodiments, the DMPK has the sequence as set forth in GenBank Accession No. NM_001081562.1 (incorporated herein as SEQ ID NO: 16). In certain embodiments, the DMPK has the sequence as set forth in GenBank Accession No. NM_001100.3 (incorporated herein as SEQ ID NO: 17).

The present disclosure provides the following non-limiting numbered embodiments:

EMBODIMENT 1

A compound comprising a modified oligonucleotide consisting of 10-30 linked nucleosides and having a nucleobase sequence comprising a complementary region comprising at least 8 contiguous nucleobases complementary to a target region of equal length of a DMPK nucleic acid.

EMBODIMENT 2

The compound of embodiment 1, wherein at least one nucleoside of the modified oligonucleotide comprises a bicyclic sugar selected from among cEt, LNA, α-L-LNA, ENA and 2′-thio LNA.

EMBODIMENT 3

The compound of any of embodiments 1 to 2, wherein the target region is exon 9 of a DMPK nucleic acid.

EMBODIMENT 4

The compound of any of embodiments 1 to 3, wherein the complementary region comprises at least 10 contiguous nucleobases complementary to a target region of equal length of a DMPK transcript.

EMBODIMENT 5

The compound of any of embodiments 1 to 3, wherein the complementary region comprises at least 12 contiguous nucleobases complementary to a target region of equal length of a DMPK nucleic acid.

EMBODIMENT 6

The compound of any of embodiments 1 to 3, wherein the complementary region comprises at least 14 contiguous nucleobases complementary to a target region of equal length of a DMPK nucleic acid.

EMBODIMENT 7

The compound of any of embodiments 1 to 3, wherein the complementary region comprises at least 16 contiguous nucleobases complementary to a target region of equal length of a DMPK nucleic acid.

EMBODIMENT 8

The compound of any of embodiments 1 to 7, wherein the DMPK nucleic acid is a DMPK pre-mRNA

EMBODIMENT 9

The compound of any of embodiments 1 to 7, wherein the DMPK nucleic acid is a DMPK mRNA.

EMBODIMENT 10

The compound of any of embodiments 1 to 9, wherein the DMPK nucleic acid has a nucleobase sequence selected from among SEQ ID NO: 1 and SEQ ID NO: 2.

EMBODIMENT 11

The compound of any of embodiments 1 to 10, wherein the modified oligonucleotide has a nucleobase sequence comprising a complementary region comprising at least 10 contiguous nucleobases complementary to a target region of equal length of SEQ ID NO: 1 or SEQ ID NO: 2.

EMBODIMENT 12

The compound of embodiments 1 to 10, wherein the modified oligonucleotide has a nucleobase sequence comprising a complementary region comprising at least 12 contiguous nucleobases complementary to a target region of equal length of SEQ ID NO: 1 or SEQ ID NO: 2.

EMBODIMENT 13

The compound of embodiments 1 to 10, wherein the modified oligonucleotide has a nucleobase sequence comprising a complementary region comprising at least 14 contiguous nucleobases complementary to a target region of equal length of SEQ ID NO: 1 or SEQ ID NO: 2.

EMBODIMENT 14

The compound of embodiments 1 to 10, wherein the modified oligonucleotide has a nucleobase sequence comprising a complementary region comprising at least 16 contiguous nucleobases complementary to a target region of equal length of SEQ ID NO: 1 or SEQ ID NO: 2.

EMBODIMENT 15

The compound of any of embodiments 1 to 14, wherein the target region is from nucleobase 1343 to nucleobase 1368 of SEQ ID NO.: 1.

EMBODIMENT 16

The compound of any of embodiments 1 to 14, wherein the target region is from nucleobase 1317 to nucleobase 1366 of SEQ ID NO.: 1.

EMBODIMENT 17

The compound of any of embodiments 1 to 14, wherein the target region is from nucleobase 2748 to nucleobase 2791 of SEQ ID NO.: 1.

EMBODIMENT 18

The compound of any of embodiments 1 to 14, wherein the target region is from nucleobase 730 to nucleobase 748 of SEQ ID NO.: 1.

EMBODIMENT 19

The compound of any of embodiments 1 to 14, wherein the target region is from nucleobase 10195 to nucleobase 10294 of SEQ ID NO.: 2.

EMBODIMENT 20

The compound of any of embodiments 1 to 14, wherein the target region is from nucleobase 10195 to nucleobase 10294 of SEQ ID NO.: 2.

EMBODIMENT 21

The compound of any of embodiments 1 to 14, wherein the target region is from nucleobase 10201 to nucleobase 10216 of SEQ ID NO.: 2.

EMBODIMENT 22

The compound of any of embodiments 1 to 14, wherein the target region is from nucleobase 10202 to nucleobase 10218 of SEQ ID NO.: 2.

EMBODIMENT 23

The compound of any of embodiments 1 to 22, wherein the modified oligonucleotide has a nucleobase sequence that is at least 80% complementary to the target region over the entire length of the oligonucleotide.

EMBODIMENT 24

The compound of any of embodiments 1 to 22, wherein the modified oligonucleotide has a nucleobase sequence that is at least 90% complementary to the target region over the entire length of the oligonucleotide.

EMBODIMENT 25

The compound of any of embodiments 1 to 22, wherein the modified oligonucleotide has a nucleobase sequence that is at least 100% complementary to the target region over the entire length of the oligonucleotide.

EMBODIMENT 26

The compound of any of embodiments 1-25 having a nucleobase sequence comprising at least 8 contiguous nucleobases of a sequence recited in any of SEQ ID NOs: 23-874.

EMBODIMENT 27

The compound of any of embodiments 1 to 25, wherein the modified oligonucleotide has a nucleobase sequence comprising at least 10 contiguous nucleobases of sequence recited in SEQ ID NOs: 23-32.

EMBODIMENT 28

The compound of any of embodiments 1 to 25, wherein the modified oligonucleotide has a nucleobase sequence comprising at least 12 contiguous nucleobases of sequence recited in SEQ ID NOs: 23-32.

EMBODIMENT 29

The compound of any of embodiments 1 to 25, wherein the modified oligonucleotide has a nucleobase sequence comprising at least 14 contiguous nucleobases of sequence recited in SEQ ID NOs: 23-32.

EMBODIMENT 30

The compound of any of embodiments 1 to 25, wherein the modified oligonucleotide has a nucleobase sequence comprising at least 16 contiguous nucleobases of sequence recited in SEQ ID NOs: 23-32.

EMBODIMENT 31

The compound of any of embodiments 1 to 30, wherein the modified oligonucleotide has a nucleobase sequence that consists of the sequence recited in SEQ ID NO: 23.

EMBODIMENT 32

The compound of any of embodiments 1 to 14, wherein the modified oligonucleotide has a nucleobase sequence that consists of the sequence recited in SEQ ID NO: 25.

EMBODIMENT 33

The compound of any of embodiments 1 to 14, wherein the modified oligonucleotide has a nucleobase sequence that consists of the sequence recited in SEQ ID NO: 26.

EMBODIMENT 34

The compound of any of embodiments 1 to 14, wherein the modified oligonucleotide has a nucleobase sequence that consists of the sequence recited in SEQ ID NO: 27.

EMBODIMENT 35

The compound of any of embodiments 1 to 14, wherein the modified oligonucleotide has a nucleobase sequence that consists of the sequence recited in SEQ ID NO: 28.

EMBODIMENT 36

The compound of any of embodiments 1 to 14, wherein the modified oligonucleotide has a nucleobase sequence that consists of the sequence recited in SEQ ID NO: 29.

EMBODIMENT 37

The compound of any of embodiments 1 to 14, wherein the modified oligonucleotide has a nucleobase sequence that consists of the sequence recited in SEQ ID NO: 30.

EMBODIMENT 38

The compound of any of embodiments 1 to 14, wherein the modified oligonucleotide has a nucleobase sequence that consists of the sequence recited in SEQ ID NO: 31.

EMBODIMENT 39

The compound of any of embodiments 1 to 14, wherein the modified oligonucleotide has a nucleobase sequence that consists of the sequence recited in SEQ ID NO: 32.

EMBODIMENT 40

The compound of any of embodiments 1 to 14, wherein the modified oligonucleotide has a nucleobase sequence comprising the sequence recited in SEQ ID NO: 23, 24, 25, 26, 27, 28, 29, 30, 31, or 32.

EMBODIMENT 41

The compound of any of embodiments 1 to 14, wherein the modified oligonucleotide has a nucleobase sequence comprising the sequence recited in SEQ ID NO: 23, 25, 26, 27, 28, 29, 30, 31, or 32.

EMBODIMENT 42

The compound of any of embodiments 1 to 14, wherein the modified oligonucleotide has a nucleobase sequence comprising the sequence recited in SEQ ID NO: 33-874.

EMBODIMENT 43

The compound of any of embodiments 1 to 42, wherein the nucleobase sequence of the modified oligonucleotide is at least 90% complementary to SEQ ID NOs: 1-19.

EMBODIMENT 44

The compound of any of embodiments 1 to 34, wherein the nucleobase sequence of the modified oligonucleotide is 100% complementary to SEQ ID NOs: 1-19.

EMBODIMENT 45

The compound of any of embodiments 1 to 30, wherein the modified oligonucleotide consists of 16 linked nucleosides.

EMBODIMENT 46

The compound of any of embodiments 1 to 30, wherein the modified oligonucleotide consists of 17 linked nucleosides.

EMBODIMENT 47

The compound of any of embodiments 1 to 30, wherein the modified oligonucleotide consists of 18 linked nucleosides.

EMBODIMENT 48

The compound of any of embodiments 1 to 30, wherein the modified oligonucleotide consists of 19 linked nucleosides.

EMBODIMENT 49

The compound of any of embodiments 1 to 30, wherein the modified oligonucleotide consists of 20 linked nucleosides.

EMBODIMENT 50

The compound of any of embodiments 1 to 49, wherein the modified oligonucleotide is a single-stranded oligonucleotide.

EMBODIMENT 51

The compound of any of embodiments 1 to 50 wherein at least one nucleoside comprises a modified sugar.

EMBODIMENT 52

The compound of any of embodiments 1 to 51 wherein at least two nucleosides comprise a modified sugar.

EMBODIMENT 53

The compound of embodiment 52, wherein each of the modified sugars have the same modification.

EMBODIMENT 54

The compound of embodiment 52, wherein at least one the modified sugars has a different modification.

EMBODIMENT 55

The compound of any of embodiments 51 to 54, wherein at least one modified sugar is a bicyclic sugar.

EMBODIMENT 56

The compound of embodiment 55, wherein the bicyclic sugar is selected from among cEt, LNA, α-L-LNA, ENA and 2′-thio LNA.

EMBODIMENT 57

The compound of embodiment 56, wherein the bicyclic sugar comprises cEt.

EMBODIMENT 58

The compound of embodiment 56, wherein the bicyclic sugar comprises LNA.

EMBODIMENT 59

The compound of embodiment 56, wherein the bicyclic sugar comprises α-L-LNA.

EMBODIMENT 60

The compound of embodiment 56, wherein the bicyclic sugar comprises ENA.

EMBODIMENT 61

The compound of embodiment 56, wherein the bicyclic sugar comprises 2′-thio LNA.

EMBODIMENT 62

The compound of any of embodiments 1 to 61, wherein at least one modified sugar comprises a 2′-substituted nucleoside.

EMBODIMENT 63

The compound of embodiment 62, wherein the 2′-substituted nucleoside is selected from among: 2′-OCH3, 2′-F, and 2′-O-methoxyethyl.

EMBODIMENT 64

The compound of any of embodiments 1 to 63, wherein at least one modified sugar comprises a 2′-O-methoxyethyl.

EMBODIMENT 65

The compound of any of embodiments 1 to 64, wherein at least one nucleoside comprises a modified nucleobase.

EMBODIMENT 66

The compound of embodiment 65, wherein the modified nucleobase is a 5-methylcytosine.

EMBODIMENT 67

The compound of any of embodiments 1 to 67, wherein each cytosine is a 5-methylcytosine.

EMBODIMENT 68

The compound of any of embodiments 1 to 67, wherein the modified oligonucleotide comprises:

    • a. a gap segment consisting of linked deoxynucleosides;
    • b. a 5′ wing segment consisting of linked nucleosides;
    • c. a 3′ wing segment consisting of linked nucleosides;
    • d. wherein the gap segment is positioned between the 5′ wing segment and the 3′ wing segment and wherein each nucleoside of each wing segment comprises a modified sugar.

EMBODIMENT 69

The compound of embodiment 68, wherein the modified oligonucleotide consists of 16 linked nucleosides.

EMBODIMENT 70

The compound of embodiment 68, wherein the modified oligonucleotide consists of 17 linked nucleosides.

EMBODIMENT 71

The compound of embodiment 68, wherein the modified oligonucleotide consists of 18 linked nucleosides.

EMBODIMENT 72

The compound of embodiment 68, wherein the modified oligonucleotide consists of 19 linked nucleosides.

EMBODIMENT 73

The compound of embodiment 68, wherein the modified oligonucleotide consists of 20 linked nucleosides.

EMBODIMENT 74

The compound of any of embodiments 68 to 73, wherein the 5′-wing segment consists of two linked nucleosides.

EMBODIMENT 75

The compound of any of embodiments 68 to 73, wherein the 5′-wing segment consists of three linked nucleosides.

EMBODIMENT 76

The compound of any of embodiments 68 to 73, wherein the 5′-wing segment consists of four linked nucleosides.

EMBODIMENT 77

The compound of any of embodiments 68 to 73, wherein the 5′-wing segment consists of five linked nucleosides.

EMBODIMENT 78

The compound of any of embodiments 68 to 73, wherein the 5′-wing segment consists of six linked nucleosides.

EMBODIMENT 79

The compound of any of embodiments 68 to 78, wherein the 3′-wing segment consists of two linked nucleosides.

EMBODIMENT 80

The compound of any of embodiments 68 to 78, wherein the 3′-wing segment consists of three linked nucleosides.

EMBODIMENT 81

The compound of any of embodiments 68 to 78, wherein the 3′-wing segment consists of four linked nucleosides.

EMBODIMENT 82

The compound of any of embodiments 68 to 78, wherein the 3′-wing segment consists of five linked nucleosides.

EMBODIMENT 83

The compound of any of embodiments 68 to 78, wherein the 3′-wing segment consists of six linked nucleosides.

EMBODIMENT 84

The compound of any of embodiments 68 to 83, wherein the gap segment consists of six linked deoxynucleosides.

EMBODIMENT 85

The compound of any of embodiments 68 to 83, wherein the gap segment consists of seven linked deoxynucleosides.

EMBODIMENT 86

The compound of any of embodiments 68 to 83, wherein the gap segment consists of eight linked deoxynucleosides.

EMBODIMENT 87

The compound of any of embodiments 68 to 83, wherein the gap segment consists of nine linked deoxynucleosides.

EMBODIMENT 88

The compound of any of embodiments 68 to 83, wherein the gap segment consists of ten linked deoxynucleosides.

EMBODIMENT 89

The compound of any of embodiments 1 to 31, 34, 37 to 45, or 53 to 88, wherein the modified oligonucleotide consists of 16 linked nucleosides and comprises:

    • a. a gap segment consisting of ten linked deoxynucleosides;
    • b. a 5′ wing segment consisting of three linked nucleosides;
    • c. a 3′ wing segment consisting of three linked nucleosides;
    • d. wherein the gap segment is positioned between the 5′ wing segment and the 3′ wing segment, and wherein each nucleoside of each wing segment comprises a bicyclic sugar.

EMBODIMENT 90

The compound of any of embodiments 1 to 31, 34, 37 to 45, or 53 to 88, wherein the modified oligonucleotide consists of 16 linked nucleosides and comprises:

    • a. a gap segment consisting of eight linked deoxynucleosides;
    • b. a 5′ wing segment consisting of four linked nucleosides and having an AABB 5′-wing motif;
    • c. a 3′ wing segment consisting of four linked nucleosides and having a BBAA 3′-wing motif;
    • d. wherein the gap segment is positioned between the 5′ wing segment and the 3′ wing segment.

EMBODIMENT 91

The compound of any of embodiments 1 to 30, 35, 36, 46, or 50 to 88, wherein the modified oligonucleotide consists of 17 linked nucleosides and comprises:

    • a. a gap segment consisting of seven linked deoxynucleosides;
    • b. a 5′ wing segment consisting of five linked nucleosides and having an AAABB 5′-wing motif;
    • c. a 3′ wing segment consisting of five linked nucleosides and having a BBAAA 3′-wing motif;
    • d. wherein the gap segment is positioned between the 5′ wing segment and the 3′ wing segment.

EMBODIMENT 92

The compound of any of embodiments 1 to 31, 34, 37 to 45, or 53 to 88, wherein the modified oligonucleotide consists of 16 linked nucleosides and comprises:

    • a. a gap segment consisting of eight linked deoxynucleosides;
    • b. a 5′ wing segment consisting of four linked nucleosides and having a E-E-K-K 5′-wing motif;
    • c. a 3′ wing segment consisting of four linked nucleosides and having a K-K-E-E 3′-wing motif;
    • d. wherein the gap segment is positioned between the 5′ wing segment and the 3′ wing segment, and wherein each E represents 2′-O-methoxyethyl sugar and each K represents a cEt sugar.

EMBODIMENT 93

The compound of any of embodiments 1 to 30, 35, 36, 46, or 50 to 88, wherein the modified oligonucleotide consists of 17 linked nucleosides and comprises:

    • a. a gap segment consisting of seven linked deoxynucleosides;
    • b. a 5′ wing segment consisting of five linked nucleosides and having an E-E-E-K-K 5′-wing motif;
    • c. a 3′ wing segment consisting of five linked nucleosides and having a K-K-E-E-E 3′-wing motif;
    • d. wherein the gap segment is positioned between the 5′ wing segment and the 3′ wing segment, and wherein each E represents 2′-O-methoxyethyl sugar and each K represents a cEt sugar.

EMBODIMENT 94

The compound of any of embodiments 1 to 30, 32, 33, or 49 to 88, wherein the modified oligonucleotide consists of 20 linked nucleosides and comprises:

    • a. a gap segment consisting of ten linked deoxynucleosides;
    • b. a 5′ wing segment consisting of five linked nucleosides;
    • c. a 3′ wing segment consisting of five linked nucleosides;
    • d. wherein the gap segment is positioned between the 5′ wing segment and the 3′ wing segment, and wherein each nucleoside of each wing segment comprises a 2′-O-methoxyethyl sugar.

EMBODIMENT 95

The compound of any of embodiments 1 to 31, 34, 37 to 45, or 53 to 88, wherein the modified oligonucleotide consists of 16 linked nucleosides and comprises:

    • a. a gap segment consisting of ten linked deoxynucleosides;
    • b. a 5′ wing segment consisting of three linked nucleosides;
    • c. a 3′ wing segment consisting of three linked nucleosides;
    • d. wherein the gap segment is positioned between the 5′ wing segment and the 3′ wing segment, and wherein each nucleoside of each wing segment comprises a cEt sugar.

EMBODIMENT 96

The compound of any of embodiments 1 to 67, wherein the modified oligonucleotide comprises at least 8 contiguous nucleobases complementary to a target region within nucleobase 1343 and nucleobase 1368 of SEQ ID NO.: 1, and wherein the modified oligonucleotide comprises:

    • a. a gap segment consisting of linked deoxynucleosides;
    • b. a 5′ wing segment consisting of linked nucleosides;
    • c. a 3′ wing segment consisting of linked nucleosides;
    • d. wherein the gap segment is positioned between the 5′ wing segment and the 3′ wing segment and wherein each nucleoside of each wing segment comprises a modified sugar.

EMBODIMENT 97

The compound of embodiment 96, wherein each modified sugar in the 5′-wing segment has the same modifications.

EMBODIMENT 98

The compound of embodiment 96, wherein at least two modified sugars in the 5′-wing segment have different modifications.

EMBODIMENT 99

The compound of any of embodiments 96 to 98 wherein each modified sugar in the 3′-wing segment has the same modifications.

EMBODIMENT 100

The compound of any of embodiments 96 to 98, wherein at least two modified sugars in the 3′-wing segment have different modification.

EMBODIMENT 101

The compound of embodiment 96, wherein at least one modified sugar is a bicyclic sugar selected from among cEt, LNA, α-L-LNA, ENA and 2′-thio LNAs.

EMBODIMENT 102

The compound of embodiment 90 to 91, wherein each B represents a bicyclic sugar selected from among cEt, LNA, α-L-LNA, ENA and 2′-thio LNA.

EMBODIMENT 103

The compound of embodiment 102, wherein the bicyclic sugar comprises BNA.

EMBODIMENT 104

The compound of embodiment 102, wherein the bicyclic sugar comprises cEt.

EMBODIMENT 105

The compound of embodiment 102, wherein the bicyclic sugar comprises LNA.

EMBODIMENT 106

The compound of embodiment 102, wherein the bicyclic sugar comprises α-L-LNA.

EMBODIMENT 107

The compound of embodiment 102, wherein the bicyclic sugar comprises ENA.

EMBODIMENT 108

The compound of embodiment 102, wherein the bicyclic sugar comprises 2′-thio LNA.

EMBODIMENT 109

The compound of embodiment 90 or 91, wherein each A represents a 2′-substituted nucleoside is selected from among: 2′-OCH3, 2′-F, and 2′-O-methoxyethyl.

EMBODIMENT 110

The compound of embodiment 109, wherein the 2′-substituted nucleoside comprises 2′-O-methoxyethyl.

EMBODIMENT 111

The compound of any of embodiments 1 to 111, wherein at least one internucleoside linkage is a modified internucleoside linkage.

EMBODIMENT 112

The compound of any of embodiments 1 to 111, wherein each internucleoside linkage is a phosphorothioate internucleoside linkage.

EMBODIMENT 113

A compound consisting of ISIS 486178.

EMBODIMENT 114

A compound consisting of ISIS 512497.

EMBODIMENT 115

A compound consisting of ISIS 598768.

EMBODIMENT 116

A compound consisting of ISIS 594300.

EMBODIMENT 117

A compound consisting of ISIS 594292.

EMBODIMENT 118

A compound consisting of ISIS 569473.

EMBODIMENT 119

A compound consisting of ISIS 598769.

EMBODIMENT 120

A compound consisting of ISIS 570808.

EMBODIMENT 121

A compound consisting of ISIS 598777.

EMBODIMENT 122

A compound having a nucleobase sequence as set forth in SEQ ID NO: 23, wherein the modified oligonucleotide consists of 16 linked nucleosides and comprises:

    • a. a gap segment consisting of ten linked deoxynucleosides;
    • b. a 5′ wing segment consisting of three linked nucleosides;
    • c. a 3′ wing segment consisting of three linked nucleosides;
    • d. wherein the gap segment is positioned between the 5′ wing segment and the 3′ wing segment;
    • e. wherein each nucleoside of each wing segment comprises a bicyclic sugar;
    • f. wherein each internucleoside linkage is a phosphorothioate internucleoside linkage; and
    • g. wherein each cytosine residue is a 5-methyl cytosine.

EMBODIMENT 123

A compound having a nucleobase sequence as set forth in SEQ ID NO: 29, wherein the modified oligonucleotide consists of 16 linked nucleosides and comprises:

    • a. a gap segment consisting of ten linked deoxynucleosides;
    • b. a 5′ wing segment consisting of three linked nucleosides;
    • c. a 3′ wing segment consisting of three linked nucleosides;
    • d. wherein the gap segment is positioned between the 5′ wing segment and the 3′ wing segment;
    • e. wherein each nucleoside of each wing segment comprises a bicyclic sugar;
    • f. wherein each internucleoside linkage is a phosphorothioate internucleoside linkage; and
    • g. wherein each cytosine residue is a 5-methyl cytosine.

EMBODIMENT 124

A compound having a nucleobase sequence as set forth in SEQ ID NO: 31, wherein the modified oligonucleotide consists of 16 linked nucleosides and comprises:

    • a. a gap segment consisting of ten linked deoxynucleosides;
    • b. a 5′ wing segment consisting of three linked nucleosides;
    • c. a 3′ wing segment consisting of three linked nucleosides;
    • d. wherein the gap segment is positioned between the 5′ wing segment and the 3′ wing segment;
    • e. wherein each nucleoside of each wing segment comprises a bicyclic sugar;
    • f. wherein each internucleoside linkage is a phosphorothioate internucleoside linkage; and
    • g. wherein each cytosine residue is a 5-methyl cytosine.

EMBODIMENT 125

A compound having a nucleobase sequence as set forth in SEQ ID NO: 26, wherein the modified oligonucleotide consists of 16 linked nucleosides and comprises:

    • a. a gap segment consisting of eight linked deoxynucleosides;
    • b. a 5′ wing segment consisting of four linked nucleosides and having a E-E-K-K 5′-wing motif;
    • c. a 3′ wing segment consisting of four linked nucleosides and having a K-K-E-E 3′-wing motif;
    • d. wherein the gap segment is positioned between the 5′ wing segment and the 3′ wing segment;
    • e. wherein each E represents 2′-O-methoxyethyl sugar and each K represents a cEt sugar;
    • f. wherein each internucleoside linkage is a phosphorothioate internucleoside linkage; and
    • g. wherein each cytosine residue is a 5-methyl cytosine.

EMBODIMENT 126

A compound having a nucleobase sequence as set forth in SEQ ID NO: 30, wherein the modified oligonucleotide consists of 16 linked nucleosides and comprises:

    • a. a gap segment consisting of eight linked deoxynucleosides;
    • b. a 5′ wing segment consisting of four linked nucleosides and having a E-E-K-K 5′-wing motif;
    • c. a 3′ wing segment consisting of four linked nucleosides and having a K-K-E-E 3′-wing motif;
    • d. wherein the gap segment is positioned between the 5′ wing segment and the 3′ wing segment;
    • e. wherein each E represents 2′-O-methoxyethyl sugar and each K represents a cEt sugar;
    • f. wherein each internucleoside linkage is a phosphorothioate internucleoside linkage; and
    • g. wherein each cytosine residue is a 5-methyl cytosine.

EMBODIMENT 127

A compound having a nucleobase sequence as set forth in SEQ ID NO: 32, wherein the modified oligonucleotide consists of 16 linked nucleosides and comprises:

    • a. a gap segment consisting of eight linked deoxynucleosides;
    • b. a 5′ wing segment consisting of four linked nucleosides and having a E-E-K-K 5′-wing motif;
    • c. a 3′ wing segment consisting of four linked nucleosides and having a K-K-E-E 3′-wing motif;
    • d. wherein the gap segment is positioned between the 5′ wing segment and the 3′ wing segment;
    • e. wherein each E represents 2′-O-methoxyethyl sugar and each K represents a cEt sugar;
    • f. wherein each internucleoside linkage is a phosphorothioate internucleoside linkage; and
    • g. wherein each cytosine residue is a 5-methyl cytosine.

EMBODIMENT 128

A compound having a nucleobase sequence as set forth in SEQ ID NO: 27, wherein the modified oligonucleotide consists of 17 linked nucleosides and comprises:

    • a. a gap segment consisting of seven linked deoxynucleosides;
    • b. a 5′ wing segment consisting of five linked nucleosides and having an E-E-E-K-K 5′-wing motif;
    • c. a 3′ wing segment consisting of five linked nucleosides and having a K-K-E-E-E 3′-wing motif;
    • d. wherein the gap segment is positioned between the 5′ wing segment and the 3′ wing segment;
    • e. wherein each E represents 2′-O-methoxyethyl sugar and each K represents a cEt sugar;
    • f. wherein each internucleoside linkage is a phosphorothioate internucleoside linkage; and
    • g. wherein each cytosine residue is a 5-methyl cytosine.

EMBODIMENT 129

A compound having a nucleobase sequence as set forth in SEQ ID NO: 28, wherein the modified oligonucleotide consists of 17 linked nucleosides and comprises:

    • a. a gap segment consisting of seven linked deoxynucleosides;
    • b. a 5′ wing segment consisting of five linked nucleosides and having an E-E-E-K-K 5′-wing motif;
    • c. a 3′ wing segment consisting of five linked nucleosides and having a K-K-E-E-E 3′-wing motif;
    • d. wherein the gap segment is positioned between the 5′ wing segment and the 3′ wing segment;
    • e. wherein each E represents 2′-O-methoxyethyl sugar and each K represents a cEt sugar;
    • f. wherein each internucleoside linkage is a phosphorothioate internucleoside linkage; and
    • g. wherein each cytosine residue is a 5-methyl cytosine.

EMBODIMENT 130

A compound having a nucleobase sequence as set forth in SEQ ID NO: 25, wherein the modified oligonucleotide consists of 20 linked nucleosides and comprises:

    • a. a gap segment consisting of ten linked deoxynucleosides;
    • b. a 5′ wing segment consisting of five linked nucleosides;
    • c. a 3′ wing segment consisting of five linked nucleosides;
    • d. wherein the gap segment is positioned between the 5′ wing segment and the 3′ wing segment;
    • e. wherein each nucleoside of each wing segment comprises a 2′-O-methoxyethyl sugar;
    • f. wherein each internucleoside linkage is a phosphorothioate internucleoside linkage; and
    • g. wherein each cytosine residue is a 5-methyl cytosine.

EMBODIMENT 131

The compound of any of embodiments 1 to 130 comprising a conjugate.

EMBODIMENT 132

A composition comprising the compound of any of embodiments 1 to 131, and a pharmaceutically acceptable carrier or diluent.

EMBODIMENT 133

A method of treating DM1 in an animal comprising administering to an animal in need thereof a compound according to any of embodiments 1 to 130, or a composition according to embodiment 132.

EMBODIMENT 134

The method of embodiment 133, wherein the compound reduces DMPK mRNA levels.

EMBODIMENT 135

The method of embodiment 133, wherein the compound reduces DMPK protein expression.

EMBODIMENT 136

The method of embodiment 133, wherein the compound reduces CUGexp DMPK.

EMBODIMENT 137

The method of embodiment 133, wherein the compound preferentially reduces CUGexp DMPK.

EMBODIMENT 138

The method of embodiment 133, wherein the compound reduces CUGexp DMPK mRNA.

EMBODIMENT 139

The method of embodiment 133, wherein the compound preferentially reduces CUGexp DMPK mRNA.

EMBODIMENT 140

The method of embodiment 138 or 139, wherein the preferential reduction of CUGexp is in muscle tissue.

EMBODIMENT 141

A method of reducing myotonia in an animal comprising administering to an animal in need thereof a compound according to any of embodiments 1 to 131, or a composition according to embodiment 132.

EMBODIMENT 142

A method of reducing MBLN dependent spliceopathy in an animal comprising administering to an animal in need thereof a compound according to any of embodiments 1 to 131, or a composition according to embodiment 132.

EMBODIMENT 143

The method of embodiment 138, wherein splicing of any of Serca1, m-Titin, Clcn1, and Zasp is corrected.

EMBODIMENT 144

The method of any of embodiments 133 to 143, wherein the administering is systemic administration.

EMBODIMENT 145

The method of any of embodiments 133 to 143, wherein the administering is parenteral administration.

EMBODIMENT 146

The method of embodiment 144, wherein the systemic administration is any of subcutaneous administration, intravenous administration, intracerebroventricular administration, and intrathecal administration.

EMBODIMENT 147

The method of any of embodiments 133 to 143, wherein the administration is not intramuscular administration.

EMBODIMENT 148

The method of any of embodiments 133 to 143, wherein the animal is a human.

EMBODIMENT 149

A method of reducing spliceopathy of Serca1 in an animal in need thereof by administering a compound according to any of embodiments 1 to 131, or a composition according to embodiment 132, and thereby causing Serca1 exon 22 inclusion.

EMBODIMENT 150

A method of reducing spliceopathy of m-Titin in an animal in need thereof by administering a compound according to any of embodiments 1 to 131, or a composition according to embodiment 132, and thereby causing m-Titin exon 5 inclusion.

EMBODIMENT 151

A method of reducing spliceopathy of Clcn1 in an animal in need thereof by administering a compound according to any of embodiments 1 to 131, or a composition according to embodiment 132, and thereby causing Clcn1 exon 7a inclusion.

EMBODIMENT 152

A method of reducing spliceopathy of Zasp in an animal in need thereof by administering a compound according to any of embodiments 1 to 131, or a composition according to embodiment 132, and thereby causing Zasp exon 11 inclusion.

EMBODIMENT 153

A method of reducing DMPK mRNA in a cell, comprising contacting a cell with a compound according to any of embodiments 1 to 131, or a composition according to embodiment 132.

EMBODIMENT 154

A method of reducing DMPK protein in a cell, comprising contacting a cell with a compound according to any of embodiments 1 to 131, or a composition according to embodiment 132.

EMBODIMENT 155

A method of reducing CUGexp mRNA in a cell, comprising contacting a cell with a compound according to any of embodiments 1 to 131, or a composition according to embodiment 132.

EMBODIMENT 156

The method of any of embodiments 149 to 151, wherein the cell is in an animal.

EMBODIMENT 157

The method of embodiment 156, wherein the animal is a human.

EMBODIMENT 158

A method of achieving a preferential reduction of CUGexp DMPK RNA, comprising:

    • a. selecting a subject having type 1 myotonic dystrophy or having a CUGexp DMPK RNA; and
    • b. administering to said subject a compound according to any of embodiments 1 to 131, or a composition according to embodiment 132;
    • wherein said compound according to any of embodiments 1 to 131, or a composition according to embodiment 132, when bound to said CUGexp DMPK RNA, activates a ribonuclease, thereby achieving a preferential reduction of said CUGexp DMPK RNA.

EMBODIMENT 159

A method of achieving a preferential reduction of CUGexp DMPK RNA, comprising:

    • a. selecting a subject having type 1 myotonic dystrophy or having a CUGexp DMPK RNA; and
    • b. systemically administering to said subject a compound according to any of embodiments 1 to 131, or a composition according to embodiment 132;
    • wherein said chemically-modified antisense oligonucleotide, when bound to said CUGexp DMPK RNA, achieves a preferential reduction of said CUGexp DMPK RNA.

EMBODIMENT 160

A method of reducing spliceopathy in a subject suspected of having type 1 myotonic dystrophy or having a nuclear retained CUGexp DMPK RNA, comprising:

    • administering to said subject a compound according to any of embodiments 1 to 131, or a composition according to embodiment 132,
    • wherein the compound according to any of embodiments 1 to 131, or a composition according to embodiment 132, when bound to said mutant DMPK RNA, activates a ribonuclease, thereby reducing spliceopathy.

EMBODIMENT 161

A method of preferentially reducing CUGexp DMPK RNA, reducing myotonia or reducing spliceopathy in an animal comprising administering to the animal a compound according to any of embodiments 1 to 131 or a pharmaceutical composition of embodiment 132, wherein the compound reduces DMPK expression in the animal, thereby preferentially reducing CUGexp DMPK RNA, reducing myotonia, or reducing spliceopathy in the animal.

EMBODIMENT 162

A method for treating an animal with type 1 myotonic dystrophy comprising identifying said animal with type 1 myotonic dystrophy,

    • administering to said animal a therapeutically effective amount of a compound according to any of embodiments 1 to 131 or a pharmaceutical composition of embodiment 132,
    • wherein said animal with type 1 myotonic dystrophy is treated.

EMBODIMENT 163

A method of reducing DMPK expression comprising administering to an animal a compound according to any of embodiments 1 to 131 or a pharmaceutical composition of embodiment 132, wherein expression of DMPK is reduced.

EMBODIMENT 164

A compound according to any of embodiments 1 to 131 or a pharmaceutical composition of embodiment 132, for use in treating DM1 in an animal.

EMBODIMENT 165

A compound according to any of embodiments 1 to 131 or a pharmaceutical composition of embodiment 132, for use in reducing myotonia in an animal.

EMBODIMENT 166

A compound according to any of embodiments 1 to 131 or a pharmaceutical composition of embodiment 132, for use in reducing MBLN dependent spliceopathy in an animal.

DETAILED DESCRIPTION

It is to be understood that both the foregoing general description and the following detailed description are exemplary and explanatory only and are not restrictive of the invention, as claimed. Herein, the use of the singular includes the plural unless specifically stated otherwise. Herein, the use of “or” means “and/or” unless stated otherwise. Furthermore, the use of the term “including” as well as other forms, such as “includes” and “included”, is not limiting. Also, terms such as “element” or “component” encompass both elements and components comprising one unit and elements and components that comprise more than one subunit, unless specifically stated otherwise.

The section headings used herein are for organizational purposes only and are not to be construed as limiting the subject matter described. All documents, or portions of documents, cited in this application, including, but not limited to, patents, patent applications, articles, books, and treatises, are hereby expressly incorporated-by-reference for the portions of the document discussed herein, as well as in their entirety.

DEFINITIONS

Unless specific definitions are provided, the nomenclature utilized in connection with, and the procedures and techniques of, analytical chemistry, synthetic organic chemistry, and medicinal and pharmaceutical chemistry described herein are those well known and commonly used in the art. Standard techniques can be used for chemical synthesis, and chemical analysis. Where permitted, all patents, applications, published applications and other publications, GENBANK Accession Numbers and associated sequence information obtainable through databases such as National Center for Biotechnology Information (NCBI) and other data referred to throughout in the disclosure herein are incorporated by reference for the portions of the document discussed herein, as well as in their entirety.

Unless otherwise indicated, the following terms have the following meanings:

“2′-O-methoxyethyl” (also 2′-MOE and 2′-O(CH2)2—OCH3) refers to an O-methoxy-ethyl modification of the 2′ position of a furanosyl ring. A 2′-O-methoxyethyl modified sugar is a modified sugar.

“2′-O-methoxyethyl nucleotide” means a nucleotide comprising a 2′-O-methoxyethyl modified sugar moiety.

“5-methylcytosine” means a cytosine modified with a methyl group attached to position 5. A 5-methylcytosine is a modified nucleobase.

“About” means within ±7% of a value. For example, if it is stated, “the compound affected at least about 70% inhibition of DMPK”, it is implied that the DMPK levels are inhibited within a range of 63% and 77%.

“Active pharmaceutical agent” means the substance or substances in a pharmaceutical composition that provide a therapeutic benefit when administered to an animal. For example, in certain embodiments an antisense oligonucleotide targeted to DMPK is an active pharmaceutical agent.

“Active target region” or “target region” means a region to which one or more active antisense compounds is targeted. “Active antisense compounds” means antisense compounds that reduce target nucleic acid levels or protein levels.

“Administered concomitantly” refers to the co-administration of two agents in any manner in which the pharmacological effects of both are manifest in the patient at the same time. Concomitant administration does not require that both agents be administered in a single pharmaceutical composition, in the same dosage form, or by the same route of administration. The effects of both agents need not manifest themselves at the same time. The effects need only be overlapping for a period of time and need not be coextensive.

“Administering” means providing an agent to an animal, and includes, but is not limited to, administering by a medical professional and self-administering.

“Agent” means an active substance that can provide a therapeutic benefit when administered to an animal. “First Agent” means a therapeutic compound of the invention. For example, a first agent can be an antisense oligonucleotide targeting DMPK. “Second agent” means a second therapeutic compound of the invention (e.g. a second antisense oligonucleotide targeting DMPK) and/or a non-DMPK therapeutic compound.

“Amelioration” refers to a lessening of at least one indicator, sign, or symptom of an associated disease, disorder, or condition. The severity of indicators can be determined by subjective or objective measures, which are known to those skilled in the art.

“Animal” refers to a human or non-human animal, including, but not limited to, mice, rats, rabbits, dogs, cats, pigs, and non-human primates, including, but not limited to, monkeys and chimpanzees.

“Antisense activity” means any detectable or measurable activity attributable to the hybridization of an antisense compound to its target nucleic acid. In certain embodiments, antisense activity is a decrease in the amount or expression of a target nucleic acid or protein encoded by such target nucleic acid.

“Antisense compound” means an oligomeric compound that is capable of undergoing hybridization to a target nucleic acid through hydrogen bonding. Examples of antisense compounds include single-stranded and double-stranded compounds, such as, antisense oligonucleotides, siRNAs, shRNAs, snoRNAs, miRNAs, and satellite repeats.

“Antisense inhibition” means reduction of target nucleic acid levels or target protein levels in the presence of an antisense compound complementary to a target nucleic acid compared to target nucleic acid levels or target protein levels in the absence of the antisense compound.

“Antisense oligonucleotide” means a single-stranded oligonucleotide having a nucleobase sequence that permits hybridization to a corresponding region or segment of a target nucleic acid.

“Bicyclic sugar” means a furanosyl ring modified by the bridging of two non-geminal carbon ring atoms. A bicyclic sugar is a modified sugar.

“Bicyclic nucleic acid” or “BNA” refers to a nucleoside or nucleotide wherein the furanose portion of the nucleoside or nucleotide includes a bridge connecting two carbon atoms on the furanose ring, thereby forming a bicyclic ring system.

“Cap structure” or “terminal cap moiety” means chemical modifications, which have been incorporated at either terminus of an antisense compound.

“Chemically distinct region” refers to a region of an antisense compound that is in some way chemically different than another region of the same antisense compound. For example, a region having 2′-O-methoxyethyl nucleotides is chemically distinct from a region having nucleotides without 2′-O-methoxyethyl modifications.

“Chimeric antisense compound” means an antisense compound that has at least two chemically distinct regions.

“Co-administration” means administration of two or more agents to an individual. The two or more agents can be in a single pharmaceutical composition, or can be in separate pharmaceutical compositions. Each of the two or more agents can be administered through the same or different routes of administration. Co-administration encompasses parallel or sequential administration.

“Complementarity” means the capacity for pairing between nucleobases of a first nucleic acid and a second nucleic acid.

“Contiguous nucleobases” means nucleobases immediately adjacent to each other.

“CUGexp DMPK” means mutant DMPK RNA containing an expanded CUG repeat (CUGexp). The wild-type DMPK gene has 5-37 CTG repeats in the 3′ untranslated region. In a “CUGexp DMPK” (such as in a myotonic dystrophy type I patient) this number is significantly expanded and is, for example, in the range of 50 to greater than 3,500 (Harper, Myotonic Dystrophy (Saunders, London, ed. 3, 2001); Annu. Rev. Neurosci. 29: 259, 2006; EMBO J. 19: 4439, 2000; Curr Opin Neurol. 20: 572, 2007).

“Diluent” means an ingredient in a composition that lacks pharmacological activity, but is pharmaceutically necessary or desirable. For example, the diluent in an injected composition can be a liquid, e.g. saline solution.

“DMPK” means any nucleic acid or protein of distrophia myotonica protein kinase. DMPK can be a mutant DMPK including CUGexp DMPK nucleic acid.

“DMPK expression” means the level of mRNA transcribed from the gene encoding DMPK or the level of protein translated from the mRNA. DMPK expression can be determined by art known methods such as a Northern or Western blot.

“DMPK nucleic acid” means any nucleic acid encoding DMPK. For example, in certain embodiments, a DMPK nucleic acid includes a DNA sequence encoding DMPK, an RNA sequence transcribed from DNA encoding DMPK (including genomic DNA comprising introns and exons), and an mRNA or pre-mRNA sequence encoding DMPK. “DMPK mRNA” means an mRNA encoding a DMPK protein.

“Dose” means a specified quantity of a pharmaceutical agent provided in a single administration, or in a specified time period. In certain embodiments, a dose can be administered in one, two, or more boluses, tablets, or injections. For example, in certain embodiments where subcutaneous administration is desired, the desired dose requires a volume not easily accommodated by a single injection, therefore, two or more injections can be used to achieve the desired dose. In certain embodiments, the pharmaceutical agent is administered by infusion over an extended period of time or continuously. Doses can be stated as the amount of pharmaceutical agent per hour, day, week, or month.

“Effective amount” or “therapeutically effective amount” means the amount of active pharmaceutical agent sufficient to effectuate a desired physiological outcome in an individual in need of the agent. The effective amount can vary among individuals depending on the health and physical condition of the individual to be treated, the taxonomic group of the individuals to be treated, the formulation of the composition, assessment of the individual's medical condition, and other relevant factors.

“Fully complementary” or “100% complementary” means each nucleobase of a nucleobase sequence of a first nucleic acid has a complementary nucleobase in a second nucleobase sequence of a second nucleic acid. In certain embodiments, a first nucleic acid is an antisense compound and a target nucleic acid is a second nucleic acid.

“Gapmer” means a chimeric antisense compound in which an internal region having a plurality of nucleosides that support RNase H cleavage is positioned between external regions having one or more nucleosides, wherein the nucleosides comprising the internal region are chemically distinct from the nucleoside or nucleosides comprising the external regions. The internal region can be referred to as a “gap segment” and the external regions can be referred to as “wing segments.”

“Gap-widened” means a chimeric antisense compound having a gap segment of 12 or more contiguous 2′-deoxyribonucleosides positioned between and immediately adjacent to 5′ and 3′ wing segments having from one to six nucleosides.

“Hybridization” means the annealing of complementary nucleic acid molecules. In certain embodiments, complementary nucleic acid molecules include an antisense compound and a target nucleic acid.

“Identifying an animal with type 1 myotonic dystrophy” means identifying an animal having been diagnosed with a type 1 myotonic dystrophy, disorder or condition or identifying an animal predisposed to develop a type 1 myotonic dystrophy, disorder or condition. For example, individuals with a familial history can be predisposed to type 1 myotonic dystrophy, disorder or condition. Such identification can be accomplished by any method including evaluating an individual's medical history and standard clinical tests or assessments.

“Immediately adjacent” means there are no intervening elements between the immediately adjacent elements.

“Individual” means a human or non-human animal selected for treatment or therapy.

“Internucleoside linkage” refers to the chemical bond between nucleosides.

“Linked nucleosides” means adjacent nucleosides which are bonded or linked together by an internucleoside linkage.

“Mismatch” or “non-complementary nucleobase” refers to the case when a nucleobase of a first nucleic acid is not capable of pairing with the corresponding nucleobase of a second or target nucleic acid.

“Modified internucleoside linkage” refers to a substitution or any change from a naturally occurring internucleoside bond (i.e. a phosphodiester internucleoside bond).

“Modified nucleobase” refers to any nucleobase other than adenine, cytosine, guanine, thymidine, or uracil. An “unmodified nucleobase” means the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C), and uracil (U).

“Modified nucleotide” means a nucleotide having, independently, a modified sugar moiety, modified internucleoside linkage, or modified nucleobase. A “modified nucleoside” means a nucleoside having, independently, a modified sugar moiety or modified nucleobase.

“Modified oligonucleotide” means an oligonucleotide comprising at least one modified nucleoside and/or modified internucleoside linkage.

“Modified sugar” refers to a substitution or change from a natural sugar moiety. Modified sugars include substituted sugar moieities and surrogate sugar moieties.

“Motif” means the pattern of chemically distinct regions in an antisense compound.

“Myotonia” means an abnormally slow relaxation of a muscle after voluntary contraction or electrical stimulation.

“Nuclear ribonuclease” means a ribonuclease found in the nucleus. Nuclear ribonucleases include, but are not limited to, RNase H including RNase H1 and RNase H2, the double stranded RNase drosha and other double stranded RNases.

“Naturally occurring internucleoside linkage” means a 3′ to 5′ phosphodiester linkage.

“Natural sugar moiety” means a sugar found in DNA (2′-H) or RNA (2′-OH).

“Nucleic acid” refers to molecules composed of monomeric nucleotides. A nucleic acid includes ribonucleic acids (RNA), deoxyribonucleic acids (DNA), single-stranded nucleic acids, double-stranded nucleic acids, small interfering ribonucleic acids (siRNA), and microRNAs (miRNA). A nucleic acid can also comprise a combination of these elements in a single molecule.

“Nucleobase” means a heterocyclic moiety capable of pairing with a base of another nucleic acid.

“Nucleobase sequence” means the order of contiguous nucleobases independent of any sugar, linkage, or nucleobase modification.

“Nucleoside” means a nucleobase linked to a sugar. In certain embodiments, a nucleoside is linked to a phosphate group.

“Nucleoside mimetic” includes those structures used to replace the sugar or the sugar and the base and not necessarily the linkage at one or more positions of an oligomeric compound such as for example nucleoside mimetics having morpholino, cyclohexenyl, cyclohexyl, tetrahydropyranyl, bicyclo or tricyclo sugar mimetics e.g. non furanose sugar units.

“Nucleotide” means a nucleoside having a phosphate group covalently linked to the sugar portion of the nucleoside.

“Nucleotide mimetic” includes those structures used to replace the nucleoside and the linkage at one or more positions of an oligomeric compound such as for example peptide nucleic acids or morpholinos (morpholinos linked by —N(H)—C(═O)—O— or other non-phosphodiester linkage).

“Oligomeric compound” or “oligomer” means a polymer of linked monomeric subunits which is capable of hybridizing to at least a region of a nucleic acid molecule.

“Oligonucleotide” means a polymer of linked nucleosides, wherein each nucleoside and each internucleoside linkage may be modified or unmodified, independent one from another.

“Parenteral administration” means administration through injection or infusion. Parenteral administration includes subcutaneous administration, intravenous administration, intramuscular administration, intraarterial administration, intraperitoneal administration, or intracranial administration, e.g. intrathecal or intracerebroventricular administration. Administration can be continuous, or chronic, or short or intermittent.

“Peptide” means a molecule formed by linking at least two amino acids by amide bonds. Peptide refers to polypeptides and proteins.

“Pharmaceutical composition” means a mixture of substances suitable for administering to an individual. For example, a pharmaceutical composition can comprise one or more active agents and a sterile aqueous solution.

“Pharmaceutically acceptable salts” means physiologically and pharmaceutically acceptable salts of antisense compounds, i.e., salts that retain the desired biological activity of the parent oligonucleotide and do not impart undesired toxicological effects thereto.

“Phosphorothioate linkage” means a linkage between nucleosides where the phosphodiester bond is modified by replacing one of the non-bridging oxygen atoms with a sulfur atom. A phosphorothioate linkage is a modified internucleoside linkage.

“Portion” means a defined number of contiguous (i.e. linked) nucleobases of a nucleic acid.

In certain embodiments, a portion is a defined number of contiguous nucleobases of a target nucleic acid. In certain embodiments, a portion is a defined number of contiguous nucleobases of an antisense compound.

“Preferentially reducing CUG exp DMPK RNA” refers to a preferential reduction of RNA transcripts from a CUGexp DMPK allele relative to RNA transcripts from a normal DMPK allele.

“Prevent” refers to delaying or forestalling the onset or development of a disease, disorder, or condition for a period of time from minutes to indefinitely. Prevent also means reducing risk of developing a disease, disorder, or condition.

“Prodrug” means a therapeutic agent that is prepared in an inactive form that is converted to an active form within the body or cells thereof by the action of endogenous enzymes or other chemicals or conditions.

“Side effects” means physiological responses attributable to a treatment other than the desired effects. In certain embodiments, side effects include injection site reactions, liver function test abnormalities, renal function abnormalities, liver toxicity, renal toxicity, central nervous system abnormalities, myopathies, and malaise. For example, increased aminotransferase levels in serum can indicate liver toxicity or liver function abnormality. For example, increased bilirubin can indicate liver toxicity or liver function abnormality.

“Single-stranded oligonucleotide” means an oligonucleotide which is not hybridized to a complementary strand.

“Specifically hybridizable” refers to an antisense compound having a sufficient degree of complementarity between an antisense oligonucleotide and a target nucleic acid to induce a desired effect, while exhibiting minimal or no effects on non-target nucleic acids under conditions in which specific binding is desired, i.e. under physiological conditions in the case of in vivo assays and therapeutic treatments.

“Spliceopathy” means a change in the alternative splicing of one or more RNAs that leads to the expression of altered splice products in a particular tissue.

“Subcutaneous administration” means administration just below the skin.

“Substituted sugar moiety” means a furanosyl other than a natural sugar of RNA or DNA.

“Sugar” or “Sugar moiety” means a natural sugar moiety or a modified sugar.

“Sugar surrogate” overlaps with the slightly broader term “nucleoside mimetic” but is intended to indicate replacement of the sugar unit (furanose ring) only A sugar surrogate is capable of replacing the naturally occurring sugar moiety of a nucleoside, such that the resulting nucleoside sub-units are capable of linking together and/or linking to other nucleosides to form an oligomeric compound which is capable of hybridizing to a complementary oligomeric compound. Such structures include rings comprising a different number of atoms than furanosyl (e.g., 4, 6, or 7-membered rings); replacement of the oxygen of a furanosyl with a non-oxygen atom (e.g., carbon, sulfur, or nitrogen); or both a change in the number of atoms and a replacement of the oxygen. Such structures may also comprise substitutions corresponding to those described for substituted sugar moieties (e.g., 6-membered carbocyclic bicyclic sugar surrogates optionally comprising additional substituents). Sugar surrogates also include more complex sugar replacements (e.g., the non-ring systems of peptide nucleic acid). Sugar surrogates include without limitation morpholinos, cyclohexenyls and cyclohexitols.

“Targeting” or “targeted” means the process of design and selection of an antisense compound that will specifically hybridize to a target nucleic acid and induce a desired effect.

“Target nucleic acid,” “target RNA,” and “target RNA transcript” all refer to a nucleic acid capable of being targeted by antisense compounds. In certain embodiments, a target nucleic acid comprises a region of a DMPK nucleic acid.

“Target segment” means the sequence of nucleotides of a target nucleic acid to which an antisense compound is targeted. “5′ target site” refers to the 5′-most nucleotide of a target segment. “3′ target site” refers to the 3′-most nucleotide of a target segment.

“Therapeutically effective amount” means an amount of an agent that provides a therapeutic benefit to an individual.

“Treat” refers to administering a pharmaceutical composition to effect an alteration or improvement of a disease, disorder, or condition.

“Type 1 myotonic dystrophy” or “DM1” means an autosomal dominant disorder caused by expansion of a non-coding CTG repeat in DMPK. This mutation leads to RNA dominance, a process in which expression of RNA containing an expanded CUG repeat (CUGexp) induced cell dysfunction. The CUGexp tract interacts with RNA binding proteins and causes the mutant transcript to be retained in nuclear foci. The toxicity of this RNA stems from sequestration of RNA binding proteins and activation of signaling pathways.

“Unmodified nucleotide” means a nucleotide composed of naturally occurring nucleobases, sugar moieties, and internucleoside linkages. In certain embodiments, an unmodified nucleotide is an RNA nucleotide (i.e. β-D-ribonucleosides) or a DNA nucleotide (i.e. β-D-deoxyribonucleoside).

Certain Embodiments

Certain embodiments provide methods, compounds, and compositions for inhibiting DMPK expression.

Certain embodiments provide a method of reducing DMPK expression in an animal comprising administering to the animal a compound comprising a modified oligonucleotide targeting DMPK.

Certain embodiments provide a method of preferentially reducing CUGexp DMPK RNA, reducing myotonia or reducing spliceopathy in an animal comprising administering to the animal a compound comprising a modified oligonucleotide targeted to DMPK, wherein the modified oligonucleotide preferentially reduces CUGexp DMPK RNA, reduces myotonia or reduces spliceopathy in the animal.

Certain embodiments provide a method of administering an antisense oligonucleotide to counteract RNA dominance by directing the cleavage of pathogenic transcripts.

Certain embodiments provide a method of reducing spliceopathy of Serca1. In certain embodiments, methods provided herein result in exon 22 inclusion. In certain embodiments, the corrective splicing occurs in the tibialis anterior, gastrocnemius, and quadriceps muscles.

Certain embodiments provide a method of reducing spliceopathy of m-Titin. In certain embodiments, methods provided herein result in exon 5 inclusion. In certain embodiments, the corrective splicing occurs in the tibialis anterior, gastrocnemius, and quadriceps muscles.

Certain embodiments provide a method of reducing spliceopathy of Clcn1. In certain embodiments, methods provided herein result in exon 7a inclusion. In certain embodiments, the corrective splicing occurs in the tibialis anterior, gastrocnemius, and quadriceps muscles.

Certain embodiments provide a method of reducing spliceopathy of Zasp. In certain embodiments, methods provided herein result in exon 11 inclusion. In certain embodiments, the corrective splicing occurs in the tibialis anterior, gastrocnemius, and quadriceps muscles.

Certain embodiments provide a method for treating an animal with type 1 myotonic dystrophy comprising: a) identifying said animal with type 1 myotonic dystrophy, and b) administering to said animal a therapeutically effective amount of a compound comprising a modified oligonucleotide targeted to DMPK. In certain embodiments, the therapeutically effective amount of the compound administered to the animal preferentially reduces CUGexp DMPK RNA, reduces myotonia or reduces spliceopathy in the animal.

Certain embodiments provide a method of achieving a preferential reduction of CUGexp DMPK RNA, including administering to the subject suspected of having type 1 myotonic dystrophy or having a CUGexp DMPK RNA a modified antisense oligonucleotide complementary to a non-repeat region of said CUGexp DMPK RNA. The modified antisense oligonucleotide, when bound to said CUGexp DMPK RNA, achieves a preferential reduction of the CUGexp DMPK RNA.

Certain embodiments provide a method of achieving a preferential reduction of CUGexp DMPK RNA, including selecting a subject having type 1 myotonic dystrophy or having a CUGexp DMPK RNA and administering to said subject a modified antisense oligonucleotide complementary to a non-repeat region of said CUGexp DMPK RNA. The modified antisense oligonucleotide, when bound to the CUGexp DMPK RNA, activates a ribonuclease or nuclear ribonuclease, thereby achieving a preferential reduction of the CUGexp DMPK RNA in the nucleus.

Certain embodiments provide a method of achieving a preferential reduction of CUGexp DMPK RNA, including selecting a subject having type 1 myotonic dystrophy or having a mutant or CUGexp DMPK RNA and systemically administering to said subject a modified antisense oligonucleotide complementary to a non-repeat region of said CUGexp DMPK RNA. The modified antisense oligonucleotide, when bound to the mutant or CUGexp DMPK RNA, achieves a preferential reduction of the mutant or CUGexp DMPK RNA.

Certain embodiments provide a method of reducing myotonia in a subject in need thereof. The method includes administering to the subject a modified antisense oligonucleotide complementary to a non-repeat region of a DMPK RNA, wherein the modified antisense oligonucleotide, when bound to the DMPK RNA, activates a ribonuclease or nuclear ribonuclease, thereby reducing myotonia. In certain embodiments, the subject has or is suspected of having type 1 myotonic dystrophy or having a mutant DMPK RNA or CUGexp DMPK RNA. In certain embodiments, the DMPK RNA is nuclear retained.

Certain embodiments provide a method of reducing spliceopathy in a subject in need thereof. The method includes administering to the subject a modified antisense oligonucleotide complementary to a non-repeat region of a DMPK RNA, wherein the modified antisense oligonucleotide, when bound to the DMPK RNA, activates a ribonuclease or nuclear ribonuclease, thereby reducing spliceopathy. In certain embodiments, the subject has or is suspected of having type 1 myotonic dystrophy or having a nuclear retained CUGexp DMPK RNA. In certain embodiments, the DMPK RNA is nuclear retained. In certain embodiments, the spliceopathy is MBNL dependent spliceopathy.

In certain embodiments, the modified antisense oligonucleotide of the methods is chimeric. In certain embodiments, the modified antisense oligonucleotide of the methods is a gapmer.

In certain embodiments of the methods provided herein, the administering is subcutaneous. In certain embodiments, the administering is intravenous.

In certain embodiments, the modified antisense oligonucleotide of the methods targets a non-coding sequence within the non-repeat region of a DMPK RNA. In certain embodiments, the oligonucleotide targets a coding region, an intron, a 5′UTR, or a 3′UTR of the mutant DMPK RNA.

In certain embodiments of the methods provided herein, the nuclear ribonuclease is RNase H1.

In certain embodiments of the methods, the DMPK RNA is reduced in muscle tissue. In certain embodiments, the mutant DMPK RNA CUGexp DMPK RNA is preferentially reduced.

In certain embodiments, the DMPK has the sequence as set forth in GenBank Accession No. NM_001081560.1 (incorporated herein as SEQ ID NO: 1). In certain embodiments, the DMPK has the sequence as set forth in GenBank Accession No. NT_011109.15 truncated from nucleotides 18540696 to Ser. No. 18/555,106 (incorporated herein as SEQ ID NO: 2). In certain embodiments, the DMPK has the sequence as set forth in GenBank Accession No. NT_039413.7 truncated from nucleotides 16666001 to Ser. No. 16/681,000 (incorporated herein as SEQ ID NO: 3). In certain embodiments, the DMPK has the sequence as set forth in GenBank Accession No. NM_032418.1 (incorporated herein as SEQ ID NO: 4). In certain embodiments, the DMPK has the sequence as set forth in GenBank Accession No. AI007148.1 (incorporated herein as SEQ ID NO: 5). In certain embodiments, the DMPK has the sequence as set forth in GenBank Accession No. AI304033.1 (incorporated herein as SEQ ID NO: 6). In certain embodiments, the DMPK has the sequence as set forth in GenBank Accession No. BC024150.1 (incorporated herein as SEQ ID NO: 7). In certain embodiments, the DMPK has the sequence as set forth in GenBank Accession No. BC056615.1 (incorporated herein as SEQ ID NO: 8). In certain embodiments, the DMPK has the sequence as set forth in GenBank Accession No. BC075715.1 (incorporated herein as SEQ ID NO: 9). In certain embodiments, the DMPK has the sequence as set forth in GenBank Accession No. BU519245.1 (incorporated herein as SEQ ID NO: 10). In certain embodiments, the DMPK has the sequence as set forth in GenBank Accession No. CB247909.1 (incorporated herein as SEQ ID NO: 11). In certain embodiments, the DMPK has the sequence as set forth in GenBank Accession No. CX208906.1 (incorporated herein as SEQ ID NO: 12). In certain embodiments, the DMPK has the sequence as set forth in GenBank Accession No. CX732022.1 (incorporated herein as SEQ ID NO: 13). In certain embodiments, the DMPK has the sequence as set forth in GenBank Accession No. S60315.1 (incorporated herein as SEQ ID NO: 14). In certain embodiments, the DMPK has the sequence as set forth in GenBank Accession No. S60316.1 (incorporated herein as SEQ ID NO: 15). In certain embodiments, the DMPK has the sequence as set forth in GenBank Accession No. NM_001081562.1 (incorporated herein as SEQ ID NO: 16). In certain embodiments, the DMPK has the sequence as set forth in GenBank Accession No. NM_001100.3 (incorporated herein as SEQ ID NO: 17).

In certain embodiments, the modified oligonucleotide has a nucleobase sequence comprising at least 8 contiguous nucleobases of a nucleobase sequence recited in any one of SEQ ID NOs: 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33-874. In certain embodiments, the modified oligonucleotide has a nucleobase sequence comprising at least 9, at least 10, or at least 11, contiguous nucleobases of a nucleobase sequence recited in any one of SEQ ID NOs: 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33-874.

In certain embodiments, the modified oligonucleotide has a nucleobase sequence comprising at least 12 contiguous nucleobases of a nucleobase sequence recited in any one of SEQ ID NOs: 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33-874. In certain embodiments, the modified oligonucleotide has a nucleobase sequence comprising at least 13, or at least 14, contiguous nucleobases of a nucleobase sequence recited in any one of SEQ ID NOs: 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33-874.

In certain embodiments, the modified oligonucleotide has a nucleobase sequence comprising at least 15 contiguous nucleobases of a nucleobase sequence recited in any one of SEQ ID NOs: 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33-874. In certain embodiments, the modified oligonucleotide has a nucleobase sequence comprising at least 16 contiguous nucleobases of a nucleobase sequence recited in any one of SEQ ID NOs: 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33-874.

In certain embodiments, the modified oligonucleotide has a nucleobase sequence comprising at least 17 contiguous nucleobases of a nucleobase sequence recited in any one of SEQ ID NOs: 24, 25, 27, or 28.

In certain embodiments, the modified oligonucleotide has a nucleobase sequence comprising at least 18 contiguous nucleobases of a nucleobase sequence recited in any one of SEQ ID NOs: 24 or 25. In certain embodiments, the modified oligonucleotide has a nucleobase sequence comprising at least 19 contiguous nucleobases of a nucleobase sequence recited in any one of SEQ ID NOs: 24 or 25.

In certain embodiments, the modified oligonucleotides provided herein are targeted to any one of the following regions of SEQ ID NO: 1: 1343-1368, 1317-1366, 2748-2791, 2155-2208, 2748-2791, 730-748, 528-547, 531-567, 636-697, 1311-1331, 1314-1339, 1446-1475, 1635-1670, 1610-1638, 1457-1486, 2773-1788, 931-948, 934-949, 937-952, 942-957, 937-957, 943-958, 937-953, 1346-1363, 1346-1361, 1347-1363, 2162-2179, 2492-2508, 2696-2717, and 2683-2703. In certain embodiments, the modified oligonucleotides provided herein are targeted to any one of the following regions of SEQ ID NO: 1: 2773-2788, 1343-1358, and 1344-1359.

In certain embodiments, the modified oligonucleotides provided herein have a nucleobase sequence comprising a complementary region comprising at least 8 contiguous nucleobases complementary to a target region. In certain embodiments, the modified oligonucleotides provided herein have a nucleobase sequence comprising a complementary region comprising at least 8 contiguous nucleobases complementary to a target region, wherein the target region is targeted to nucleobases 1343-1368, 1317-1366, 2748-2791, 2155-2208, 2748-2791, 730-748, 528-547, 531-567, 636-697, 1311-1331, 1314-1339, 1446-1475, 1635-1670, 1610-1638, 1457-1486, 2773-1788, 931-948, 934-949, 937-952, 942-957, 937-957, 943-958, 937-953, 1346-1363, 1346-1361, 1347-1363, 2162-2179, 2492-2508, 2696-2717, or 2683-2703 of SEQ ID NO: 1. In certain embodiments, the modified oligonucleotides provided herein have a nucleobase sequence comprising a complementary region comprising at least 8 contiguous nucleobases complementary to a target region, wherein the target region is targeted to nucleobases 2773-2788, 1343-1358, or 1344-1359 of SEQ ID NO: 1.

In certain embodiments, the modified oligonucleotides provided herein have a nucleobase sequence comprising a complementary region comprising at least 10 contiguous nucleobases complementary to a target region. In certain embodiments, the modified oligonucleotides provided herein have a nucleobase sequence comprising a complementary region comprising at least 10 contiguous nucleobases complementary to a target region, wherein the target region is targeted to nucleobases 1343-1368, 1317-1366, 2748-2791, 2155-2208, 2748-2791, 730-748, 528-547, 531-567, 636-697, 1311-1331, 1314-1339, 1446-1475, 1635-1670, 1610-1638, 1457-1486, 2773-1788, 931-948, 934-949, 937-952, 942-957, 937-957, 943-958, 937-953, 1346-1363, 1346-1361, 1347-1363, 2162-2179, 2492-2508, 2696-2717, or 2683-2703 of SEQ ID NO: 1. In certain embodiments, the modified oligonucleotides provided herein have a nucleobase sequence comprising a complementary region comprising at least 10 contiguous nucleobases complementary to a target region, wherein the target region is targeted to nucleobases 2773-2788, 1343-1358, or 1344-1359 of SEQ ID NO: 1.

In certain embodiments, the modified oligonucleotides provided herein have a nucleobase sequence comprising a complementary region comprising at least 12 contiguous nucleobases complementary to a target region. In certain embodiments, the modified oligonucleotides provided herein have a nucleobase sequence comprising a complementary region comprising at least 12 contiguous nucleobases complementary to a target region, wherein the target region is targeted to nucleobases 1343-1368, 1317-1366, 2748-2791, 2155-2208, 2748-2791, 730-748, 528-547, 531-567, 636-697, 1311-1331, 1314-1339, 1446-1475, 1635-1670, 1610-1638, 1457-1486, 2773-1788, 931-948, 934-949, 937-952, 942-957, 937-957, 943-958, 937-953, 1346-1363, 1346-1361, 1347-1363, 2162-2179, 2492-2508, 2696-2717, or 2683-2703 of SEQ ID NO: 1. In certain embodiments, the modified oligonucleotides provided herein have a nucleobase sequence comprising a complementary region comprising at least 12 contiguous nucleobases complementary to a target region, wherein the target region is targeted to nucleobases 2773-2788, 1343-1358, or 1344-1359 of SEQ ID NO: 1.

In certain embodiments, the modified oligonucleotides provided herein have a nucleobase sequence comprising a complementary region comprising at least 14 contiguous nucleobases complementary to a target region. In certain embodiments, the modified oligonucleotides provided herein have a nucleobase sequence comprising a complementary region comprising at least 14 contiguous nucleobases complementary to a target region, wherein the target region is targeted to nucleobases 1343-1368, 1317-1366, 2748-2791, 2155-2208, 2748-2791, 730-748, 528-547, 531-567, 636-697, 1311-1331, 1314-1339, 1446-1475, 1635-1670, 1610-1638, 1457-1486, 2773-1788, 931-948, 934-949, 937-952, 942-957, 937-957, 943-958, 937-953, 1346-1363, 1346-1361, 1347-1363, 2162-2179, 2492-2508, 2696-2717, or 2683-2703 of SEQ ID NO: 1. In certain embodiments, the modified oligonucleotides provided herein have a nucleobase sequence comprising a complementary region comprising at least 14 contiguous nucleobases complementary to a target region, wherein the target region is targeted to nucleobases 2773-2788, 1343-1358, or 1344-1359 of SEQ ID NO: 1.

In certain embodiments, the modified oligonucleotides provided herein have a nucleobase sequence comprising a complementary region comprising at least 16 contiguous nucleobases complementary to a target region. In certain embodiments, the modified oligonucleotides provided herein have a nucleobase sequence comprising a complementary region comprising at least 16 contiguous nucleobases complementary to a target region, wherein the target region is targeted to nucleobases 1343-1368, 1317-1366, 2748-2791, 2155-2208, 2748-2791, 730-748, 528-547, 531-567, 636-697, 1311-1331, 1314-1339, 1446-1475, 1635-1670, 1610-1638, 1457-1486, 2773-1788, 931-948, 934-949, 937-952, 942-957, 937-957, 943-958, 937-953, 1346-1363, 1346-1361, 1347-1363, 2162-2179, 2492-2508, 2696-2717, or 2683-2703 of SEQ ID NO: 1. In certain embodiments, the modified oligonucleotides provided herein have a nucleobase sequence comprising a complementary region comprising at least 16 contiguous nucleobases complementary to a target region, wherein the target region is targeted to nucleobases 2773-2788, 1343-1358, or 1344-1359 of SEQ ID NO: 1.

In certain embodiments, the modified oligonucleotides provided herein are targeted to any one of the following regions of SEQ ID NO: 2: 10195-10294, 13553-13572, 13748-13767, 13455-13475, 13628-13657, 13735-13760, 13746-13905, 13836-13851, 13553-13568, 13563-13578, 13624-13639, 13686-13701, 13760-13775, 13763-13779, 13765-13780, 2580-2595, 6446-6461, 11099-11115, 11082-11099, 1974-1993, 4435-4456, 6035-6052, 6360-6385, 6445-6468, 6807-6824, 6789-6806, and 6596-6615. In certain embodiments, the modified oligonucleotides provided herein are targeted to any one of the following regions of SEQ ID NO: 2: 13836-13831, 8603-8618, and 8604-8619.

In certain embodiments, the modified oligonucleotides provided herein have a nucleobase sequence comprising a complementary region comprising at least 8 contiguous nucleobases complementary to a target region. In certain embodiments, the modified oligonucleotides provided herein have a nucleobase sequence comprising a complementary region comprising at least 8 contiguous nucleobases complementary to a target region, wherein the target region is targeted to nucleobases 10195-10294, 13553-13572, 13748-13767, 13455-13475, 13628-13657, 13735-13760, 13746-13905, 13836-13851, 13553-13568, 13563-13578, 13624-13639, 13686-13701, 13760-13775, 13763-13779, 13765-13780, 2580-2595, 6446-6461, 11099-11115, 11082-11099, 1974-1993, 4435-4456, 6035-6052, 6360-6385, 6445-6468, 6807-6824, 6789-6806, or 6596-6615 of SEQ ID NO: 2. In certain embodiments, the modified oligonucleotides provided herein have a nucleobase sequence comprising a complementary region comprising at least 8 contiguous nucleobases complementary to a target region, wherein the target region is targeted to nucleobases 13836-13831, 8603-8618, or 8604-8619 of SEQ ID NO: 2.

In certain embodiments, the modified oligonucleotides provided herein have a nucleobase sequence comprising a complementary region comprising at least 10 contiguous nucleobases complementary to a target region. In certain embodiments, the modified oligonucleotides provided herein have a nucleobase sequence comprising a complementary region comprising at least 10 contiguous nucleobases complementary to a target region, wherein the target region is targeted to nucleobases 10195-10294, 13553-13572, 13748-13767, 13455-13475, 13628-13657, 13735-13760, 13746-13905, 13836-13851, 13553-13568, 13563-13578, 13624-13639, 13686-13701, 13760-13775, 13763-13779, 13765-13780, 2580-2595, 6446-6461, 11099-11115, 11082-11099, 1974-1993, 4435-4456, 6035-6052, 6360-6385, 6445-6468, 6807-6824, 6789-6806, or 6596-6615 of SEQ ID NO: 2. In certain embodiments, the modified oligonucleotides provided herein have a nucleobase sequence comprising a complementary region comprising at least 10 contiguous nucleobases complementary to a target region, wherein the target region is targeted to nucleobases 13836-13831, 8603-8618, or 8604-8619 of SEQ ID NO: 2.

In certain embodiments, the modified oligonucleotides provided herein have a nucleobase sequence comprising a complementary region comprising at least 12 contiguous nucleobases complementary to a target region. In certain embodiments, the modified oligonucleotides provided herein have a nucleobase sequence comprising a complementary region comprising at least 12 contiguous nucleobases complementary to a target region, wherein the target region is targeted to nucleobases 10195-10294, 13553-13572, 13748-13767, 13455-13475, 13628-13657, 13735-13760, 13746-13905, 13836-13851, 13553-13568, 13563-13578, 13624-13639, 13686-13701, 13760-13775, 13763-13779, 13765-13780, 2580-2595, 6446-6461, 11099-11115, 11082-11099, 1974-1993, 4435-4456, 6035-6052, 6360-6385, 6445-6468, 6807-6824, 6789-6806, or 6596-6615 of SEQ ID NO: 2. In certain embodiments, the modified oligonucleotides provided herein have a nucleobase sequence comprising a complementary region comprising at least 12 contiguous nucleobases complementary to a target region, wherein the target region is targeted to nucleobases 13836-13831, 8603-8618, or 8604-8619 of SEQ ID NO: 2.

In certain embodiments, the modified oligonucleotides provided herein have a nucleobase sequence comprising a complementary region comprising at least 14 contiguous nucleobases complementary to a target region. In certain embodiments, the modified oligonucleotides provided herein have a nucleobase sequence comprising a complementary region comprising at least 14 contiguous nucleobases complementary to a target region, wherein the target region is targeted to nucleobases 10195-10294, 13553-13572, 13748-13767, 13455-13475, 13628-13657, 13735-13760, 13746-13905, 13836-13851, 13553-13568, 13563-13578, 13624-13639, 13686-13701, 13760-13775, 13763-13779, 13765-13780, 2580-2595, 6446-6461, 11099-11115, 11082-11099, 1974-1993, 4435-4456, 6035-6052, 6360-6385, 6445-6468, 6807-6824, 6789-6806, or 6596-6615 of SEQ ID NO: 2. In certain embodiments, the modified oligonucleotides provided herein have a nucleobase sequence comprising a complementary region comprising at least 14 contiguous nucleobases complementary to a target region, wherein the target region is targeted to nucleobases 13836-13831, 8603-8618, or 8604-8619 of SEQ ID NO: 2.

In certain embodiments, the modified oligonucleotides provided herein have a nucleobase sequence comprising a complementary region comprising at least 16 contiguous nucleobases complementary to a target region. In certain embodiments, the modified oligonucleotides provided herein have a nucleobase sequence comprising a complementary region comprising at least 16 contiguous nucleobases complementary to a target region, wherein the target region is targeted to nucleobases 10195-10294, 13553-13572, 13748-13767, 13455-13475, 13628-13657, 13735-13760, 13746-13905, 13836-13851, 13553-13568, 13563-13578, 13624-13639, 13686-13701, 13760-13775, 13763-13779, 13765-13780, 2580-2595, 6446-6461, 11099-11115, 11082-11099, 1974-1993, 4435-4456, 6035-6052, 6360-6385, 6445-6468, 6807-6824, 6789-6806, or 6596-6615 of SEQ ID NO: 2. In certain embodiments, the modified oligonucleotides provided herein have a nucleobase sequence comprising a complementary region comprising at least 16 contiguous nucleobases complementary to a target region, wherein the target region is targeted to nucleobases 13836-13831, 8603-8618, or 8604-8619 of SEQ ID NO: 2.

In certain embodiments, the animal is a human.

In certain embodiments, the compounds or compositions of the invention are designated as a first agent and the methods of the invention further comprise administering a second agent. In certain embodiments, the first agent and the second agent are co-administered. In certain embodiments the first agent and the second agent are co-administered sequentially or concomitantly.

In certain embodiments, administration comprises parenteral administration.

In certain embodiments, the compound is a single-stranded modified oligonucleotide. In certain embodiments, the nucleobase sequence of the modified oligonucleotide is at least 95% complementary to any one of SEQ ID NOs: 1-19 as measured over the entirety of said modified oligonucleotide. In certain embodiments, the nucleobase sequence of the modified oligonucleotide is 100% complementary to any one of SEQ ID NOs: 1-19 as measured over the entirety of said modified oligonucleotide. In certain embodiments, the compound is a single-stranded modified oligonucleotide. In certain embodiments, the nucleobase sequence of the modified oligonucleotide is at least 95% complementary to any one of SEQ ID NO: 1 as measured over the entirety of said modified oligonucleotide. In certain embodiments, the nucleobase sequence of the modified oligonucleotide is 100% complementary to any one of SEQ ID NO: 1 as measured over the entirety of said modified oligonucleotide.

In certain embodiments, the nucleobase sequence of the modified oligonucleotide is at least 90% complementary to any one of SEQ ID NO: 1 as measured over the entirety of said modified oligonucleotide. In certain embodiments, the nucleobase sequence of the modified oligonucleotide is 85% complementary to any one of SEQ ID NOs: 1 as measured over the entirety of said modified oligonucleotide.

In certain embodiments, the nucleobase sequence of the modified oligonucleotide is at least 90% complementary to any one of SEQ ID NO: 2 as measured over the entirety of said modified oligonucleotide. In certain embodiments, the nucleobase sequence of the modified oligonucleotide is 85% complementary to any one of SEQ ID NO: 2 as measured over the entirety of said modified oligonucleotide.

In certain embodiments, at least one internucleoside linkage of said modified oligonucleotide is a modified internucleoside linkage. In certain embodiments, each internucleoside linkage is a phosphorothioate internucleoside linkage.

In certain embodiments, at least one nucleoside of said modified oligonucleotide comprises a modified sugar. In certain embodiments, at least one modified sugar is a bicyclic sugar. In certain embodiments, at least one modified sugar comprises a 2′-O-methoxyethyl or a 4′-(CH2)n—O-2′ bridge, wherein n is 1 or 2.

In certain embodiments, at least one nucleoside of said modified oligonucleotide comprises a modified nucleobase. In certain embodiments, the modified nucleobase is a 5-methylcytosine.

In certain embodiments, the modified oligonucleotide comprises: a) a gap segment consisting of linked deoxynucleosides; b) a 5′ wing segment consisting of linked nucleosides; and c) a 3′ wing segment consisting of linked nucleosides. The gap segment is positioned between the 5′ wing segment and the 3′ wing segment and each nucleoside of each wing segment comprises a modified sugar.

In certain embodiments, the modified oligonucleotide comprises: a) a gap segment consisting often linked deoxynucleosides; b) a 5′ wing segment consisting of five linked nucleosides; and c) a 3′ wing segment consisting of five linked nucleosides. The gap segment is positioned between the 5′ wing segment and the 3′ wing segment, each nucleoside of each wing segment comprises a 2′-O-methoxyethyl sugar, each internucleoside linkage of said modified oligonucleotide is a phosphorothioate linkage, and each cytosine in said modified oligonucleotide is a 5′-methylcytosine.

In certain embodiments, the modified oligonucleotide consists of 20 linked nucleosides. In certain embodiments, the modified oligonucleotide consists of 19 linked nucleosides. In certain embodiments, the modified oligonucleotide consists of 18 linked nucleosides. In certain embodiments, the modified oligonucleotide consists of 17 linked nucleosides. In certain embodiments, the modified oligonucleotide consists of 16 linked nucleosides.

Certain embodiments provide a method of preferentially reducing CUGexp DMPK RNA, reducing myotonia or reducing spliceopathy in an animal comprising administering to the animal a compound comprising a modified oligonucleotide having a gap segment consisting often linked deoxynucleosides, a 5′ wing segment consisting of five linked nucleosides and a 3′ wing segment consisting of five linked nucleosides. The gap segment is positioned between the 5′ wing segment and the 3′ wing segment, each nucleoside of each wing segment comprises a 2′-O-methoxyethyl sugar, each internucleoside linkage of said modified oligonucleotide is a phosphorothioate linkage, each cytosine in said modified oligonucleotide is a 5′-methylcytosine.

In certain embodiments, the modified oligonucleotide comprises: a) a gap segment consisting of eight linked deoxynucleosides; b) a 5′ wing segment consisting of four linked nucleosides and having a E-E-K-K 5′-wing motif; c) a 3′ wing segment consisting of four linked nucleosides and having a K-K-E-E 3′-wing motif; and d) wherein the gap segment is positioned between the 5′ wing segment and the 3′ wing segment, and wherein each E represents 2′-O-methoxyethyl sugar and each K represents a cEt sugar.

In certain embodiments, the modified oligonucleotide comprises: a) a gap segment consisting of seven linked deoxynucleosides; b) a 5′ wing segment consisting of five linked nucleosides and having an E-E-E-K-K 5′-wing motif; c) a 3′ wing segment consisting of five linked nucleosides and having a K-K-E-E-E 3′-wing motif; and d) wherein the gap segment is positioned between the 5′ wing segment and the 3′ wing segment, and wherein each E represents 2′-O-methoxyethyl sugar and each K represents a cEt sugar.

In certain embodiments, the modified oligonucleotide comprises: a) a gap segment consisting often linked deoxynucleosides; b) a 5′ wing segment consisting of five linked nucleosides; c) a 3′ wing segment consisting of five linked nucleosides; and d) wherein the gap segment is positioned between the 5′ wing segment and the 3′ wing segment, and wherein each nucleoside of each wing segment comprises a 2′-O-methoxyethyl sugar.

In certain embodiments, the modified oligonucleotide comprises: a) a gap segment consisting often linked deoxynucleosides; b) a 5′ wing segment consisting of three linked nucleosides; c) a 3′ wing segment consisting of three linked nucleosides; and d) wherein the gap segment is positioned between the 5′ wing segment and the 3′ wing segment, and wherein each nucleoside of each wing segment comprises a cEt sugar.

Certain embodiments provide a method of preferentially reducing CUGexp DMPK RNA, reducing myotonia or reducing spliceopathy in an animal comprising administering to the animal a compound comprising a modified oligonucleotide having: a) a gap segment consisting of eight linked deoxynucleosides; b) a 5′ wing segment consisting of four linked nucleosides and having a E-E-K-K 5′-wing motif; c) a 3′ wing segment consisting of four linked nucleosides and having a K-K-E-E 3′-wing motif; and d) wherein the gap segment is positioned between the 5′ wing segment and the 3′ wing segment, and wherein each E represents 2′-O-methoxyethyl sugar and each K represents a cEt sugar.

Certain embodiments provide a method of preferentially reducing CUGexp DMPK RNA, reducing myotonia or reducing spliceopathy in an animal comprising administering to the animal a compound comprising a modified oligonucleotide having: a) a gap segment consisting of seven linked deoxynucleosides; b) a 5′ wing segment consisting of five linked nucleosides and having an E-E-E-K-K 5′-wing motif; c) a 3′ wing segment consisting of five linked nucleosides and having a K-K-E-E-E 3′-wing motif; and d) wherein the gap segment is positioned between the 5′ wing segment and the 3′ wing segment, and wherein each E represents 2′-O-methoxyethyl sugar and each K represents a cEt sugar.

Certain embodiments provide a method of preferentially reducing CUGexp DMPK RNA, reducing myotonia or reducing spliceopathy in an animal comprising administering to the animal a compound comprising a modified oligonucleotide having: a) a gap segment consisting often linked deoxynucleosides; b) a 5′ wing segment consisting of five linked nucleosides; c) a 3′ wing segment consisting of five linked nucleosides; and d) wherein the gap segment is positioned between the 5′ wing segment and the 3′ wing segment, and wherein each nucleoside of each wing segment comprises a 2′-O-methoxyethyl sugar.

Certain embodiments provide a method of preferentially reducing CUGexp DMPK RNA, reducing myotonia or reducing spliceopathy in an animal comprising administering to the animal a compound comprising a modified oligonucleotide having: a) a gap segment consisting of ten linked deoxynucleosides; b) a 5′ wing segment consisting of three linked nucleosides; c) a 3′ wing segment consisting of three linked nucleosides; and d) wherein the gap segment is positioned between the 5′ wing segment and the 3′ wing segment, and wherein each nucleoside of each wing segment comprises a cEt sugar.

Certain embodiments provide the use of any compound as described herein in the manufacture of a medicament for use in any of the therapeutic methods described herein. For example, certain embodiments provide the use of a compound as described herein in the manufacture of a medicament for treating, ameliorating, or preventing type 1 myotonic dystrophy. Certain embodiments provide the use of a compound as described herein in the manufacture of a medicament for inhibiting expression of DMPK and treating, preventing, delaying or ameliorating a DMPK related disease and or a symptom thereof. Certain embodiments provide the use of a compound as described herein in the manufacture of a medicament for reducing DMPK expression in an animal. Certain embodiments provide the use of a compound as described herein in the manufacture of a medicament for preferentially reducing CUGexp DMPK, reducing myotonia, or reducing spliceopathy in an animal. Certain embodiments provide the use of a compound as described herein in the manufacture of a medicament for treating an animal with type 1 myotonic dystrophy. Certain embodiments provide the use of a compound as described herein in the manufacture of a medicament for treating, preventing, delaying, or ameliorating symptoms and outcomes associated with development of DM1 including muscle stiffness, myotonia, disabling distal weakness, weakness in face and jaw muscles, difficulty in swallowing, drooping of the eyelids (ptosis), weakness of neck muscles, weakness in arm and leg muscles, persistent muscle pain, hypersomnia, muscle wasting, dysphagia, respiratory insufficiency, irregular heartbeat, heart muscle damage, apathy, insulin resistance, and cataracts. Certain embodiments provide the use of a compound as described herein in the manufacture of a medicament for counteracting RNA dominance by directing the cleavage of pathogenic transcripts.

Certain embodiments provide a kit for treating, preventing, or ameliorating type 1 myotonic dystrophy as described herein wherein the kit comprises: a) a compound as described herein; and optionally b) an additional agent or therapy as described herein. The kit can further include instructions or a label for using the kit to treat, prevent, or ameliorate type 1 myotonic dystrophy.

Certain embodiments provide any compound or composition as described herein, for use in any of the therapeutic methods described herein. For example, certain embodiments provide a compound or composition as described herein for inhibiting expression of DMPK and treating, preventing, delaying or ameliorating a DMPK related disease and or a symptom thereof. Certain embodiments provide a compound or composition as described herein for use in reducing DMPK expression in an animal. Certain embodiments provide a compound or composition as described herein for use in preferentially reducing CUGexp DMPK, reducing myotonia, or reducing spliceopathy in an animal. Certain embodiments provide a compound or composition as described herein for use in treating an animal with type 1 myotonic dystrophy. Certain embodiments provide a compound or composition as described herein for use in treating, preventing, delaying, or ameliorating symptoms and outcomes associated with development of DM1 including muscle stiffness, myotonia, disabling distal weakness, weakness in face and jaw muscles, difficulty in swallowing, drooping of the eyelids (ptosis), weakness of neck muscles, weakness in arm and leg muscles, persistent muscle pain, hypersomnia, muscle wasting, dysphagia, respiratory insufficiency, irregular heartbeat, heart muscle damage, apathy, insulin resistance, and cataracts. Certain embodiments provide a compound or composition as described herein for use in counteracting RNA dominance by directing the cleavage of pathogenic transcripts. Certain embodiments provide compounds comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides having a nucleobase sequence comprising at least 12 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33-874.

Other compounds which can be used in the methods described herein are also provided.

For example, certain embodiments provide compounds comprising a modified oligonucleotide consisting of 10 to 80, 12 to 50, 12 to 30, 15 to 30, 18 to 24, 19 to 22, or 20 linked nucleosides having a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, or at least 19, contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33-874.

Certain embodiments provide compounds comprising a modified oligonucleotide consisting of 10 to 80, 12 to 50, 12 to 30, 15 to 30, 18 to 24, 19 to 22, or 20, linked nucleosides having a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33-874.

Certain embodiments provide compounds comprising a modified oligonucleotide consisting of 10 to 80, 12 to 50, 12 to 30, 15 to 30, or 15 to 17, linked nucleosides having a nucleobase sequence comprising a portion of at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, or at least 19, or more, contiguous nucleobases complementary to an equal length portion of nucleobases 1343-1368, 1317-1366, 2748-2791, 2155-2208, 2748-2791, 730-748, 528-547, 531-567, 636-697, 1311-1331, 1314-1339, 1446-1475, 1635-1670, 1610-1638, 1457-1486, 2773-1788, 931-948, 934-949, 937-952, 942-957, 937-957, 943-958, 937-953, 1346-1363, 1346-1361, 1347-1363, 2162-2179, 2492-2508, 2696-2717, or 2683-2703 of SEQ ID NO: 1.

Certain embodiments provide compounds comprising a modified oligonucleotide consisting of 10 to 80, 12 to 50, 12 to 30, 15 to 30, 18 to 24, 19 to 22, or 20, linked nucleosides having a nucleobase sequence comprising a portion of at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, or at least 19, or more, contiguous nucleobases complementary to an equal length portion of nucleobases 10195-10294, 13553-13572, 13748-13767, 13455-13475, 13628-13657, 13735-13760, 13746-13905, 13836-13851, 13553-13568, 13563-13578, 13624-13639, 13686-13701, 13760-13775, 13763-13779, 13765-13780, 2580-2595, 6446-6461, 11099-11115, 11082-11099, 1974-1993, 4435-4456, 6035-6052, 6360-6385, 6445-6468, 6807-6824, 6789-6806, or 6596-6615 of SEQ ID NO: 2.

In certain embodiments, the modified oligonucleotide is a single-stranded oligonucleotide.

In certain embodiments, the nucleobase sequence of the modified oligonucleotide is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100%, complementary to any of SEQ ID NOs: 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33-874.

In certain embodiments, at least one internucleoside linkage is a modified internucleoside linkage.

In certain embodiments, each internucleoside linkage is a phosphorothioate internucleoside linkage.

In certain embodiments, at least one nucleoside comprises a modified sugar.

In certain embodiments, at least one modified sugar is a bicyclic sugar.

In certain embodiments, at least one modified sugar is a cEt.

In certain embodiments, at least one modified sugar comprises a 2′-O-methoxyethyl.

In certain embodiments, at least one nucleoside comprises a modified nucleobase.

In certain embodiments, the modified nucleobase is a 5-methylcytosine. In certain embodiments, each cytosine residue comprises a 5-methylcytosine.

In certain embodiments, the modified oligonucleotide consists of 16 linked nucleosides.

In certain embodiments, the modified oligonucleotide consists of 17 linked nucleosides.

In certain embodiments, the modified oligonucleotide consists of 20 linked nucleosides.

Antisense Compounds

Oligomeric compounds include, but are not limited to, oligonucleotides, oligonucleosides, oligonucleotide analogs, oligonucleotide mimetics, antisense compounds, antisense oligonucleotides, and siRNAs. An oligomeric compound can be “antisense” to a target nucleic acid, meaning that is capable of undergoing hybridization to a target nucleic acid through hydrogen bonding.

In certain embodiments, an antisense compound has a nucleobase sequence that, when written in the 5′ to 3′ direction, comprises the reverse complement of the target segment of a target nucleic acid to which it is targeted. In certain such embodiments, an antisense oligonucleotide has a nucleobase sequence that, when written in the 5′ to 3′ direction, comprises the reverse complement of the target segment of a target nucleic acid to which it is targeted.

In certain embodiments, an antisense compound targeted to DMPK as described herein is 10 to 30 nucleotides in length. In other words, the antisense compounds are in some embodiments from 10 to 30 linked nucleobases. In other embodiments, the antisense compound comprises a modified oligonucleotide consisting of 8 to 80, 10 to 80, 12 to 30, 12 to 50, 15 to 30, 15 to 18, 15 to 17, 16 to 16, 18 to 24, 19 to 22, or 20 linked nucleobases. In certain such embodiments, the antisense compound comprises a modified oligonucleotide consisting of 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, or 80 linked nucleobases in length, or a range defined by any two of the above values. In certain embodiments, antisense compounds of any of these lengths contain at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, or at least 19, contiguous nucleobases of the nucleobase sequence of any of the exemplary antisense compounds described herein (e.g., at least 8 contiguous nucleobases of a nucleobase sequence recited in any one of SEQ ID NOs: 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33-874.

In certain embodiments, the antisense compound comprises a shortened or truncated modified oligonucleotide. The shortened or truncated modified oligonucleotide can have a single nucleoside deleted from the 5′ end (5′ truncation), or alternatively from the 3′ end (3′ truncation). A shortened or truncated oligonucleotide can have two nucleosides deleted from the 5′ end, or alternatively can have two subunits deleted from the 3′ end. Alternatively, the deleted nucleosides can be dispersed throughout the modified oligonucleotide, for example, in an antisense compound having one nucleoside deleted from the 5′ end and one nucleoside deleted from the 3′ end.

When a single additional nucleoside is present in a lengthened oligonucleotide, the additional nucleoside can be located at the 5′ or 3′ end of the oligonucleotide. When two or more additional nucleosides are present, the added nucleosides can be adjacent to each other, for example, in an oligonucleotide having two nucleosides added to the 5′ end (5′ addition), or alternatively to the 3′ end (3′ addition), of the oligonucleotide. Alternatively, the added nucleoside can be dispersed throughout the antisense compound, for example, in an oligonucleotide having one nucleoside added to the 5′ end and one subunit added to the 3′ end.

It is possible to increase or decrease the length of an antisense compound, such as an antisense oligonucleotide, and/or introduce mismatch bases without eliminating activity. For example, in Woolf et al. (Proc. Natl. Acad. Sci. USA 89:7305-7309, 1992), a series of antisense oligonucleotides 13-25 nucleobases in length were tested for their ability to induce cleavage of a target RNA in an oocyte injection model. Antisense oligonucleotides 25 nucleobases in length with 8 or 11 mismatch bases near the ends of the antisense oligonucleotides were able to direct specific cleavage of the target mRNA, albeit to a lesser extent than the antisense oligonucleotides that contained no mismatches. Similarly, target specific cleavage was achieved using 13 nucleobase antisense oligonucleotides, including those with 1 or 3 mismatches.

Gautschi et al (J. Natl. Cancer Inst. 93:463-471, March 2001) demonstrated the ability of an oligonucleotide having 100% complementarity to the bcl-2 mRNA and having 3 mismatches to the bcl-xL mRNA to reduce the expression of both bcl-2 and bcl-xL in vitro and in vivo. Furthermore, this oligonucleotide demonstrated potent anti-tumor activity in vivo.

Maher and Dolnick (Nuc. Acid. Res. 16:3341-3358, 1988) tested a series of tandem 14 nucleobase antisense oligonucleotides, and a 28 and 42 nucleobase antisense oligonucleotides comprised of the sequence of two or three of the tandem antisense oligonucleotides, respectively, for their ability to arrest translation of human DHFR in a rabbit reticulocyte assay. Each of the three 14 nucleobase antisense oligonucleotides alone was able to inhibit translation, albeit at a more modest level than the 28 or 42 nucleobase antisense oligonucleotides.

Target Nucleic Acids, Target Regions and Nucleotide Sequences

Nucleotide sequences that encode DMPK include, without limitation, the following sequences as set forth in GenBank Accession No. NM_001081560.1 (incorporated herein as SEQ ID NO: 1), GenBank Accession No. NT_011109.15 truncated from nucleotides 18540696 to Ser. No. 18/555,106 (incorporated herein as SEQ ID NO: 2), GenBank Accession No. NT_039413.7 truncated from nucleotides 16666001 to Ser. No. 16/681,000 (incorporated herein as SEQ ID NO: 3), GenBank Accession No. NM_032418.1 (incorporated herein as SEQ ID NO: 4), GenBank Accession No. AI007148.1 (incorporated herein as SEQ ID NO: 5), GenBank Accession No. AI304033.1 (incorporated herein as SEQ ID NO: 6), GenBank Accession No. BC024150.1 (incorporated herein as SEQ ID NO: 7), GenBank Accession No. BC056615.1 (incorporated herein as SEQ ID NO: 8), GenBank Accession No. BC075715.1 (incorporated herein as SEQ ID NO: 9), GenBank Accession No. BU519245.1 (incorporated herein as SEQ ID NO: 10), GenBank Accession No. CB247909.1 (incorporated herein as SEQ ID NO: 11), GenBank Accession No. CX208906.1 (incorporated herein as SEQ ID NO: 12), GenBank Accession No. CX732022.1 (incorporated herein as SEQ ID NO: 13), GenBank Accession No. S60315.1 (incorporated herein as SEQ ID NO: 14), GenBank Accession No. S60316.1 (incorporated herein as SEQ ID NO: 15), GenBank Accession No. NM_001081562.1 (incorporated herein as SEQ ID NO: 16), and GenBank Accession No. NM_001100.3 (incorporated herein as SEQ ID NO: 17). It is understood that the sequence set forth in each SEQ ID NO in the Examples contained herein is independent of any modification to a sugar moiety, an internucleoside linkage, or a nucleobase. As such, antisense compounds defined by a SEQ ID NO can comprise, independently, one or more modifications to a sugar moiety, an internucleoside linkage, or a nucleobase. Antisense compounds described by Isis Number (Isis No) indicate a combination of nucleobase sequence and motif.

In certain embodiments, a target region is a structurally defined region of the target nucleic acid. For example, a target region can encompass a 3′ UTR, a 5′ UTR, an exon, an intron, an exon/intron junction, a coding region, a translation initiation region, translation termination region, or other defined nucleic acid region. The structurally defined regions for DMPK can be obtained by accession number from sequence databases such as NCBI and such information is incorporated herein by reference. In certain embodiments, a target region can encompass the sequence from a 5′ target site of one target segment within the target region to a 3′ target site of another target segment within the target region.

Targeting includes determination of at least one target segment to which an antisense compound hybridizes, such that a desired effect occurs. In certain embodiments, the desired effect is a reduction in mRNA target nucleic acid levels. In certain embodiments, the desired effect is reduction of levels of protein encoded by the target nucleic acid or a phenotypic change associated with the target nucleic acid.

A target region can contain one or more target segments. Multiple target segments within a target region can be overlapping. Alternatively, they can be non-overlapping. In certain embodiments, target segments within a target region are separated by no more than about 300 nucleotides. In certain embodiments, target segments within a target region are separated by a number of nucleotides that is, is about, is no more than, is no more than about, 250, 200, 150, 100, 90, 80, 70, 60, 50, 40, 30, 20, or 10 nucleotides on the target nucleic acid, or is a range defined by any two of the preceding values. In certain embodiments, target segments within a target region are separated by no more than, or no more than about, 5 nucleotides on the target nucleic acid. In certain embodiments, target segments are contiguous. Contemplated are target regions defined by a range having a starting nucleic acid that is any of the 5′ target sites or 3′ target sites listed herein.

Suitable target segments can be found within a 5′ UTR, a coding region, a 3′ UTR, an intron, an exon, or an exon/intron junction. Target segments containing a start codon or a stop codon are also suitable target segments. A suitable target segment can specifically exclude a certain structurally defined region such as the start codon or stop codon.

The determination of suitable target segments can include a comparison of the sequence of a target nucleic acid to other sequences throughout the genome. For example, the BLAST algorithm can be used to identify regions of similarity amongst different nucleic acids. This comparison can prevent the selection of antisense compound sequences that can hybridize in a non-specific manner to sequences other than a selected target nucleic acid (i.e., non-target or off-target sequences).

There can be variation in activity (e.g., as defined by percent reduction of target nucleic acid levels) of the antisense compounds within an active target region. In certain embodiments, reductions in DMPK mRNA levels are indicative of inhibition of DMPK protein expression. Reductions in levels of a DMPK protein are also indicative of inhibition of target mRNA expression. Further, phenotypic changes, such as a reducing myotonia or reducing spliceopathy, can be indicative of inhibition of DMPK mRNA and/or protein expression.

Hybridization

In some embodiments, hybridization occurs between an antisense compound disclosed herein and a DMPK nucleic acid. The most common mechanism of hybridization involves hydrogen bonding (e.g., Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding) between complementary nucleobases of the nucleic acid molecules.

Hybridization can occur under varying conditions. Stringent conditions are sequence-dependent and are determined by the nature and composition of the nucleic acid molecules to be hybridized.

Methods of determining whether a sequence is specifically hybridizable to a target nucleic acid are well known in the art (Sambrooke and Russell, Molecular Cloning: A Laboratory Manual, 3rd Ed., 2001). In certain embodiments, the antisense compounds provided herein are specifically hybridizable with a DMPK nucleic acid.

Complementarity

An antisense compound and a target nucleic acid are complementary to each other when a sufficient number of nucleobases of the antisense compound can hydrogen bond with the corresponding nucleobases of the target nucleic acid, such that a desired effect will occur (e.g., antisense inhibition of a target nucleic acid, such as a DMPK nucleic acid).

An antisense compound can hybridize over one or more segments of a DMPK nucleic acid such that intervening or adjacent segments are not involved in the hybridization event (e.g., a loop structure, mismatch or hairpin structure).

In certain embodiments, the antisense compounds provided herein, or a specified portion thereof, are, or are at least, 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% complementary to a DMPK nucleic acid, a target region, target segment, or specified portion thereof. In certain embodiments, the antisense compounds are at least 70%, at least 80%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% complementary to a DMPK nucleic acid, a target region, target segment, or specified portion thereof, and contain at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, or at least 19, contiguous nucleobases of the nucleobase sequence of any of the exemplary antisense compounds described herein (e.g., at least 8 contiguous nucleobases of a nucleobase sequence recited in any one of SEQ ID NOs: 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33-874). Percent complementarity of an antisense compound with a target nucleic acid can be determined using routine methods, and is measured over the entirety of the antisense compound.

For example, an antisense compound in which 18 of 20 nucleobases of the antisense compound are complementary to a target region, and would therefore specifically hybridize, would represent 90 percent complementarity. In this example, the remaining noncomplementary nucleobases can be clustered or interspersed with complementary nucleobases and need not be contiguous to each other or to complementary nucleobases. As such, an antisense compound which is 18 nucleobases in length having 4 (four) noncomplementary nucleobases which are flanked by two regions of complete complementarity with the target nucleic acid would have 77.8% overall complementarity with the target nucleic acid and would thus fall within the scope of the present invention. Percent complementarity of an antisense compound with a region of a target nucleic acid can be determined routinely using BLAST programs (basic local alignment search tools) and PowerBLAST programs known in the art (Altschul et al., J. Mol. Biol., 1990, 215, 403 410; Zhang and Madden, Genome Res., 1997, 7, 649 656). Percent homology, sequence identity or complementarity, can be determined by, for example, the Gap program (Wisconsin Sequence Analysis Package, Version 8 for Unix, Genetics Computer Group, University Research Park, Madison Wis.), using default settings, which uses the algorithm of Smith and Waterman (Adv. Appl. Math., 1981, 2, 482 489).

In certain embodiments, the antisense compounds provided herein, or specified portions thereof, are fully complementary (i.e. 100% complementary) to a target nucleic acid, or specified portion thereof. For example, antisense compound can be fully complementary to a DMPK nucleic acid, or a target region, or a target segment or target sequence thereof. As used herein, “fully complementary” means each nucleobase of an antisense compound is capable of precise base pairing with the corresponding nucleobases of a target nucleic acid. For example, a 20 nucleobase antisense compound is fully complementary to a target sequence that is 400 nucleobases long, so long as there is a corresponding 20 nucleobase portion of the target nucleic acid that is fully complementary to the antisense compound. Fully complementary can also be used in reference to a specified portion of the first and/or the second nucleic acid. For example, a 20 nucleobase portion of a 30 nucleobase antisense compound can be “fully complementary” to a target sequence that is 400 nucleobases long. The 20 nucleobase portion of the 30 nucleobase oligonucleotide is fully complementary to the target sequence if the target sequence has a corresponding 20 nucleobase portion wherein each nucleobase is complementary to the 20 nucleobase portion of the antisense compound. At the same time, the entire 30 nucleobase antisense compound can be fully complementary to the target sequence, depending on whether the remaining 10 nucleobases of the antisense compound are also complementary to the target sequence.

The location of a non-complementary nucleobase can be at the 5′ end or 3′ end of the antisense compound. Alternatively, the non-complementary nucleobase or nucleobases can be at an internal position of the antisense compound. When two or more non-complementary nucleobases are present, they can be either contiguous (i.e. linked) or non-contiguous. In one embodiment, a non-complementary nucleobase is located in the wing segment of a gapmer antisense oligonucleotide.

In certain embodiments, antisense compounds that are, or are up to 10, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleobases in length comprise no more than 4, no more than 3, no more than 2, or no more than 1 non-complementary nucleobase(s) relative to a target nucleic acid, such as a DMPK nucleic acid, or specified portion thereof.

In certain embodiments, antisense compounds that are, or are up to 10, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleobases in length comprise no more than 6, no more than 5, no more than 4, no more than 3, no more than 2, or no more than 1 non-complementary nucleobase(s) relative to a target nucleic acid, such as a DMPK nucleic acid, or specified portion thereof.

The antisense compounds provided herein also include those which are complementary to a portion of a target nucleic acid. As used herein, “portion” refers to a defined number of contiguous (i.e. linked) nucleobases within a region or segment of a target nucleic acid. A “portion” can also refer to a defined number of contiguous nucleobases of an antisense compound. In certain embodiments, the antisense compounds, are complementary to at least an 8 nucleobase portion of a target segment. In certain embodiments, the antisense compounds are complementary to at least a 10 nucleobase portion of a target segment. In certain embodiments, the antisense compounds are complementary to at least a 15 nucleobase portion of a target segment. Also contemplated are antisense compounds that are complementary to at least an 8, at least a 9, at least a 10, at least an 11, at least a 12, at least a 13, at least a 14, at least a 15, at least a 16, at least a 17, at least an 18, at least a 19, at least a 20, or more nucleobase portion of a target segment, or a range defined by any two of these values.

Identity

The antisense compounds provided herein can also have a defined percent identity to a particular nucleotide sequence, SEQ ID NO, or compound represented by a specific Isis number, or portion thereof. As used herein, an antisense compound is identical to the sequence disclosed herein if it has the same nucleobase pairing ability. For example, a RNA which contains uracil in place of thymidine in a disclosed DNA sequence would be considered identical to the DNA sequence since both uracil and thymidine pair with adenine. Shortened and lengthened versions of the antisense compounds described herein as well as compounds having non-identical bases relative to the antisense compounds provided herein also are contemplated. The non-identical bases can be adjacent to each other or dispersed throughout the antisense compound. Percent identity of an antisense compound is calculated according to the number of bases that have identical base pairing relative to the sequence to which it is being compared.

In certain embodiments, the antisense compounds, or portions thereof, are at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% identical to one or more of the exemplary antisense compounds or SEQ ID NOs, or a portion thereof, disclosed herein.

Modifications

A nucleoside is a base-sugar combination. The nucleobase (also known as base) portion of the nucleoside is normally a heterocyclic base moiety. Nucleotides are nucleosides that further include a phosphate group covalently linked to the sugar portion of the nucleoside. For those nucleosides that include a pentofuranosyl sugar, the phosphate group can be linked to the 2′, 3′ or 5′ hydroxyl moiety of the sugar. Oligonucleotides are formed through the covalent linkage of adjacent nucleosides to one another, to form a linear polymeric oligonucleotide. Within the oligonucleotide structure, the phosphate groups are commonly referred to as forming the internucleoside linkages of the oligonucleotide.

Modifications to antisense compounds encompass substitutions or changes to internucleoside linkages, sugar moieties, or nucleobases. Modified antisense compounds are often preferred over native forms because of desirable properties such as, for example, enhanced cellular uptake, enhanced affinity for nucleic acid target, increased stability in the presence of nucleases, or increased inhibitory activity.

Chemically modified nucleosides can also be employed to increase the binding affinity of a shortened or truncated antisense oligonucleotide for its target nucleic acid. Consequently, comparable results can often be obtained with shorter antisense compounds that have such chemically modified nucleosides.

Modified Internucleoside Linkages

The naturally occurring internucleoside linkage of RNA and DNA is a 3′ to 5′ phosphodiester linkage. Antisense compounds having one or more modified, i.e. non-naturally occurring, internucleoside linkages are often selected over antisense compounds having naturally occurring internucleoside linkages because of desirable properties such as, for example, enhanced cellular uptake, enhanced affinity for target nucleic acids, and increased stability in the presence of nucleases.

Oligonucleotides having modified internucleoside linkages include internucleoside linkages that retain a phosphorus atom as well as internucleoside linkages that do not have a phosphorus atom. Representative phosphorus containing internucleoside linkages include, but are not limited to, phosphodiesters, phosphotriesters, methylphosphonates, phosphoramidate, and phosphorothioates. Methods of preparation of phosphorous-containing and non-phosphorous-containing linkages are well known.

In certain embodiments, antisense compounds targeted to a DMPK nucleic acid comprise one or more modified internucleoside linkages. In certain embodiments, the modified internucleoside linkages are phosphorothioate linkages. In certain embodiments, each internucleoside linkage of an antisense compound is a phosphorothioate internucleoside linkage.

Modified Sugar Moieties

Antisense compounds of the invention can optionally contain one or more nucleosides wherein the sugar group has been modified. Such sugar modified nucleosides may impart enhanced nuclease stability, increased binding affinity, or some other beneficial biological property to the antisense compounds. In certain embodiments, nucleosides comprise chemically modified ribofuranose ring moieties. Examples of chemically modified ribofuranose rings include without limitation, addition of substitutent groups (including 5′ and 2′ substituent groups, bridging of non-geminal ring atoms to form bicyclic nucleic acids (BNA), replacement of the ribosyl ring oxygen atom with S, N(R), or C(R1)(R2) (R, R1 and R2 are each independently H, C1-C12 alkyl or a protecting group) and combinations thereof. Examples of chemically modified sugars include 2′-F-5′-methyl substituted nucleoside (see PCT International Application WO 2008/101157 Published on Aug. 21, 2008 for other disclosed 5′,2′-bis substituted nucleosides) or replacement of the ribosyl ring oxygen atom with S with further substitution at the 2′-position (see published U.S. Patent Application US2005-0130923, published on Jun. 16, 2005) or alternatively 5′-substitution of a BNA (see PCT International Application WO 2007/134181 Published on Nov. 22, 2007 wherein LNA is substituted with for example a 5′-methyl or a 5′-vinyl group).

Examples of nucleosides having modified sugar moieties include without limitation nucleosides comprising 5′-vinyl, 5′-methyl (R or S), 4′-S, 2′-F, 2′-OCH3, 2′-OCH2CH3, 2′-OCH2CH2F and 2′-O(CH2)2OCH3 substituent groups. The substituent at the 2′ position can also be selected from allyl, amino, azido, thio, O-allyl, O—C1-C10 alkyl, OCF3, OCH2F, O(CH2)2SCH3, O(CH2)2—O—N(Rm)(Rn), O—CH2—C(═O)—N(Rm)(Rn), and O—CH2—C(═O)—N(Rl)—(CH2)2—N(Rm)(Rn), where each Rl, Rm and Rn is, independently, H or substituted or unsubstituted C1-C10 alkyl.

Examples of bicyclic nucleic acids (BNAs) include without limitation nucleosides comprising a bridge between the 4′ and the 2′ ribosyl ring atoms. In certain embodiments, antisense compounds provided herein include one or more BNA nucleosides wherein the bridge comprises one of the formulas: 4′-(CH2)—O-2′ (LNA); 4′-(CH2)—S-2; 4′-(CH2)2—O-2′ (ENA); 4′-CH(CH3)—O-2′ and 4′-CH(CH2OCH3)—O-2′ (and analogs thereof see U.S. Pat. No. 7,399,845, issued on Jul. 15, 2008); 4′-C(CH3)(CH3)—O-2′ (and analogs thereof see PCT/US2008/068922 published as WO/2009/006478, published Jan. 8, 2009); 4′-CH2—N(OCH3)-2′ (and analogs thereof see PCT/US2008/064591 published as WO/2008/150729, published Dec. 11, 2008); 4′-CH2—O—N(CH3)-2′ (see published U.S. Patent Application US2004-0171570, published Sep. 2, 2004); 4′-CH2—N(R)—O-2′, wherein R is H, C1-C12 alkyl, or a protecting group (see U.S. Pat. No. 7,427,672, issued on Sep. 23, 2008); 4′-CH2—C(H)(CH3)-2′ (see Chattopadhyaya et al., J. Org. Chem., 2009, 74, 118-134); and 4′-CH2—C(═CH2)-2′ (and analogs thereof see PCT/US2008/066154 published as WO 2008/154401, published on Dec. 8, 2008).

Further bicyclic nucleosides have been reported in published literature (see for example: Srivastava et al., J. Am. Chem. Soc., 2007, 129(26) 8362-8379; Frieden et al., Nucleic Acids Research, 2003, 21, 6365-6372; Elayadi et al., Curr. Opinion Invens. Drugs, 2001, 2, 558-561; Braasch et al., Chem. Biol., 2001, 8, 1-7; Orum et al., Curr. Opinion Mol. Ther., 2001, 3, 239-243; Wahlestedt et al., Proc. Natl. Acad. Sci. U.S.A, 2000, 97, 5633-5638; Singh et al., Chem. Commun., 1998, 4, 455-456; Koshkin et al., Tetrahedron, 1998, 54, 3607-3630; Kumar et al., Bioorg. Med. Chem. Lett., 1998, 8, 2219-2222; Singh et al., J. Org. Chem., 1998, 63, 10035-10039; U.S. Pat. Nos. 7,399,845; 7,053,207; 7,034,133; 6,794,499; 6,770,748; 6,670,461; 6,525,191; 6,268,490; U.S. Patent Publication Nos.: US2008-0039618; US2007-0287831; US2004-0171570; U.S. patent application Ser. No. 12/129,154; 61/099,844; 61/097,787; 61/086,231; 61/056,564; 61/026,998; 61/026,995; 60/989,574; International applications WO 2007/134181; WO 2005/021570; WO 2004/106356; WO 94/14226; and PCT International Applications Nos.: PCT/US2008/068922; PCT/US2008/066154; and PCT/US2008/064591). Each of the foregoing bicyclic nucleosides can be prepared having one or more stereochemical sugar configurations including for example α-L-ribofuranose and β-D-ribofuranose (see PCT international application PCT/DK98/00393, published on Mar. 25, 1999 as WO 99/14226).

In certain embodiments, bicyclic nucleosides comprise a bridge between the 4′ and the 2′ carbon atoms of the pentofuranosyl sugar moiety including without limitation, bridges comprising 1 or from 1 to 4 linked groups independently selected from —[C(Ra)(Rb)]n—, —C(Ra)═C(Rb)—, —C(Ra)═N—, —C(═NRa)—, —C(═O)—, —C(═S)—, —O—, —Si(Ra)2—, —S(═O)x—, and —N(Ra)—; wherein: x is 0, 1, or 2; n is 1, 2, 3, or 4; each Ra and Rb is, independently, H, a protecting group, hydroxyl, C1-C12 alkyl, substituted C1-C12 alkyl, C2-C12 alkenyl, substituted C2-C12 alkenyl, C2-C12 alkynyl, substituted C2-C12 alkynyl, C5-C20 aryl, substituted C5-C20 aryl, heterocycle radical, substituted heterocycle radical, heteroaryl, substituted heteroaryl, C5-C7 alicyclic radical, substituted C5-C7 alicyclic radical, halogen, OJ1, NJ1J2, SJ1, N3, COOJ1, acyl (C(═O)—H), substituted acyl, CN, sulfonyl (S(═O)2-J1), or sulfoxyl (S(═O)-J1); and

each J1 is, independently, H, C1-C12 alkyl, substituted C1-C12 alkyl, C2-C12 alkenyl, substituted C2-C12 alkenyl, C2-C12 alkynyl, substituted C2-C12 alkynyl, C5-C20 aryl, substituted C5-C20 aryl, acyl (C(═O)—H), substituted acyl, a heterocycle radical, a substituted heterocycle radical, C1-C12 aminoalkyl, substituted C1-C12 aminoalkyl or a protecting group.

In certain embodiments, the bridge of a bicyclic sugar moiety is, —[C(Ra)(Rb)]n—, —[C(Ra)(Rb)]n—O—, —C(RaRb)—N(R)—O— or —C(RaRb)—O—N(R)—. In certain embodiments, the bridge is 4′-CH2-2′, 4′-(CH2)2-2′, 4′-(CH2)3-2′, 4′-CH2—O-2′, 4′-(CH2)2—O-2′, 4′-CH2—O—N(R)-2′ and 4′-CH2—N(R)—O-2′- wherein each R is, independently, H, a protecting group or C1-C12 alkyl.

In certain embodiments, bicyclic nucleosides are further defined by isomeric configuration. For example, a nucleoside comprising a 4′-(CH2)—O-2′ bridge, may be in the α-L configuration or in the β-D configuration. Previously, α-L-methyleneoxy (4′-CH2—O-2) BNA's have been incorporated into antisense oligonucleotides that showed antisense activity (Frieden et al., Nucleic Acids Research, 2003, 21, 6365-6372).

In certain embodiments, bicyclic nucleosides include those having a 4′ to 2′ bridge wherein such bridges include without limitation, α-L-4′-(CH2)—O-2′, β-D-4′-CH2—O-2′, 4′-(CH2)2—O-2′, 4′-CH2—O—N(R)-2′, 4′-CH2—N(R)—O-2′, 4′-CH(CH3)—O-2′, 4′-CH2—S-2′, 4′-CH2—N(R)-2′, 4′-CH2—CH(CH3)-2′, and 4′-(CH2)3-2′, wherein R is H, a protecting group or C1-C12 alkyl.

In certain embodiments, bicyclic nucleosides have the formula:

wherein:

Bx is a heterocyclic base moiety;

-Qa-Qb-Qc- is —CH2—N(Rc)—CH2—, —C(═O)—N(Rc)—CH2—, —CH2—O—N(Rc)—, —CH2—N(Rc)—O— or —N(Rc)—O—CH2;

Rc is C1-C12 alkyl or an amino protecting group; and

Ta and Tb are each, independently H, a hydroxyl protecting group, a conjugate group, a reactive phosphorus group, a phosphorus moiety or a covalent attachment to a support medium.

In certain embodiments, bicyclic nucleosides have the formula:

wherein:

Bx is a heterocyclic base moiety;

Ta and Tb are each, independently H, a hydroxyl protecting group, a conjugate group, a reactive phosphorus group, a phosphorus moiety or a covalent attachment to a support medium;

Za is C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, substituted C1-C6 alkyl, substituted C2-C6 alkenyl, substituted C2-C6 alkynyl, acyl, substituted acyl, substituted amide, thiol or substituted thiol.

In one embodiment, each of the substituted groups, is, independently, mono or poly substituted with substituent groups independently selected from halogen, oxo, hydroxyl, OJc, NJcJd, SJc, N3, OC(═X)Jc, and NJeC(═X)NJcJd, wherein each Jc, Jd and Je is, independently, H, C1-C6 alkyl, or substituted C1-C6 alkyl and X is O or NJc.

In certain embodiments, bicyclic nucleosides have the formula:

wherein:

Bx is a heterocyclic base moiety;

Ta and Tb are each, independently H, a hydroxyl protecting group, a conjugate group, a reactive phosphorus group, a phosphorus moiety or a covalent attachment to a support medium;

Zb is C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, substituted C1-C6 alkyl, substituted C2-C6 alkenyl, substituted C2-C6 alkynyl or substituted acyl (C(═O)—).

In certain embodiments, bicyclic nucleosides have the formula:

wherein:

Bx is a heterocyclic base moiety;

Ta and Tb are each, independently H, a hydroxyl protecting group, a conjugate group, a reactive phosphorus group, a phosphorus moiety or a covalent attachment to a support medium;

Rd is C1-C6 alkyl, substituted C1-C6 alkyl, C2-C6 alkenyl, substituted C2-C6 alkenyl, C2-C6 alkynyl or substituted C2-C6 alkynyl;

    • each qa, qb, qc and qd is, independently, H, halogen, C1-C6 alkyl, substituted C1-C6 alkyl, C2-C6 alkenyl, substituted C2-C6 alkenyl, C2-C6 alkynyl or substituted C2-C6 alkynyl, C1-C6 alkoxyl, substituted C1-C6 alkoxyl, acyl, substituted acyl, C1-C6 aminoalkyl or substituted C1-C6 aminoalkyl;

In certain embodiments, bicyclic nucleosides have the formula:

wherein:

Bx is a heterocyclic base moiety;

Ta and Tb are each, independently H, a hydroxyl protecting group, a conjugate group, a reactive phosphorus group, a phosphorus moiety or a covalent attachment to a support medium;

qa, qb, qc and qf are each, independently, hydrogen, halogen, C1-C12 alkyl, substituted C1-C12 alkyl, C2-C12 alkenyl, substituted C2-C12 alkenyl, C2-C12 alkynyl, substituted C2-C12 alkynyl, C1-C12 alkoxy, substituted C1-C12 alkoxy, OJj, SJj, SOJj, SO2Jj, NJjJk, N3, CN, C(═O)OJj, C(═O)NJjJk, C(═O)Jj, O—C(═O)NJjJk, N(H)C(═NH)NJjJk, N(H)C(═O)NJjJk or N(H)C(═S)NJjJk;

or qe and qf together are ═C(qg)(qh);

qg and qh are each, independently, H, halogen, C1-C12 alkyl or substituted C1-C12 alkyl.

The synthesis and preparation of adenine, cytosine, guanine, 5-methyl-cytosine, thymine and uracil bicyclic nucleosides having a 4′-CH2—O-2′ bridge, along with their oligomerization, and nucleic acid recognition properties have been described (Koshkin et al., Tetrahedron, 1998, 54, 3607-3630). The synthesis of bicyclic nucleosides has also been described in WO 98/39352 and WO 99/14226.

Analogs of various bicyclic nucleosides that have 4′ to 2′ bridging groups such as 4′-CH2—O-2′ and 4′-CH2—S-2′, have also been prepared (Kumar et al., Bioorg. Med. Chem. Lett., 1998, 8, 2219-2222). Preparation of oligodeoxyribonucleotide duplexes comprising bicyclic nucleosides for use as substrates for nucleic acid polymerases has also been described (Wengel et al., WO 99/14226). Furthermore, synthesis of 2′-amino-BNA, a novel conformationally restricted high-affinity oligonucleotide analog has been described in the art (Singh et al., J. Org. Chem., 1998, 63, 10035-10039). In addition, 2′-amino- and 2′-methylamino-BNA's have been prepared and the thermal stability of their duplexes with complementary RNA and DNA strands has been previously reported.

In certain embodiments, bicyclic nucleosides have the formula:

wherein:

Bx is a heterocyclic base moiety;

Ta and Tb are each, independently H, a hydroxyl protecting group, a conjugate group, a reactive phosphorus group, a phosphorus moiety or a covalent attachment to a support medium;

each qi, qj, qk and ql is, independently, H, halogen, C1-C12 alkyl, substituted C1-C12 alkyl, C2-C12 alkenyl, substituted C2-C12 alkenyl, C2-C12 alkynyl, substituted C2-C12 alkynyl, C1-C12 alkoxyl, substituted C1-C12 alkoxyl, OJj, SJj, SOJj, SO2Jj, NJjJk, N3, CN, C(═O)OJj, C(═O)NJjJk, C(═O)Jj, O—C(═O)NJjJk, N(H)C(═NH)NJjJk, N(H)C(═O)NJjJk or N(H)C(═S)NJjJk; and

qi and qj or ql and qk together are ═C(qg)(qh), wherein qg and qh are each, independently, H, halogen, C1-C12 alkyl or substituted C1-C12 alkyl.

One carbocyclic bicyclic nucleoside having a 4′-(CH2)3-2′ bridge and the alkenyl analog bridge 4′-CH═CH—CH2-2′ have been described (Frier et al., Nucleic Acids Research, 1997, 25(22), 4429-4443 and Albaek et al., J. Org. Chem., 2006, 71, 7731-7740). The synthesis and preparation of carbocyclic bicyclic nucleosides along with their oligomerization and biochemical studies have also been described (Srivastava et al., J. Am. Chem. Soc. 2007, 129(26), 8362-8379).

In certain embodiments, bicyclic nucleosides include, but are not limited to, (A) α-L-methyleneoxy (4′-CH2—O-2) BNA, (B) β-D-methyleneoxy (4′-CH2—O-2) BNA, (C) ethyleneoxy (4′-(CH2)2—O-2′) BNA, (D) aminooxy (4′-CH2—O—N(R)-2′) BNA, (E) oxyamino (4′-CH2—N(R)—O-2′) BNA, (F) methyl(methyleneoxy) (4′-CH(CH3)—O-2) BNA (also referred to as constrained ethyl or cEt), (G) methylene-thio (4′-CH2—S-2) BNA, (H) methylene-amino (4′-CH2—N(R)-2) BNA, (I) methyl carbocyclic (4′-CH2—CH(CH3)-2′) BNA, (J) propylene carbocyclic (4′-(CH2)3-2′) BNA, and (K) vinyl BNA as depicted below.

wherein Bx is the base moiety and R is, independently, H, a protecting group, C1-C6 alkyl or C1-C6 alkoxy.

In certain embodiments, nucleosides are modified by replacement of the ribosyl ring with a sugar surrogate. Such modification includes without limitation, replacement of the ribosyl ring with a surrogate ring system (sometimes referred to as DNA analogs) such as a morpholino ring, a cyclohexenyl ring, a cyclohexyl ring or a tetrahydropyranyl ring such as one having one of the formula:

In certain embodiments, sugar surrogates are selected having the formula:

wherein:

Bx is a heterocyclic base moiety;

T3 and T4 are each, independently, an internucleoside linking group linking the tetrahydropyran nucleoside analog to the oligomeric compound or one of T3 and T4 is an internucleoside linking group linking the tetrahydropyran nucleoside analog to an oligomeric compound or oligonucleotide and the other of T3 and T4 is H, a hydroxyl protecting group, a linked conjugate group or a 5′ or 3′-terminal group;

q1, q2, q3, q4, q5, q6 and q7 are each independently, H, C1-C6 alkyl, substituted C1-C6 alkyl, C2-C6 alkenyl, substituted C2-C6 alkenyl, C2-C6 alkynyl or substituted C2-C6 alkynyl; and

one of R1 and R2 is hydrogen and the other is selected from halogen, substituted or unsubstituted alkoxy, NJ1J2, SJ1, N3, OC(═X)J1, OC(═X)NJ1J2, NJ3C(═X)NJ1J2 and CN, wherein X is O, S or NJ1 and each J1, J2 and J3 is, independently, H or C1-C6 alkyl.

In certain embodiments, q1, q2, q3, q4, q5, q6 and q7 are each H. In certain embodiments, at least one of q1, q2, q3, q4, q5, q6 and q7 is other than H. In certain embodiments, at least one of q1, q2, q3, q4, q5, q6 and q7 is methyl. In certain embodiments, THP nucleosides are provided wherein one of R1 and R2 is F. In certain embodiments, R1 is fluoro and R2 is H; R1 is methoxy and R2 is H, and R1 is methoxyethoxy and R2 is H.

Such sugar surrogates include, but are not limited to, what is referred to in the art as hexitol nucleic acid (HNA), altritol nucleic acid (ANA), and mannitol nucleic acid (MNA) (see Leumann, C. J., Bioorg. & Med. Chem., 2002, 10, 841-854).

In certain embodiments, sugar surrogates comprise rings having more than 5 atoms and more than one heteroatom. For example nucleosides comprising morpholino sugar moieties and their use in oligomeric compounds has been reported (see for example: Braasch et al., Biochemistry, 2002, 41, 4503-4510; and U.S. Pat. Nos. 5,698,685; 5,166,315; 5,185,444; and 5,034,506).

As used here, the term “morpholino” means a sugar surrogate having the following structure:

In certain embodiments, morpholinos may be modified, for example by adding or altering various substituent groups from the above morpholino structure. Such sugar surrogates are referred to herein as “modified morpholinos.”

In certain embodiments, antisense compounds comprise one or more modified cyclohexenyl nucleosides, which is a nucleoside having a six-membered cyclohexenyl in place of the pentofuranosyl residue in naturally occurring nucleosides. Modified cyclohexenyl nucleosides include, but are not limited to those described in the art (see for example commonly owned, published PCT Application WO 2010/036696, published on Apr. 10, 2010, Robeyns et al., J. Am. Chem. Soc., 2008, 130(6), 1979-1984; Horváth et al., Tetrahedron Letters, 2007, 48, 3621-3623; Nauwelaerts et al., J. Am. Chem. Soc., 2007, 129(30), 9340-9348; Gu et al. Nucleosides, Nucleotides & Nucleic Acids, 2005, 24(5-7), 993-998; Nauwelaerts et al., Nucleic Acids Research, 2005, 33(8), 2452-2463; Robeyns et al., Acta Crystallographica, Section F: Structural Biology and Crystallization Communications, 2005, F61(6), 585-586; Gu et al., Tetrahedron, 2004, 60(9), 2111-2123; Gu et al., Oligonucleotides, 2003, 13(6), 479-489; Wang et al., J. Org. Chem., 2003, 68, 4499-4505; Verbeure et al., Nucleic Acids Research, 2001, 29(24), 4941-4947; Wang et al., J. Org. Chem., 2001, 66, 8478-82; Wang et al., Nucleosides, Nucleotides & Nucleic Acids, 2001, 20(4-7), 785-788; Wang et al., J. Am. Chem., 2000, 122, 8595-8602; Published PCT application, WO 06/047842; and Published PCT Application WO 01/049687; the text of each is incorporated by reference herein, in their entirety). Certain modified cyclohexenyl nucleosides have the formula:

wherein:

Bx is a heterocyclic base moiety;

T3 and T4 are each, independently, an internucleoside linking group linking the cyclohexenyl nucleoside analog to an antisense compound or one of T3 and T4 is an internucleoside linking group linking the tetrahydropyran nucleoside analog to an antisense compound and the other of T3 and T4 is H, a hydroxyl protecting group, a linked conjugate group, or a 5′- or 3′-terminal group; and q1, q2, q3, q4, q5, q6, q7, q8 and q9 are each, independently, H, C1-C6 alkyl, substituted C1-C6 alkyl, C2-C6 alkenyl, substituted C2-C6 alkenyl, C2-C6 alkynyl, substituted C2-C6 alkynyl or other sugar substituent group.

Many other bicyclic and tricyclic sugar surrogate ring systems are also known in the art that can be used to modify nucleosides for incorporation into antisense compounds (see for example review article: Leumann, Christian J., Bioorg. & Med. Chem., 2002, 10, 841-854). Such ring systems can undergo various additional substitutions to enhance activity.

Methods for the preparations of modified sugars are well known to those skilled in the art. Some representative U.S. patents that teach the preparation of such modified sugars include without limitation, U.S.: 4,981,957; 5,118,800; 5,319,080; 5,359,044; 5,393,878; 5,446,137; 5,466,786; 5,514,785; 5,519,134; 5,567,811; 5,576,427; 5,591,722; 5,597,909; 5,610,300; 5,627,053; 5,639,873; 5,646,265; 5,670,633; 5,700,920; 5,792,847 and 6,600,032 and International Application PCT/US2005/019219, filed Jun. 2, 2005 and published as WO 2005/121371 on Dec. 22, 2005, and each of which is herein incorporated by reference in its entirety.

In nucleotides having modified sugar moieties, the nucleobase moieties (natural, modified or a combination thereof) are maintained for hybridization with an appropriate nucleic acid target.

In certain embodiments, antisense compounds targeted to a DMPK nucleic acid comprise one or more nucleotides having modified sugar moieties. In certain embodiments, the modified sugar moiety is 2′-MOE. In certain embodiments, the 2′-MOE modified nucleotides are arranged in a gapmer motif.

Modified Nucleobases

Nucleobase (or base) modifications or substitutions are structurally distinguishable from, yet functionally interchangeable with, naturally occurring or synthetic unmodified nucleobases. Both natural and modified nucleobases are capable of participating in hydrogen bonding. Such nucleobase modifications can impart nuclease stability, binding affinity or some other beneficial biological property to antisense compounds. Modified nucleobases include synthetic and natural nucleobases such as, for example, 5-methylcytosine (5-me-C). Certain nucleobase substitutions, including 5-methylcytosine substitutions, are particularly useful for increasing the binding affinity of an antisense compound for a target nucleic acid. For example, 5-methylcytosine substitutions have been shown to increase nucleic acid duplex stability by 0.6-1.2° C. (Sanghvi, Y. S., Crooke, S. T. and Lebleu, B., eds., Antisense Research and Applications, CRC Press, Boca Raton, 1993, pp. 276-278).

Additional unmodified nucleobases include 5-hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-halouracil and cytosine, 5-propynyl (—C≡C—CH3) uracil and cytosine and other alkynyl derivatives of pyrimidine bases, 6-azo uracil, cytosine and thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl and other 8-substituted adenines and guanines, 5-halo particularly 5-bromo, 5-trifluoromethyl and other 5-substituted uracils and cytosines, 7-methylguanine and 7-methyladenine, 2-F-adenine, 2-amino-adenine, 8-azaguanine and 8-azaadenine, 7-deazaguanine and 7-deazaadenine and 3-deazaguanine and 3-deazaadenine.

Heterocyclic base moieties can also include those in which the purine or pyrimidine base is replaced with other heterocycles, for example 7-deaza-adenine, 7-deazaguanosine, 2-aminopyridine and 2-pyridone. Nucleobases that are particularly useful for increasing the binding affinity of antisense compounds include 5-substituted pyrimidines, 6-azapyrimidines and N-2, N-6 and 0-6 substituted purines, including 2 aminopropyladenine, 5-propynyluracil and 5-propynylcytosine.

In certain embodiments, antisense compounds targeted to a DMPK nucleic acid comprise one or more modified nucleobases. In certain embodiments, gap-widened antisense oligonucleotides targeted to a DMPK nucleic acid comprise one or more modified nucleobases. In certain embodiments, the modified nucleobase is 5-methylcytosine. In certain embodiments, each cytosine is a 5-methylcytosine.

Certain Antisense Compound Motifs

In certain embodiments, antisense compounds targeted to a DMPK nucleic acid have chemically modified subunits arranged in patterns, or motifs, to confer to the antisense compounds properties such as enhanced the inhibitory activity, increased binding affinity for a target nucleic acid, or resistance to degradation by in vivo nucleases.

Chimeric antisense compounds typically contain at least one region modified so as to confer increased resistance to nuclease degradation, increased cellular uptake, increased binding affinity for the target nucleic acid, and/or increased inhibitory activity. A second region of a chimeric antisense compound can optionally serve as a substrate for the cellular endonuclease RNase H, which cleaves the RNA strand of an RNA:DNA duplex.

Antisense compounds having a gapmer motif are considered chimeric antisense compounds. In a gapmer an internal region having a plurality of nucleotides that supports RNaseH cleavage is positioned between external regions having a plurality of nucleotides that are chemically distinct from the nucleosides of the internal region. In the case of an antisense oligonucleotide having a gapmer motif, the gap segment generally serves as the substrate for endonuclease cleavage, while the wing segments comprise modified nucleosides. In certain embodiments, the regions of a gapmer are differentiated by the types of sugar moieties comprising each distinct region. The types of sugar moieties that are used to differentiate the regions of a gapmer can in some embodiments include β-D-ribonucleosides, β-D-deoxyribonucleosides, 2′-modified nucleosides (such 2′-modified nucleosides can include 2′-MOE, and 2′-O—CH3, among others), and bicyclic sugar modified nucleosides (such bicyclic sugar modified nucleosides can include those having a 4′-(CH2)n—O-2′ bridge, where n=1 or n=2). The wing-gap-wing motif is frequently described as “X—Y—Z”, where “X” represents the length of the 5′ wing region, “Y” represents the length of the gap region, and “Z” represents the length of the 3′ wing region. As used herein, a gapmer described as “X—Y—Z” has a configuration such that the gap segment is positioned immediately adjacent each of the 5′ wing segment and the 3′ wing segment. Thus, no intervening nucleotides exist between the 5′ wing segment and gap segment, or the gap segment and the 3′ wing segment. Any of the antisense compounds described herein can have a gapmer motif. In some embodiments, X and Z are the same, in other embodiments they are different. In a preferred embodiment, Y is between 8 and 15 nucleotides. X, Y or Z can be any of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30 or more nucleotides. Thus, gapmers include, but are not limited to, for example 5-10-5, 4-8-4, 4-12-3, 4-12-4, 3-14-3, 2-β-5, 2-16-2, 1-18-1, 3-10-3, 2-10-2, 1-10-1, 2-8-2, 6-8-6, 5-8-5, 5-7-5, 1-8-1, or 2-6-2.

In certain embodiments, the antisense compound as a “wingmer” motif, having a wing-gap or gap-wing configuration, i.e. an X—Y or Y—Z configuration as described above for the gapmer configuration. Thus, wingmer configurations include, but are not limited to, for example 5-10, 8-4, 4-12, 12-4, 3-14, 16-2, 18-1, 10-3, 2-10, 1-10, 8-2, 2-13, or 5-13.

In certain embodiments, antisense compounds targeted to a DMPK nucleic acid possess a 5-10-5 gapmer motif. In certain embodiments, antisense compounds targeted to a DMPK nucleic acid possess a 5-7-5 gapmer motif. In certain embodiments, antisense compounds targeted to a DMPK nucleic acid possess a 3-10-3 gapmer motif. In certain embodiments, antisense compounds targeted to a DMPK nucleic acid possess a 4-8-4 gapmer motif.

In certain embodiments, an antisense compound targeted to a DMPK nucleic acid has a gap-widened motif.

In certain embodiments, antisense compounds of any of these gapmer or wingmer motifs contain at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, or at least 19, contiguous nucleobases of the nucleobase sequence of any of the exemplary antisense compounds described herein (e.g., at least 8 contiguous nucleobases of a nucleobase sequence recited in any one of SEQ ID NOs: 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33-874.

In certain embodiments, the present invention provides oligomeric compounds comprising oligonucleotides. In certain embodiments, such oligonucleotides comprise one or more chemical modification. In certain embodiments, chemically modified oligonucleotides comprise one or more modified sugars. In certain embodiments, chemically modified oligonucleotides comprise one or more modified nucleobases. In certain embodiments, chemically modified oligonucleotides comprise one or more modified internucleoside linkages. In certain embodiments, the chemically modifications (sugar modifications, nucleobase modifications, and/or linkage modifications) define a pattern or motif. In certain embodiments, the patterns of chemical modifications of sugar moieties, internucleoside linkages, and nucleobases are each independent of one another. Thus, an oligonucleotide may be described by its sugar modification motif, internucleoside linkage motif and/or nucleobase modification motif (as used herein, nucleobase modification motif describes the chemical modifications to the nucleobases independent of the sequence of nucleobases).

Certain Sugar Motifs

In certain embodiments, oligonucleotides comprise one or more type of modified sugar moieties and/or naturally occurring sugar moieties arranged along an oligonucleotide or region thereof in a defined pattern or sugar modification motif. Such motifs may include any of the sugar modifications discussed herein and/or other known sugar modifications.

In certain embodiments, the oligonucleotides comprise or consist of a region having a gapmer sugar modification motif, which comprises two external regions or “wings” and an internal region or “gap.” The three regions of a gapmer motif (the 5′-wing, the gap, and the 3′-wing) form a contiguous sequence of nucleosides wherein at least some of the sugar moieties of the nucleosides of each of the wings differ from at least some of the sugar moieties of the nucleosides of the gap. Specifically, at least the sugar moieties of the nucleosides of each wing that are closest to the gap (the 3′-most nucleoside of the 5′-wing and the 5′-most nucleoside of the 3′-wing) differ from the sugar moiety of the neighboring gap nucleosides, thus defining the boundary between the wings and the gap. In certain embodiments, the sugar moieties within the gap are the same as one another. In certain embodiments, the gap includes one or more nucleoside having a sugar moiety that differs from the sugar moiety of one or more other nucleosides of the gap. In certain embodiments, the sugar modification motifs of the two wings are the same as one another (symmetric gapmer). In certain embodiments, the sugar modification motifs of the 5′-wing differs from the sugar modification motif of the 3′-wing (asymmetric gapmer).

Certain 5′-Wings

In certain embodiments, the 5′-wing of a gapmer consists of 1 to 5 linked nucleosides. In certain embodiments, the 5′-wing of a gapmer consists of 2 to 5 linked nucleosides. In certain embodiments, the 5′-wing of a gapmer consists of 3 to 5 linked nucleosides. In certain embodiments, the 5′-wing of a gapmer consists of 4 or 5 linked nucleosides. In certain embodiments, the 5′-wing of a gapmer consists of 1 to 4 linked nucleosides. In certain embodiments, the 5′-wing of a gapmer consists of 1 to 3 linked nucleosides. In certain embodiments, the 5′-wing of a gapmer consists of 1 or 2 linked nucleosides. In certain embodiments, the 5′-wing of a gapmer consists of 2 to 4 linked nucleosides. In certain embodiments, the 5′-wing of a gapmer consists of 2 or 3 linked nucleosides. In certain embodiments, the 5′-wing of a gapmer consists of 3 or 4 linked nucleosides. In certain embodiments, the 5′-wing of a gapmer consists of 1 nucleoside. In certain embodiments, the 5′-wing of a gapmer consists of 2 linked nucleosides. In certain embodiments, the 5′-wing of a gapmer consists of 3 linked nucleosides. In certain embodiments, the 5′-wing of a gapmer consists of 4 linked nucleosides. In certain embodiments, the 5′-wing of a gapmer consists of 5 linked nucleosides.

In certain embodiments, the 5′-wing of a gapmer comprises at least one bicyclic nucleoside. In certain embodiments, the 5′-wing of a gapmer comprises at least two bicyclic nucleosides. In certain embodiments, the 5′-wing of a gapmer comprises at least three bicyclic nucleosides. In certain embodiments, the 5′-wing of a gapmer comprises at least four bicyclic nucleosides. In certain embodiments, the 5′-wing of a gapmer comprises at least one constrained ethyl nucleoside. In certain embodiments, the 5′-wing of a gapmer comprises at least one LNA nucleoside. In certain embodiments, each nucleoside of the 5′-wing of a gapmer is a bicyclic nucleoside. In certain embodiments, each nucleoside of the 5′-wing of a gapmer is a constrained ethyl nucleoside. In certain embodiments, each nucleoside of the 5′-wing of a gapmer is a LNA nucleoside.

In certain embodiments, the 5′-wing of a gapmer comprises at least one non-bicyclic modified nucleoside. In certain embodiments, the 5′-wing of a gapmer comprises at least one 2′-substituted nucleoside. In certain embodiments, the 5′-wing of a gapmer comprises at least one 2′-MOE nucleoside. In certain embodiments, the 5′-wing of a gapmer comprises at least one 2′-OMe nucleoside. In certain embodiments, each nucleoside of the 5′-wing of a gapmer is a non-bicyclic modified nucleoside. In certain embodiments, each nucleoside of the 5′-wing of a gapmer is a 2′-substituted nucleoside. In certain embodiments, each nucleoside of the 5′-wing of a gapmer is a 2′-MOE nucleoside. In certain embodiments, each nucleoside of the 5′-wing of a gapmer is a 2′-OMe nucleoside.

In certain embodiments, the 5′-wing of a gapmer comprises at least one bicyclic nucleoside and at least one non-bicyclic modified nucleoside. In certain embodiments, the 5′-wing of a gapmer comprises at least one bicyclic nucleoside and at least one 2′-substituted nucleoside. In certain embodiments, the 5′-wing of a gapmer comprises at least one bicyclic nucleoside and at least one 2′-MOE nucleoside. In certain embodiments, the 5′-wing of a gapmer comprises at least one bicyclic nucleoside and at least one 2′-OMe nucleoside. In certain embodiments, the 5′-wing of a gapmer comprises at least one bicyclic nucleoside and at least one 2′-deoxynucleoside.

In certain embodiments, the 5′-wing of a gapmer comprises at least one constrained ethyl nucleoside and at least one non-bicyclic modified nucleoside. In certain embodiments, the 5′-wing of a gapmer comprises at least one constrained ethyl nucleoside and at least one 2′-substituted nucleoside. In certain embodiments, the 5′-wing of a gapmer comprises at least one constrained ethyl nucleoside and at least one 2′-MOE nucleoside. In certain embodiments, the 5′-wing of a gapmer comprises at least one constrained ethyl nucleoside and at least one 2′-OMe nucleoside. In certain embodiments, the 5′-wing of a gapmer comprises at least one constrained ethyl nucleoside and at least one 2′-deoxynucleoside.

In certain embodiments, the 5′-wing of a gapmer comprises at least one LNA nucleoside and at least one non-bicyclic modified nucleoside. In certain embodiments, the 5′-wing of a gapmer comprises at least one LNA nucleoside and at least one 2′-substituted nucleoside. In certain embodiments, the 5′-wing of a gapmer comprises at least one LNA nucleoside and at least one 2′-MOE nucleoside. In certain embodiments, the 5′-wing of a gapmer comprises at least one LNA nucleoside and at least one 2′-OMe nucleoside. In certain embodiments, the 5′-wing of a gapmer comprises at least one LNA nucleoside and at least one 2′-deoxynucleoside.

In certain embodiments, the 5′-wing of a gapmer comprises three constrained ethyl nucleosides. In certain embodiments, the 5′-wing of a gapmer comprises two bicyclic nucleosides and two non bicyclic modified nucleosides. In certain embodiments, the 5′-wing of a gapmer comprises two constrained ethyl nucleosides and two 2′-MOE nucleosides. In certain embodiments, the 5′-wing of a gapmer comprises two bicyclic nucleosides and two non bicyclic modified nucleosides. In certain embodiments, the 5′-wing of a gapmer comprises two constrained ethyl nucleosides and two 2′-MOE nucleosides. In certain embodiments, the 5′-wing of a gapmer comprises two constrained ethyl nucleosides and three 2′-MOE nucleosides.

In certain embodiments, the 5′-wing of a gapmer comprises three LNA nucleosides. In certain embodiments, the 5′-wing of a gapmer comprises two LNAnucleosides and two non bicyclic modified nucleosides. In certain embodiments, the 5′-wing of a gapmer comprises two LNA nucleosides and two 2′-MOE nucleosides. In certain embodiments, the 5′-wing of a gapmer comprises two LNA and two non bicyclic modified nucleosides. In certain embodiments, the 5′-wing of a gapmer comprises two LNA nucleosides and two 2′-MOE nucleosides. In certain embodiments, the 5′-wing of a gapmer comprises two LNA nucleosides and three 2′-MOE nucleosides.

In certain embodiments, the 5′-wing of a gapmer comprises three constrained ethyl nucleosides. In certain embodiments, the 5′-wing of a gapmer comprises two bicyclic nucleosides and two non bicyclic modified nucleosides. In certain embodiments, the 5′-wing of a gapmer comprises two constrained ethyl nucleosides and two 2′-OMe nucleosides. In certain embodiments, the 5′-wing of a gapmer comprises two bicyclic nucleosides and two non bicyclic modified nucleosides. In certain embodiments, the 5′-wing of a gapmer comprises two constrained ethyl nucleosides and two 2′-OMe nucleosides. In certain embodiments, the 5′-wing of a gapmer comprises two constrained ethyl nucleosides and three 2′-OMe nucleosides.

In certain embodiments, the 5′-wing of a gapmer comprises three LNA nucleosides. In certain embodiments, the 5′-wing of a gapmer comprises two LNAnucleosides and two non bicyclic modified nucleosides. In certain embodiments, the 5′-wing of a gapmer comprises two LNA nucleosides and two 2′-OMe nucleosides. In certain embodiments, the 5′-wing of a gapmer comprises two LNA and two non bicyclic modified nucleosides. In certain embodiments, the 5′-wing of a gapmer comprises two LNA nucleosides and two 2′-OMe nucleosides. In certain embodiments, the 5′-wing of a gapmer comprises two LNA nucleosides and three 2′-OMe nucleosides.

In certain embodiments, the 5′-wing of a gapmer has an AABB motif, wherein each A is selected from among a 2′-MOE nucleoside and a 2′OMe nucleoside. In certain embodiments, the 5′-wing of a gapmer has an AABB motif, wherein each B is selected from among a cEt, LNA, α-L-LNA, ENA and 2′-thio LNA nucleoside. In certain embodiments, the 5′-wing of a gapmer has an AABB motif, wherein each A represents a 2′-MOE nucleoside and each B represents a constrained ethyl nucleoside.

In certain embodiments, the 5′-wing of a gapmer has an AAABB motif, wherein each A is selected from among a 2′-MOE nucleoside and a 2′OMe nucleoside. In certain embodiments, the 5′-wing of a gapmer has an AABB motif, wherein each B is selected from among a cEt, LNA, α-L-LNA, ENA and 2′-thio LNA nucleoside. In certain embodiments, the 5′-wing of a gapmer has an AABB motif, wherein each A represents a 2′-MOE nucleoside and each B represents a constrained ethyl nucleoside.

Certain 3′-Wings

In certain embodiments, the 3′-wing of a gapmer consists of 1 to 5 linked nucleosides. In certain embodiments, the 3′-wing of a gapmer consists of 2 to 5 linked nucleosides. In certain embodiments, the 3′-wing of a gapmer consists of 3 to 5 linked nucleosides. In certain embodiments, the 3′-wing of a gapmer consists of 4 or 5 linked nucleosides. In certain embodiments, the 3′-wing of a gapmer consists of 1 to 4 linked nucleosides. In certain embodiments, the 3′-wing of a gapmer consists of 1 to 3 linked nucleosides. In certain embodiments, the 3′-wing of a gapmer consists of 1 or 2 linked nucleosides. In certain embodiments, the 3′-wing of a gapmer consists of 2 to 4 linked nucleosides. In certain embodiments, the 3′-wing of a gapmer consists of 2 or 3 linked nucleosides. In certain embodiments, the 3′-wing of a gapmer consists of 3 or 4 linked nucleosides. In certain embodiments, the 3′-wing of a gapmer consists of 1 nucleoside. In certain embodiments, the 3′-wing of a gapmer consists of 2 linked nucleosides. In certain embodiments, the 3′-wing of a gapmer consists of 3 linked nucleosides. In certain embodiments, the 3′-wing of a gapmer consists of 4 linked nucleosides. In certain embodiments, the 3′-wing of a gapmer consists of 5 linked nucleosides.

In certain embodiments, the 3′-wing of a gapmer comprises at least one bicyclic nucleoside. In certain embodiments, the 3′-wing of a gapmer comprises at least one constrained ethyl nucleoside. In certain embodiments, the 3′-wing of a gapmer comprises at least one LNA nucleoside. In certain embodiments, each nucleoside of the 3′-wing of a gapmer is a bicyclic nucleoside. In certain embodiments, each nucleoside of the 3′-wing of a gapmer is a constrained ethyl nucleoside. In certain embodiments, each nucleoside of the 3′-wing of a gapmer is a LNA nucleoside.

In certain embodiments, the 3′-wing of a gapmer comprises at least one non-bicyclic modified nucleoside. In certain embodiments, the 3′-wing of a gapmer comprises at least two non-bicyclic modified nucleosides. In certain embodiments, the 3′-wing of a gapmer comprises at least three non-bicyclic modified nucleosides. In certain embodiments, the 3′-wing of a gapmer comprises at least four non-bicyclic modified nucleosides. In certain embodiments, the 3′-wing of a gapmer comprises at least one 2′-substituted nucleoside. In certain embodiments, the 3′-wing of a gapmer comprises at least one 2′-MOE nucleoside. In certain embodiments, the 3′-wing of a gapmer comprises at least one 2′-OMe nucleoside. In certain embodiments, each nucleoside of the 3′-wing of a gapmer is a non-bicyclic modified nucleoside. In certain embodiments, each nucleoside of the 3′-wing of a gapmer is a 2′-substituted nucleoside. In certain embodiments, each nucleoside of the 3′-wing of a gapmer is a 2′-MOE nucleoside. In certain embodiments, each nucleoside of the 3′-wing of a gapmer is a 2′-OMe nucleoside.

In certain embodiments, the 3′-wing of a gapmer comprises at least one bicyclic nucleoside and at least one non-bicyclic modified nucleoside. In certain embodiments, the 3′-wing of a gapmer comprises at least one bicyclic nucleoside and at least one 2′-substituted nucleoside. In certain embodiments, the 3′-wing of a gapmer comprises at least one bicyclic nucleoside and at least one 2′-MOE nucleoside. In certain embodiments, the 3′-wing of a gapmer comprises at least one bicyclic nucleoside and at least one 2′-OMe nucleoside. In certain embodiments, the 3′-wing of a gapmer comprises at least one bicyclic nucleoside and at least one 2′-deoxynucleoside.

In certain embodiments, the 3′-wing of a gapmer comprises at least one constrained ethyl nucleoside and at least one non-bicyclic modified nucleoside. In certain embodiments, the 3′-wing of a gapmer comprises at least one constrained ethyl nucleoside and at least one 2′-substituted nucleoside. In certain embodiments, the 3′-wing of a gapmer comprises at least one constrained ethyl nucleoside and at least one 2′-MOE nucleoside. In certain embodiments, the 3′-wing of a gapmer comprises at least one constrained ethyl nucleoside and at least one 2′-OMe nucleoside. In certain embodiments, the 3′-wing of a gapmer comprises at least one constrained ethyl nucleoside and at least one 2′-deoxynucleoside.

In certain embodiments, the 3′-wing of a gapmer comprises at least one LNA nucleoside and at least one non-bicyclic modified nucleoside. In certain embodiments, the 3′-wing of a gapmer comprises at least one LNA nucleoside and at least one 2′-substituted nucleoside. In certain embodiments, the 3′-wing of a gapmer comprises at least one LNA nucleoside and at least one 2′-MOE nucleoside. In certain embodiments, the 3′-wing of a gapmer comprises at least one LNA nucleoside and at least one 2′-OMe nucleoside. In certain embodiments, the 3′-wing of a gapmer comprises at least one LNA nucleoside and at least one 2′-deoxynucleoside.

In certain embodiments, the 3′-wing of a gapmer comprises three constrained ethyl nucleosides. In certain embodiments, the 3′-wing of a gapmer comprises two bicyclic nucleosides and two non bicyclic modified nucleosides. In certain embodiments, the 3′-wing of a gapmer comprises two constrained ethyl nucleosides and two 2′-MOE nucleosides. In certain embodiments, the 3′-wing of a gapmer comprises two bicyclic nucleosides and two non bicyclic modified nucleosides. In certain embodiments, the 3′-wing of a gapmer comprises two constrained ethyl nucleosides and two 2′-MOE nucleosides. In certain embodiments, the 5′-wing of a gapmer comprises two constrained ethyl nucleosides and three 2′-MOE nucleosides.

In certain embodiments, the 3′-wing of a gapmer comprises three LNA nucleosides. In certain embodiments, the 3′-wing of a gapmer comprises two LNAnucleosides and two non bicyclic modified nucleosides. In certain embodiments, the 3′-wing of a gapmer comprises two LNA nucleosides and two 2′-MOE nucleosides. In certain embodiments, the 3′-wing of a gapmer comprises two LNA and two non bicyclic modified nucleosides. In certain embodiments, the 3′-wing of a gapmer comprises two LNA nucleosides and two 2′-MOE nucleosides. In certain embodiments, the 3′-wing of a gapmer comprises two LNA nucleosides and three 2′-MOE nucleosides.

In certain embodiments, the 3′-wing of a gapmer comprises three constrained ethyl nucleosides. In certain embodiments, the 3′-wing of a gapmer comprises two bicyclic nucleosides and two non bicyclic modified nucleosides. In certain embodiments, the 3′-wing of a gapmer comprises two constrained ethyl nucleosides and two 2′-OMe nucleosides. In certain embodiments, the 3′-wing of a gapmer comprises two bicyclic nucleosides and two non bicyclic modified nucleosides. In certain embodiments, the 3′-wing of a gapmer comprises two constrained ethyl nucleosides and two 2′-OMe nucleosides. In certain embodiments, the 3′-wing of a gapmer comprises two constrained ethyl nucleosides and three 2′-OMe nucleosides.

In certain embodiments, the 3′-wing of a gapmer comprises three LNA nucleosides. In certain embodiments, the 3′-wing of a gapmer comprises two LNAnucleosides and two non bicyclic modified nucleosides. In certain embodiments, the 3′-wing of a gapmer comprises two LNA nucleosides and two 2′-OMe nucleosides. In certain embodiments, the 3′-wing of a gapmer comprises two LNA and two non bicyclic modified nucleosides. In certain embodiments, the 3′-wing of a gapmer comprises two LNA nucleosides and two 2′-OMe nucleosides. In certain embodiments, the 3′-wing of a gapmer comprises two LNA nucleosides and three 2′-OMe nucleosides.

In certain embodiments, the 3′-wing of a gapmer has a BBAA motif, wherein each A is selected from among a 2′-MOE nucleoside and a 2′OMe nucleoside. In certain embodiments, the 3′-wing of a gapmer has an BBAA motif, wherein each B is selected from among a cEt, LNA, α-L-LNA, ENA and 2′-thio LNA nucleoside. In certain embodiments, the 3′-wing of a gapmer has a BBAA motif, wherein each A represents a 2′-MOE nucleoside and each B represents a constrained ethyl nucleoside.

In certain embodiments, the 3′-wing of a gapmer has a BBAAA motif, wherein each A is selected from among a 2′-MOE nucleoside and a 2′OMe nucleoside. In certain embodiments, the 3′-wing of a gapmer has a BBAA motif, wherein each B is selected from among a cEt, LNA, α-L-LNA, ENA and 2′-thio LNA nucleoside. In certain embodiments, the 3′-wing of a gapmer has a BBAA motif, wherein each A represents a 2′-MOE nucleoside and each B represents a constrained ethyl nucleoside.

Compositions and Methods for Formulating Pharmaceutical Compositions

Antisense oligonucleotides can be admixed with pharmaceutically acceptable active or inert substance for the preparation of pharmaceutical compositions or formulations. Compositions and methods for the formulation of pharmaceutical compositions are dependent upon a number of criteria, including, but not limited to, route of administration, extent of disease, or dose to be administered.

Antisense compound targeted to a DMPK nucleic acid can be utilized in pharmaceutical compositions by combining the antisense compound with a suitable pharmaceutically acceptable diluent or carrier. A pharmaceutically acceptable diluent includes phosphate-buffered saline (PBS). PBS is a diluent suitable for use in compositions to be delivered parenterally. Accordingly, in one embodiment, employed in the methods described herein is a pharmaceutical composition comprising an antisense compound targeted to a DMPK nucleic acid and a pharmaceutically acceptable diluent. In certain embodiments, the pharmaceutically acceptable diluent is PBS. In certain embodiments, the antisense compound is an antisense oligonucleotide.

Pharmaceutical compositions comprising antisense compounds encompass any pharmaceutically acceptable salts, esters, or salts of such esters, or any other oligonucleotide which, upon administration to an animal, including a human, is capable of providing (directly or indirectly) the biologically active metabolite or residue thereof. Accordingly, for example, the disclosure is also drawn to pharmaceutically acceptable salts of antisense compounds, prodrugs, pharmaceutically acceptable salts of such prodrugs, and other bioequivalents. Suitable pharmaceutically acceptable salts include, but are not limited to, sodium and potassium salts.

A prodrug can include the incorporation of additional nucleosides at one or both ends of an antisense compound which are cleaved by endogenous nucleases within the body, to form the active antisense compound.

Conjugated Antisense Compounds

Antisense compounds can be covalently linked to one or more moieties or conjugates which enhance the activity, cellular distribution or cellular uptake of the resulting antisense oligonucleotides. Typical conjugate groups include cholesterol moieties and lipid moieties. Additional conjugate groups include carbohydrates, phospholipids, biotin, phenazine, folate, phenanthridine, anthraquinone, acridine, fluoresceins, rhodamines, coumarins, and dyes.

Antisense compounds can also be modified to have one or more stabilizing groups that are generally attached to one or both termini of antisense compounds to enhance properties such as, for example, nuclease stability. Included in stabilizing groups are cap structures. These terminal modifications protect the antisense compound having terminal nucleic acid from exonuclease degradation, and can help in delivery and/or localization within a cell. The cap can be present at the 5′-terminus (5′-cap), or at the 3′-terminus (3′-cap), or can be present on both termini. Cap structures are well known in the art and include, for example, inverted deoxy abasic caps. Further 3′ and 5′-stabilizing groups that can be used to cap one or both ends of an antisense compound to impart nuclease stability include those disclosed in WO 03/004602 published on Jan. 16, 2003.

Cell Culture and Antisense Compounds Treatment

The effects of antisense compounds on the level, activity or expression of DMPK nucleic acids can be tested in vitro in a variety of cell types. Cell types used for such analyses are available from commercial vendors (e.g. American Type Culture Collection, Manassas, Va.; Zen-Bio, Inc., Research Triangle Park, N.C.; Clonetics Corporation, Walkersville, Md.) and cells are cultured according to the vendor's instructions using commercially available reagents (e.g. Invitrogen Life Technologies, Carlsbad, Calif.). Illustrative cell types include, but are not limited to, HepG2 cells, Hep3B cells, primary hepatocytes, A549 cells, GM04281 fibroblasts and LLC-MK2 cells.

In Vitro Testing of Antisense Oligonucleotides

Described herein are methods for treatment of cells with antisense oligonucleotides, which can be modified appropriately for treatment with other antisense compounds.

In general, cells are treated with antisense oligonucleotides when the cells reach approximately 60-80% confluence in culture.

One reagent commonly used to introduce antisense oligonucleotides into cultured cells includes the cationic lipid transfection reagent LIPOFECTIN® (Invitrogen, Carlsbad, Calif.). Antisense oligonucleotides are mixed with LIPOFECTIN® in OPTI-MEM® 1 (Invitrogen, Carlsbad, Calif.) to achieve the desired final concentration of antisense oligonucleotide and a LIPOFECTIN® concentration that typically ranges 2 to 12 ug/mL per 100 nM antisense oligonucleotide.

Another reagent used to introduce antisense oligonucleotides into cultured cells includes LIPOFECTAMINE 2000® (Invitrogen, Carlsbad, Calif.). Antisense oligonucleotide is mixed with LIPOFECTAMINE 2000® in OPTI-MEM® 1 reduced serum medium (Invitrogen, Carlsbad, Calif.) to achieve the desired concentration of antisense oligonucleotide and a LIPOFECTAMINE® concentration that typically ranges 2 to 12 ug/mL per 100 nM antisense oligonucleotide.

Another reagent used to introduce antisense oligonucleotides into cultured cells includes Cytofectin® (Invitrogen, Carlsbad, Calif.). Antisense oligonucleotide is mixed with Cytofectin® in OPTI-MEM® 1 reduced serum medium (Invitrogen, Carlsbad, Calif.) to achieve the desired concentration of antisense oligonucleotide and a Cytofectin® concentration that typically ranges 2 to 12 ug/mL per 100 nM antisense oligonucleotide.

Another technique used to introduce antisense oligonucleotides into cultured cells includes electroporation.

Cells are treated with antisense oligonucleotides by routine methods. Cells are typically harvested 16-24 hours after antisense oligonucleotide treatment, at which time RNA or protein levels of target nucleic acids are measured by methods known in the art and described herein. In general, when treatments are performed in multiple replicates, the data are presented as the average of the replicate treatments.

The concentration of antisense oligonucleotide used varies from cell line to cell line. Methods to determine the optimal antisense oligonucleotide concentration for a particular cell line are well known in the art. Antisense oligonucleotides are typically used at concentrations ranging from 1 nM to 300 nM when transfected with LIPOFECTAMINE2000®, Lipofectin or Cytofectin. Antisense oligonucleotides are used at higher concentrations ranging from 625 to 20,000 nM when transfected using electroporation.

RNA Isolation

RNA analysis can be performed on total cellular RNA or poly(A)+mRNA. Methods of RNA isolation are well known in the art. RNA is prepared using methods well known in the art, for example, using the TRIZOL® Reagent (Invitrogen, Carlsbad, Calif.) according to the manufacturer's recommended protocols.

Analysis of Inhibition of Target Levels or Expression

Inhibition of levels or expression of a DMPK nucleic acid can be assayed in a variety of ways known in the art. For example, target nucleic acid levels can be quantitated by, e.g., Northern blot analysis, competitive polymerase chain reaction (PCR), or quantitaive real-time PCR. RNA analysis can be performed on total cellular RNA or poly(A)+mRNA. Methods of RNA isolation are well known in the art. Northern blot analysis is also routine in the art. Quantitative real-time PCR can be conveniently accomplished using the commercially available ABI PRISM® 7600, 7700, or 7900 Sequence Detection System, available from PE-Applied Biosystems, Foster City, Calif. and used according to manufacturer's instructions.

Quantitative Real-Time PCR Analysis of Target RNA Levels

Quantitation of target RNA levels can be accomplished by quantitative real-time PCR using the ABI PRISM® 7600, 7700, or 7900 Sequence Detection System (PE-Applied Biosystems, Foster City, Calif.) according to manufacturer's instructions. Methods of quantitative real-time PCR are well known in the art.

Prior to real-time PCR, the isolated RNA is subjected to a reverse transcriptase (RT) reaction, which produces complementary DNA (cDNA) that is then used as the substrate for the real-time PCR amplification. The RT and real-time PCR reactions are performed sequentially in the same sample well. RT and real-time PCR reagents are obtained from Invitrogen (Carlsbad, Calif.). RT, real-time-PCR reactions are carried out by methods well known to those skilled in the art.

Gene (or RNA) target quantities obtained by real time PCR are normalized using either the expression level of a gene whose expression is constant, such as cyclophilin A, or by quantifying total RNA using RIBOGREEN® (Invitrogen, Inc. Carlsbad, Calif.). Cyclophilin A expression is quantified by real time PCR, by being run simultaneously with the target, multiplexing, or separately. Total RNA is quantified using RIBOGREEN® RNA quantification reagent (Invitrogen, Inc. Eugene, Oreg.). Methods of RNA quantification by RIBOGREEN® are taught in Jones, L. J., et al, (Analytical Biochemistry, 1998, 265, 368-374). A CYTOFLUOR® 4000 instrument (PE Applied Biosystems) is used to measure RIBOGREEN® fluorescence.

Probes and primers are designed to hybridize to a DMPK nucleic acid. Methods for designing real-time PCR probes and primers are well known in the art, and can include the use of software such as PRIMER EXPRESS® Software (Applied Biosystems, Foster City, Calif.).

Analysis of Protein Levels

Antisense inhibition of DMPK nucleic acids can be assessed by measuring DMPK protein levels. Protein levels of DMPK can be evaluated or quantitated in a variety of ways well known in the art, such as immunoprecipitation, Western blot analysis (immunoblotting), enzyme-linked immunosorbent assay (ELISA), quantitative protein assays, protein activity assays (for example, caspase activity assays), immunohistochemistry, immunocytochemistry or fluorescence-activated cell sorting (FACS). Antibodies directed to a target can be identified and obtained from a variety of sources, such as the MSRS catalog of antibodies (Aerie Corporation, Birmingham, Mich.), or can be prepared via conventional monoclonal or polyclonal antibody generation methods well known in the art.

In Vivo Testing of Antisense Compounds

Antisense compounds, for example, antisense oligonucleotides, are tested in animals to assess their ability to inhibit expression of DMPK and produce phenotypic changes. Testing can be performed in normal animals, or in experimental disease models, for example, the HSALR mouse model of myotonic dystrophy (DM1).

The HSALR mouse model is an established model for DM1 (Mankodi, A. et al. Science. 289: 1769, 2000). The mice carry a human skeletal actin (hACTA1) transgene with 220 CTG repeats inserted in the 3′ UTR of the gene. The hACTA1-CUGexp transcript accumulates in nuclear foci in skeletal muscles and results in myotonia similar to that in human DM1 (Mankodi, A. et al. Mol. Cell 10: 35, 2002; Lin, X. et al. Hum. Mol. Genet. 15: 2087, 2006). Hence, it is expected that amelioration of DM1 symptoms in the HSALR mouse by antisense inhibition of the hACTA1 transgene would predict amelioration of similar symptoms in human patients by antisense inhibition of the DMPK transcript.

Expression of CUGexp RNA in mice causes extensive remodeling of the muscle transcriptome, much of which is reproduced by ablation of MBNL1. Hence, it is expected that normalization of the transcriptome in HSALR mice would predict normalization of the human transcriptome in DM1 patients by antisense inhibition of the DMPK transcript.

For administration to animals, antisense oligonucleotides are formulated in a pharmaceutically acceptable diluent, such as phosphate-buffered saline. Administration includes parenteral routes of administration. Following a period of treatment with antisense oligonucleotides, RNA is isolated from tissue and changes in DMPK nucleic acid expression are measured. Changes in DMPK protein levels are also measured.

Splicing

Myotonic dystrophy (DM1) is caused by CTG repeat expansions in the 3′ untranslated region of the DMPK gene (Brook, J. D. et al. Cell. 68: 799, 1992). This mutation leads to RNA dominance, a process in which expression of RNA containing an expanded CUG repeat (CUGexp) induces cell dysfunction (Osborne R J and Thornton C A., Human Molecular Genetics., 2006, 15(2): R162-R169). Such CUGexp are retained in the nuclear foci of skeletal muscles (Davis, B. M. et al. Proc. Natl. Acad. Sci. U.S.A. 94:7388, 1997). The accumulation of CUGexp in the nuclear foci leads to the sequestration of poly(CUG)-binding proteins, such as, Muscleblind-like 1 (MBLN1) (Miller, J. W. et al. EMBO J. 19: 4439, 2000). MBLN1 is a splicing factor and regulates the splicing of genes such as Serca1, CIC-1, Titin, and Zasp. Therefore, sequestration of MBLN1 by CUGexp triggers misregulated alternative splicing of the exons of genes that MBLN1 normally controls (Lin, X. et al. Hum. Mol. Genet. 15: 2087, 2006). Correction of alternative splicing in an animal displaying such disregulation, such as, for example, in a DM1 patient and the HSALR mouse model, is a useful indicator for the efficacy of a treatment, including treatment with an antisense oligonucleotide.

Certain Antisense Mechanisms

Myotonic dystrophy (DM1) is caused by CTG repeat expansions in the 3′ untranslated region of the DMPK gene. In certain embodiments, expansions in the 3′ untranslated region of the DMPK gene results in the transcription of RNA containing an expanded CUG repeat, and RNA containing an expanded CUG repeat (CUGexp) is retained in the nuclear foci of skeletal muscles. In certain instances, the cellular machinery responsible for exporting mRNA from the nucleus into the cytoplasm does not export RNA containing an expanded CUG repeat from the nucleus or does so less efficiently. In certain embodiments, cells do not export DMPK CUGexp mRNA from the nucleus or such export is reduced. Accordingly, in certain embodiments, DMPK CUGexp mRNA accumulates in the nucleus. In certain embodiments, more copies of DMPK CUGexp mRNA are present in the nucleus of a cell than are copies of wild-type DMPK mRNA, which is exported normally. In such embodiments, antisense compounds that reduce target in the nucleus will preferentially reduce mutant DMPK CUGexp mRNA relative to wild type DMPK mRNA, due to their relative abundences in the nucleus, even if the antisense compound does not otherwise distinguish between mutant and wild type. Since RNase H dependent antisense compounds are active in the nucleus, such compounds are particularly well suited for such use.

In certain instances, wild-type DMPK pre-mRNA and mutant CUGexp DMPK pre-mRNA are expected to be processed into mRNA at similar rate. Accordingly, approximately the same amount of wild-type DMPK pre-mRNA and mutant CUGexp DMPK pre-mRNA are expected to be present in the nucleus of a cell. However, after proceesing, wild type DMPK mRNA is exported from the nucleus relatively quickly, and mutant CUGexp DMPK mRNA is exported slowly or not at all. In certan such embodiments, mutant CUGexp DMPK mRNA accumulates in the nucleus in greater amounts than wild-type DMPK mRNA. In certain such embodiments, an antisense oligonucleotide targeted to the mRNA, will preferentially reduce the expression of the mutant CUGexp DMPK mRNA compared to the wild-type DMPK mRNA because more copies of the mutant CUGexp DMPK mRNA are present in the nucleus of the cell. In certain embodiments, antisense compounds targeted to pre-mRNA and not mRNA (e.g., targeting an intron) are not expected to preferentially reduce mutant DMPK relative to wild type, because the nuclear abundance of the two pre-mRNAs is likely to be similar. In certain embodiments, antisense compounds described herein are not targeted to introns of DMPK pre-mRNA. In certain embodiments, antisense compounds described herein are targeted to exons or exon-exon junctions present in DMPK mRNA. In certain embodiments, use of an antisense oligonucleotide to target the mRNA is therefore preferred because an antisense oligonucleotide having one or more features described herein (i) has activity in the nucleus of a cell and (2) will preferentially reduce mutant CUGexp DMPK mRNA compared to wild-type DMPK mRNA.

Certain Biomarkers

DM1 severity in mouse models is determined, at least in part, by the level of CUGexp transcript accumulation in the nucleus or nuclear foci. A useful physiological marker for DM1 severity is the development of high-frequency runs of involuntary action potentials (myotonia).

Certain Indications

In certain embodiments, provided herein are methods of treating an individual comprising administering one or more pharmaceutical compositions as described herein. In certain embodiments, the individual has type 1 myotonic dystrophy (DM1).

Accordingly, provided herein are methods for ameliorating a symptom associated with type 1 myotonic dystrophy in a subject in need thereof. In certain embodiments, provided is a method for reducing the rate of onset of a symptom associated with type 1 myotonic dystrophy. In certain embodiments, provided is a method for reducing the severity of a symptom associated with type 1 myotonic dystrophy. In certain embodiments, symptoms associated with DM1 include muscle stiffness, myotonia, disabling distal weakness, weakness in face and jaw muscles, difficulty in swallowing, drooping of the eyelids (ptosis), weakness of neck muscles, weakness in arm and leg muscles, persistent muscle pain, hypersomnia, muscle wasting, dysphagia, respiratory insufficiency, irregular heartbeat, heart muscle damage, apathy, insulin resistance, and cataracts. In children, the symptoms may also be developmental delays, learning problems, language and speech issues, and personality development issues.

In certain embodiments, the methods comprise administering to an individual in need thereof a therapeutically effective amount of a compound targeted to a DMPK nucleic acid.

In certain embodiments, administration of an antisense compound targeted to a DMPK nucleic acid results in reduction of DMPK expression by at least about 15%, by at least about 20%, by at least about 25%, by at least about 30%, by at least about 35%, by at least about 40%, by at least about 45%, by at least about 50%, by at least about 55%, by at least about 60%, by least about 65%, by least about 70%, by least about 75%, by least about 80%, by at least about 85%, by at least about 90%, by at least about 95% or by at least about 99%, or a range defined by any two of these values.

In certain embodiments, pharmaceutical compositions comprising an antisense compound targeted to DMPK are used for the preparation of a medicament for treating a patient suffering or susceptible to type 1 myotonic dystrophy.

In certain embodiments, the methods described herein include administering a compound comprising a modified oligonucleotide having a contiguous nucleobases portion as described herein of a sequence recited in SEQ ID NOs: 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33-874.

Administration

In certain embodiments, the compounds and compositions as described herein are administered parenterally.

In certain embodiments, parenteral administration is by infusion. Infusion can be chronic or continuous or short or intermittent. In certain embodiments, infused pharmaceutical agents are delivered with a pump. In certain embodiments, parenteral administration is by injection (e.g., bolus injection). The injection can be delivered with a syringe.

Parenteral administration includes subcutaneous administration, intravenous administration, intramuscular administration, intraarterial administration, intraperitoneal administration, or intracranial administration, e.g., intrathecal or intracerebroventricular administration. Administration can be continuous, or chronic, or short, or intermittent.

In certain embodiments, the administering is subcutaneous, intravenous, intracerebral, intracerebroventricular, intrathecal or another administration that results in a systemic effect of the oligonucleotide (systemic administration is characterized by a systemic effect, i.e., an effect in more than one tissue) or delivery to the CNS or to the CSF.

The duration of action as measured by inhibition of alpha 1 actin and reduction of myotonia in the HSALR mouse model of DM1 is prolonged in muscle tissue including quadriceps, gastrocnemius, and the tibialis anterior (see Examples, below). Subcutaneous injections of antisense oligonucleotide for 4 weeks results in inhibition of alpha 1 actin by at least 70% in quadriceps, gastrocnemius, and the tibialis anterior in HSALR mice for at least 11 weeks (77 days) after termination of dosing. Subcutaneous injections of antisense oligonucleotide for 4 weeks results in elimination of myotonia in quadriceps, gastrocnemius, and the tibialis anterior in HSALR mice for at least 11 weeks (77 days) after termination of dosing.

In certain embodiments, delivery of a compound of composition, as described herein, results in at least 70% down-regulation of a target mRNA and/or target protein for at least 77 days. In certain embodiments, delivery of a compound or composition, as described herein, results in 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% down-regulation of a target mRNA and/or target protein for at least 30 days, at least 35 days, at least 40 days, at least 45 days, at least 50 days, at least 55 days, at least 60 days, at least 65 days, at least 70 days, at least 75 days, at least 76 days, at least 77 days, at least 78 days, at least 79 days, at least 80 days, at least 85 days, at least 90 days, at least 95 days, at least 100 days, at least 105 days, at least 110 days, at least 115 days, at least 120 days, at least 1 year.

In certain embodiments, an antisense oligonucleotide is delivered by injection or infusion once every 77 days. In certain embodiments, an antisense oligonucleotide is delivered by injection or infusion once every month, every two months, every three months, every 6 months, twice a year or once a year.

Certain Combination Therapies

In certain embodiments, a first agent comprising the modified oligonucleotide of the invention is co-administered with one or more secondary agents. In certain embodiments, such second agents are designed to treat the same type 1 myotonic dystrophy as the first agent described herein. In certain embodiments, such second agents are designed to treat a different disease, disorder, or condition as the first agent described herein. In certain embodiments, such second agents are designed to treat an undesired side effect of one or more pharmaceutical compositions as described herein. In certain embodiments, second agents are co-administered with the first agent to treat an undesired effect of the first agent. In certain embodiments, second agents are co-administered with the first agent to produce a combinational effect. In certain embodiments, second agents are co-administered with the first agent to produce a synergistic effect.

In certain embodiments, a first agent and one or more second agents are administered at the same time. In certain embodiments, the first agent and one or more second agents are administered at different times. In certain embodiments, the first agent and one or more second agents are prepared together in a single pharmaceutical formulation. In certain embodiments, the first agent and one or more second agents are prepared separately.

Certain Comparator Compounds

In certain embodiments, the compounds disclosed herein benefit from one or more improved in vitro and/or in vivo properties relative to an appropriate comparator compound.

In certain embodiments, ISIS 445569, a 5-10-5 MOE gapmer, having a sequence of (from 5′ to 3′) CGGAGCGGTTGTGAACTGGC (incorporated herein as SEQ ID NO: 24), wherein each internucleoside linkage is a phosphorothioate linkage, each cytosine is a 5-methylcytosine, and each of nucleosides 1-5 and 16-20 comprise a 2′-O-methoxyethyl moiety, which was previously described in WO 2012/012443, incorporated herein by reference, is a comparator compound.

ISIS 445569 is an appropriate representative comparator compound because ISIS 445569 demonstrates statistically significant reduction of human DMPK in vitro as measured using a plurality of primer probe sets (see e.g. Example 1 and Example 2 of WO 2012/012443). Additionally, ISIS 445569 demonstrates statistically significant dose-dependent inhibition of human DMPK in vitro in both human skeletal muscle cells and DM1 fibroblasts (see e.g. Example 4 and Example 5 of WO 2012/012443 and Example 28 of WO 2012/012467). ISIS 445569 also reduces human DMPK transcript expression in transgenic mice (Examples 23 and 24 of WO 2012/012443 and Examples 29 and 30 of WO 2012/012467). ISIS 445569 was a preferred human DMPK antisense compound in WO 2012/012443 and WO 2012/012467.

Certain Compounds

In certain embodiments, the compounds disclosed herein benefit from improved activity and/or improved tolerability relative to appropriate comparator compounds, such as ISIS 445569. For example, in certain embodiments, ISIS 598769, ISIS 598768, and/or ISIS 486178 have more activity and/or tolerability than appropriate comparator compounds, such as ISIS 445569.

In certain embodiments, the compounds disclosed herein are more potent than appropriate comparator compounds, such as ISIS 445569. For example, as provided in Example 10 (described herein), ISIS 598769 achieved an IC50 of 1.9 μM, ISIS 598768 achieved an IC50 of 1.2 μM, and ISIS 486178 achieved an IC50 of 0.7 μM in a 6 point dose response curve (61.7 nM, 185.2 nM, 555.6 nM, 1666.7 nM, 5000.0 nM, and 15000.0 nM) in cultured in HepG2 cells when transfected using electroporation, whereas ISIS 445569 achieved an IC50 of 2.3 μM. Thus, ISIS 598769, ISIS 598768, and ISIS 486178 are more potent than the comparator compound, ISIS 445569.

In certain embodiments, the compounds disclosed herein have greater activity than appropriate comparator compounds, such as ISIS 445569, at achieving dose-dependent inhibition of DMPK across multiple different muscle tissues. In another example, as provided in Example 16 (described herein), ISIS 598768 and ISIS 598769 achieved greater dose-dependent inhibition than the comparator compound ISIS 445569 across several different muscle tissues when administered subcutaneously to DMSXL transgenic mice twice a week for 4 weeks with 25 mg/kg/week, 50 mg/kg/wk, or 100 mg/kg/wk. In some muscle tissues, for example, in the tibialis anterior, both ISIS 598768 and ISIS 598769 achieved greater inhibition of DMPK at 25, 50 and 100 mg/kg/wk than ISIS 445569 achieved at 200 mg/kg/wk. In the quadriceps and gastrocnemius, both ISIS 598768 and ISIS 598769 achieved equal or greater inhibition of DMPK at 50 mg/kg/wk than ISIS 445569 achieved at 100 or 200 mg/kg/wk. Thus, ISIS 598768 and ISIS 598769 have greater activity than ISIS 445569 at achieving dose-dependent inhibition of DMPK across multiple different muscle tissues.

In certain embodiments, the compounds disclosed herein are more tolerable than appropriate comparator compounds, such as ISIS 445569, when administered to CD-1 mice. In another example, as provided in Example 17 (described herein), ISIS 598769, ISIS 598768, and ISIS 486178 exhibited more favorable tolerability markers than ISIS 445569 when administered to CD-1 mice. ISIS 598769, ISIS 598768, and ISIS 486178 were administered subcutaneously twice a week for 6 weeks at 50 mg/kg/wk. ISIS 445569 was administered subcutaneously twice a week for 6 weeks at 100 mg/kg/wk. After treatment, ALT, AST, and BUN levels were lower in ISIS 486178 and ISIS 598768 treated mice than in ISIS 445569 treated mice. After treatment, ALT and AST levels were lower in ISIS 598769 treated mice than in ISIS 445569 treated mice. Therefore, ISIS 598769, ISIS 598768, and ISIS 486178 are more tolerable than the comparator compound, ISIS 445569 in CD-1 mice.

In certain embodiments, the compounds disclosed herein are more tolerable than appropriate comparator compounds, such as ISIS 445569, when administered to Sprague-Dawley rats. In another example, as provided in Example 18 (described herein), ISIS 598769, ISIS 598768, and ISIS 486178 exhibited more favorable tolerability markers than ISIS 445569 when administered to Sprague-Dawley rats. ISIS 598769, ISIS 598768, and ISIS 486178 were administered subcutaneously twice a week for 6 weeks at 50 mg/kg/wk. ISIS 445569 was administered subcutaneously twice a week for 6 weeks at 100 mg/kg/wk. After treatment, ALT and AST levels were lower in ISIS 486178, ISIS 598769, and ISIS 598768 treated mice than in ISIS 445569 treated mice. Therefore ISIS 598769, ISIS 598768, and ISIS 486178 are more tolerable than the comparator compound, ISIS 445569 in Sprague-Dawley rats.

In certain embodiments, the compounds disclosed herein exhibit more favorable tolerability markers in cynomolgous monkeys than appropriate comparator compounds, such as ISIS 445569. In another example, as provided in Example 19 (described herein), ISIS 598769, ISIS 598768, and ISIS 486178 exhibited more favorable tolerability markers in cynomolgous monkeys including Alanine aminotransferase (ALT), aspartate aminotransferase (AST), lactate dehydrogenase (LDH), and creatine kinase (CK) assessment. In certain embodiments, ALT and AST levels are used as indicators of hepatotoxicity. For example, in certain embodiments, elevated ALT and AST levels indicate trauma to liver cells. In certain embodiments, elevated CK levels are associated with damage to cells in muscle tissue. In certain embodiments, elevated LDH levels are associated with cellular tissue damage.

In certain embodiments, the compounds disclosed herein are more tolerable than appropriate comparator compounds, such as ISIS 445569, when administered to cynomolgous monkeys. As provided in Example 19, groups of cynomolgous monkeys were treated with 40 mg/kg/wk of ISIS 598769, ISIS 598768, ISIS 486178, and ISIS 445569. Treatment with ISIS 445569 resulted in elevated ALT and AST levels at 93 days into treatment. Treatment with ISIS 598768, and ISIS 486178 resulted in lower ALT and AST levels at 58 and 93 days into treatment compared to ISIS 445569. Treatment with ISIS 598769, resulted in lower AST levels at 58 and 93 days into treatment and lower ALT levels at 93 days of treatment compared to ISIS 445569. Furthermore, the ALT and AST levels of monkeys receiving doses of ISIS 598769, ISIS 598768, and ISIS 486178 were consistent with the ALT and AST levels of monkeys given saline. Treatment with ISIS 445569 resulted in elevated LDH levels compared to the LDH levels measured in animals given ISIS 598769, ISIS 598768, and ISIS 486178 at 93 days into treatment. Additionally, treatment with ISIS 445569 resulted in elevated CK levels compared to the CK levels measured in animals given ISIS 598769, ISIS 598768, and ISIS 486178 at 93 days into treatment. Therefore, ISIS 598769, ISIS 598768, and ISIS 486178 are more tolerable than the comparator compound, ISIS 445569.

As the data discussed above demonstrate, ISIS 598769, ISIS 598768, and ISIS 486178 possess a wider range of well-tolerated doses at which ISIS 598769, ISIS 598768, and ISIS 486178 are active compared to the comparator compound, ISIS 445569. Additionally, the totality of the data presented in the examples herein and discussed above demonstrate that each of ISIS 598769, ISIS 598768, and ISIS 486178 possess a number of safety and activity advantages over the comparator compound, ISIS 445569. In other words, each of ISIS 598769, ISIS 598768, and ISIS 486178 are likely to be safer and more active drugs in humans than ISIS 445569.

In certain embodiments, ISIS 445569 is likely to be a safer and more active drug in humans for reducing CUGexp DMPK mRNA and\or treating conditions or symptoms associated with having myotonic dystrophy type 1 than the other compounds disclosed in WO 2012/012443 and/or WO 2012/012467.

In certain embodiments, ISIS 512497 has a better safety profile in primates and CD-1 mice than ISIS 445569. In certain embodiments, ISIS 512497 achieves greater knockdown of human DMPK nucleic acid in multiple muscle tissues when administered at the same dose and at lower doses than ISIS 445569.

In certain embodiments, ISIS 486178 has a better safety profile in mice, rats, and primates than ISIS 445569. In certain embodiments, ISIS 486178 achieves greater knockdown of human DMPK nucleic acid in one or more muscle tissues when administered at the same dose and at lower doses than ISIS 445569.

In certain embodiments, ISIS 570808 achieves much greater knockdown of human DMPK nucleic acid at least five different muscle tissues when administered at the same dose and at lower dose than ISIS 445569.

In certain embodiments, ISIS 594292 achieves greater knockdown of human DMPK nucleic acid in one or more muscle tissues when administered at the same dose as ISIS 445569. In certain embodiments, ISIS 486178 has a better safety profile in primates than ISIS 445569.

In certain embodiments, ISIS 569473 achieves greater knockdown of human DMPK nucleic acid in one or more muscle tissues when administered at the same dose as ISIS 445569. In certain embodiments, ISIS 569473 has a better safety profile in primates than ISIS 445569.

In certain embodiments, ISIS 594300 achieves greater knockdown of human DMPK nucleic acid in one or more muscle tissues when administered at the same dose as ISIS 445569. In certain embodiments, ISIS 594300 has a better safety profile in primates than ISIS 445569.

In certain embodiments, ISIS 598777 achieves greater knockdown of human DMPK nucleic acid in one or more muscle tissues when administered at the same dose as ISIS 445569. In certain embodiments, ISIS 598777 has a better safety profile in primates than ISIS 445569.

In certain embodiments, ISIS 598768 achieves greater knockdown of human DMPK nucleic acid in one or more muscle tissues when administered at the same dose as ISIS 445569. In certain embodiments, ISIS 598768 has a better safety profile in primates than ISIS 445569.

In certain embodiments, ISIS 598769 achieves greater knockdown of human DMPK nucleic acid in one or more muscle tissues when administered at the same dose as ISIS 445569. In certain embodiments, ISIS 598769 has a better safety profile in primates than ISIS 445569.

Nonlimiting Disclosure and Incorporation by Reference

While certain compounds, compositions and methods described herein have been described with specificity in accordance with certain embodiments, the following examples serve only to illustrate the compounds described herein and are not intended to limit the same. Each of the references, GenBank accession numbers, and the like recited in the present application is incorporated herein by reference in its entirety.

Although the sequence listing accompanying this filing identifies each sequence as either “RNA” or “DNA” as required, in reality, those sequences may be modified with any combination of chemical modifications. One of skill in the art will readily appreciate that such designation as “RNA” or “DNA” to describe modified oligonucleotides is, in certain instances, arbitrary. For example, an oligonucleotide comprising a nucleoside comprising a 2′-OH sugar moiety and a thymine base could be described as a DNA having a modified sugar (2′-OH for the natural 2′-H of DNA) or as an RNA having a modified base (thymine (methylated uracil) for natural uracil of RNA).

Accordingly, nucleic acid sequences provided herein, including, but not limited to those in the sequence listing, are intended to encompass nucleic acids containing any combination of natural or modified RNA and/or DNA, including, but not limited to such nucleic acids having modified nucleobases. By way of further example and without limitation, an oligomeric compound having the nucleobase sequence “ATCGATCG” encompasses any oligomeric compounds having such nucleobase sequence, whether modified or unmodified, including, but not limited to, such compounds comprising RNA bases, such as those having sequence “AUCGAUCG” and those having some DNA bases and some RNA bases such as “AUCGATCG” and oligomeric compounds having other modified or naturally occurring bases, such as “ATmeeCGAUCG,” wherein meC indicates a cytosine base comprising a methyl group at the 5-position.

EXAMPLES

Non-Limiting Disclosure and Incorporation by Reference

While certain compounds, compositions and methods described herein have been described with specificity in accordance with certain embodiments, the following examples serve only to illustrate the compounds described herein and are not intended to limit the same. Each of the references recited in the present application is incorporated herein by reference in its entirety.

Example 1

Design of Antisense Oligonucleotides Targeting Human Dystrophia Myotonica Protein Kinase (hDMPK)

A series of antisense oligonucleotides (ASOs) were designed to target hDMPK. The newly designed ASOs were prepared using standard oligonucleotide synthesis well known in the art and are described in Tables 1 and 2, below. Subscripts “s” indicate phosphorothioate internucleoside linkages; subscripts “k” indicate 6′-(S)—CH3 bicyclic nucleosides (cEt); subscripts “e” indicate 2′-O-methoxyethyl (MOE) modified nucleosides; and subscripts “d” indicate β-D-2′-deoxyribonucleosides. “mC” indicates 5-methylcytosine nucleosides.

The antisense oligonucleotides are targeted to either SEQ ID NO: 1 (GENBANK Accession No. NM_001081560.1) and/or SEQ ID NO: 2 (the complement of GENBANK Accession No. NT_011109.15 truncated from nucleotides 18540696 to Ser. No. 18/555,106). “Start site” indicates the 5′-most nucleoside to which the gapmer is targeted in the human gene sequence. “Stop site” indicates the 3′-most nucleoside to which the gapmer is targeted human gene sequence.

TABLE 1
Design of antisense oligonucleotides targeting hDMPK and targeted to SEQ ID NO 2
Start Stop SEQ ID
ISIS No. Composition (5′ to 3′) Motif Length Site Site No.
486178 AksmCksAksAdsTdsAdsAdsAds kkk-10-kkk 16 13836 13851 23
TdsAdsmCdsmCdsGdsAksGksGk
445569 mCesGesGesAesGesmCdsGdsGdsTdsTdsGds e5-d10-e5 20 13226 13245 24
TdsGdsAdsAdsmCesTesGesGesmCe
512497 GesmCesGesmCesAesmCdsmCdsTdsTdsmCds e5-d10-e5 20 8608 8627 25
mCdsmCdsGdsAdsAdsTesGesTesmCesmCe
598768 mCesmCesmCksGksAdsAdsTdsGds eekk-d8-kkee 16 8603 8618 26
TdsmCdsmCdsGdsAksmCksAesGe
594300 mCesGesGesAksGksmCdsGdsGds eeekk-d7-kkeee 17 13229 13245 27
TdsTdsGdsTdsGksAksAesmCesTe
594292 AesmCesAesAksTksAdsAdsAdsTds eeekk-d7-kkeee 17 13835 13851 28
AdsmCdsmCdsGksAksGesGesAe
569473 GksAksmCksAdsAdsTdsmCdsTds kkk-d10-kkk 16 5082 5097 29
mCdsmCdsGdsmCdsmCdsAksGksGk
598769 TesmCesmCksmCksGdsAdsAdsTds eekk-d8-kkee 16 8604 8619 30
GdsTdsmCdsmCdsGksAksmCesAe
570808 TksGksTksAdsAdsTdsGdsTds kkk-d10-kkk 16 10201 10216 31
TdsGdsTdsmCdsmCdsAksGksTk
598777 GesTesGksTksAdsAdsTdsGds eekk-d8-kkee 16 10202 10217 32
TdsTdsGdsTdsmCksmCksAesGe

TABLE 2
Design of antisense oligonucleotides targeting hDMPK and targeted to SEQ ID NO 1
Start Stop
ISIS No. Composition (5′ to 3′ ) Motif Length Site Site
486178 AksmCksAksAdsTdsAdsAdsAds kkk-10-kkk 16 2773 2788
TdsAdsmCdsmCdsGdsAksGksGk
445569 mCesGesGesAesGesmCdsGdsGdsTdsTdsGds e5-d10-e5 20 2163 2182
TdsGdsAdsAdsmCesTesGesGesmCe
512497 GesmCesGesmCesAesmCdsmCdsTdsTdsmCds e5-d10-e5 20 1348 1367
mCdsmCdsGdsAdsAdsTesGesTesmCesmCe
598768 mCesmCesmCksGksAdsAdsTdsGds eekk-d8-kkee 16 1343 1358
TdsmCdsmCdsGdsAksmCksAesGe
594300 mCesGesGesAksGksmCdsGdsGds eeekk-d7-kkeee 17 2166 2182
TdsTdsGdsTdsGksAksAesmCesTe
594292 AesmCesAesAksTksAdsAdsAdsTds eeekk-d7-kkeee 17 2772 2788
AdsmCdsmCdsGksAksGesGesAe
569473 GksAksmCksAdsAdsTdsmCdsTds kkk-d10-kkk 16 730 745
mCdsmCdsGdsmCdsmCdsAksGksGk
598769 TesmCesmCksmCksGdsAdsAdsTds eekk-d8-kkee 16 1344 1359
GdsTdsmCdsmCdsGksAksmCesAe

Example 2

Antisense Inhibition of Human DMPK in Human Skeletal Muscle Cells (hSKMc)

Antisense oligonucleotides targeted to a human DMPK nucleic acid were tested for their effect on DMPK RNA transcript in vitro. Cultured hSKMc cells at a density of 20,000 cells per well were transfected using electroporation with 10,000 nM antisense oligonucleotide. After approximately 24 hours, RNA was isolated from the cells and DMPK transcript levels were measured by quantitative real-time PCR. DMPK RNA transcript levels were adjusted according to total RNA content, as measured by RIBOGREEN®. Results are presented as percent expression of DMPK, relative to untreated control cells.

The antisense oligonucleotides in Tables 3, 4, 5, and 6 are 5-10-5 gapmers, where the gap segment comprises ten 2′-deoxynucleosides and each wing segment comprises five 2′-MOE nucleosides. The internucleoside linkages throughout each gapmer are phosphorothioate (P═S) linkages. All cytosine residues throughout each gapmer are 5-methylcytosines. ‘Target start site’ indicates the 5′-most nucleoside to which the antisense oligonucleotide is targeted in the human genomic gene sequence. ‘Target stop site’ indicates the 3′-most nucleoside to which the antisense oligonucleotide is targeted in the human genomic sequence. All the antisense oligonucleotides listed in Table 3, 4, or 5 target SEQ ID NO: 1 (GENBANK Accession No. NM_001081560.1). All the antisense oligonucleotides listed in Table 6 target SEQ ID NO: 2 (the complement of GENBANK Accession No. NT_011109.15 truncated from nucleotides 18540696 to Ser. No. 18/555,106).

Several of the antisense oligonucleotides in Tables 2, 3, 4, and 5 demonstrated significant inhibition of DMPK mRNA levels under the conditions specified above.

TABLE 3
Inhibition of human DMPK RNA transcript in hSKMc by 5-10-5 gapmers targeting SEQ ID NO: 1
Start Site Stop Site SEQ
ISIS % Target on Seq ID: on Seq ID
No. Sequence Expression 1 ID: 1 NO.
UTC N/A 100.0 N/A N/A 33
444401 TTGCACTTTGCGAACCAACG 7.3 2490 2509 34
512326 CGACACCTCGCCCCTCTTCA 13.4 528 547 35
512327 ACGACACCTCGCCCCTCTTC 40.8 529 548 36
512328 CACGACACCTCGCCCCTCTT 27.8 530 549 37
512329 GCACGACACCTCGCCCCTCT 16.5 531 550 38
512330 AGCACGACACCTCGCCCCTC 17.9 532 551 39
512331 AAGCACGACACCTCGCCCCT 18.8 533 552 40
512332 GAAGCACGACACCTCGCCCC 23.3 534 553 41
512333 GGAAGCACGACACCTCGCCC 28.1 535 554 42
512334 CGGAAGCACGACACCTCGCC 16.3 536 555 43
512335 ACGGAAGCACGACACCTCGC 28.7 537 556 44
512336 CACGGAAGCACGACACCTCG 15.9 538 557 45
512337 TCACGGAAGCACGACACCTC 18.8 539 558 46
512338 CTCACGGAAGCACGACACCT 16.4 540 559 47
512339 CCTCACGGAAGCACGACACC 20.2 541 560 48
512340 TCCTCACGGAAGCACGACAC 19.3 542 561 49
512341 CTCCTCACGGAAGCACGACA 15.2 543 562 50
512342 TCTCCTCACGGAAGCACGAC 16.2 544 563 51
512343 CTCTCCTCACGGAAGCACGA 16.4 545 564 52
512344 CCTCTCCTCACGGAAGCACG 15.7 546 565 53
512345 CCCTCTCCTCACGGAAGCAC 14.7 547 566 54
512346 TCCCTCTCCTCACGGAAGCA 20.6 548 567 55
512347 GTCCCTCTCCTCACGGAAGC 32.6 549 568 56
512348 CGTCCCTCTCCTCACGGAAG 31.5 550 569 57
512349 GGTCCCCATTCACCAACACG 41.6 568 587 58
512350 CGGTCCCCATTCACCAACAC 31.6 569 588 59
512351 CCGGTCCCCATTCACCAACA 38.1 570 589 60
512352 GCCGGTCCCCATTCACCAAC 55.5 571 590 61
512353 CGCCGGTCCCCATTCACCAA 42.9 572 591 62
512354 CCGCCGGTCCCCATTCACCA 35.7 573 592 63
512355 ACCGCCGGTCCCCATTCACC 51.4 574 593 64
512356 CACCGCCGGTCCCCATTCAC 34.4 575 594 65
512357 CCACCGCCGGTCCCCATTCA 40.4 576 595 66
512358 TCCACCGCCGGTCCCCATTC 35.5 577 596 67
512359 ATCCACCGCCGGTCCCCATT 41.7 578 597 68
512360 GATCCACCGCCGGTCCCCAT 51.0 579 598 69
512361 TGATCCACCGCCGGTCCCCA 35.9 580 599 70
512362 GTGATCCACCGCCGGTCCCC 53.2 581 600 71
512363 CGTGATCCACCGCCGGTCCC 28.2 582 601 72
512364 TTCTCATCCTGGAAGGCGAA 34.6 611 630 73
512365 GTTCTCATCCTGGAAGGCGA 57.1 612 631 74
512366 AGTTCTCATCCTGGAAGGCG 72.1 613 632 75
512367 GTAGTTCTCATCCTGGAAGG 47.1 615 634 76
512368 GGTAGTTCTCATCCTGGAAG 56.0 616 635 77
512369 AGGTAGTTCTCATCCTGGAA 48.3 617 636 78
512370 CAGGTAGTTCTCATCCTGGA 20.2 618 637 79
512371 TACAGGTAGTTCTCATCCTG 44.0 620 639 80
512372 GTACAGGTAGTTCTCATCCT 64.1 621 640 81
512373 GGTACAGGTAGTTCTCATCC 54.2 622 641 82
512374 AGGTACAGGTAGTTCTCATC 65.6 623 642 83
512375 CCAGGTACAGGTAGTTCTCA 45.7 625 644 84
512376 ACCAGGTACAGGTAGTTCTC 60.4 626 645 85
512377 GACCAGGTACAGGTAGTTCT 62.2 627 646 86
512378 TGACCAGGTACAGGTAGTTC 64.9 628 647 87
512379 CATGACCAGGTACAGGTAGT 39.2 630 649 88
512380 CCATGACCAGGTACAGGTAG 27.7 631 650 89
512381 TCCATGACCAGGTACAGGTA 21.6 632 651 90
512382 CTCCATGACCAGGTACAGGT 25.7 633 652 91
512383 ACTCCATGACCAGGTACAGG 28.6 634 653 92
512384 TACTCCATGACCAGGTACAG 23.7 635 654 93
512385 ATACTCCATGACCAGGTACA 20.8 636 655 94
512386 AATACTCCATGACCAGGTAC 22.0 637 656 95
512387 TAATACTCCATGACCAGGTA 14.7 638 657 96
512388 CGTAATACTCCATGACCAGG 10.4 640 659 97
512389 AGCAGTGTCAGCAGGTCCCC 15.0 665 684 98
512390 CAGCAGTGTCAGCAGGTCCC 13.0 666 685 99
512391 TCAGCAGTGTCAGCAGGTCC 22.3 667 686 100
512392 CTCAGCAGTGTCAGCAGGTC 16.4 668 687 101
512393 GCTCAGCAGTGTCAGCAGGT 22.2 669 688 102
512394 TGCTCAGCAGTGTCAGCAGG 26.2 670 689 103
512395 TTGCTCAGCAGTGTCAGCAG 27.4 671 690 104
512396 CTTGCTCAGCAGTGTCAGCA 15.7 672 691 105
512397 ACTTGCTCAGCAGTGTCAGC 43.5 673 692 106
512398 AACTTGCTCAGCAGTGTCAG 26.9 674 693 107
512399 AAACTTGCTCAGCAGTGTCA 20.0 675 694 108
512400 CAAACTTGCTCAGCAGTGTC 23.1 676 695 109
512401 CCAAACTTGCTCAGCAGTGT 20.5 677 696 110
512402 CCCAAACTTGCTCAGCAGTG 13.5 678 697 33

TABLE 4
Inhibition of human DMPK RNA transcript in hSKMc by 5-10-5 gapmers targeting SEQ ID NO: 1
Start Site Stop Site SEQ
ISIS % Target on Seq ID: on Seq ID
No. Sequence Expression 1 ID: 1 NO.
UTC N/A 100 N/A N/A
444401 TTGCACTTTGCGAACCAACG 13.4 2490 2509 33
512480 GTGAGCCCGTCCTCCACCAA 29.8 1310 1329 111
512481 AGTGAGCCCGTCCTCCACCA 15.6 1311 1330 112
512482 CAGTGAGCCCGTCCTCCACC 10.7 1312 1331 113
512483 GCAGTGAGCCCGTCCTCCAC 33.3 1313 1332 114
512484 GGCAGTGAGCCCGTCCTCCA 9.6 1314 1333 115
512485 TGGCAGTGAGCCCGTCCTCC 8.8 1315 1334 116
512486 CATGGCAGTGAGCCCGTCCT 10.5 1317 1336 117
512487 CCATGGCAGTGAGCCCGTCC 10.1 1318 1337 118
512488 TCCATGGCAGTGAGCCCGTC 13.7 1319 1338 119
512489 CTCCATGGCAGTGAGCCCGT 16.9 1320 1339 120
512490 TCTCCATGGCAGTGAGCCCG 29.1 1321 1340 121
512491 GTCTCCATGGCAGTGAGCCC 41.3 1322 1341 122
512492 CCTTCCCGAATGTCCGACAG 8.8 1343 1362 123
512493 ACCTTCCCGAATGTCCGACA 12.1 1344 1363 124
512494 CACCTTCCCGAATGTCCGAC 6 1345 1364 125
512495 GCACCTTCCCGAATGTCCGA 8.5 1346 1365 126
512496 CGCACCTTCCCGAATGTCCG 5.6 1347 1366 127
512497 GCGCACCTTCCCGAATGTCC 7.7 1348 1367 25
512498 GGCGCACCTTCCCGAATGTC 15 1349 1368 128
512499 ACAAAAGGCAGGTGGACCCC 22.8 1373 1392 129
512500 CACAAAAGGCAGGTGGACCC 22 1374 1393 130
512501 CCACAAAAGGCAGGTGGACC 16.4 1375 1394 131
512502 CCCACAAAAGGCAGGTGGAC 15.8 1376 1395 132
512503 GCCCACAAAAGGCAGGTGGA 25.1 1377 1396 133
512504 AGCCCACAAAAGGCAGGTGG 24.7 1378 1397 134
512505 TAGCCCACAAAAGGCAGGTG 20.7 1379 1398 135
512506 GTAGCCCACAAAAGGCAGGT 20.7 1380 1399 136
512507 AGTAGCCCACAAAAGGCAGG 27.8 1381 1400 137
512508 GAGTAGCCCACAAAAGGCAG 43.9 1382 1401 138
512509 GGAGTAGCCCACAAAAGGCA 29.9 1383 1402 139
512510 AGGAGTAGCCCACAAAAGGC 31.9 1384 1403 140
512511 TAGGAGTAGCCCACAAAAGG 59.9 1385 1404 141
512512 GTAGGAGTAGCCCACAAAAG 40.1 1386 1405 142
512513 AGTAGGAGTAGCCCACAAAA 48.1 1387 1406 143
512514 GAGTAGGAGTAGCCCACAAA 53.3 1388 1407 144
512515 GGAGTAGGAGTAGCCCACAA 24.7 1389 1408 145
512516 AGGAGTAGGAGTAGCCCACA 22.1 1390 1409 146
512517 CAGGAGTAGGAGTAGCCCAC 15.4 1391 1410 147
512518 GCAGGAGTAGGAGTAGCCCA 32.8 1392 1411 148
512519 TGCAGGAGTAGGAGTAGCCC 37.6 1393 1412 149
512520 ATGCAGGAGTAGGAGTAGCC 47.4 1394 1413 150
512521 CATGCAGGAGTAGGAGTAGC 67.2 1395 1414 151
512522 CCATGCAGGAGTAGGAGTAG 58.8 1396 1415 152
512523 GCCATGCAGGAGTAGGAGTA 42.4 1397 1416 153
512524 GGCCATGCAGGAGTAGGAGT 34.1 1398 1417 154
512525 GGGCCATGCAGGAGTAGGAG 44.5 1399 1418 155
512526 AGGGCCATGCAGGAGTAGGA 42 1400 1419 156
512527 GAGGGCCATGCAGGAGTAGG 46.3 1401 1420 157
512528 CTGAGGGCCATGCAGGAGTA 25.3 1403 1422 158
512529 CCTGAGGGCCATGCAGGAGT 28.1 1404 1423 159
512530 CCCTGAGGGCCATGCAGGAG 22.8 1405 1424 160
512531 TCCCTGAGGGCCATGCAGGA 25.7 1406 1425 161
512532 GTCCCTGAGGGCCATGCAGG 17 1407 1426 162
512533 TGTCCCTGAGGGCCATGCAG 18.9 1408 1427 163
512534 CTGTCCCTGAGGGCCATGCA 27.3 1409 1428 164
512535 ACTGTCCCTGAGGGCCATGC 16.5 1410 1429 165
512536 CACTGTCCCTGAGGGCCATG 26 1411 1430 166
512537 TCACTGTCCCTGAGGGCCAT 22.7 1412 1431 167
512538 CTCACTGTCCCTGAGGGCCA 20.2 1413 1432 168
512539 CCTCACTGTCCCTGAGGGCC 19.3 1414 1433 169
512540 ACCTCACTGTCCCTGAGGGC 31 1415 1434 170
512541 GACCTCACTGTCCCTGAGGG 51.4 1416 1435 171
512542 GGACCTCACTGTCCCTGAGG 28 1417 1436 172
512543 GGGACCTCACTGTCCCTGAG 42.6 1418 1437 173
512544 CCTCCAGTTCCATGGGTGTG 16.7 1444 1463 174
512545 GCCTCCAGTTCCATGGGTGT 21.9 1445 1464 175
512546 GGCCTCCAGTTCCATGGGTG 19 1446 1465 176
512547 CGGCCTCCAGTTCCATGGGT 14.9 1447 1466 177
512548 TCGGCCTCCAGTTCCATGGG 23 1448 1467 178
512549 CTCGGCCTCCAGTTCCATGG 15.7 1449 1468 179
512550 GCTCGGCCTCCAGTTCCATG 16.2 1450 1469 180
512551 TGCTCGGCCTCCAGTTCCAT 17.7 1451 1470 181
512552 CTGCTCGGCCTCCAGTTCCA 18.4 1452 1471 182
512553 GCTGCTCGGCCTCCAGTTCC 22 1453 1472 183
512554 AGCTGCTCGGCCTCCAGTTC 32.4 1454 1473 184
512555 CAGCTGCTCGGCCTCCAGTT 15.7 1455 1474 185
512556 GCAGCTGCTCGGCCTCCAGT 16.3 1456 1475 186

TABLE 5
Inhibition of human DMPK RNA transcript in hSKMc by 5-10-5 gapmers targeting SEQ ID NO: 1
Start Site Stop Site SEQ
ISIS % Target on Seq ID: on Seq ID
No. Sequence Expression 1 ID: 1 NO.
UTC N/A 100.0 N/A N/A
444401 TTGCACTTTGCGAACCAACG 7.0 2490 2509 33
512557 AGCAGCTGCTCGGCCTCCAG 25.2 1457 1476 187
512558 AAGCAGCTGCTCGGCCTCCA 16.1 1458 1477 188
512559 CAAGCAGCTGCTCGGCCTCC 21.9 1459 1478 189
512560 TCAAGCAGCTGCTCGGCCTC 24.8 1460 1479 190
512561 CTCAAGCAGCTGCTCGGCCT 19.8 1461 1480 191
512562 GCTCAAGCAGCTGCTCGGCC 11.6 1462 1481 192
512563 GGCTCAAGCAGCTGCTCGGC 19.8 1463 1482 193
512564 TGGCTCAAGCAGCTGCTCGG 31.9 1464 1483 194
512565 GTGGCTCAAGCAGCTGCTCG 27.5 1465 1484 195
512566 TGTGGCTCAAGCAGCTGCTC 35.4 1466 1485 196
512567 GTGTGGCTCAAGCAGCTGCT 24.8 1467 1486 197
512568 CCACTTCAGCTGTTTCATCC 43.1 1525 1544 198
512569 TGCCACTTCAGCTGTTTCAT 35.0 1527 1546 199
512570 CTGCCACTTCAGCTGTTTCA 27.8 1528 1547 200
512571 ACTGCCACTTCAGCTGTTTC 78.9 1529 1548 201
512572 AACTGCCACTTCAGCTGTTT 36.4 1530 1549 202
512573 GAACTGCCACTTCAGCTGTT 30.3 1531 1550 203
512574 GGAACTGCCACTTCAGCTGT 66.7 1532 1551 204
512575 TGGAACTGCCACTTCAGCTG 22.6 1533 1552 205
512576 CTGGAACTGCCACTTCAGCT 22.9 1534 1553 206
512577 GCTGGAACTGCCACTTCAGC 59.5 1535 1554 207
512578 CGCTGGAACTGCCACTTCAG 24.9 1536 1555 208
512579 CCGCTGGAACTGCCACTTCA 42.5 1537 1556 209
512580 GCCGCTGGAACTGCCACTTC 20.0 1538 1557 210
512581 AGCCGCTGGAACTGCCACTT 19.4 1539 1558 211
512582 CTCAGCCTCTGCCGCAGGGA 22.1 1560 1579 212
512583 CCTCAGCCTCTGCCGCAGGG 33.7 1561 1580 213
512584 GGCCTCAGCCTCTGCCGCAG 24.6 1563 1582 214
512585 CGGCCTCAGCCTCTGCCGCA 55.1 1564 1583 215
512586 TCGGCCTCAGCCTCTGCCGC 60.8 1565 1584 216
512587 CTCGGCCTCAGCCTCTGCCG 31.8 1566 1585 217
512588 CCTCGGCCTCAGCCTCTGCC 16.4 1567 1586 218
512589 ACCTCGGCCTCAGCCTCTGC 31.1 1568 1587 219
512590 CACCTCGGCCTCAGCCTCTG 39.7 1569 1588 220
512591 TCACCTCGGCCTCAGCCTCT 24.8 1570 1589 221
512592 GTCACCTCGGCCTCAGCCTC 28.7 1571 1590 222
512593 CGTCACCTCGGCCTCAGCCT 20.3 1572 1591 223
512594 AGCACCTCCTCCTCCAGGGC 18.4 1610 1629 224
512595 GAGCACCTCCTCCTCCAGGG 19.9 1611 1630 225
512596 TGAGCACCTCCTCCTCCAGG 15.6 1612 1631 226
512597 GTGAGCACCTCCTCCTCCAG 22.3 1613 1632 227
512598 GGTGAGCACCTCCTCCTCCA 19.4 1614 1633 228
512599 GGGTGAGCACCTCCTCCTCC 17.3 1615 1634 229
512600 CGGGTGAGCACCTCCTCCTC 12.2 1616 1635 230
512601 CCGGGTGAGCACCTCCTCCT 15.9 1617 1636 231
512602 GCCGGGTGAGCACCTCCTCC 15.7 1618 1637 232
512603 TGCCGGGTGAGCACCTCCTC 15.1 1619 1638 233
512604 CTGCCGGGTGAGCACCTCCT 24.5 1620 1639 234
512605 TCTGCCGGGTGAGCACCTCC 33.8 1621 1640 235
512606 GCTCTGCCGGGTGAGCACCT 26.1 1623 1642 236
512607 GGCTCTGCCGGGTGAGCACC 50.4 1624 1643 237
512608 AGGCTCTGCCGGGTGAGCAC 42.9 1625 1644 238
512609 CAGGCTCTGCCGGGTGAGCA 39.2 1626 1645 239
512610 TCAGGCTCTGCCGGGTGAGC 20.2 1627 1646 240
512611 GCTCAGGCTCTGCCGGGTGA 22.5 1629 1648 241
512612 CGGCTCAGGCTCTGCCGGGT 27.0 1631 1650 242
512613 CCGGCTCAGGCTCTGCCGGG 68.8 1632 1651 243
512614 CCCGGCTCAGGCTCTGCCGG 58.8 1633 1652 244
512615 TCCCGGCTCAGGCTCTGCCG 24.8 1634 1653 245
512616 CTCCCGGCTCAGGCTCTGCC 10.4 1635 1654 246
512617 TCTCCCGGCTCAGGCTCTGC 12.8 1636 1655 247
512618 ATCTCCCGGCTCAGGCTCTG 13.3 1637 1656 248
512619 CATCTCCCGGCTCAGGCTCT 7.7 1638 1657 249
512620 CCATCTCCCGGCTCAGGCTC 2.8 1639 1658 250
512621 TCCATCTCCCGGCTCAGGCT 2.6 1640 1659 251
512622 CTCCATCTCCCGGCTCAGGC 1.5 1641 1660 252
512623 CCTCCATCTCCCGGCTCAGG 1.4 1642 1661 253
512624 GCCTCCATCTCCCGGCTCAG 2.0 1643 1662 254
512625 GGCCTCCATCTCCCGGCTCA 8.3 1644 1663 255
512626 TGGCCTCCATCTCCCGGCTC 9.4 1645 1664 256
512627 ATGGCCTCCATCTCCCGGCT 6.3 1646 1665 257
512628 GATGGCCTCCATCTCCCGGC 2.7 1647 1666 258
512629 GGATGGCCTCCATCTCCCGG 1.3 1648 1667 259
512630 CGGATGGCCTCCATCTCCCG 1.5 1649 1668 260
512631 GCGGATGGCCTCCATCTCCC 2.4 1650 1669 261
512632 TGCGGATGGCCTCCATCTCC 2.2 1651 1670 262
512633 GTTCCGAGCCTCTGCCTCGC 29.2 1701 1720 263

TABLE 6
Inhibition of human DMPK RNA transcript in hSKMc by 5-10-5 gapmers targeting SEQ ID NO: 2
Start Site Stop Site SEQ
ISIS % Target on Seq ID: on Seq ID
No. Sequence Expression 2 ID: 2 NO.
UTC N/A 100.0 N/A N/A
444401 TTGCACTTTGCGAACCAACG 7.0 13553 13572 33
444436 GTCGGAGGACGAGGTCAATA 9.7 13748 13767 264
512634 AGGGCCTCAGCCTGGCCGAA 31.7 13452 13471 265
512635 CAGGGCCTCAGCCTGGCCGA 39.5 13453 13472 266
512636 GTCAGGGCCTCAGCCTGGCC 20.5 13455 13474 267
512637 CGTCAGGGCCTCAGCCTGGC 23.3 13456 13475 268
512638 AGCAAATTTCCCGAGTAAGC 14.7 13628 13647 269
512639 AAGCAAATTTCCCGAGTAAG 21.2 13629 13648 270
512640 AAAAGCAAATTTCCCGAGTA 23.0 13631 13650 271
512641 CAAAAGCAAATTTCCCGAGT 19.7 13632 13651 272
512642 GCAAAAGCAAATTTCCCGAG 26.6 13633 13652 273
512643 GGCAAAAGCAAATTTCCCGA 12.8 13634 13653 274
512644 TGGCAAAAGCAAATTTCCCG 12.2 13635 13654 275
512645 TTTGGCAAAAGCAAATTTCC 24.2 13637 13656 276
512646 GTTTGGCAAAAGCAAATTTC 25.5 13638 13657 277
512647 GGGTTTGGCAAAAGCAAATT 43.0 13640 13659 278
512648 CGGGTTTGGCAAAAGCAAAT 27.2 13641 13660 279
512649 AAGCGGGTTTGGCAAAAGCA 27.0 13644 13663 280
512650 AATATCCAAACCGCCGAAGC 45.7 13728 13747 281
512651 AAATATCCAAACCGCCGAAG 56.6 13729 13748 282
512652 ATAAATATCCAAACCGCCGA 39.0 13731 13750 283
512653 AATAAATATCCAAACCGCCG 34.7 13732 13751 284
512654 TCAATAAATATCCAAACCGC 34.7 13734 13753 285
512655 GTCAATAAATATCCAAACCG 19.1 13735 13754 286
512656 GGTCAATAAATATCCAAACC 24.3 13736 13755 287
512657 AGGTCAATAAATATCCAAAC 23.5 13737 13756 288
512658 GAGGTCAATAAATATCCAAA 24.2 13738 13757 289
512659 ACGAGGTCAATAAATATCCA 28.3 13740 13759 290
512660 GACGAGGTCAATAAATATCC 17.8 13741 13760 291
512661 AGGACGAGGTCAATAAATAT 45.7 13743 13762 292
512662 GAGGACGAGGTCAATAAATA 27.6 13744 13763 293
512663 CGGAGGACGAGGTCAATAAA 15.8 13746 13765 294
512664 TCGGAGGACGAGGTCAATAA 10.8 13747 13766 295
512665 AGTCGGAGGACGAGGTCAAT 15.4 13749 13768 296
512666 GAGTCGGAGGACGAGGTCAA 18.8 13750 13769 297
512667 GCGAGTCGGAGGACGAGGTC 26.0 13752 13771 298
512668 AGCGAGTCGGAGGACGAGGT 21.7 13753 13772 299
512669 CAGCGAGTCGGAGGACGAGG 13.7 13754 13773 300
512670 TCAGCGAGTCGGAGGACGAG 16.5 13755 13774 301
512671 GTCAGCGAGTCGGAGGACGA 17.4 13756 13775 302
512672 CTGTCAGCGAGTCGGAGGAC 25.2 13758 13777 303
512673 CCTGTCAGCGAGTCGGAGGA 18.4 13759 13778 304
512674 AGCCTGTCAGCGAGTCGGAG 16.8 13761 13780 305
512675 GTCTCAGTGCATCCAAAACG 11.8 13807 13826 306
512676 GGTCTCAGTGCATCCAAAAC 17.7 13808 13827 307
512677 GGGTCTCAGTGCATCCAAAA 11.2 13809 13828 308
512678 GGAGGGCCTTTTATTCGCGA 17.8 13884 13903 309
512679 TGGAGGGCCTTTTATTCGCG 13.2 13885 13904 310
512680 ATGGAGGGCCTTTTATTCGC 19.3 13886 13905 311
512681 GATGGAGGGCCTTTTATTCG 30.5 13887 13906 312
512682 AGATGGAGGGCCTTTTATTC 50.8 13888 13907 313
512683 CAGATGGAGGGCCTTTTATT 46.1 13889 13908 314
512684 GCAGATGGAGGGCCTTTTAT 50.4 13890 13909 315
512685 CCCTCAGGCTCTCTGCTTTA 34.7 655 674 316
512686 GCCCTCAGGCTCTCTGCTTT 47.9 656 675 317
512687 AGCCCTCAGGCTCTCTGCTT 47.4 657 676 318
512688 TAGCCCTCAGGCTCTCTGCT 54.1 658 677 319
512689 TTAGCCCTCAGGCTCTCTGC 48.0 659 678 320
512690 TTTAGCCCTCAGGCTCTCTG 50.7 660 679 321
512691 ATTTAGCCCTCAGGCTCTCT 47.3 661 680 322
512692 AATTTAGCCCTCAGGCTCTC 44.8 662 681 323
512693 AAATTTAGCCCTCAGGCTCT 39.2 663 682 324
512694 TAAATTTAGCCCTCAGGCTC 48.0 664 683 325
512695 TTAAATTTAGCCCTCAGGCT 54.9 665 684 326
512696 GTTAAATTTAGCCCTCAGGC 48.1 666 685 327
512697 AGTTAAATTTAGCCCTCAGG 39.3 667 686 328
512698 CAGTTAAATTTAGCCCTCAG 47.5 668 687 329
512699 ACAGTTAAATTTAGCCCTCA 68.2 669 688 330
512700 GACAGTTAAATTTAGCCCTC 59.2 670 689 331
512701 GGACAGTTAAATTTAGCCCT 63.7 671 690 332
512702 CGGACAGTTAAATTTAGCCC 50.7 672 691 333
512703 TCGGACAGTTAAATTTAGCC 39.6 673 692 334
512704 CTCGGACAGTTAAATTTAGC 36.5 674 693 335
512705 ACTCGGACAGTTAAATTTAG 59.1 675 694 336
512706 GACTCGGACAGTTAAATTTA 50.0 676 695 337
512707 CGACTCGGACAGTTAAATTT 63.0 677 696 338
512708 CCGACTCGGACAGTTAAATT 34.3 678 697 339
512709 TCCGACTCGGACAGTTAAAT 39.5 679 698 340

Example 3

Design of Antisense Oligonucleotides Targeting Human Dystrophia Myotonica Protein Kinase (hDMPK)

A series of antisense oligonucleotides (ASOs) were designed to target hDMPK. The newly designed ASOs were prepared using standard oligonucleotide synthesis well known in the art and are described in Table 7, below. Subscripts “s” indicate phosphorothioate internucleoside linkages; subscripts “k” indicate 6′-(S)—CH3 bicyclic nucleosides (cEt); subscripts “e” indicate 2′-O-methoxyethyl (MOE) modified nucleosides; and subscripts “d” indicate β-D-2′-deoxyribonucleosides. “mC” indicates 5-methylcytosine nucleosides.

The antisense oligonucleotides targeted to a human DMPK nucleic acid were tested for their effect on DMPK RNA transcript in vitro. Cultured HepG2 cells at a density of 20,000 cells per well were transfected using electroporation with 4,500 nM antisense oligonucleotide. After approximately 24 hours, RNA was isolated from the cells and DMPK transcript levels were measured by quantitative real-time PCR. DMPK RNA transcript levels were adjusted according to total RNA content, as measured by RIBOGREEN®. Results are presented as percent expression of DMPK, relative to untreated control cells. ‘Target start site’ indicates the 5′-most nucleoside to which the antisense oligonucleotide is targeted in the human genomic gene sequence. ‘Target stop site’ indicates the 3′-most nucleoside to which the antisense oligonucleotide is targeted in the human genomic sequence. All the antisense oligonucleotides listed in Table 7 target SEQ ID NO: 1 (GENBANK Accession No. NM_001081560.1).

Several of the antisense oligonucleotides demonstrated significant inhibition of DMPK mRNA levels under the conditions specified above.

TABLE 7
Inhibition of human DMPK RNA transcript in HepG2 cells targeting SEQ ID NO: 1
Start Site Stop Site Seq
ISIS % Target on Seq ID: on Seq ID
No. Sequence Expression 1 ID: 1 No.
UTC N/A 100 N/A N/A
533424 TesmCesTesmCdsmCdsTdsmCdsAdsmCdsGdsGdsAdsAdsGksmCksAk 34.4 548 563 341
533425 mCesTesmCesTdsmCdsmCdsTdsmCdsAdsmCdsGdsGdsAdsAksGksmCk 32.1 549 564 342
533426 mCesienCesTesmCdsTdsmCdsmCdsTdsmCdsAdsmCdsGdsGdsAksAksGk 52.1 550 565 343
533427 AesAesAesmCdsTdsTdsGdsmCdsTdsmCdsAdsGdsmCdsAksGksTk 36.8 679 694 344
533428 mCesAesAesAdsmCdsTdsTdsGdsmCdsTdsmCdsAdsGdsmCksAksGk 59.9 680 695 345
533429 mCesmCesAesAdsAdsmCdsTdsTdsGdsmCdsTdsmCdsAdsGksmCksAk 39.3 681 696 346
533430 mCesmCesmCesAdsAdsAdsmCdsTdsTdsGdsmCdsTdsmCdsAksGksmCk 37.6 682 697 347
533431 mCesmCesmCesmCdsAdsAdsAdsmCdsTdsTdsGdsmCdsTdsmCksAksGk 39.6 683 698 348
533432 TesmCesmCesmCdsmCdsAdsAdsAdsmCdsTdsTdsGdsmCdsTksmCksAk 52.1 684 699 349
533433 GesTesTesTdsGdsAdsTdsGdsTdsmCdsmCdsmCdsTdsGksTksGk 53.9 782 797 350
533434 GesGesTesTdsTdsGdsAdsTdsGdsTdsmCdsmCdsmCdsTksGksTk 38.1 783 798 351
533435 GesGesGesTdsTdsTdsGdsAdsTdsGdsTdsmCdsmCdsmCksTksGk 43.7 784 799 352
533436 AesmCesAesGdsmCdsmCdsTdsGdsmCdsAdsGdsGdsAdsTksmCksTk 29.5 927 942 353
533437 mCesAesmCesAdsGdsmCdsmCdsTdsGdsmCdsAdsGdsGdsAksTksmCk 48.6 928 943 354
533438 mCesmCesAesmCdsAdsGdsmCdsmCdsTdsGdsmCdsAdsGdsGksAksTk 46.9 929 944 355
533439 mCesmCesmCesAdsmCdsAdsGdsmCdsmCdsTdsGdsmCdsAdsGksGksAk 43.6 930 945 356
533440 GesmCesmCesmCdsAdsmCdsAdsGdsmCdsmCdsTdsGdsmCdsAksGksGk 26.9 931 946 357
533441 mCesGesmCesmCdsmCdsAdsmCdsAdsGdsmCdsmCdsTdsGdsmCksAksGk 31.3 932 947 358
533442 mCesmCesGesmCdsmCdsmCdsAdsmCdsAdsGdsmCdsmCdsTdsGksmCksAk 20.5 933 948 359
533443 AesmCesmCesGdsmCdsmCdsmCdsAdsmCdsAdsGdsmCdsmCdsTksGksmCk 13.7 934 949 360
533444 mCesAesmCesmCdsGdsmCdsmCdsmCdsAdsmCdsAdsGdsmCdsmCksTksGk 29.4 935 950 361
533445 mCesmCesAesmCdsmCdsGdsmCdsmCdsmCdsAdsmCdsAdsGdsmCksmCksTk 32 936 951 362
533446 mCesmCesmCesAdsmCdsmCdsGdsmCdsmCdsmCdsAdsmCdsAdsGksmCksmCk 8.3 937 952 363
533447 GesmCesmCesmCdsAdsmCdsmCdsGdsmCdsmCdsmCdsAdsmCdsAksGksmCk 18.3 938 953 364
533448 mCesmCesAesGdsGdsmCdsmCdsmCdsAdsmCdsmCdsGdsmCdsmCksmCksAk 19.4 942 957 365
533449 mCesmCesmCesAdsGdsGdsmCdsmCdsmCdsAdsmCdsmCdsGdsmCksmCksmCk 24.2 943 958 366
533450 TesmCesmCesmCdsAdsGdsGdsmCdsmCdsmCdsAdsmCdsmCdsGksmCksmCk 39.2 944 959 367
533451 TesGesmCesmCdsTdsGdsTdsmCdsmCdsmCdsAdsGdsGdsmCksmCksmCk 44.2 950 965 368
533452 mCesTesGesmCdsmCdsTdsGdsTdsmCdsmCdsmCdsAdsGdsGksmCksmCk 55.6 951 966 369
533453 GesmCesTesGdsmCdsmCdsTdsGdsTdsmCdsmCdsmCdsAdsGksGksmCk 71.2 952 967 370
533454 GesGesTesGdsGdsmCdsAdsmCdsmCdsTdsTdsmCdsGdsAksAksAk 39.6 1276 1291 371
533455 mCesGesGesTdsGdsGdsmCdsAdsmCdsmCdsTdsTdsmCdsGksAksAk 52.9 1277 1292 372
533456 TesmCesGesGdsTdsGdsGdsmCdsAdsmCdsmCdsTdsTdsmCksGksAk 27 1278 1293 373
533457 AesGesTesGdsAdsGdsmCdsmCdsmCdsGdsTdsmCdsmCdsTksmCksmCk 51.5 1315 1330 374
533458 mCesAesGesTdsGdsAdsGdsmCdsmCdsmCdsGdsTdsmCdsmCksTksmCk 55.1 1316 1331 375
533459 GesmCesAesGdsTdsGdsAdsGdsmCdsmCdsmCdsGdsTdsmCksmCksTk 33.7 1317 1332 376
533460 TesmCesmCesmCdsGdsAdsAdsTdsGdsTdsmCdsmCdsGdsAksmCksAk 28.7 1344 1359 377
533461 TesTesmCesmCdsmCdsGdsAdsAdsTdsGdsTdsmCdsmCdsGksAksmCk 36.2 1345 1360 378
533462 mCesTesTesmCdsmCdsmCdsGdsAdsAdsTdsGdsTdsmCdsmCksGksAk 23 1346 1361 379
533463 mCesmCesTesTdsmCdsmCdsmCdsGdsAdsAdsTdsGdsTdsmCksmCksGk 11.5 1347 1362 380
533464 AesmCesmCesTdsTdsmCdsmCdsmCdsGdsAdsAdsTdsGdsTksmCksmCk 19.9 1348 1363 381
533465 mCesAesmCesmCdsTdsTdsmCdsmCdsmCdsGdsAdsAdsTdsGksTksmCk 30.2 1349 1364 382
533466 GesmCesAesmCdsmCdsTdsTdsmCdsmCdsmCdsGdsAdsAdsTksGksTk 30.2 1350 1365 383
533467 mCesGesmCesAdsmCdsmCdsTdsTdsmCdsmCdsmCdsGdsAdsAksTksGk 35.5 1351 1366 384
533468 AesTesmCesmCdsGdsmCdsTdsmCdsmCdsTdsGdsmCdsAdsAksmCksTk 47.4 1746 1761 385
533469 mCesAesTesmCdsmCdsGdsmCdsTdsmCdsmCdsTdsGdsmCdsAksAksmCk 51.2 1747 1762 386
533470 mCesmCesAesTdsmCdsmCdsGdsmCdsTdsmCdsmCdsTdsGdsmCksAksAk 35.5 1748 1763 387
533471 GesmCesTesmCdsmCdsmCdsTdsmCdsTdsGdsmCdsmCdsTdsGksmCksAk 65.6 1770 1785 388
533472 AesGesGesTdsGdsGdsAdsTdsmCdsmCdsGdsTdsGdsGksmCksmCk 51.8 1816 1831 389
533473 GesGesGesAdsAdsGdsGdsTdsGdsGdsAdsTdsmCdsmCksGksTk 44.9 1820 1835 390
533474 AesmCesAesGdsGdsAdsGdsmCdsAdsGdsGdsGdsAdsAksAksGk 80.8 1955 1970 391
533475 mCesAesGesAdsmCdsTdsGdsmCdsGdsGdsTdsGdsAdsGksTksTk 95.5 2034 2049 392
533476 GesGesmCesTdsmCdsmCdsTdsGdsGdsGdsmCdsGdsGdsmCksGksmCk 55.7 2050 2065 393
533477 GesGesmCesGdsGdsmCdsTdsmCdsmCdsTdsGdsGdsGdsmCksGksGk 45.8 2053 2068 394
533478 mCesGesmCesGdsGdsGdsmCdsGdsGdsmCdsTdsmCdsmCdsTksGksGk 83.7 2057 2072 395
533479 GesAesGesmCdsGdsmCdsGdsGdsGdsmCdsGdsGdsmCdsTksmCksmCk 79.8 2060 2075 396
533480 GesGesTesTdsmCdsAdsGdsGdsGdsAdsGdsmCdsGdsmCksGksGk 49.4 2068 2083 397
533481 AesGesTesTdsmCdsTdsAdsGdsGdsGdsTdsTdsmCdsAksGksGk 37 2076 2091 398
533482 mCesAesGesTdsTdsmCdsTdsAdsGdsGdsGdsTdsTdsmCksAksGk 28.5 2077 2092 399
533483 AesmCesAesGdsTdsTdsmCdsTdsAdsGdsGdsGdsTdsTksmCksAk 42 2078 2093 400
533484 GesAesmCesAdsGdsTdsTdsmCdsTdsAdsGdsGdsGdsTksTksmCk 37.4 2079 2094 401
533485 AesGesAesmCdsAdsGdsTdsTdsmCdsTdsAdsGdsGdsGksTksTk 66.5 2080 2095 402
533486 AesAesGesAdsmCdsAdsGdsTdsTdsmCdsTdsAdsGdsGksGksTk 62.4 2081 2096 403
533487 GesAesAesGdsAdsmCdsAdsGdsTdsTdsmCdsTdsAdsGksGksGk 56.9 2082 2097 404
533488 mCesGesAesAdsGdsAdsmCdsAdsGdsTdsTdsmCdsTdsAksGksGk 36.8 2083 2098 405
533489 TesmCesGesAdsAdsGdsAdsmCdsAdsGdsTdsTdsmCdsTksAksGk 49.6 2084 2099 406
533490 GesTesmCesGdsAdsAdsGdsAdsmCdsAdsGdsTdsTdsmCksTksAk 40.4 2085 2100 407
533491 AesGesTesmCdsGdsAdsAdsGdsAdsmCdsAdsGdsTdsTksmCksTk 37.4 2086 2101 408
533492 GesAesGesTdsmCdsGdsAdsAdsGdsAdsmCdsAdsGdsTksTksmCk 36.6 2087 2102 409
533493 GesGesAesGdsTdsmCdsGdsAdsAdsGdsAdsmCdsAdsGksTksTk 33.2 2088 2103 410
533494 mCesGesGesAdsGdsTdsmCdsGdsAdsAdsGdsAdsmCdsAksGksTk 45.3 2089 2104 411
533495 mCesmCesGesGdsAdsGdsTdsmCdsGdsAdsAdsGdsAdsmCksAksGk 45.9 2090 2105 412
533496 mCesmCesmCesGdsGdsAdsGdsTdsmCdsGdsAdsAdsGdsAksmCksAk 51.3 2091 2106 413
533497 mCesmCesmCesmCdsGdsGdsAdsGdsTdsmCdsGdsAdsAdsGksAksmCk 49.2 2092 2107 414
533498 GesmCesmCesmCdsmCdsGdsGdsAdsGdsTdsmCdsGdsAdsAksGksAk 52.3 2093 2108 415
533499 GesGesmCesmCdsmCdsmCdsGdsGdsAdsGdsTdsmCdsGdsAksAksGk 54.9 2094 2109 416
533500 GesGesGesmCdsmCdsmCdsmCdsGdsGdsAdsGdsTdsmCdsGksAksAk 46.7 2095 2110 417
533809 AesmCesAesAdsTdsAdsAdsAdsTdsAdsmCdsmCdsGdsAksGksGk 51.4 2773 2788 418

Example 4

Design of Antisense Oligonucleotides Targeting Human Dystrophia Myotonica Protein Kinase (hDMPK)

Dose Response HepG2

A series of antisense oligonucleotides (ASOs) were designed to target hDMPK. The newly designed ASOs were prepared using standard oligonucleotide synthesis well known in the art and are described in Table 8, below. Subscripts “s” indicate phosphorothioate internucleoside linkages; subscripts “k” indicate 6′-(S)—CH3 bicyclic nucleosides (cEt); subscripts “e” indicate 2′-O-methoxyethyl (MOE) modified nucleosides; and subscripts “d” indicate β-D-2′-deoxyribonucleosides. “mC” indicates 5-methylcytosine nucleosides.

The antisense oligonucleotides are targeted to SEQ ID NO: 1 (GENBANK Accession No. NM_001081560.1). “Start site” indicates the 5′-most nucleoside to which the gapmer is targeted in the human gene sequence. “Stop site” indicates the 3′-most nucleoside to which the gapmer is targeted human gene sequence.

TABLE 8
Design of antisense oligonucleotides targeting hDMPK
SEQ
ISIS ID
No. Composition (5′ to 3′) Start Site Stop Site NO
533440 GesmCesmCesmCdsAdsmCdsAdsGdsmCdsmCdsTdsGdsmCdsAksGksGk 931 946 357
533442 mCesmCesGesmCdsmCdsmCdsAdsmCdsAdsGdsmCdsmCdsTdsGksmCksAk 933 948 359
533443 AesmCesmCesGdsmCdsmCdsmCdsAdsmCdsAdsGdsmCdsmCdsTksGksmCk 934 949 360
533446 mCesmCesmCesAdsmCdsmCdsGdsmCdsmCdsmCdsAdsmCdsAdsGksmCksmCk 937 952 363
533447 GesmCesmCesmCdsAdsmCdsmCdsGdsmCdsmCdsmCdsAdsmCdsAksGksmCk 938 953 364
533448 mCesmCesAesGdsGdsmCdsmCdsmCdsAdsmCdsmCdsGdsmCdsmCksmCksAk 942 957 365
533449 mCesmCesmCesAdsGdsGdsmCdsmCdsmCdsAdsmCdsmCdsGdsmCksmCksmCk 943 958 366
533462 mCesTesTesmCdsmCdsmCdsGdsAdsAdsTdsGdsTdsmCdsmCksGksAk 1346 1361 379
533463 mCesmCesTesTdsmCdsmCdsmCdsGdsAdsAdsTdsGdsTdsmCksmCksGk 1347 1362 380
533464 AesmCesmCesTdsTdsmCdsmCdsmCdsGdsAdsAdsTdsGdsTksmCksmCk 1348 1363 381
533529 mCesGesGesTdsTdsGdsTdsGdsAdsAdsmCdsTdsGdsGksmCksAk 2162 2177 23
533530 AesGesmCesGdsGdsTdsTdsGdsTdsGdsAdsAdsmCdsTksGksGk 2164 2179 419
533599 GesmCesAesmCdsTdsTdsTdsGdsmCdsGdsAdsAdsmCdsmCksAksAk 2492 2507 420
533600 TesGesmCesAdsmCdsTdsTdsTdsGdsmCdsGdsAdsAdsmCksmCksAk 2493 2508 421

Example 5

Dose Response HepG2

Antisense oligonucleotides targeted to a human DMPK nucleic acid were tested for their effect on human DMPK RNA transcript in vitro. Cultured HepG2 cells at a density of 20,000 cells per well were transfected using electroporation with 625 nM, 1250 nM, 2500 nM, 5000 nM, and 10000.0 nM concentrations of each antisense oligonucleotide. After approximately 24 hours, RNA was isolated from the cells and DMPK RNA transcript levels were measured by quantitative real-time PCR using primer probe set RTS3164 (forward sequence AGCCTGAGCCGGGAGATG, designated herein as SEQ ID NO: 20; reverse sequence GCGTAGTTGACTGGCGAAGTT, designated herein as SEQ ID NO: 21; probe sequence AGGCCATCCGCACGGACAACCX, designated herein as SEQ ID NO: 22). Human DMPK RNA transcript levels were adjusted according to total RNA content, as measured by RIBOGREEN®. Results are presented in the table below as percent expression of human DMPK, relative to untreated control (UTC) cells. The tested antisense oligonucleotide sequences demonstrated dose-dependent inhibition of human DMPK mRNA levels under the conditions specified above.

TABLE 9
Inhibition of human DMPK RNA transcript in HepG2 cells
targeting SEQ ID NO: 1
ISIS Dose % Target Start Site Stop Site
No. (nM) Expression on Seq ID: 1 on Seq ID: 1
UTC N/A 100 N/A N/A
486178 625.0 39.4 2773 2788
486178 1250.0 31.2 2773 2788
486178 2500.0 20.6 2773 2788
486178 5000.0 13 2773 2788
486178 10000.0 11.5 2773 2788
533440 625.0 55.4 931 946
533440 1250.0 40.4 931 946
533440 2500.0 25.4 931 946
533440 5000.0 22.6 931 946
533440 10000.0 10.3 931 946
533442 625.0 55.2 933 948
533442 1250.0 33.1 933 948
533442 2500.0 29 933 948
533442 5000.0 16.9 933 948
533442 10000.0 7.2 933 948
533443 625.0 44.8 934 949
533443 1250.0 29.4 934 949
533443 2500.0 19.9 934 949
533443 5000.0 10.8 934 949
533443 10000.0 7 934 949
533446 625.0 50.9 937 952
533446 1250.0 35.5 937 952
533446 2500.0 30.4 937 952
533446 5000.0 14.6 937 952
533446 10000.0 14 937 952
533447 625.0 53.3 938 953
533447 1250.0 31.7 938 953
533447 2500.0 16.8 938 953
533447 5000.0 11.7 938 953
533447 10000.0 4.4 938 953
533448 625.0 58.8 942 957
533448 1250.0 36.9 942 957
533448 2500.0 24.8 942 957
533448 5000.0 11.5 942 957
533448 10000.0 10.1 942 957
533449 625.0 61.1 943 958
533449 1250.0 42.8 943 958
533449 2500.0 30.4 943 958
533449 5000.0 20.2 943 958
533449 10000.0 10.1 943 958
533462 625.0 50.7 1346 1361
533462 1250.0 32.3 1346 1361
533462 2500.0 29.2 1346 1361
533462 5000.0 12.5 1346 1361
533462 10000.0 5.8 1346 1361
533463 625.0 39.1 1347 1362
533463 1250.0 23.7 1347 1362
533463 2500.0 12.6 1347 1362
533463 5000.0 9.3 1347 1362
533463 10000.0 3.2 1347 1362
533464 625.0 48.8 1348 1363
533464 1250.0 36.4 1348 1363
533464 2500.0 24.5 1348 1363
533464 5000.0 11.7 1348 1363
533464 10000.0 5 1348 1363
533529 625.0 35.8 2162 2177
533529 1250.0 26.4 2162 2177
533529 2500.0 18.3 2162 2177
533529 5000.0 14.8 2162 2177
533529 10000.0 14.7 2162 2177
533530 625.0 47.4 2164 2179
533530 1250.0 22.1 2164 2179
533530 2500.0 21.5 2164 2179
533530 5000.0 14.4 2164 2179
533530 10000.0 8 2164 2179
533599 625.0 31.3 2492 2507
533599 1250.0 21.9 2492 2507
533599 2500.0 13.1 2492 2507
533599 5000.0 8.8 2492 2507
533599 10000.0 7.3 2492 2507
533600 625.0 33.8 2493 2508
533600 1250.0 20.9 2493 2508
533600 2500.0 16.5 2493 2508
533600 5000.0 10.4 2493 2508
533600 10000.0 12.1 2493 2508

Example 6

Design of Antisense Oligonucleotides Targeting Human Dystrophia Myotonica Protein Kinase (hDMPK)

A series of antisense oligonucleotides (ASOs) were designed to target hDMPK. The newly designed ASOs were prepared using standard oligonucleotide synthesis well known in the art and are described in Table 10, below. Subscripts “s” indicate phosphorothioate internucleoside linkages; subscripts “k” indicate 6′-(S)—CH3 bicyclic nucleosides (cEt); subscripts “e” indicate 2′-O-methoxyethyl (MOE) modified nucleosides; and subscripts “d” indicate β-D-2′-deoxyribonucleosides. “mC” indicates 5-methylcytosine nucleosides.

The antisense oligonucleotides are targeted to SEQ ID NO: 2 (the complement of GENBANK Accession No. NT_011109.15 truncated from nucleotides 18540696 to Ser. No. 18/555,106). “Start site” indicates the 5′-most nucleoside to which the gapmer is targeted in the human gene sequence. “Stop site” indicates the 3′-most nucleoside to which the gapmer is targeted human gene sequence.

TABLE 10
Design of antisense oligonucleotides targeting hDMPK
Start Site Stop Site Seq
ISIS on Seq on Seq ID
No. Sequence ID: 2 ID: 2 No.
UTC N/A N/A N/A
486178 AksmCksAksAdsTdsAdsAdsAdsTdsAdsmCdsmCdsGdsAksGksGk 13836 13851 23
533597 AesmCesTesTdsTdsGdsmCdsGdsAdsAdsmCdsmCdsAdsAksmCksGk 13553 13568 422
533603 AesAesAesGdsmCdsTdsTdsTdsGdsmCdsAdsmCdsTdsTksTksGk 13563 13578 423
533617 TesmCesmCesmCdsGdsAdsGdsTdsAdsAdsGdsmCdsAdsGksGksmCk 13624 13639 424
533649 GesmCesAesGdsmCdsGdsmCdsAdsAdsGdsTdsGdsAdsGksGksAk 13686 13701 425
533694 GesTesmCesAdsGdsmCdsGdsAdsGdsTdsmCdsGdsGdsAksGksGk 13760 13775 426
533697 mCesmCesTesGdsTdsmCdsAdsGdsmCdsGdsAdsGdsTdsmCksGksGk 13763 13778 427
533698 GesmCesmCesTdsGdsTdsmCdsAdsGdsmCdsGdsAdsGdsTksmCksGk 13764 13779 428
533699 AesGesmCesmCdsTdsGdsTdsmCdsAdsGdsmCdsGdsAdsGksTksmCk 13765 13780 429
533711 GesGesGesTdsmCdsTdsmCdsAdsGdsTdsGdsmCdsAdsTksmCksmCk 13813 13828 430
533721 AesGesGesTdsTdsTdsTdsTdsmCdsmCdsAdsGdsAdsGksGksmCk 2580 2595 431
533722 AesAesGesGdsTdsTdsTdsTdsTdsmCdsmCdsAdsGdsAksGksGk 2581 2596 432
533751 GesGesTesmCdsAdsmCdsTdsGdsmCdsTdsGdsGdsGdsTksmCksmCk 6446 6461 433
533786 GesTesGesGdsTdsTdsTdsmCdsTdsGdsTdsmCdsTdsGksmCksTk 11099 11114 434
533787 mCesGesTesGdsGdsTdsTdsTdsmCdsTdsGdsTdsmCdsTksGksmCk 11100 11115 435

Example 7

Dose Response for ASOs Targeted to a Human DMPK RNA Transcript in HepG2 Cells

Antisense oligonucleotides targeted to a human DMPK nucleic acid were tested for their effect on human DMPK RNA transcript in vitro. Cultured HepG2 cells at a density of 20,000 cells per well were transfected using electroporation with 625 nM, 1250 nM, 2500 nM, 5000 nM, and 10000.0 nM concentrations of each antisense oligonucleotide. After approximately 24 hours, RNA was isolated from the cells and DMPK RNA transcript levels were measured by quantitative real-time PCR using primer probe set RTS3164 (forward sequence AGCCTGAGCCGGGAGATG, designated herein as SEQ ID NO: 20; reverse sequence GCGTAGTTGACTGGCGAAGTT, designated herein as SEQ ID NO: 21; probe sequence AGGCCATCCGCACGGACAACCX, designated herein as SEQ ID NO: 22). Human DMPK RNA transcript levels were adjusted according to total RNA content, as measured by RIBOGREEN®. Results are presented as percent expression of human DMPK, relative to untreated control (UTC) cells and are shown in the table below. The tested antisense oligonucleotide sequences demonstrated dose-dependent inhibition of human DMPK mRNA levels under the conditions specified above.

TABLE 11
Inhibition of human DMPK RNA transcript in HepG2 cells
targeting SEQ ID NO: 1
ISIS Dose % Target Start Site Stop Site on
No. (nM) Expression on Seq ID: 2 Seq ID: 2
UTC NA 100 N/A N/A
486178 625.000 39.4 13836 13851
486178 1250.000 27.3 13836 13851
486178 2500.000 14 13836 13851
486178 5000.000 16.3 13836 13851
486178 10000.000 8.3 13836 13851
533597 625.000 42.4 13553 13568
533597 1250.000 30.3 13553 13568
533597 2500.000 15.3 13553 13568
533597 5000.000 10 13553 13568
533597 10000.000 10.6 13553 13568
533603 625.000 48.2 13563 13578
533603 1250.000 31.1 13563 13578
533603 2500.000 22.4 13563 13578
533603 5000.000 15.6 13563 13578
533603 10000.000 9.9 13563 13578
533617 625.000 38.4 13624 13639
533617 1250.000 26.3 13624 13639
533617 2500.000 21.6 13624 13639
533617 5000.000 15.8 13624 13639
533617 10000.000 14.6 13624 13639
533649 625.000 52.2 13686 13701
533649 1250.000 27.8 13686 13701
533649 2500.000 24.6 13686 13701
533649 5000.000 20.5 13686 13701
533649 10000.000 14.5 13686 13701
533694 625.000 53.3 13760 13775
533694 1250.000 29.4 13760 13775
533694 2500.000 23.6 13760 13775
533694 5000.000 18.7 13760 13775
533694 10000.000 13.5 13760 13775
533697 625.000 30.6 13763 13778
533697 1250.000 14.9 13763 13778
533697 2500.000 13.8 13763 13778
533697 5000.000 9.7 13763 13778
533697 10000.000 7.1 13763 13778
533698 625.000 23.4 13764 13779
533698 1250.000 15.5 13764 13779
533698 2500.000 13.8 13764 13779
533698 5000.000 12.4 13764 13779
533698 10000.000 10.2 13764 13779
533699 625.000 38.2 13765 13780
533699 1250.000 26.9 13765 13780
533699 2500.000 17.6 13765 13780
533699 5000.000 12.9 13765 13780
533699 10000.000 9.3 13765 13780
533711 625.000 35.1 13813 13828
533711 1250.000 34.6 13813 13828
533711 2500.000 22.4 13813 13828
533711 5000.000 22 13813 13828
533711 10000.000 13 13813 13828
533721 625.000 36.3 2580 2595
533721 1250.000 29.8 2580 2595
533721 2500.000 23.2 2580 2595
533721 5000.000 17.8 2580 2595
533721 10000.000 17.2 2580 2595
533722 625.000 48.5 2581 2596
533722 1250.000 28.6 2581 2596
533722 2500.000 21.9 2581 2596
533722 5000.000 28.1 2581 2596
533722 10000.000 13.8 2581 2596
533751 625.000 37.7 6446 6461
533751 1250.000 21.6 6446 6461
533751 2500.000 12.6 6446 6461
533751 5000.000 9.7 6446 6461
533751 10000.000 8.5 6446 6461
533786 625.000 53.6 11099 11114
533786 1250.000 26.6 11099 11114
533786 2500.000 14.7 11099 11114
533786 5000.000 9.6 11099 11114
533786 10000.000 5.5 11099 11114
533787 625.000 43.8 11100 11115
533787 1250.000 27.7 11100 11115
533787 2500.000 16.3 11100 11115
533787 5000.000 7 11100 11115
533787 10000.000 4.5 11100 11115

Example 8

ASOs Designed to Target a Human DMPK RNA Transcript

A series of antisense oligonucleotides (ASOs) were designed to target hDMPK. The newly designed ASOs were prepared using standard oligonucleotide synthesis well known in the art and are described in Table 12, below. Subscripts “s” indicate phosphorothioate internucleoside linkages; subscripts “k” indicate 6′-(S)—CH3 bicyclic nucleosides (cEt); subscripts “e” indicate 2′-O-methoxyethyl (MOE) modified nucleosides; and subscripts “d” indicate β-D-2′-deoxyribonucleosides. “mC” indicates 5-methylcytosine nucleosides.

The antisense oligonucleotides targeted to a human DMPK nucleic acid were tested for their effect on DMPK RNA transcript in vitro. Cultured hSKMC cells at a density of 20,000 cells per well were transfected using electroporation with 800 nM antisense oligonucleotide. After approximately 24 hours, RNA was isolated from the cells and DMPK transcript levels were measured by quantitative real-time PCR. DMPK RNA transcript levels were adjusted according to total RNA content, as measured by RIBOGREEN®. Results are presented as percent expression of DMPK, relative to untreated control cells.

‘Target start site’ indicates the 5′-most nucleoside to which the antisense oligonucleotide is targeted in the human genomic gene sequence. ‘Target stop site’ indicates the 3′-most nucleoside to which the antisense oligonucleotide is targeted in the human genomic sequence. All the antisense oligonucleotides listed in Table 12 target SEQ ID NO: 1 (GENBANK Accession No. NM_001081560.1).

Several of the antisense oligonucleotides demonstrated significant inhibition of DMPK mRNA levels under the conditions specified above.

TABLE 12
Inhibition of human DMPK RNA transcript in HepG2 cells using ASOs targeting SEQ ID NO: 1
Start Site Stop Site Seq
ISIS % Target on Seq on Seq ID
No. Sequence Expression ID: 1 ID: 1 No.
UTC N/A 100 N/A N/A
444401 TesTesGesmCesAesmCdsTdsTdsTdsGdsmCdsGdsAdsAdsmCdsmCesAesAesmCesGe 25.2 2490 2509 33
444436 GesTesmCesGesGesAdsGdsGdsAdsmCdsGdsAdsGdsGdsTdsmCesAesAesTesAe 30.8 2685 2704 264
486072 AksAksGkSAdsmCdsAdsGdsTdsTdsmCdsTdsAdsGdsGksGksTk 36.8 2081 2096 403
486073 mCksGksAksAdsGdsAdsmCdsAdsGdsTdsTdsmCdsTdsAksGksGk 22.4 2083 2098 405
486075 GksTksmCksGdsAdsAdsGdsAdsmCdsAdsGdsTdsTdsmCksTksAk 41.3 2085 2100 407
486076 AksGksTksmCdsGdsAdsAdsGdsAdsmCdsAdsGdsTdsTksmCksTk 22.4 2086 2101 408
486077 GksAksGksTdsmCdsGdsAdsAdsGdsAdsmCdsAdsGdsTksTksmCk 35.2 2087 2102 409
486078 mCksGksGksAdsGdsTdsmCdsGdsAdsAdsGdsAdsmCdsAksGksTk 12.4 2089 2104 411
486079 mCksmCksmCksGdsGdsAdsGdsTdsmCdsGdsAdsAdsGdsAksmCksAk 36.5 2091 2106 413
486080 mCksmCksmCksmCdsGdsGdsAdsGdsTdsmCdsGdsAdsAdsGksAksmCk 19.9 2092 2107 414
486085 GksAksAksmCdsTdsGdsGdsmCdsAdsGdsGdsmCdsGdsGksTksGk 30.1 2155 2170 436
486086 TksGksTksGdsAdsAdsrmCdsTdsGdsGdsmCdsAdsGdsGksmCksGk 17.2 2158 2173 437
486087 GksGksTksTdsGdsTdsGdsAdsAdsmCdsTdsGdsGdsmCksAksGk 11.5 2161 2176 438
486088 GksAksGksmCdsGdsGdsTdsTdsGdsTdsGdsAdsAdsmCksTksGk 21.7 2165 2180 439
486094 AksmCksTksGdsGdsAdsGdsmCdsTdsGdsGdsGdsmCdsGksGksAk 30.2 2193 2208 440
486096 AksGksGksAdsmCdsTdsGdsGdsAdsGdsmCdsTdsGdsGksGksmCk 43.5 2196 2211 441
486097 TksmCksAksmCdsAdsGdsGdsAdsmCdsTdsGdsGdsAdsGksmCksTk 54.5 2200 2215 442
486098 AksTksmCksAdsmCdsAdsGdsGdsAdsmCdsTdsGdsGdsAksGksmCk 77.3 2201 2216 443
486099 GksGksAksTdsmCdsAdsmCdsAdsGdsGdsAdsmCdsTdsGksGksAk 24.8 2203 2218 444
486101 mCksAksGksmCdsmCdsTdsGdsGdsmCdsmCdsGdsAdsAdsAksGksAk 31.6 2386 2401 445
486102 mCksTksmCksAdsGdsmCdsmCdsTdsGdsGdsmCdsmCdsGdsAksAksAk 35.1 2388 2403 446
486104 GksTksmCksAdsGdsGdsGdsmCdsmCdsTdsmCdsAdsGdsmCksmCksTk 26.9 2396 2411 447
486105 mCksGksTksmCdsAdsGdsGdsGdsmCdsmCdsTdsmCdsAdsGksmCksmCk 48.4 2397 2412 448
486110 TksTksTksGdsmCdsAdsmCdsTdsTdsTdsGdsmCdsGdsAksAksmCk 31.6 2495 2510 449
486111 GksAksAksAdsGdsmCdsTdsTdsTdsGdsmCdsAdsmCdsTksTksTk 31.9 2501 2516 450
486112 AksAksTksTdsTdsmCdsmCdsmCdsGdsAdsGdsTdsAdsAksGksmCk 47.4 2565 2580 451
486115 GksmCksAksAdsAdsTdsTdsTdsmCdsmCdsmCdsGdsAdsGksTksAk 20.8 2568 2583 452
486116 AksGksmCksAdsAdsAdsTdsTdsTdsmCdsmCdsmCdsGdAksGksTk 23.9 2569 2584 453
486117 AksAksGksmCdsAdsAdsAdsTdsTdsTdsmCdsmCdsmCdsGksAksGk 22 2570 2585 454
486118 AksAksAksGdsmCdsAdsAdsAdsTdsTdsTdsmCdsmCdsmCksGksAk 26.7 2571 2586 455
486119 AksAksAksAdsGdsmCdsAdAdsAdsTdsTdsTdsmCdsmCksmCksGk 33.5 2572 2587 456
486120 GksmCksAksAdsAdsAdsGdsmCdsAdsAdsAdsTdsTdsTksmCksmCk 51.4 2574 2589 457
486121 GksGksmCksAdAdsAdsAdsGdsmCdsAdsAdsAdsTdsTksTksmCk 60.8 2575 2590 458
486123 TksGksGdsmCdsAdsAdsAdsAdsGdsmCdsAdsAdsAksTksTk 39.8 2577 2592 459
486125 GksTksTksTdsGdsGdsmCdsAdsAdsAdsAdsGdsmCdsAksAksAk 32.7 2579 2594 460
486126 GksGksTksTdsTdsGdsGdsmCdsAdsAdsAdsAdsGdsmCksAksAk 19.2 2580 2595 461
486127 GksGksGksTdsTdsTdsGdsGdsmCdsAdsAdsAdsAdsGksmCksAk 36.1 2581 2596 462
486128 GksmCksGksGdsGdsTdsTdsTdsGdsGdsmCdsAdsAdsAksAksGk 39.1 2583 2598 463
486129 AksGksmCksGdsGdsGdsTdsTdsTdsGdsGdsmCdsAdsAksAksAk 31.4 2584 2599 464
486130 AksAksGksmCdsGdsGdsGdsTdsTdsTdsGdsGdsmCdsAksAksAk 35.7 2585 2600 465
486133 mCksTksmCksmCdsGdsAdsGdsAdsGdsmCdsAdsGdsmCdsGksmCksAk 45.9 2631 2646 466
486134 GksmCksTksmCdsmCdsGdsAdsGdsAdsGdsmCdsAdsGdsmCksGksmCk 29.5 2632 2647 467
486135 GksGksmCksTdsmCdsmCdsGdsAdsGdsAdsGdsmCdsAdsGksmCksGk 51.4 2633 2648 468
486142 TksAksAksAdsTdsAdsTdsmCdsmCdsAdAdsAdsmCdsmCksGksmCk 64.4 2671 2686 469
486147 GksTksmCksAdsAdsTdsAdsAdsAdsTdsAdsTdsmCdsmCksAksAk 16.1 2676 2691 470
486148 AksGksGksTdsmCdsAdsAdsTdsAdsAdsAdsTdsAdsTksmCksmCk 18.3 2678 2693 471
486149 mCksGksAksGdsGdsTdsmCdsAdsAdsTdsAdsAdsAdsTksAksTk 37.9 2680 2695 472
486150 AksmCksGksAdsGdsGdsTdsmCdsAdsAdsTdsAdsAdsAksTksk 45.3 2681 2696 473
486151 GksAksmCksGdsAdsGdsGdsTdsmCdsAdsAdsTdsAdsAksAksTk 52.2 2682 2697 474
486152 GksGksAksmCdsGdsAdsGdsGdsTdsmCdsAdsAdsTdsAksAksAk 19.8 2683 2698 475
486153 AksGksGksAdsmCdsGdsAdsGdsGdsTdsmCdsAdsAdsTksAksAk 19.9 2684 2699 476
486154 GksAksGksGdsAdsmCdsGdsAdsGdsGdsTdsmCdsAdsAksTksAk 19.6 2685 2700 477
486155 GksGksAksGdsGdsAdsmCdsGdsAdsGdsGdsTdsmCdsAksAksTk 38.3 2686 2701 478
486156 mCksGksGksAdsGdsGdsAdsmCdsGdsAdsGdsGdsTdsmCksAksAk 14.1 2687 2702 479
486157 TksmCksGksGdsAdsGdsGdsAdsmCdsGdsAdsGdsGdsTksmCksAk 23.2 2688 2703 480
486158 GksTksCksGdsGdsAdsGdsGdAdsmCdsGdsAdsGdsGksTksmCk 34.5 2689 2704 481
486159 AksGksTksmCdsGdsGdsAdsGdsGdAdsmCdsGdsAdsGksGksTk 23.7 2690 2705 482
486160 GksAksGksTdsmCdsGdsGdsAdsGdsGdsAdsmCdsGdsAksGksGk 14.3 2691 2706 483
486161 mCksGksAksGdsTdsmCdsGdsGdsAdsGdsGdsAdsmCdsGksAksGk 29 2692 2707 484
486162 AksGksmCksGdsAdsGdsTdsmCdsGdsGdsAdsGdsGdsAksmCksGk 20.6 2694 2709 485
486163 mCksAksGksmCdsGdsAdsGdsTdsmCdsGdsGdsAdsGdsGksAksmCk 29 2695 2710 486
486164 TksmCksAksGdsmCdsGdsAdsGdsTdsmCdsGdsGdsAdsGksGksAk 17 2696 2711 487
486165 GksTksmCksAdsGdsmCdsGdsAdsGdsTdsmCdsGdsGdsAksGksGk 14.2 2697 2712 426
486166 TksGksTksmCdsAdsGdsmCdsGdsAdsGdsTdsmCdsGdsGksAksGk 25.1 2698 2713 488
486167 mCksTksGkTdsmCdsAdsGdsmCdsGdsAdsGdsTdsmCdsGksGksAk 15 2699 2714 489
486168 mCksmCksTksGdsTdsmCdsAdsGdsmCdsGdsAdsGdsTdsmCksGksGk 12.4 2700 2715 427
486169 GksmCksmCksTdsGdsTdsmCdsAdsGdsmCdsGdsAdsGdsTksmCksGk 24.5 2701 2716 428
486170 AksGksmCksmCdsTdsGdsTdsmCdsAdsGdsmCdsGdsAdsGksTksmCk 16.3 2702 2717 429
486171 mCksAksGksTdsGdsmCdsAdsTdsmCdsmCdsAdsAdsAdsAksmCksGk 31.8 2744 2759 490
486172 TksmCksAksGdsTdsGdsmCdsAdsTdsmCdsmCdsAdsAdsAksAksmCk 23.1 2745 2760 491
486173 mCksTksmCksAdsGdsTdsGdsmCdsAdsTdsmCdsmCdsAdsAksAksAk 23 2746 2761 492
486174 TksmCksTksmCdsAdsGdsTdsGdsmCdsAdsTdsmCdsmCdsAksAksAk 50.9 2747 2762 493
486175 GksTksmCksTdsmCdsAdsGdsTdsGdsmCdsAdsTdsmCdsmCksAksAk 17.2 2748 2763 494
486176 GksGksGksTdsmCdsTdsmCdsAdsGdsTdsGdsmCdsAdsTksmCksmCk 37.6 2750 2765 430
486177 mCksAksAksTdsAdsAdsAdsTdsAdsmCdsmCdsGdsAdsGksGksAk 40 2772 2787 495
486178 AksmCksAksAdsTdsAdsAdsAdsTdsAdsmCdsmCdsGdsAksGksGk 11.3 2773 2788 23
486179 AksGksAksmCdsAdsAdsTdsAdsAdsAdsTdsAdsmCdsmCksGksAk 13.5 2775 2790 496
486180 mCksAksGkAdsmCdsAdsAdsTdsAdsAdsAdsTdsAdsmCksmCksGk 18.6 2776 2791 497

Example 9

ASOs Designed to Target a Human DMPK RNA Transcript

A series of antisense oligonucleotides (ASOs) were designed to target hDMPK. The newly designed ASOs were prepared using standard oligonucleotide synthesis well known in the art and are described in Table 13 to 18, below. Subscripts “s” indicate phosphorothioate internucleoside linkages; subscripts “k” indicate 6′-(S)—CH3 bicyclic nucleosides (cEt); subscripts “e” indicate 2′-O-methoxyethyl (MOE) modified nucleosides; and subscripts “d” indicate β-D-2′-deoxyribonucleosides. “mC” indicates 5-methylcytosine nucleosides.

The antisense oligonucleotides targeted to a human DMPK nucleic acid were tested for their effect on DMPK RNA transcript in vitro. Cultured HepG2 cells at a density of 20,000 cells per well were transfected using electroporation with 4,500 nM antisense oligonucleotide. After approximately 24 hours, RNA was isolated from the cells and DMPK transcript levels were measured by quantitative real-time PCR. DMPK RNA transcript levels were adjusted according to total RNA content, as measured by RIBOGREEN®. Results are presented as percent expression of DMPK, relative to untreated control cells, with “% Target Expression” representing the percent expression of DMPK relative to untreated control cells

All the antisense oligonucleotides listed in Table 13 target SEQ ID NO: 1 (GENBANK Accession No. NM_001081560.1). All the antisense oligonucleotides listed in Table 14 to 18 target SEQ ID NO: 2 (the complement of GENBANK Accession No. NT_011109.15 truncated from nucleotide; 185406 to 18555106). ‘Target start site’ indicates the 5′-most nucleoside to which the antisense oligonucleotide is targeted in the human genomic gene sequence. ‘Target stop site’ indicates the 3′-most nucleoside to which the antisense oligonucleotide is targeted in the human genomic sequence.

TABLE 13
Inhibition of human DMPK RNA transcript in HepG2 cells targeting SEQ ID NO: 1
Start Site Stop Site
ISIS % Target on Seq on Seq Seq ID
No. Sequence Expression ID: 1 ID: 1 No.
UTC N/A 100 N/A N/A
445569 mCesGesGesAesGesmCdsGdsGdsTdsTdsGdsTdsGdsAdsAdsmCesTesGesGesmCe 36.7 2163 2182 24
486178 AksmCksAksAdsTdsAdsAdsAdsTdsAdsmCdsmCdsGdsAksGksGk 21.3 2773 2788 23
569403 mCksAksmCksGdsGdsAdsAdsGdsmCdsAdsmCdsGdsAdsmCksAksmCk 18.8 542 557 498
569404 TksmCksAksmCdsGdsGdsAdsAdsGdsmCdsAdsmCdsGdsAksmCksAk 25.2 543 558 499
569405 mCksTksmCksAdsmCdsGdsGdsAdsAdsGdsmCdsAdsmCdsGksAksmCk 21.2 544 559 500
569406 mCksmCksTksmCdsTdsmCdsmCdsTdsmCdsAdsmCdsGdsGdsAksAksGk 27.9 550 565 343
569407 GksTksmCksmCdsmCdsTdsmCdsTdsmCdsmCdsTdsmCdsAdsmCksGksGk 30.9 553 568 501
569408 mCksGksTksmCdsmCdsmCdsTdsmCdsTdsmCdsmCdsTdsmCdsAksmCksGk 32.8 554 569 502
569409 mCksmCksmCksAdsTdsTdsmCdsAdsmCdsmCdsAdsAdsmCdsAksmCksGk 33 568 583 503
569410 mCksmCksmCksmCdsAdsTdsTdsmCdsAdsmCdsmCdsAdsAdsmCksAksmCk 42.1 569 584 504
569411 TksmCksmCksmCdsmCdsAdsTdsTdsmCdsAdsmCdsmCdsAdsAksmCksAk 68.6 570 585 505
569412 GksTksmCksmCdsmCdsmCdsAdsTdsTdsmCdsAdsmCdsmCdsAksAksmCk 60.7 571 586 506
569413 GksGksTksmCdsmCdsmCdsmCdsAdsTdsTdsmCdsAdsmCdsmCksAksAk 65.1 572 587 507
569414 mCksGksGksTdsmCdsmCdsmCdsmCdsAdsTdsTdsmCdsAdsmCksmCksAk 54.4 573 588 508
569415 mCksmCksGksGdsTdsmCdsmCdsmCdsmCdsAdsTdsTdsmCdsAksmCksmCk 51.3 574 589 509
569416 GksmCksmCksGdsGdsTdsmCdsmCdsmCdsmCdsAdsTdsTdsmCksAksmCk 57.9 575 590 510
569417 mCksGksmCksmCdsGdsGdsTdsmCdsmCdsmCdsmCdsAdsTdsTksmCksAk 43.2 576 591 511
569418 mCksmCksGksmCdsmCdsGdsGdsTdsmCdsmCdsmCdsmCdsAdsTksTksmCk 79.3 577 592 512
569419 AksmCksmCksGdsmCdsmCdsGdsGdsTdsmCdsmCdsmCdsmCdsAksTksTk 36 578 593 513
569420 mCksAksmCksmCdsGdsmCdsmCdsGdsGdsTdsmCdsmCdsmCdsmCksAksTk 36.2 579 594 514
569421 mCksmCksAksmCdsmCdsGdsmCdsmCdsGdsGdsTdsmCdsmCdsmCksmCksAk 34.7 580 595 515
569422 TksmCksmCksAdsmCdsmCdsGdsmCdsmCdsGdsGdsTdsmCdsmCksmCksmCk 40 581 596 516
569423 AksTksmCksmCdsAdsmCdsmCdsGdsmCdsmCdsGdsGdsTdsmCksmCksmCk 31.6 582 597 517
569424 GksAksTksmCdsmCdsAdsmCdsmCdsGdsmCdsmCdsGdsGdsTksmCksmCk 56 583 598 518
569425 TksGksAksTdsmCdsmCdsAdsmCdsmCdsGdsmCdsmCdsGdsGksTksmCk 53.9 584 599 519
569426 GksTksGksAdsTdsmCdsmCdsAdsmCdsmCdsGdsmCdsmCdsGksGksTk 54.1 585 600 520
569427 mCksGksTksGdsAdsTdsmCdsmCdsAdsmCdsmCdsGdsmCdsmCksGksGk 34.8 586 601 521
569428 mCksAksTksmCdsmCdsTdsGdsGdsAdsAdsGdsGdsmCdsGksAksAk 71 611 626 522
569429 TksmCksAksTdsmCdsmCdsTdsGdsGdsAdsAdsGdaGdsmCksGksAk 51.1 612 627 523
569430 AksGksTksTdsmCdsTdsmCdsAdsTdsmCdsmCdsTdsGdsGksAksAk 69.2 617 632 524
569431 TksAksGksTdsTdsmCdsTdsmCdsAdsTdsmCdsmCdsTdsGksGksAk 48.6 618 633 525
569432 GksTksAksGdsTdsTdsmCdsTdsmCdsAdsTdsmCdsmCdsTksGksGk 29.6 619 634 526
569433 mCksAksGksGdsTdsAdsmCdsAdsGdsGdsTdsAdsGdsTksTksmCk 36.5 628 643 527
569434 mCksmCksAksGdsGdsTdsAdsmCdsAdsGdsGdsTdsAdsGksTksTk 51 629 644 528
560435 GksAksmCksmCdsAdsGdsGdsTdsAdsmCdsAdsGdsGdsTksAksGk 49.9 631 646 529
569436 mCksTksmCksmCdsAdsTdsGdsAdsmCdsmCdsAdsGdsGdsTksAksmCk 41 637 652 530
569437 AksmCksTksmCdsmCdsAdsTdsGdsAdsmCdsmCdsAdsGdsGksTksAk 32.9 638 653 531
569438 TksAksmCksTdsmCdsmCdsAdsTdsGdsAdsmCdsmCdsAdsGksGksTk 25.7 639 654 532
569439 AksTksAksmCdsTdsmCdsmCdsAdsTdsGdsAdsmCdsmCdsAksGksGk 9.4 640 655 533
569440 AksAksTksAdsmCdsTdsmCdsmCdsAdsTdsGdsAdsmCdsmCksAksGk 21.2 641 656 534
569441 TksAksAksTdsAdsmCdsTdsmCdsmCdsAdsTdsGdsAdsmCksmCksAk 30.8 642 657 535
569442 GksTksAksAdsTdsAdsmCdsTdsmCdsmCdsAdsTdsGdsAksmCksmCk 29.8 643 658 536
569443 mCksGksTksAdsAdsTdsAdsmCdsTdsmCdsmCdsAdsTdsGksAksmCk 25.3 644 659 537
569444 mCksTksTksGdsmCdsTdsmCdsAdsGdsmCdsAdsGdsTdsGksTksmCk 19.3 676 691 538
569445 AksmCksTksTdsGdsmCdsTdsmCdsAdsGdsmCdsAdsGdsTksGksTk 35 677 692 539
569446 AksAksmCksTdsTdsGdsmCdsTdsmCdsAdsGdsmCdsAdsGksTksGk 30 678 693 540
569447 AksAksAksmCdsTdsTdsGdsmCdsTdsmCdsAdsGdsmCdsAksGksTk 32.2 679 694 344
569448 mCksmCksAksAdsAdsmCdsTdsTdsGdsmCdsTdsmCdsAdsGksmCksAk 30.1 681 696 346
569449 mCksmCksmCksAdsAdsAdsmCdsTdsTdsGdsmCdsTdsmCdsAksGksmCk 18.4 682 697 347
569450 mCksmCksmCksmCdsAdsAdsAdsmCdsTdsTdsGdsmCdsTdsmCksAksGk 44.8 683 698 348
569451 GksmCksTksmCdsmCdsmCdsmCdsAdsAdsAdsmCdsTdsTdsGksmCksTk 47 686 701 541
569452 mCksGksmCksTdsmCdsmCdsmCdsmCdsAdsAdsAdsmCdsTdsTksGksmCk 35.4 687 702 542
569453 mCksmCksGksmCdsTdsmCdsmCdsmCdsmCdsAdsAdsAdsmCdsTksTksGk 46.6 688 703 543
569454 TksmCksmCksGdsmCdsTdsmCdsmCdsmCdsmCdsAdsAdsAdsmCksTksTk 29.4 689 704 544
569455 AksTksmCksmCdsGdsmCdsTdsmCdsmCdsmCdsmCdsAdsAdsAksmCksTk 36.9 690 705 545
569456 AksAksTksmCdsmCdsGdsmCdsTdsmCdsmCdsmCdsmCdsAdsAksAksmCk 32.9 691 706 546
569457 GksAksAksTdsmCdsmCdsGdsmCdsTdsmCdsmCdsmCdsmCdsAksAksAk 41.7 692 707 547
569458 GksGksAksAdsTdsmCdsmCdsGdsmCdsTdsmCdsmCdsmCdsmCksAksAk 36.4 693 708 548
569459 mCksGksGksAdsAdsTdsmCdsmCdsGdsmCdsTdsmCdsmCdsmCksmCksAk 30 694 709 549
569460 mCksmCksGksGdsAdsAdsTdsmCdsmCdsGdsmCdsTdsmCdsmCksmCksmCk 26.5 695 710 550
569461 GksmCksmCksGdsGdsAdsAdsTdsmCdsmCdsGdsmCdsTdsmCksmCksmCk 36.5 696 711 551
569462 AksGksAksAdsGdsmCdsGdgmCdsGdsmCdsmCdsAdsTdsmCksTksmCk 26 713 728 552
569463 TksAksGksAdsAdsGdsmCdsGdsmCdsGdsmCdsmCdsAdsTksmCksTk 40.3 714 729 553
569464 GksTksAksGdsAdsAdsGdsmCdsGdsmCdsGdsmCdsmCdsAksTksmCk 28.9 715 730 554
569465 GksGksTksAdsGdsAdsAdsGdsmCdsGdsmCdsGdsmCdsmCksAksTk 35.7 716 731 555
569466 AksGksGksTdsAdsGdsAdsAdsGdsmCdsGdsmCdsGdsmCksmCksAk 31.1 717 732 556
569467 mCksAksGksGdsTdsAdsGdsAdACkGdsmCdsGdsmCdsGksmCksmCk 14.8 718 733 557
569468 mCksmCksAksGdsGdsTdsAdsGdsAdsAdsGdsmCdsGdsmCksGksmCk 32.1 719 734 558
569469 GksmCksmCkAdsGdsGdsTdsAdsGdsAdsAdsGdsmCdsGksmCksGk 54.5 720 735 559
569470 mCksGksmCksmCdsAdsGdsGdsTdsAdsGdsAdsAdsGdsmCksGksmCk 50.5 721 736 560
569471 mCksmCksGksmCdsmCdsAdsGdsGdsTdsAdsGdsAdsAdsGksmCksGk 56.6 722 737 561
569472 TksmCksmCksGdsmCdsmCdsAdsGdsGdsTdsAdsGdsAdsAksGksmCk 44.1 723 738 562
569473 GksAksmCksAdsAdsTdsmCdsTdsmCdsmCdsGdsmCdsmCdsAksGksGk 14.2 730 745 29
569474 TksGksAksmCdsAdsAdsTdsmCdsTdsmCdsmCdsGdsmCdsmCksAksGk 25.9 731 746 563
569475 AksTksGksAdsmCdsAdsAdsTdsmCdsTdsmCdsmCdsGdsmCksmCksAk 28.7 732 747 564
569476 mCksAksTksGdsAdsmCdsAdsAdsTdsmCdsTdsmCdsmCdsGksmCksmCk 27.4 733 748 565
569477 mCksmCksAksTdsGdsAdsmCdsAdsAdsTdsmCdsTdsmCdsmCksGksmCk 52.4 734 749 566
569478 GksmCksmCksAdsTdsGdsAdsmCdsAdsAdsTdsmCdsTdsmCksmCksGk 50.5 735 750 567
569479 GksGksmCksmCdsAdsTdsGdsAdsmCdsAdsAdsTdsmCdsTksmCksmCk 48.4 736 751 568

TABLE 14
Inhibition of human DMPK RNA transcript in HepG2 cells targeting SEQ ID NO: 2
Start Site Stop Site
ISIS % Target on Seq on Seq Seq ID
No. Sequence Expression ID: 2 ID: 2 No.
UTC N/A 100 N/A N/A
445569 mCesGesGesAesGesmCdsGdsGdsTdsTdsGdsTdsGdsAdsAdsmCesTesGesGesmCe 31.4 13226 13245 24
486178 AksmCksAksAdsTdsAdsAdsAdsTdsAdsmCdsmCdsGdsAksGksGk 25.3 13836 13851 23
570801 mCksmCksAksAdsmCdsTdsGdsTdsTdsmCdsTdsmCdsTdsTksAksGk 22.7 10165 10180 569
570802 AksAksmCksmCdsAdsAdsmCdsTdsGdsTdsTdsmCdsTdsmCksTksTk 22.6 10167 10182 570
570803 mCksmCksAksGdsTdsAdsAdsTdsAdsAdsAdsAdsGdsmCksTksGk 37.4 10190 10205 571
570804 GksTksmCksmCdsAdsGdsTdsAdsAdsTdsAdsAdsAdsAksGksmCk 24.9 10192 10207 572
570805 GksTksTksGdsTdsmCdsmCdsAdsGdsTdsAdsAdsTdsAksAksAk 23.8 10195 10210 573
570806 AksTksGksTdsTdsGdsTdsmCdsmCdsAdsGdsTdsAdsAksTksAk 21.9 10197 10212 574
570807 TkAksAksTdsGdsTdsTdsGdsTdsmCdsmCdsAdsGdsTksAksAk 20 10199 10214 575
570808 TksGksTksAdsAdsTdsGdsTdsTdsGdsTdsmCdsmCdsAksGksTk 11.5 10201 10216 31
570809 TksTksmCksAdsAdsTdsmCdsmCdsTdsGdsAdsmCdsmCdsmCksAksmCk 34.7 10279 10294 576
570810 GksGksTksTdsmCdsAdsAdsTdsmCdsmCdsTdsGdsAdsmCksmCksmCk 76.4 10281 10296 577
570811 TksGksGksGdsTdsTdsmCdsAdsAdsTdsmCdsmCdsTdsGkAksmCk 72.4 10283 10298 578
570812 GksAksTksGdsGdsGdsTdsTdsmCdsAdsAdsTdsmCdsmCksTksGk 49 10285 10300 579
570813 AksGksGksAdsTdsGdsGdsGdsTdsTdsmCdsAdsAdsTksmCksmCk 80.8 10287 10302 580
570814 AksGksAksGdsGdsAdsTdsGdsGdsGdsTdsTdsmCdsAksAksTk 43.3 10289 10304 581
570815 AksTksAksGdsAdsGdsGdsAdsTdsGdsGdsGdsTdsTksmCksAk 63.2 10291 10306 582
570816 mCksmCksmCksTdsmCdsmCdsTdsGdsTdsGdsGdsGdsAdsAksmCksAk 38.8 10349 10364 583
570817 GksTksmCksmCdsmCdsTdsmCdsmCdsTdsGdsTdsGdsGdsGksAksAk 91 10351 10366 584
570818 mCksAksGksTdsmCdsmCdsmCdsTdsmCdsmCdsTdsGdsTdsGksGksGk 64.8 10353 10368 585
570819 AksGksmCksAdsGdsTdsmCdsmCdsmCdsTdsmCdsmCdsTdsGksTksGk 28.5 10355 10370 586
570820 AksmCksTksmCdsAdsGdsmCdsTdsGdsTdsGdsGdsGdsAksAksGk 62.9 10417 10432 587
570821 mCksmCksmCksAdsmCdsTdsmCdsAdsGdsmCdsTdsGdsTdsGksGksGk 79.9 10420 10435 588
570822 AksmCksmCksmCdsmCdsAdsmCdsTdsmCdsAdsGdsmCdsTdsGksTksGk 47.5 10422 10437 589
570823 AksmCksAksmCdsmCdsmCdsmCdAdsmCdsTdsmCdsAdsGdsmCksTksGk 78.1 10424 10439 590
570824 GksmCksAksmCdsAdsmCdsmCdsmCdsmCdsAdsmCdsTdsmCdsAksGksmCk 82.5 10426 10441 591
570825 TksmCksAksGdsmCdsAdsmCdsAdsmCdsmCdsmCdsmCdsAdsmCksTksmCk 52.6 10429 10444 592
570826 GksTksGksGdsTdsmCdsmCdsTdsAdsAdsGdsAdsmCdsTksGksGk 30.9 10474 10489 593
570827 GksAksTksGdsTdsGdsGdsTdsmCdsmCdsTdsAdsAdsGksAksmCk 25.5 10477 10492 594
570828 mCksAksGksAdsTdsGdsTdsGdsGdsTdsmCdsmCdsTdsAksAksGk 18.6 10479 10494 595
570829 mCksmCksTksmCdsmCdsAdsmCdsAdsGdsAdsTdsGdsTdsGksGksTk 44.5 10485 10500 596
570830 mCksAksmCksmCdsTdsmCdsmCdsAdsmCdsAdsGdsAdsTdsGksTksGk 67.4 10487 10502 597
570831 GksGksmCksmCdsAdsmCdsmCdsTdsmCdsmCdsAdsmCdsAdsGksAksTk 56.3 10490 10505 598
570832 TksGksmCksTdsTdsGdsGdsmCdsTdsmCdsTdsGdsGdsmCksmCksAk 42.4 10501 10516 599
570833 AksmCksTksGdsmCdsTdsTdsGdsGdsmCdsTdsmCdsTdsGtsGksmCk 16 10503 10518 600
570834 AksGksAksmCdsTdsGdsmCdsTdsTdsGdsGdsmCdsTdsmCksTksGk 47.5 10505 10520 601
570835 GksGksAksGdsAdsmCdsTdsGdsmCdsTdsTdsGdsGdsmCksTksmCk 37.2 10507 10522 602
570836 TksGksmCksAdsGdsAdsmCdsmCdsmCdsmCdsTdsmCdsTdsTksMCksTk 63.1 10556 10571 603
570837 mCksTksmCksmCdsTdsmCdsmCdsmCdsTdsTdsGdsAdsmCdsAksTksGk 60.7 10579 10594 604
570838 mCksmCksAksGdsAdsmCdsmCdsmCdsmCdsmCdsAdsTdsGdsTksTksmCk 42.9 10609 10624 605
570839 GksTksmCksmCdsAdsGdsAdsmCdsmCdsmCdsmCdsmCdsAdsTksGksTk 64.3 10611 10626 606
570840 GksGksGksTdsmCdsmCdsAdsGdsAdsmCdsmCdsmCdsmCdsmCksAksTk 68.5 10613 10628 607
570841 AksmCksmCksTdsTdsmCdsTdsGdsmCdsAdsGdsGdsGdsAksmCksTk 14.9 10631 10646 608
570842 TksAksAksAdsmCdsmCdsTdsTdsmCdsTdsGdsmCdsAdsGksGksGk 51.7 10634 10649 609
570843 GksAksAksAdsAdsGdsmCdsmCdsmCdsTdsGdsmCdsmCdsmCksmCksTk 46.3 10684 10699 610
570844 TksAksGksGdsAdsAdsAdsAdsGdsmCdsmCdsmCdsTdsGksmCksmCk 52.3 10687 10702 611
570845 mCksTksTksAdsGdsGdsAdsAdAdsAdsGdsmCdsmCdsmCksTksGk 53.8 10689 10704 612
570846 TksGksmCksTdsTdsAdsGdsGdsAdsAdsAdsAdsGdsmCksmCksmCk 47.8 10691 10706 613
570847 TksmCksTksGdsmCdsTdsTdsAdsGdsGdsAdsAdsAdsAksGksmCk 43.9 10693 10708 614
570848 mCksTksmCksmCdsTdsmCdsTdsGdsmCdsTdsTdsAdsGdsGksAksAk 67.9 10697 10712 615
570849 mCksmCksmCksTdsmCdsmCdsTdsmCdsTdsGdsmCdsTdsTdsAksGksGk 50.8 10699 10714 616
570850 mCksTksGksAdsTdsTdsTdsGdsAdsGdsGdsAdsAdsGksGksGk 41.1 10759 10774 617
570851 TksmCksmCksTdsGdsAdsTdsTdsTdsGdsAdsGdsGdsAksAksGk 87.4 10761 10776 618
570852 mCksmCksTksmCdsmCdsTdsGdsAdsTdsTdsTdsGdsAdsGksGksAk 75.8 10763 10778 619
570853 GksAksmCksmCdsTdsmCdsmCdsTdsGdsAdsTdsTdsTdsGksAksGk 87.4 10765 10780 620
570854 AksAksGksAdsmCdsmCdsTdsmCdsmCdsTdsGdsAdsTdsTksTksGk 60.3 10767 10782 621
570855 mCksmCksAksAdsGdsAdsmCdsmCdsTdsmCdsmCdsTdsGdsAksTksTk 61.4 10769 10784 622
570856 mCksTksGksmCdsTdsTdsmCdsmCdsAdsAdsGdsAdsmCdsmCksTksmCk 40.4 10775 10790 623
570857 AksGksmCksTdsGdsmCdsTdsTdsmCdsmCdsAdsAdsGdsAksmCksmCk 48.5 10777 10792 624
570858 GksmCksAksGdsmCdsTdsGdsmCdsTdsTdsmCdsmCdsAdsAksGksAk 87.7 10779 10794 625
570859 mCksTksGksGdsTdsGdsGdsAdsGdsAdsAdsmCdsmCdsAksGksAk 92.6 10816 10831 626
570860 mCksTksmCksTdsGdsGdsTdsGdsGdsAdsGdsAdsAdsmCksmCksAk 86.6 10818 10833 627
570861 TksTksmCksTdsmCdsTdsGdsGdsTdsGdsGdsAdsGdsAksAksmCk 82.6 10820 10835 628
570862 GksAksTksTdsmCdsTdsmCdsTdsGdsGdsTdsGdsGdsAksGksAk 76.1 10822 10837 629
570863 AksmCksTksTdsAdsmCdsTdsGdsTdsTdsTdsmCdsAdsTksmCksmCk 80.6 10981 10996 630
570864 mCksGksGksAdsmCdsmCdsmCdsmCdsmCdsTdsmCdsmCdsmCdsmCksTksmCk 58.7 11002 11017 631
570865 GksAksmCksGdsGdsAdsmCdsmCdsmCdsmCdsmCdsTdsmCdsmCksmCksmCk 61.5 11004 11019 632
570866 mCksTksGksAdsmCdsGdsGdsAdsmCdsmCdsmCdsmCdsmCdsTksmCksmCk 47.6 11006 11021 633
570867 mCksmCksmCksTdsGdsAdsmCdsGdsGdsAdsmCdsmCdsmCdsmCksmCksTk 69.5 11008 11023 634
570868 AksAksGksmCdsmCdsmCdsTdsmCdsAdsmCdsmCdsTdsTdsTksTksmCk 54 11036 11051 635
570869 GksGksAksAdsGdsmCdsmCdsmCdsTdsmCdsAdsmCdsmCdsTksTksTk 37.5 11038 11053 636
570870 mCksGksGksGdsAdsAdsGdsmCdsmCdsmCdsTdsmCdsAdsmCksmCksTk 70.7 11040 11055 637
570871 mCksmCksmCksGdsGdsGdsAdsAdsGdsmCdsmCdsmCdsTdsmCksAksmCk 71.2 11042 11057 638
570872 mCksAksmCksmCdsmCdsGdsGdsGdsAdsAdsGdsmCdsmCdsmCksTksmCk 51.6 11044 11059 639
570873 GksmCksmCksAdsmCdsmCdsmCdsGdsGdsGdsAdsAdsGdsmCksmCksmCk 45.8 11046 11061 640
570874 AksmCksGksmCdsmCdsAdsmCdsmCdsmCdsGdsGdsGdsAdsAksGksmCk 31.8 11048 11063 641
570875 mCkTksGksTdsTdsmCdsAdsGdsGdsAdsAdsGdsTdsmCksmCksmCk 14.3 11082 11097 642
570876 TksTksmCksTdsGdsTdsTdsmCdsAdsGdsGdsAdsAdsGksTksmCk 18 11084 11099 643
570877 GksmCksTksTdsmCdsTdsGdsTdsTdsmCdsAdsGdsGdsAksAksGk 44 11086 11101 644

TABLE 15
Inhibition of human DMPK RNA transcript in HepG2 cells targeting SEQ ID NO: 2
Start Site Stop Site
ISIS % Target on Seq on Seq Seq ID
No. Sequence Expression ID: 2 ID: 2 No.
UTC N/A 100 N/A N/A
445569 mCesGesGesAesGesmCdsGdsGdsTdsTdsGdsTdsGdsAdsAdsmCesTesGesGesmCe 55 13226 13245 24
486178 AksmCksAksAdsTdsAdsAdsAdsTdsAdsmCdsmCdsGdsAksGksGk 33.9 13836 13851 23
570647 GkgmCksTksTdsGdsGdsGdsmCdsmCdsmCdsAdsmCdsmCdsmCksmCksTk 80.3 5718 5733 645
570648 AksGksGksmCdsTdsTdsGdsGdsGdsmCdsmCdsmCdsAdsmCksmCksmCk 92.3 5720 5735 646
570649 mCksGksAksGdsGdsmCdsTdsTdsGdsGdsGdsmCdsmCdsmCksAksmCk 100.7 5722 5737 647
570650 AksGksmCksGdsAdsGdsGdsmCdsTdsTdsGdsGdsGdsmCksmCksmCk 75.8 5724 5739 648
570651 AksGksAksGdsmCdsGdsAdsGdsGdsmCdsTdsTdsGdsGksGksmCk 99.8 5726 5741 649
570652 GksmCksAksGdsAdsGdsmCdsGdsAdsGdsGdsmCdsTdsTksGksGk 135.4 5728 5743 650
570653 GksAksGksmCdsAdsGdsAdsGdsmCdsGdsAdsGdsGdsmCksTksTk 111.5 5730 5745 651
570654 AksAksAksGdsGdsAdsGdsmCdsAdsGdsAdsGdsmCdsGksAksGk 87.5 5734 5749 652
570655 mCksAksAksAdsAdsGdsGdsAdsGdsmCdsAdsGdsAdsGksmCksGk 94.5 5736 5751 653
570656 TksGksGksAdsmCdsmCdsAdsAdsAdsAdsGdsGdsAdsGksmCksAk 75.4 5741 5756 654
570657 mCksmCksTksGdsGdsAdsmCdsmCdsAdsAdsAdsAdsGdsGksAksGk 87.3 5743 5758 655
570658 mCksAksmCksmCdsTdsGdsGdsAdsmCdsmCdsAdsAdsAdsAksGksGk 93.2 5745 5760 656
570659 mCksGksmCksAdsmCdsmCdsTdsGdsGdsAdsmCdsmCdsAdsAksAksAk 70 5747 5762 657
570660 GksAksmCksmCdsGdsmCdsAdsmCdsmCdsTdsGdsGdsAdsmCksmCksAk 46.4 5750 5765 658
570661 AksmCksmCksTdsTdsGdsTdsAdsGdsTdsGdsGdsAdsmCksGksAk 44 5951 5966 659
570662 TksmCksAksmCdsmCdsTdsTdsGdsTdsAdsGdsTdsGdsGksAksmCk 76.8 5953 5968 660
570663 GkcmCksTksmCdsAdsmCdsmCdsTdsTdsGdsTdsAdsGdsTksGksGk 69.5 5955 5970 661
570664 GksGksAksGdsAdsGdsGdsAdsGdsGdsmCdsGdsAdsTksAksGk 88.2 6015 6030 662
570665 AksGksGksGdsAdsGdsAdsGdsGdsAdsGdsGdsmCdsGksAksTk 96.9 6017 6032 663
570666 mCksTksmCksmCdsTdsGdsmCdsTdsmCdsAdsGdsAdsGdsGksGksAk 74.7 6028 6043 664
570667 GksTksgskmCdsTdsmCdsmCdsTdsGdsmCdsTdsmCdsAdsGksAksGk 77.5 6031 6046 665
570668 AksGksGksTdsGdsmCdsTdsmCdsmCdsTdsGdsmCdsTdsmCksAksGk 76.7 6033 6048 666
570669 AksGksAksGdsGdsTdsGdsmCdsTdsmCdsmCdsTdsGdsmCksTksmCk 43.3 6035 6050 667
570670 AksGksAksGdsAdsGdsGdsTdsGdsmCdsTdsmCdsmCdsTksGksmCk 27.1 6037 6052 668
570671 AksmCksmCksmCdsmCdsGdsmCdsmCdsmCdsmCdsmCdsGdsmCdsTksmCksAk 42.6 6291 6306 669
570672 mCksTksAksmCdsmCdsmCdsmCdsGdsmCdsmCdsmCdsmCdsmCdsGksmCksTk 44.9 6293 6308 670
570673 AksmCksmCksTdsAdsmCdsmCdsmCdsmCdsGdsmCdsmCdsmCdsmCksmCksGk 36.6 6295 6310 671
570674 GksTksAksmCdsmCdsTdsAdsmCdsmCdsmCdsmCdsGdsmCdsmCksmCksmCk 52 6297 6312 672
570675 AksGksGksTdaAdsmCdsmCdsTdsAdsmCdsmCdsmCdsmCdsGksmCksmCk 56.4 6299 6314 673
570676 GksGksGksAdsGdsGdsTdsTdsmCdsmCdsmCdsGdsmCdsAksGksmCk 51.4 6329 6344 674
570677 GksTksmCksmCdsTdsTdsAdsmCdsTdsmCdsmCdsAdsAdsmCksTksTk 28 6360 6375 675
570678 mCksTksGksTdsmCdsmCdsTdsTdsAdsmCdsTdsmCdsmCdsAksAksmCk 33.6 6362 6377 676
570679 mCksAksmCksTdsGdsTdsmCdsmCdsTdsTdsAdsmCdsTdsmCksmCksAk 7.9 6364 6379 677
570680 GksGksmCksAdsmCdsTdsGdsTdsmCdsmCdsTdsTdsAdsmCksTksmCk 20.2 6366 6381 678
570681 TksAksGksGdsmCdsAdsmCdsTdsGdsTdsmCdsmCdsTdsTksAksmCk 38.3 6368 6383 679
570682 GksGksTksAdsGdsGdsmCdsAdsmCdsTdsGdsTdsmCdsmCksTksTk 13.9 6370 6385 680
570683 GksTksmCksAdsmCdsTdsGdsmCdsTdsGdsGdsGdsTdsmCksmCksTk 29 6445 6460 681
570684 GksGksTksmCdsAdsmCdsTdsGdsmCdsTdsGdsGdsGdsTksmCksmCk 21.3 6446 6461 43
570685 AksGksGksTdsmCdsAdsmCdsTdsGdsmCdsTdsGdsGdsGksTksmCk 16.9 6447 6462 682
570686 mCksTksAksGdsGdsTdsmCdsAdsmCdsTdsGdsmCdsTdsGksGksGk 19.6 6449 6464 683
570687 GksTksmCksTdsAdsGdsGdsTdsmCdsAdsmCdsTdsGdsmCksTksGk 15.7 6451 6466 684
570688 AksAksGksTdsmCdsTdsAdsGdsGdsTdsmCdsAdsmCdsTksGksmCk 16.6 6453 6468 685
570689 GksmCksAksmCdsTdsmCdsmCdsAdsTdsTdsGdsTdsmCdsTksmCksAk 13.2 6530 6545 686
570690 mCksTksGksmCdsAdsmCdsTdsmCdsmCdsAdsTdsTdsGdsTksmCksTk 50.1 6532 6547 687
570691 mCksmCksmCksTdsGdsmCdsAdsmCdsTdsmCdsmCdsAdsTdsTksGksTk 48.4 6534 6549 688
570692 mCksmCksmCksmCdsmCdsTdsGdsmCdsAdsmCdsTdsmCdsmCdsAksTksTk 74 6536 6551 689
570693 mCksTksTksGdsmCdsTdsGdsAdsGdsTdsmCdsAdsGdsGksAksGk 25.3 6559 6574 690
570694 TksmCksmCksTdsTdsGdsmCdsTdsGdsAdsGdsTdsmCdsAksGksGk 39.5 6561 6576 691
570695 mCksTksTksmCdsmCdsTdsTdsGdsmCdsTdsGdsAdsGdsTksmCksAk 22.9 6563 6578 692
570696 AksmCksmCksTdsTdsmCdsmCdsTdsTdsGdsmCdsTdsGdsAksGksTk 52.5 6565 6580 693
570697 GksGksAksmCdsmCdsTdsTdsmCdsmCdsTdsTdsGdsmCdsTksGksAk 37.6 6567 6582 694
570698 mCksAksGksGdsAdsmCdsmCdsTdsTdsmCdsmCdsTdsTdsGksmCksTk 44.2 6569 6584 695
570699 AksGksmCksmCdsmCdsTdsmCdsmCdsAdsGdsGdsAdsmCdsmCksTksTk 26.6 6576 6591 696
570700 TkAksGksmCdsTdsmCdsmCdsmCdsmCdsAdsmCdsTdsmCdsmCksAksGk 33.6 6594 6609 697
570701 GksAksTksAdsGdsmCdsTdsmCdsmCdsmCdsmCdsAdsmCdsTksmCksmCk 20.4 6596 6611 698
570702 mCksAksGksAdsTdsAdsGdsmCdsTdsmCdsmCdsmCdsmCdsAksmCksTk 33.8 6598 6613 699
570703 mCksTksmCksAdsGdsAdsTdsAdsGdsmCdsTdsmCdsmCdsmCksmCksAk 25.8 6600 6615 700
570704 AksGksmCksTdsmCdsAdsGdsAdsTdsAdsGdsmCdsTdsmCksmCksmCk 29.1 6602 6617 701
570705 TksmCksAksGdsmCdsTdsmCdsAdsGdsAdsTdsAdsGdsmCksTksmCk 47.4 6604 6619 702
570706 TksmCksTksmCdsAdsGdsmCdsTdsmCdsAdsGdsAdsTdsAksGksmCk 33.4 6606 6621 703
570707 GksAksGksTdsmCdsmCdsTdsmCdsTdsmCdsmCdsTdsGdsmCksTksTk 49 6636 6651 704
570708 GksGksAksGdsGdsAdsGdsTdsmCdsmCdsTdsmCdsTdsmCksmCksTk 79.2 6640 6655 705
570709 GksAksGksGdAdsGdsGdsAdsGdsTdsmCdsmCdsTdsmCksTksmCk 63.3 6642 6657 706
570710 mCksAksAksAdsAdsGdsGdsGdsmCdsAdsmCdsmCdsmCdsAksGksAk 38.8 6713 6728 707
570711 AksGksmCksAdsAdsAdsAdsGdsGdsGdsmCdsAdsmCdsmCksmCksAk 13.7 6715 6730 708
570712 GksGksAksTdsmCdsmCdsmCdsmCdsAdsGdsTdsAdsTdsTksGksTk 45.8 6733 6748 709
570713 mCksTksGksGdsAdsTdsmCdsmCdsmCdsmCdsAdsGdsTdsAksTksTk 45.6 6735 6750 710
570714 TksGksmCksTdsGdsGdsAdsTdsmCdsmCdsmCdsmCdsAdsGksTksAk 43.6 6737 6752 711
570715 AksTksTksmCdsTdsmCdsTdsAdsGdsAdsmCdsTdsGdsmCksAksAk 18.3 6789 6804 712
570716 TksAksAksTdsTdsmCdsTdsmCdsTdsAdsGdsAdsmCdsTksGksmCk 15.1 6791 6806 713
570717 TksmCksTksAdsAdsTdsTdsmCdsTdsmCdsTdsAdsGdsAksmCksTk 49.9 6793 6808 714
570718 TksmCksTksmCdsTdAdsAdsTdsTdsmCdsTdsmCdsTdsAksGksAk 77.6 6795 6810 715
570719 mCksTksmCksmCdsAdsTdsAdsAdsTdsTdsmCdsTdsmCdsTksAksAk 42 6804 6819 716
570720 AksmCksTksmCdsTdsmCdsmCdsAdsTdsAdsAdsTdsTdsmCksTksmCk 28.5 6807 6822 717
570721 AksmCksAksmCdsTdsmCdsTdsmCdsmCdsAdsTdsAdsAdsTksTksmCk 27.4 6809 6824 718
570722 mCksmCksAksmCdsAdsmCdsTdsmCdsTdsmCdsmCdsAdsTdsAksAksTk 35.4 6811 6826 719
570723 TksGksmCksmCdsAdsmCdsAdsmCdsTdsmCdsTdsmCdsmCdsAksTksAk 45 6813 6828 720

TABLE 16
Inhibition of human DMPK RNA transcript in HepG2 cells targeting SEQ ID NO: 2
Start Site Stop Site
ISIS % Target on Seq on Seq Seq ID
No. Sequence Expression ID: 2 ID: 2 No.
UTC N/A 100 N/A N/A
445569 mCesGesGesAesGesmCdsGdsGdsTdsTdsGdsTdsGdsAdsAdsmCesTesGesGesmCe 33.9 13226 13245 24
486178 AksmCksAksAdsTdsAdsAdsAdsTdsAdsmCdsmCdsGdsAksGksGk 21.5 13836 13851 23
570339 mCksmCksmCksAdsTdsGdsmCdsmCdsmCdsAdsTdsmCdsmCdsTksGksmCk 56.2 1534 1549 721
570340 GksGksAksmCdsAdsGdsAdsGdsAdsAdsAdsTdsGdsTksTksGk 46.7 1597 1612 722
570341 GksGksmCksAdsTdsAdsGdsGdsAdsmCdsAdsGdsAdsGksAksAk 35.6 1603 1618 723
570342 GksTksGksGesmCdsAdsTdsAdsGdsGdsAdsmCdsAdsGksAksGk 34.8 1605 1620 724
570343 TksGksGksTdsGdsGdsmCdsAdsTdsAdsGdsGdsAdsmCksAksGk 60.3 1607 1622 725
570344 mCksTksTksAdsmCdsTdsmCdsTdsGdsmCdsmCdsmCdsmCdsTksmCksmCk 49.6 1627 1642 726
570345 AksmCksmCksTdsTdsAdsmCdsTdsmCdsTdsGdsmCdsmCdsmCksmCksTk 48.6 1629 1644 727
570346 TksGksAksmCdsmCdsTdsTdsAdsmCdsTdsmCdsTdsGdsmCksmCksmCk 36.8 1631 1646 728
570347 GksmCksTksGdsAdsmCdsmCdsTdsTdsAdsmCdsTdsmCdsTksGksmCk 53.5 1633 1648 729
570348 mCksTksGksmCdsTdsGdsAdsmCdsmCdsTdsTdsAdsmCdsTksmCksTk 59 1635 1650 730
570349 mCksTksmCksTdsGdsmCdsTdsGdsAdsmCdsmCdsTdsTdsAksmCksTk 70.8 1637 1652 731
570350 GksmCksmCksTdsmCdsTdsGdsmCdsTdsGdsAdsmCdsmCdsTksTksAk 54 1639 1654 732
570351 mCksmCksAksTdsGdsGdsmCdsTdsmCdsTdsGdsAdsGdsTksmCksAk 52.6 1666 1681 733
570352 AksGksmCksmCdsAdsTdsGdsGdsmCdsTdsmCdsTdsGdsAksGksTk 60.7 1668 1683 734
570353 TksAksAksGdsmCdsmCdsAdsTdsGdsGdsmCdsTdsmCdsTksGksAk 82.3 1670 1685 735
570354 TksAksGksmCdsmCdsTdsGdsmCdsTdsGdsTdsGdsAdsmCksTksmCk 40.8 1687 1702 736
570355 AksTksGksGdsGdsAdsGdsGdsmCdsTdsGdsTdsTdsGksGksmCk 90.7 1707 1722 737
570356 mCksmCksAksTdsGdsGdsGdsAdsGdsGdsmCdsTdsGdsTksTksGk 73.9 1709 1724 738
570357 GksGksmCksmCdsAdsTdsGdsGdsGdsAdsGdsGdsmCdsTksGksTk 94.9 1711 1726 739
570358 GksTksGksmCdsAdsGdsAdsGdsAdsGdsGdsmCdsmCdsAksTksGk 73.5 1720 1735 740
570359 GksAksGksmCdsTdsmCdsmCdsmCdsAdsGdsmCdsAdsTdsGksAksmCk 70.2 1759 1774 741
570360 AksGksGksGdsAdsGdsmCdsTdsmCdsmCdsmCdsAdsGdsmCksAksTk 56.1 1762 1777 742
570361 GksmCksmCksAdsTdsAdsGdsAdsGdsmCdsmCdsmCdsAdsmCksTksTk 54.9 1799 1814 743
570362 GksGksGksmCdsmCksAdsTdsAdsGdsAdsGdsmCdsmCdsmCksAksmCk 78.1 1801 1816 744
570363 AksTksGksmCdsTdsGdsGdsmCdsmCdsmCdsTdsmCdsmCdsTksGksGk 76.2 1848 1863 745
570364 AksGksmCksTdsGdsmCdsmCdsmCdsmCdsAdsTdsGdsmCdsTksGksGk 92.6 1857 1872 746
570365 mCksGksmCksmCdsmCdsmCdsTdsGdsGdsmCdsAdsGdsmCdsTksGksmCk 73.6 1867 1882 747
570366 TksGksmCksGdsmCdsmCdsmCdsmCdsTdsGdsGdsmCdsAdsGksmCksTk 76.6 1869 1884 748
570367 GksmCksTksGdsmCdsGdsmCdsmCdsmCdsmCdsTdsGdsGdsmCksAksGk 79.1 1871 1886 749
570368 mCksGksGksmCdsTdsGdsmCdsGdsmCdsmCdsmCdsmCdsTdsGksGksmCk 82.9 1873 1888 750
570369 GksTksmCksGdsGdsmCdsTdsGdsmCdsGdsmCdsmCdsmCdsmCksTksgk 47.5 1875 1890 751
570370 mCksTksGksTdsmCdsGdsGdsmCdsTdsGdsmCdsGdsmCdsmCksmCksmCk 79.6 1877 1892 752
570371 GksmCksmCksTdsGdsTdsmCdsGdsGdsmCdsTdsdGdsmCdsGksmCksmCk 58.4 1879 1894 753
570372 mCksTksGksmCdsmCdsTdsGdsTdsmCdsGdsGdsmCdsTdsGksmCdsgk 49.9 1881 1896 754
570373 AksmCksmCksTdsGdsmCdsmCdsTdsGdsTdsmCdsGdsGdsmCksTksgk 27.4 1883 1898 755
570374 AksmCksAksmCdsmCdsTdsGdsmCdsmCdsTdsGdsTdsmCdsGksGksmCk 54.3 1885 1900 756
570375 GksAksAksmCdsAdsmCdsmCdsTdsGdsmCdsmCdsTdsGdsTksmCksgk 50.5 1887 1902 757
570376 mCksmCksGksAdsAdsmCdsAdsmCdsmCdsTdsGdsmCdsmCdsTksGkstk 57.7 1889 1904 758
570377 mCksGksmCksmCdsGdsAdsAdsmCdsAdsmCdsmCdsTdsGdsmCksmCkstk 69.3 1891 1906 759
570378 mCksmCksTksGdsGdsGdsmCdsAdsmCdsmCdsTdsGdsTdsTksGksgk 188.2 1925 1940 760
570379 GksTksGksmCdsmCdsTdsGdsGdsGdsmCdsAdsmCdsmCdsTksGkstk 111.5 1928 1943 761
570380 mCksGksmCksmCdsmCdsTdsmCdsmCdsmCdsAdsGdsTdsGdsmCksmCkstk 78 1938 1953 762
570381 AksmCksmCksGdsmCdsmCdsmCdsTdsmCdsmCdsmCdsAdsGdsTksGksmCk 74.9 1940 1955 763
570382 TksmCksAksmCdsmCdsGdsmCdsmCdsmCdsTdsmCdsmCdsmCdsAksGkstk 71.6 1942 1957 764
570383 AksGksTksmCdsAdsmCdsmCdsGdsmCdsmCdsmCdsTdsmCdsmCksmCksak 62.1 1944 1959 765
570384 TksGksAksGdsTdsmCdsAdsmCdsmCdsGdsmCdsmCdsmCdsTksmCksmCk 65.6 1946 1961 766
570385 mCksGksTksGdsAdsGdsTdsmCdsAdsmCdsmCdsGdsmCdsmCksmCkstk 37.3 1948 1963 767
570386 mCksAksAksAdsGdsmCdsTdsGdsGdsTdsTdsmCdsTdsmCksmCksmCk 30.5 1974 1989 768
570387 TksGksmCksAdsAdsAdsGdsmCdsTdsGdsGdsTdsTdsmCksTksmCk 35.8 1976 1991 769
570388 TksmCksTksGdsmCdsAdsAdsAdsAdsGdsmCdsTdsGdsGdsTksTksmCk 30.1 1978 1993 770
570389 TksGksTksmCdsTdsGdsmCdsAdsAdsAdsGdsmCdsTdsGksGkstk 50.1 1980 1995 771
570390 mCksmCksTksGdsTdsmCdsTdsGdsmCdsAdsAdsAdsGdsmCksTksgk 36 1982 1997 772
570391 mCksGksmCksmCdsTdsGdsTdsmCdsTdsGdsmCdsAdsAdsAksGksmCk 31.1 1984 1999 773
570392 TksTksGksTdsmCdsmCdsmCdsTdsmCdsmCdsTdsGdsGdsAksTksmCk 62.9 2022 2037 774
570393 AksGksTksTdsGdsTdsmCdsmCdsmCdsTdsmCdsmCdsTdsGksGksak 57.1 2024 2039 775
570394 AksAksAksGdsTdsTdsGdsTdsmCdsmCdsmCdsTdsmCdsmCksTksgk 56.2 2026 2041 776
570395 mCksmCksAksAdsAdsGdsTdsTdsGdsTdsmCdsmCdsmCdsTksmCksmCk 48.9 2028 2043 777
570396 AksmCksmCksmCdsAdsAdsAdsGdsTdsTdsGdsTdsmCdsmCksmCkstk 59.9 2030 2045 778
570397 GksAksAksmCdsmCdsmCdsAdsAdsAdsGdsTdsTdsGdsTksmCksmCk 47.9 2032 2047 779
570398 GksAksAksGdsAdsAdsmCdsmCdsmCdsAdsAdsAdsGdsTksTksgk 60 2035 2050 780
570399 mCksmCksAksGdsAdsAdsGdsAdsAdsmCdsmCdsmCdsAdsAksAksgk 51.2 2038 2053 781
570400 mCkAksmCksmCdsmCdsAdsGdsAdsAdsGdsAdsAdsmCdsmCksmCksak 51.1 2041 2056 782
570401 GksmCksAksGdsAdsAdsmCdsmCdsTdsAdsmCdsAdsAdsAksAksgk 44.9 2066 2081 783
570402 GksTksGksmCdsAdsGdsAdsAdsmCdsmCdsTdsAdsmCdsAksAksAk 53 2068 2083 784
570403 GksGksGksTdsGdsmCdsAdsGdsAdsAdgmCdsmCdsTdsAksmCksAk 51.5 2070 2085 785
570404 GksTksGksGdsGdsTdsGdsmCdsAdsGdsAdsAdsmCdsmCksTksAk 57.4 2072 2087 786
570405 mCksmCksAksmCdsAdsmCdsGdsGdsmCdsTdsmCdsAdsTdsAksGksGk 54.3 2116 2131 787
570406 AksmCksmCksmCdsAdsmCdsAdsmCdsGdsGdsmCdsTdsmCdsAksTksAk 43.6 2118 2133 788
570407 TksGksAksmCdsmCdsmCdsAdsmCdsAdsmCdsGdsGdsmCdsTksmCksAk 44 2120 2135 789
570408 GksmCksTksGdsAdsmCdsmCdsmCdsAdsmCdsAdsmCdsGdsGksmCksTk 56.5 2122 2137 790
570409 TksGksGksmCdsTdsGdsAdsmCdsmCdsmCdsAdsmCdsAdsmCksGksGk 54.8 2124 2139 791
570410 GksGksTksGdsGdsmCdsTdsGdsAdsmCdsmCdsmCdsAdsmCksAksmCk 46.8 2126 2141 792
570411 AksTksGksGdsTdsGdsGdsmCdsTdsGdsAdsmCdsmCdsmCksAksmCk 73.8 2128 2143 793
570412 GksAksAksTdsGdsGdsTdsGdsGdsmCdsTdsGdsAdsmCksmCksmCk 43.5 2130 2145 794
570413 mCksTksAksAdsAdsGdsGdsAdsmCdsGdsmCdsAdsGdsGksGksAk 54.4 2159 2174 795
570414 AksAksmCksTdsAdsAdsAdsGdsGdsAdsmCdsGdsmCdsAksGksgk 49.1 2161 2176 796
570415 GksAksGksAdsAdsmCdsTdsAdsAdsAdsGdsGdsAdsmCksGksmCk 35.4 2164 2179 797

TABLE 17
Inhibition of human DMPK RNA transcript in HepG2 cells targeting SEQ ID NO: 2
Start Site Stop Site
ISIS % Target on Seq on Seq Seq ID
No. Sequence Expression ID: 2 ID: 2 No.
UTC N/A 100 N/A N/A
445569 mCesGesGsAsGesmCdsGdsGdsTdsTdsGdsTdsGdsAdsAdsmCesTesGesGesmCe 41.4 13226 13245 24
486178 AksmCksAksAdsTdsAdsAdsAdsTdsAdsmCdsmCdsGdsAksGksGk 24 13836 13851 23
570493 AksTksTksGdsGdsTdgmCdsmCdsmCdsAdsAdsGdsmCdsmCksmCksmCk 112.1 3973 3988 798
570494 mCksmCksAksTdsTdsGdsGdsTdsmCdsmCdsmCdsAdsAdsGksmCksmCk 91.3 3975 3990 799
570495 GksmCksmCksmCdsAdsTdsTdsGdsGdsTdsmCdsmCdsmCdsAksAksGk 103.4 3977 3992 800
570496 AksmCksGksmCdsmCdsmCdsAdsTdsTdsGdsGdsTdsmCdsmCksmCksAk 67.8 3979 3994 801
570497 mCksmCksAksmCdsGdsmCdsmCdsmCdsAdsTdsTdsGdsGdsTksmCksmCk 77.3 3981 3996 802
570498 mCksAksmCksmCdsAdsmCdsGdsmCdsmCdsmCdsAdsTdsTdsGksGksTk 98.3 3983 3998 803
570499 AksGksAksmCdsmCdsmCdsAdsAdsmCdsTdsmCdsmCdsAdsmCksmCksmCk 63.7 4036 4051 804
570500 TksmCksAksmCdsmCdsTdsmCdsGdsmCdsmCdsmCdsmCdsTdsmCksTksTk 43 4181 4196 805
570501 mCksmCksTksmCdsAdsmCdsmCdsTdsmCdsGdsmCdsmCdsmCdsmCksTksmCk 38.1 4183 4198 806
570502 AksGksmCksmCdsmCdsmCdsTdsmCdsAdsmCdsmCdsTdsmCdsGksmCksmCk 85.4 4187 4202 807
570503 mCksTksmCksAdsAdsAdsGdsmCdsmCdsmCdsmCdsmCdsmGdsAksmCksGk 115.8 4210 4225 808
570504 AksTksmCksmCdsTdsmCdsAdsAdsAdsGdsmCdsmCdsmCdsmCksmCksmCk 114.5 4213 4228 809
570505 GksGksAksTdsmCdsmCdsTdsmCdsAchAdsAdsGdsmCdsmCksmCksmCk 88.1 4215 4230 810
570506 GksmCksGksGdsAdsTdsmCdsmCdsTdsmCdsAdsAdsAdsGksmCksmCk 93.1 4217 4232 811
570507 GksmCksGksmCdsGdsGdsAdsTdsmCdsmCdsTdsmCdsAdsAksAksGk 102.9 4219 4234 812
570508 GksGksGksmCdsGdsmCdsGdsGdsAdsTdsmCdsmCdsTdsmCksAksAk 78.5 4221 4236 813
570509 GksAksGksmCdsTdsGdsmCdsAdsGdsmCdsmCdsGdsGdsAksGksAk 192.2 4239 4254 814
570510 AksGksGksAdsGdsmCdsTdsGdsmCdsAdsGdsmCdsmCdsGksGksAk 219.8 4241 4256 815
570511 mCksGksGksAdsGdsGdsAdsGdsmCdsTdsGdsmCdsAdsGksmCksmCk 128.6 4244 4259 816
570512 AksmCksmCksmCdsGdsGdsAdsGdsGdsAdsGdsmCdsTdsGksmCksAk 89.9 4247 4262 817
570513 GksmCksAksmCdsmCdsmCdsGdsGdsAdsGdsGdsAdsGdsmCksTksGk 96.1 4249 4264 818
570514 GksGksGksmCdsAdsmCdsmCdsmCdsGdsGdsAdsGdsGdsAksGksmCk 67.8 4251 4266 819
570515 mCksAksGksGdsGdsmCdsAdsmCdsmCdsmCdsGdsGdsAdsGksGkAk 64.2 4253 4268 820
570516 TksGksmCksAdsGdsGdsGdsmCdsAdsmCdsmCdsmCdsGdsGksAksGk 62.2 4255 4270 821
570517 mCksmCksTksGdsmCdsAdsGdsGdsGdsmCdsAdsmCdsmCdsmCksGksgk 77.7 4257 4272 822
570518 mCksGksAksmCdsAdsmCdsmCdsTdsGdsmCdsAdsGdsGdsGksmCksAk 79 4262 4277 823
570519 mCksAksmCksGdsAdsmCdsAdsmCdsmCdsTdsGdsmCdsAdsGksGksGk 68.5 4264 4279 824
570520 AksGksmCksAdsmCdsGdsAdsmCdsAdsmCdsmCdsTdsGdsmCksAksGk 39.8 4266 4281 825
570521 GksAksAksGdsmCdsAdsmCdsGdsAdsmCdsAdsmCdsmCdsTksGksmCk 32.4 4268 4283 826
570522 mCksmCksAksGdsGdsTdsAdsGdsTdsTdsmCdsTdsmCdsAksTksmCk 41 4353 4368 827
570523 mCksAksmCksmCdsAdsGdsGdsTdsAdsGdsTdsTdsmCdsTksmCksAk 71.9 4355 4370 828
570524 mCksTksmCksAdsmCdsmCdsAdsGdsGdsTdsAdsGdsTdsTksmCksTk 105.9 4357 4372 829
570525 AksGksmCksTdsmCdsAdsmCdsmCdsAdsGdsGdsTdsAdsGksTksTk 99.3 4359 4374 830
570526 GksGksAksGdsmCdsTdsmCdsAdsmCdsmCdsAdsGdsGdsTksAksGk 85.2 4361 4376 831
570527 mCksmCksGksGdAdsGdsmCdsTdsmCdsAdsmCdsmCdsAdsGksGksTk 82.5 4363 4378 832
570528 GksmCksmCksmCdsGdsGdsAdsGdsmCdsTdsmCdsAdsmCdsmCksAksGk 60.5 4365 4380 833
570529 TksAksGksAdsGdsmCdsTdsTdsmCdsmCdsTdsmCdsTdsmCksmCksmCk 35.4 4435 4450 834
570530 mCksmCksTksAdsGdsAdsGdsmCdsTdsTdsmCdsmCdsTdsmCksTksmCk 29.4 4437 4452 835
570531 AksTksmCksmCdsTdsAdsGdsAdsGdsmCdsTdsTdsmCdsmCksTksmCk 30.4 4439 4454 836
570532 mCksAksAksTdsmCdsmCdsTdsAdsGdsAdsGdsmCdsTdsTksmCksmCk 30.3 4441 4456 837
570533 mCksmCksmCksAdsAdsTdsmCdsmCdsTdsAdsGdsAdsGdsmCksTksTk 54.1 4443 4458 838
570534 mCksmCksmCksmCdsmCdsAdsAdsTdsmCdsmCdsTdsAdsGdsAksGksmCk 60.1 4445 4460 839
570535 mCksAksmCksmCdsmCdsmCdsmCdsAdsAdsTdsmCdsmCdsTdsAksGksAk 68.5 4447 4462 840
570536 AksGksmCksAdsmCdsmCdsmCdsmCdsmCdsAdsAdsTdsmCdsmCksTksAk 37.5 4449 4464 841
570537 GksmCksAksGdsmCdsAdsmCdsmCdsmCdsmCdsmCdsAdsAdsTksmCksmCk 50.9 4451 4466 842
570538 GksGksGksmCdsAdsGdsmCdsAdsmCdsmCdsmCdsmCdsmCdsAksAksTk 67.7 4453 4468 843
570539 TksGksAksmCdsAdsmCdsAdsmCdsmCdsmCdsTdsmCdsTdsTksAksmCk 55.9 4498 4513 844
570540 mCksmCksTksGdsAdsmCdsAdsmCdsAdsmCdsmCdsmCdsTdsmCksTksTk 45.1 4500 4515 845
570541 mCkAksmCksmCdsTdsGdsAdsmCdsAdsmCdsAdsmCdsmCdsmCksTksmCk 30.9 4502 4517 846
570542 TksmCksmCksAdsmCdsmCdsTdsGdsAdsmCdsAdsmCdsAdsmCksmCksmCk 35 4504 4519 847
570543 mCksAksTksmCdsmCdsAdsmCdsmCdsTdsGdAdsmCdsAdsmCksAksmCk 48 4506 4521 848
570544 mCksTksmCksAdsTdsmCdsmCdsAdsmCdsmCdsTdsGdsAdsmCksAksmCk 37.1 4508 4523 849
570545 mCksmCksmCksTdsmCdsAdsTddsmCdsmCdsAdsmCdsmCdsTdsGksAksmCk 46 4510 4525 850
570546 GksmCksmCksmCdsmCdsTdsmCdsAdsTdsmCdsmCdsAdsmCdsmCksTksGk 79.2 4512 4527 851
570547 AksGksGksmCdsmCdsmCdsmCdsTdsmCdsAdsTdsmCdsmCdsAksmCksmCk 40.7 4514 4529 852
570548 GksAksAksGdsGdsmCdsmCdsmCdsmCdsTdsmCdsAdsTdsmCksmCksAk 35.9 4516 4531 853
570549 AksGksGksTdsAdsAdsGdAdsGdsAdsmCdsmCdsmCdsmCksmCksmCk 18.8 4613 4628 854
570550 mCksmCksAksGdsGdsTdsAdsAdsGdsAdsGdsAdsmCdsmCksmCksmCk 16.2 4615 4630 855
570551 TksTksmCksmCdsAdsGdsGdsTdsAdsAdsGdsAdsGdsAksmCksmCk 38.9 4617 4632 856
570552 mCksmCksAksTdsTdsmCdsmCdsAdsGdsGdsTdsAdsAdsGksAksGk 28.6 4620 4635 857
570553 TksmCksmCksmCdsAdsTdsTdsmCdsmCdsAdsGdsGdsTdsAksAksGk 42.6 4622 4637 858
570554 TksAksTksmCdsmCdsmCdsAdsTdsTdsmCdsmCdsAdsGdsGksTksAk 31.8 4624 4639 859
570555 mCksmCksTksAdsTdsmCdsmCdsmCdsAdsTdsTdsmCdsmCdsAksGksGk 62 4626 4641 860
570556 GksAksmCksmCdsTdsAdsTdsmCdsmCdsmCdsAdsTdsTdsmCksmCksAk 20 4628 4643 861
570557 AksAksGksAdsmCdsmCdsTdsAdsTdsmCdsmCdsmCdsAdsTksTksmCk 29.8 4630 4645 862
570558 TksGksAkAdsGdsAdsmCdsmCdsTdsAdsTdsmCdsmCdsmCksAksTk 45.5 4632 4647 863
570559 TksGksGksmCdsmCdsmCdsmCdsGdsTdsTdsAdsGdsAdsAksTksTk 72.7 4650 4665 864
570560 AksGksTksGdsGdsmCdsmCdsmCdsmCdsGdsTdsTdsAdsGksAksAk 33.7 4652 4667 865
570561 GksmCksAksGdsTdsGdsGdsmCdsmCdsmCdsmCdsGdsTdsTksAksGk 17.5 4654 4669 866
570562 AksGksGksmCdsAdsGdsTdsGdsGdsmCdsmCdsmCdsmCdsGksTksTk 27.9 4656 4671 867
570563 mCksTksAksGdsGdsmCdsAdsGdsTdsGdsGdsmCdsmCdsmCksmCksGk 31.3 4658 4673 868
570564 mCksmCksmCksTdsAdsGdsGdsmCdsAdsGdsTdsGdsGdsmCksmCksmCk 23.8 4660 4675 869
570565 AksGksGksTdsmCdsmCdsmCdsAdsGdsAdsmCdsAdsmCdsTksmCksmCk 17.2 4678 4693 870
570566 AksTksAksGdsGdsTdsmCdsmCdsmCdsAdsGdsAdsmCdsAksmCksTk 33.1 4680 4695 871
570567 GksAksAksTdsAdsGdsGdsTdsmCdsmCdsmCdsAdsGdsAksmCksAk 51.8 4682 4697 872
570568 GksAksGksAdsAdsTdsAdsGdsGdsTdsmCdsmCdsmCdsAksGksAk 20.3 4684 4699 873
570569 mCksAksGksAdsGdsAdsAdsTdsAdsGdsGdsTdsmCdsmCksmCksAk 19 4686 4701 874

TABLE 18
Inhibition of human DMPK RNA transcript in HepG2 cells targeting SEQ ID NO: 2
Start Site Stop Site
ISIS % Target on Seq on Seq Seq ID
No. Sequence Expression ID: 2 ID: 2 No.
UTC N/A 100 N/A N/A
445569 mCesGesGesAesGesmCdsGdsGdsTdsTdsGdsTdsGdsAdsAdsmCesTesGesGesmCe 33.8 13226 13245 24
486178 AksmCksAksAdsTdsAdsAdsAdsTdsAdsmCdsmCdsGdsAksGksGk 24.4 13836 13851 23
570647 GksmCksTksTdsGdsGdsGdsmCdsmCdsmCdsAdsmCdsmCdsmCksmCksTk 60.6 5718 5733 645
570648 AksGksGksmCdsTdsTdsGdsGdsGdsmCdsmCdsmCdsAdsmCksmCksmCk 82 5720 5735 646
570649 mCksGksAksGdsGdsmCdsTdsTdsGdsGdsGdsmCdsmCdsmCksAksmCk 133.4 5722 5737 647
570650 AksGksmCksGdsAdsGdsGdsmCdsTdsTdsGdsGdsGdsmCksmCksmCk 54.1 5724 5739 648
570651 AksGksAksGdsmCdsGdsAdsGdsGdsmCdsTdsTdsGdsGksGksmCk 88.5 5726 5741 649
570652 GksmCksAksGdsAdsGdsmCdsGdsAdsGdsGdsmCdsTdsTksGksGk 162.9 5728 5743 650
570653 GksAksGksmCdsAdsGdsAdsGdsmCdsGdsAdsGdsGdsmCksTksTk 130 5730 5745 651
570654 AksAksAksGdsGdsAdsGdsmCdsAdsGdsAdsGdsmCdsGksAksGk 66.5 5734 5749 652
570655 mCksAksAksAdsAdsGdsGdsAdsGdsmCdsAdsAdsAdsGksmCksGk 79 5736 5751 653
570656 TksGksGksAdsmCdsmCdsAdsAdsAdsAdsGdsGdsAdsGksmCksAk 57.4 5741 5756 654
570657 mCksmCksTksGdsGdsAdsmCdsmCdsAdsAdsAdsAdsGdsGksAksGk 129.2 5743 5758 655
570658 mCksAksmCksmCdsTdsGdsGdsAdsmCdsmCdsAdsAdsAdsAksGksGk 66.3 5745 5760 656
570659 mCksGksmCksAdsmCdsmCdsTdsGdsGdsAdsmCdsmCdsAdsAksAksAk 58.7 5747 5762 657
570660 GksAksmCksmCdsGdsmCdsAdsmCdsmCdsTdsGdsGdsAdsmCksmCksAk 55.4 5750 5765 658
570661 AksmCksmCksTdsTdsGdsTdsAdsGdsTdsGdsGdsAdsmCksGksAk 45.4 5951 5966 659
570662 TksmCksAksmCdsmCdsTdsTdsGdsTdsAdsGdsTdsGdsGksAksmCk 63.5 5953 5968 660
570663 GksmCksTksmCdsAdsmCdsmCdsTdsTdsGdsTdsAdsGdsTksGksGk 56.6 5955 5970 661
570664 GksGksAksGdsAdsGdsGdsAdsGdsGdsmCdsGdsAdsTksAksGk 125.6 6015 6030 662
570665 AksGksGksGdsAdsGdsAdsGdsGdsAdsGdsGdsmCdsGksAksTk 64.2 6017 6032 663
570666 mCksTksmCksmCdsTdsGdsmCdsTdsmCdsAdsGdsAdsGdsGksGksAk 59 6028 6043 664
570667 GksTksGksmCdsTdsmCdsmCdsTdsGdsmCdsTdsmCdsAdsGksAksGk 82.3 6031 6046 665
570668 AksGksGksTdsGdsmCdsTdsmCdsmCdsTdsGdsmCdsTdsmCksAksGk 96.2 6033 6048 666
570669 AksGksAksGdsGdsTdsGdsmCdsTdsmCdsmCdsTdsGdsmCksTksmCk 26.2 6035 6050 667
570670 AksGksAksGdsAdsGdsGdsTdsGdsmCdsTdsmCdsmCdsTksGksmCk 18.2 6037 6052 668
570671 AksmCksmCksmCdsmCdsGdsmCdsmCdsmCdsmCdsmCdsGdsmCdsTksmCksAk 29.2 6291 6306 669
570672 mCksTksAksmCdsmCdsmCdsmCdsGdsmCdsmCdsmCdsmCdsmCdsGksmCksTk 50.3 6293 6308 670
570673 AksmCksmCksTdsAdsmCdsmCdsmCdsmCdsGdsmCdsmCdsmCdsmCksmCksGk 26.8 6295 6310 671
570674 GksTksAksmCdsmCdsTdsAdsmCdsmCdsmCdsmCdsGdsmCdsmCksmCksmCk 40.8 6297 6312 672
570675 AksGksGksTdsAdsmCdsmCdsTdsAdsmCdsmCdsmCdsmCdsGksmCksmCk 56.1 6299 6314 673
570676 GksGksGksAdsGdsGdsTdsTdsmCdsmCdsmCdsGdsmCdsAksGksmCk 95 6329 6344 674
570677 GksTksmCksmCdsTdsTdsAdsmCdsTdsmCdsmCdsAdsAdsmCksTksTk 23 6360 6375 675
570678 mCksTksGksTdsmCdsmCdsTdsTdsAdsmCdsTdsmCdsmCdsAksAksmCk 23.4 6362 6377 676
570679 mCkAksmCksTdsGdsTdsmCdsmCdsTdsTdsAdsmCdsTdsmCksmCksak 7.4 6364 6379 677
570680 GksGksmCksAdsmCdsTdsGdsTdsmCdsmCdsTdsTdsAdsmCksTksmCk 20.6 6366 6381 678
570681 TksAksGksGdsmCdsAdsmCdsTdsGdsTdsmCdsmCdsTdsTksAksmCk 29 6368 6383 679
570682 GksGksTksAdsGdsGdsmCdsAdsmCdsTdsGdsTdsmCdsmCksTksTk 10.5 6370 6385 680
570683 GksTksmCksAdsmCdsTdsGdsmCdsTdsGdsGdsGdsTdsmCksmCksTk 23 6445 6460 681
570684 GksGksTksmCdsAdsmCdsTdsGdsmCdsTdsGdsGdsGdsTksmCksmCk 22.5 6446 6461 433
570685 AksGksGksTdsmCdsAdsmCdsTdsGdsmCdsTdsGdsGdsGksTksmCk 10.2 6447 6462 682
570686 mCsTksAksGdsGdsTdsmCdsAdsmCdsTdsGdsmCdsTdsGksGksGk 11.1 6449 6464 683
570687 GksTksmCksTdsAdsGdsGdsTdsmCdsAdsmCdsTdsGdsmCksTksGk 11.7 6451 6466 684
570688 AksAksGksTdsmCdsTdsAdsGdsGdsTdsmCdsAdsmCdsTksGksmCk 14.6 6453 6468 685
570689 GksmCksAksmCdsTdsmCdsmCdsAdsTdsTdsGdsTdsmCdsTksmCksAk 10.1 6530 6545 686
570690 mCksTksGksmCdsAdsmCdsTdsmCdsmCdsAdsTdsTdsGdsTksmCksTk 35.4 6532 6547 687
570691 mCksmCksmCksTdsGdsmCdsAdsmCdsTdsmCdsmCdsAdsTdsTksGksTk 33.6 6534 6549 688
570692 mCksmCksmCksmCdsmCdsTdsGdsmCdsAdsmCdsTdsmCdsmCdsAksTksTk 77.3 6536 6551 689
570693 mCksTksTksGdsmCdsTdsGdsAdsGdsTdsmCdsAdsGdsGksAksGk 18.9 6559 6574 690
570694 TksmCksmCksTdsTdsGdsmCdsTdsGdsAdsGdsTdsmCdsAksGksGk 30.9 6561 6576 691
570695 mCksTksTksmCdsmCdsTdsTdsGdsmCdsTdsGdsAdsGdsTksmCksAk 21 6563 6578 692
570696 AksmCksmCksTdsTdsmCdsmCdsTdsTdsGdsmCdsTdsGdsAksGksTk 50.3 6565 6580 693
570697 GksGksAksmCdsmCdsTdsTdsmCdsmCdsTdsTdsGdsmCdsTksGksAk 28.3 6567 6582 694
570698 mCksAksGksGdsAdsmCdsmCdsTdsTdsmCdsmCdsTdsTdsGksmCksTk 47.6 6569 6584 695
570699 AksGksmCksmCdsmCdsTdsmCdsmCdsAdsGdsGdsAdsmCdsmCksTksTk 17.9 6576 6591 696
570700 TksAksGksmCdsTdsmCdsmCdsmCdsmCdsAdsmCdsTdsmCdsmCksAksGk 24.1 6594 6609 697
570701 GksAksTksAdsGdsmCdsTdsmCdsmCdsmCdsmCdsAdsmCdsTksmCksmCk 12.9 6596 6611 698
570702 mCksAksGksAdsTdsAdsGdsmCdsTdsmCdsmCdsmCdsmCdsAksmCksTk 24 6598 6613 699
570703 mCksTksmCksAdsGdsAdsTdsAdsGdsmCdsTdsmCdsmCdsmCksmCksAk 22.3 6600 6615 700
570704 AksGksmCksTdsmCdsAdsGdsAdsTdsAdsGdsmCdsTdsmCksmCksmCk 31.8 6602 6617 701
570705 TksmCksAksGdsmCdsTdsmCdsAdsGdsAdsTdsAdsGdsmCksTksmCk 33.9 6604 6619 702
570706 TksmCksTksmCdsAdsGdsmCdsTdsmCdsAdsGdsAdsTdsAksGksmCk 28.1 6606 6621 703
570707 GksAksGksTdsmCdsmCdsTdsmCdsTdsmCdsmCdsTdsGdsmCksTksTk 37.2 6636 6651 704
570708 GksGksAksGdsGdsAdsGdsTdsmCdsmCdsmdsmCdsTdsmCksmCksTk 66.3 6640 6655 705
570709 GksAksGksGdsAdsGdsGdsAdsGdsTdsmCdsmCdsTdsmCksTksmCk 52.7 6642 6657 706
570710 mCksAksAksAdsAdsGdsGdsGdsmCdsAdsmCdsmCdsmCdsAksGksAk 31.8 6713 6728 707
570711 AksGksmCksAdsAdsAdsAdsGdsGdsGdsmCdsksmCdsmCksmCksAk 12.3 6715 6730 708
570712 GksGksAksTdsmCdsmCdsmCdsmCdsAdsGdsTdsAdsTdsTksGksTk 37.1 6733 6748 709
570713 mCksTksGksGdsAdsTdsmCdsmCdsmCdsmCdsAdsGdsTdsAksTkstk 42.4 6735 6750 710
570714 TksGksmCksTdsGdsGdsAdsTdsmCdsmCdsmCdsmCdsAdsGksTksAk 31.4 6737 6752 711
570715 AksTksTksmCdsTdsmCdsTdsAdsGdsAdsmCdsTdsGdsmCksAksAk 12.1 6789 6804 712
570716 TksAksAksTdsTdsmCdsTdsmCdsTdsAdsGdsAdsmCdsTksGksmCk 9 6791 6806 713
570717 TksmCksTksAdsAdsTdsTdsmCdsTdsmCdsTdsAdsGdsAksmCksTk 32.1 6793 6808 714
570718 TksmCksTksmCdsTdsAdsAdsTdsTdsmCdsTdsmCdsTdsAksGksak 71.4 6795 6810 715
570719 mCksTksmCksmCdsAdsTdsAdsAdsTdsTdsmCdsTdsmCdsTksAksAk 36.9 6804 6819 716
570720 AksmCksTksmCdsTdsmCdsmCdsAdsTdsAdsAdsTdsTdsmCksTksmCk 17.1 6807 6822 717
570721 AksmCksAksmCdsTdsmCdsTdsmCdsmCdsAdsTdAdsAdsTksTksmCk 23.7 6809 6824 718
570722 mCksmCksAksmCdsAdsmCdsTdsmCdsTdsmCdsmCdsAdsTdsAksAksTk 34.4 6811 6826 719
570723 TksGksmCksmCdsAdsmCdsAdsmCdsTdsmCdsTdsmCdsmCdsAksTksAk 38.7 6813 6828 720

Example 10

Dose Response Studies with Antisense Oligonucleotides Targeting Human Dystrophia Myotonica-Protein Kinase (DMPK) in HepG2 Cells

Antisense oligonucleotides targeted to a human DMPK nucleic acid were tested for their effect on human DMPK RNA transcript in vitro. Cultured HepG2 cells at a density of 20,000 cells per well were transfected using electroporation with 61.7 nM, 185.2 nM, 555.6 nM, 1666.7 nM, 5000.0 nM, and 15000.0 nM concentrations of each antisense oligonucleotide. After approximately 24 hours, RNA was isolated from the cells and DMPK RNA transcript levels were measured by quantitative real-time PCR using primer probe set RTS3164 (forward sequence AGCCTGAGCCGGGAGATG, designated herein as SEQ ID NO: 20; reverse sequence GCGTAGTTGACTGGCGAAGTT, designated herein as SEQ ID NO: 21; probe sequence AGGCCATCCGCACGGACAACCX, designated herein as SEQ ID NO: 22). Human DMPK RNA transcript levels were adjusted according to total RNA content, as measured by RIBOGREEN®. Results are presented as percent expression of human DMPK, relative to untreated control (UTC) cells. For example, if the UTC is 100 and a dose of 5000 nM of ISIS No. 445569 yields a % Expression of human DMPK of 35 then the 5000 nM dose of ISIS reduced expression of human DMPK by 65% relative to the UTC. The half maximal inhibitory concentration (IC50) of each oligonucleotide is presented in the table below and was calculated by plotting the concentrations of oligonucleotides used versus the percent inhibition of human DMPK mRNA expression achieved at each concentration, and noting the concentration of oligonucleotide at which 50% inhibition of human DMPK mRNA expression was achieved compared to the control. The results are presented in Table 19.

The tested antisense oligonucleotide sequences demonstrated dose-dependent inhibition of human DMPK mRNA levels under the conditions specified above.

TABLE 19
Dose response studies for with antisense oligonucleotides
targeting hDMPK in HepG2 Cells
% Expression of
ISIS No. Dose (nM) human DMPK IC50
UTC ND 100 ND
445569 61.7 115.3 2.3
185.2 87.9
555.6 69.0
1666.7 57.2
5000.0 35.0
15000.0 22.6
512497 61.7 108.6 2
185.2 98.4
555.6 77.9
1666.7 57.2
5000.0 28.0
15000.0 12.8
486178 61.7 88.2 0.7
185.2 67.1
555.6 49.4
1666.7 32.8
5000.0 26.7
15000.0 11.8
569473 61.7 107.9 0.6
185.2 66.5
555.6 33.6
1666.7 23.5
5000.0 12.8
15000.0 9.2
570808 61.7 77.2 0.2
185.2 52.7
555.6 20.6
1666.7 8.1
5000.0 7.2
15000.0 5.4
594292 61.7 96.2 5.5
185.2 99.6
555.6 80.0
1666.7 59.0
5000.0 45.5
15000.0 42.8
594300 61.7 101.7 >15
185.2 104.3
555.6 101.6
1666.7 93.6
5000.0 74.9
15000.0 66.8
598768 61.7 95.5 1.2
185.2 83.6
555.6 70.6
1666.7 40.7
5000.0 22.2
15000.0 7.3
598769 61.7 103.9 1.9
185.2 105.3
555.6 76.1
1666.7 50.4
5000.0 29.8
15000.0 12.1
598777 61.7 96.4 0.9
185.2 69.4
555.6 41.8
1666.7 42.8
5000.0 16.4
15000.0 27.1

Example 11

Dose Response Studies with Antisense Oligonucleotides Targeting Human Dystrophia Myotonica-Protein Kinase (hDMPK) in Steinert DM1 Myoblast Cells

Antisense oligonucleotides targeted to a human DMPK nucleic acid were tested for their effect on human DMPK RNA transcript in vitro. Cultured Steinert DM1 myoblast cells at a density of 20,000 cells per well were transfected using electroporation with 61.7 nM, 185.2 nM, 555.6 nM, 1666.7 nM, 5000.0 nM, and 15000.0 nM concentrations of each antisense oligonucleotide. After approximately 24 hours, RNA was isolated from the cells and DMPK RNA transcript levels were measured by quantitative real-time PCR using primer probe set RTS3164 described above. Human DMPK RNA transcript levels were adjusted according to total RNA content, as measured by RIBOGREEN®. Results are presented as percent (%) expression of human DMPK, relative to untreated control (UTC) cells. The half maximal inhibitory concentration (IC50) of each oligonucleotide is presented in the table below and was calculated by plotting the concentrations of oligonucleotides used versus the percent inhibition of human DMPK mRNA expression achieved at each concentration, and noting the concentration of oligonucleotide at which 50% inhibition of human DMPK mRNA expression was achieved compared to the control. The results are presented in Table 20.

The tested antisense oligonucleotide sequences demonstrated dose-dependent inhibition of human DMPK mRNA levels under the conditions specified above.

TABLE 20
Dose response studies for with antisense oligonucleotides targeting
hDMPK in Steinert DM1 Cells
% Expression of
ISIS No. Dose (nM) human DMPK IC50
UTC ND 100 ND
445569 61.7 58.3 0.4
185.2 56.7
555.6 58.5
1666.7 40.9
5000.0 26.0
15000.0 23.5
512497 61.7 78.1 5.1
185.2 77.5
555.6 98.8
1666.7 71.2
5000.0 51.3
15000.0 22.8
486178 61.7 78.0 0.5
185.2 61.3
555.6 43.3
1666.7 27.4
5000.0 24.6
15000.0 16.9
569473 61.7 83.3 0.6
185.2 54.8
555.6 64.5
1666.7 26.1
5000.0 19.4
15000.0 15.4
570808 61.7 103.6 0.9
185.2 77.8
555.6 46.7
1666.7 25.2
5000.0 20.8
15000.0 19.3
594292 61.7 100.1 5.6
185.2 109.7
555.6 72.6
1666.7 66.2
5000.0 39.5
15000.0 45.7
594300 61.7 96.2 5.6
185.2 87.1
555.6 70.3
1666.7 66.4
5000.0 58.1
15000.0 33.2
598768 61.7 77.0 0.7
185.2 62.9
555.6 62.0
1666.7 35.6
5000.0 24.5
15000.0 21.0
598769 61.7 70.3 0.4
185.2 49.2
555.6 55.3
1666.7 33.2
5000.0 27.1
15000.0 13.4
598777 61.7 87.7 1
185.2 61.7
555.6 57.3
1666.7 37.9
5000.0 30.0
15000.0 29.7

Example 12

Dose Response Studies with Antisense Oligonucleotides Targeting Rhesus Monkey Dystrophia Myotonica-Protein Kinase (DMPK) in Cynomolgus Monkey Primary Hepatocytes

Antisense oligonucleotides targeted to a rhesus monkey DMPK nucleic acid were tested for their effect on rhesus monkey DMPK RNA transcript in vitro. Cultured cynomolgus monkey primary hepatocytes cells at a density of 20,000 cells per well were transfected using electroporation with 61.7 nM, 185.2 nM, 555.6 nM, 1666.7 nM, 5000.0 nM, and 15000.0 nM concentrations of each antisense oligonucleotide. After approximately 24 hours, RNA was isolated from the cells and DMPK RNA transcript levels were measured by quantitative real-time PCR using primer probe set RTS3164 described above. Rhesus monkey DMPK RNA transcript levels were adjusted according to total RNA content, as measured by RIBOGREEN®. Results are presented as percent (%) expression of rhesus monkey DMPK, relative to untreated control (UTC) cells. The half maximal inhibitory concentration (IC50) of each oligonucleotide is presented in the table below and was calculated by plotting the concentrations of oligonucleotides used versus the percent inhibition of rhesus monkey DMPK mRNA expression achieved at each concentration, and noting the concentration of oligonucleotide at which 50% inhibition of rhesus monkey DMPK mRNA expression was achieved compared to the control.

The tested antisense oligonucleotide sequences demonstrated dose-dependent inhibition of rhesus monkey DMPK mRNA levels under the conditions specified above.

TABLE 21
Dose response studies for with antisense oligonucleotides
targeting rhesus monkey DMPK in
cynomolgus monkey primary hepatocytes
% Expression of
ISIS No. Dose (nM) human DMPK IC50
UTC ND 100 ND
445569 61.7 79.7 1.4
185.2 41.1
555.6 58.1
1666.7 33.5
5000.0 46.9
15000.0 50.0
512497 61.7 123.4 1.5
185.2 63.7
555.6 44.8
1666.7 34.1
5000.0 51.2
15000.0 23.5
486178 61.7 51.1 <.06
185.2 30.6
555.6 22.0
1666.7 23.5
5000.0 9.8
15000.0 19.2
569473 61.7 82.1 .2
185.2 39.4
555.6 17.7
1666.7 28.5
5000.0 20.0
15000.0 15.6
570808 61.7 74.6 0.1
185.2 27.6
555.6 16.4
1666.7 25.6
5000.0 8.8
15000.0 21.9
594292 61.7 93.0 >15
185.2 82.1
555.6 106.0
1666.7 91.1
5000.0 62.2
15000.0 70.4
594300 61.7 105.5 >15
185.2 91.8
555.6 114.9
1666.7 65.7
5000.0 110.2
15000.0 118.8
598768 61.7 70.3 0.4
185.2 57.8
555.6 58.5
1666.7 16.5
5000.0 24.0
15000.0 13.4
598769 61.7 76.5 1.1
185.2 65.1
555.6 64.0
1666.7 34.4
5000.0 60.9
15000.0 8.6
598777 61.7 161.4 2.1
185.2 51.7
555.6 47.5
1666.7 34.6
5000.0 27.8
15000.0 52.9

Example 13

In Vivo Antisense Inhibition of hDMPK in DMSXL Transgenic Mice

To test the effect of antisense inhibition for the treatment of myotonic dystrophy type 1 (DM1), an appropriate mouse model was required. The transgenic mouse model, DMSXL carrying the hDMPK gene with large expansions of over 1000 CTG repeats was generated (Huguet et al., PLOS Genetics, 2012, 8(11), e1003034-e1003043). These DMSXL mice express the mutant hDMPK allele and display muscle weakness phenotype similar to that seen in DM1 patients.

ISIS 486178 from Table 1 was selected and tested for antisense inhibition of hDMPK transcript in vivo. ISIS 445569 was included in the study for comparison.

Treatment

DMSXL mice were maintained on a 12-hour light/dark cycle and fed ad libitum normal Purina mouse chow Animals were acclimated for at least 7 days in the research facility before initiation of the experiment. Antisense oligonucleotides (ASOs) were prepared in PBS and sterilized by filtering through a 0.2 micron filter. ASOs were dissolved in 0.9% PBS for injection.

DMSXL mice received subcutaneous injections of ISIS 445569 at 50 mg/kg or ISIS 486178 at 25 mg/kg twice per week for 4 weeks. The control group received subcutaneous injections of PBS twice weekly for 4 weeks. Each treatment group consisted of 4 animals.

Inhibition of hDMPK mRNA Levels

Twenty four hours after the final dose, the mice were sacrificed and tissues were collected. mRNA was isolated for real-time PCR analysis of hDMPK and normalized to 18s RNA. Human primer probe set RTS3164 was used to measure mRNA levels. The results are expressed as the average percent of hDMPK mRNA levels for each treatment group, relative to PBS control.

Human primer probe set RTS3164 (forward sequence AGCCTGAGCCGGGAGATG, designated herein as SEQ ID NO: 20; reverse sequence GCGTAGTTGACTGGCGAAGTT, designated herein as SEQ ID NO: 21; probe sequence AGGCCATCCGCACGGACAACCX, designated herein as SEQ ID NO: 22).

As presented in Table 22 below, treatment with antisense oligonucleotides reduced hDMPK transcript expression. The results indicate that treatment with ISIS 445569 and 486178 resulted in reduction of hDMPK mRNA levels in DMSXL mice.

TABLE 22
Effect of antisense oligonucleotides on hDMPK inhibition
in DMSXL mice
hDMPK
Dosage mRNA levels
ISIS No. (mg/kg) Tissue Type (% PBS) Motif/Length
PBS 0
486178 25 Tibialis 70.7 kkk-d10-kkk
Anterior (16 mer)
Soleus 67.3
Quadriceps 73.9
Latissiumus 71.0
grand dorsi
Triceps 67.1
Diaphragm 68.9
Heart 30.8
Brain 11.8
445569 50 Tibialis 38.4 e5-d10-e5
Anterior (20 mer)
Soleus 47.5
Quadriceps 41.3
Latissiumus 35.7
grand dorsi
Triceps 30.5
Diaphragm 44.7
Heart 7.6
Brain 13.1

Example 14

Effect of ASO Treatment on Muscle Strength in DMSXL Mice Targeting hDMPK

Griptest

Mice were assessed for grip strength performance in wild-type (WT) and DMSXL forelimb using a commercial grip strength dynamometer as described in the literature ((Huguet et al., PLOS Genetics, 2012, 801), e1003034-e1003043).

DMSXL mice received subcutaneous injections of ISIS 486178 at 25 mg/kg or ISIS 445569 at 50 mg/kg twice per week for 4 weeks. The control DMSXL group received subcutaneous injections of PBS twice weekly for 4 weeks. Each treatment group consisted of 4 animals. The forelimb force for each treatment group and WT was measured at day 0, 30, and 60 using the griptest. The grip strength performance was determined by measuring the force difference between day 60 and day 0. Results are presented as the average forelimb force from each group.

As illustrated in Table 23, below, treatment with ASOs targeting hDMPK improved muscle strength in DMSXL mice compared to untreated control. ISIS 486178, an ASO with cEt modifications, demonstrated substantial improvement in the forelimb strength (+3.4) compared to ISIS 445569 with MOE modifications (+0.38).

TABLE 23
Effect of ASO treatment on muscle strength in DMSXL
mice targeting hDMPK
Forelimb force (g)
Treatment group Day 0 Day 30 Day 60 Δ = Day 60-Day 0
Untreated control 72.2 70.2 67.5 −4.6
ASO 486178 62.3 65.7 65.6 +3.4
ASO 445569 64.3 68 64.7 +0.38
Wild type (WT) 75.2 76.5 78.4 +3.2

Example 15

Effect of ASO Treatment on Muscle Fiber Distribution in DMSXL Mice Targeting hDMPK

The muscle fiber distribution in DMSXL mice targeting hDMPK in the presence and absence of ISIS 445569 and 486178 was also assessed. Both ASOs were previously described in Table 1, above.

DMSXL mice received subcutaneous injections of ISIS 486178 at 25 mg/kg or ISIS 445569 at 50 mg/kg twice per week for 4 weeks. The control DMSXL group received subcutaneous injections of PBS twice weekly for 4 weeks. Each treatment group consisted of 4 animals. The muscle fiber distribution was assessed and the results are presented Table 44, below.

As illustrated, treatment with ASOs targeting hDMPK decreased the distribution of DM1 Associated Type 2c muscle fiber in the tibialis anterior (TA) of DMSXL mice compared to untreated control. The results demonstrated that normal pattern of fiber distribution in the skeletal muscles can be restored with ASO treatment. ISIS 445569 demonstrated an improvement in the muscle fiber distribution as compared to the untreated control; however ISIS 486178, an ASO with cEt modifications, demonstrated muscle fiber distribution that was more consistent with the muscle fiber distribution found in the wild-type mice.

TABLE 24
Effect of ASO treatment on muscle fiber distribution in DMSXL
mice targeting hDMPK
Fiber Type Distribution in TA muscle
Treatment group Fiber 1 Fiber 2a Fiber 2c
Untreated control   4% 25% 5.90%
ASO 486178 3.10% 15% 0.70%
ASO 445569   4% 21%   2%
Wild type (WT) 3.30% 15% 0.00%

Example 16

Dose-Dependent Antisense Inhibition of hDMPK in DMSXL Transgenic Mice

The newly designed ASOs from Table 1, above, were further evaluated in a dose-response study for antisense inhibition of hDMPK transcript in vivo. ISIS 445569 was included in the study for comparison.

Treatment

DMSXL mice were maintained on a 12-hour light/dark cycle and fed ad libitum normal Purina mouse chow Animals were acclimated for at least 7 days in the research facility before initiation of the experiment. Antisense oligonucleotides (ASOs) were prepared in PBS and sterilized by filtering through a 0.2 micron filter. ASOs were dissolved in 0.9% PBS for injection.

DMSXL mice received subcutaneous injections of PBS or ASOs from Table 1, above, targeting hDMPK. The ASO was dosed twice per week for 4 weeks at the indicated doses in Table 25, below. The control group received subcutaneous injections of PBS twice weekly for 4 weeks. Each treatment group consisted of 4 animals.

Inhibition of hDMPK mRNA Levels

Forty eight hours after the final dose, the mice were sacrificed and tissue from the tibialis anterior muscles, quadriceps muscles (left), gastrocnemius muscles, heart and diaphragm was isolated. mRNA was isolated for real-time PCR analysis of hDMPK and normalized to RIBOGREEN®. Human primer probe set RTS3164 was used to measure mRNA levels. The results summarized in Table 25, below, were independently generated from various dose-response studies. The results are presented as the average percent of hDMPK mRNA expression levels for each treatment group, relative to PBS control.

As presented, treatment with antisense oligonucleotides reduced hDMPK transcript expression in a dose-dependent manner.

TABLE 25
Dose-dependent inhibition of hDMPK mRNA levels in DMSXL mice
ISIS hDMPK mRNA levels (% PBS)
No. mg/kg/wk TA Quad (Left) Gastroc Heart Diaphragm
PBS 0 100 100 100 100 100
445569 50 54.7 80.3 97.1 55.4 21.7
100 28.3 42.1 71.3 48.9 19.7
200 22.2 33.9 45.2 34.2 10.0
512497 50 23.8 48.9 52.9 44.4 35.0
100 9.7 28.7 24.8 43.8 24.2
200 11.4 22.4 16.4 42.0 15.2
486178 25 59.1 56.1 63.1 75.3 39.1
50 33.8 61.9 58.7 59.2 32.5
100 36.6 65.8 51.6 47.3 26.2
570808 25 26.3 41.1 39.8 44.9 17.3
50 12.2 13.0 36.3 18.4 8.1
100 6.1 5.4 7.9 10.2 3.0
594292 25 48.8 32.2 68.8 70.6 72.7
50 32.0 30.4 41.1 85.1 48.3
100 31.6 39.6 53.3 63.9 40.2
598768 25 16.9 27.1 27.5 56.3 26.9
50 10.2 33.6 24.1 30.8 20.2
100 6.8 22.0 25.5 22.6 13.1
598769 25 21.6 50.8 48.1 61.0 30.3
50 12.7 25.1 42.3 36.4 16.7
100 12.8 18.4 33.2 32.0 20.2
569473 25 42.0 21.8 48.9 51.8 34.8
50 41.6 16.2 47.6 55.6 23.6
100 31.9 19.2 31.9 35.6 20.5
594300 25 114.5 56.7 96.2 91.0 62.6
50 44.3 22.3 52.8 69.3 54.7
100 73.0 22.6 56.6 78.3 44.5
598777 25 49.4 28.8 76.1 97.1 58.7
50 44.8 13.6 36.5 87.4 40.8
100 31.8 10.1 22.5 86.8 33.6
TA = Tibialis Anterior;
Quad = Quadriceps;
Gastroc = Gastrocnemius

Example 17

Six Week In Vivo Tolerability Study in CD-1 Mice

The newly designed ASOs from Table 1, above, were further evaluated in a 6 week study to assess plasma chemistry, body/organ weights and histology. Groups of CD-1 mice were administered 100 mg/kg/wk of ISIS 445569 or ISIS 512497. Further groups of CD-1 mice were administered 50 mg/kg/wk of ISIS 486178, ISIS 570808, ISIS 594292, ISIS 598768, ISIS 598769, ISIS 569473, ISIS 594300, and ISIS 598777. After six weeks and two days after each group of mice received the last dose, the mice were sacrificed and tissues were collected for analysis. For each group of mice, analysis to measure alanine transaminase levels, aspartate aminotransferase levels, blood urea nitrogen (BUN) levels, albumin levels, total bilirubin, and creatine levels was measured. Additionally, organ weights were also measured, the results of which are presented in the tables below.

TABLE 26
Plasma Chemistry in CD-1 mice
ALT AST BUN Albumin T. Bil Creatinine
ISIS No. (U/L) (U/L) (mg/dL) (g/dL) (mg/dL) (mg/dL)
PBS 31.75 60.75 32.73 2.99 0.23 0.16
486178 65.00 103.00 27.18 2.90 0.19 0.13
445569 162.75 195.25 29.70 3.38 0.26 0.14
570808 313.50 332.50 32.40 2.81 0.28 0.15
594292 58.75 133.00 28.15 2.94 0.21 0.13
598768 45.50 92.00 26.85 2.90 0.21 0.11
598769 69.25 94.25 32.73 2.89 0.18 0.13
512497 101.25 144.50 26.90 2.90 0.19 0.12
569473 75.75 137.00 28.98 3.05 0.26 0.13
594300 46.00 76.75 24.70 2.94 0.18 0.11
598777 186.50 224.25 24.68 2.97 0.30 0.11

TABLE 27
Body & Organ Weights in CD-1 mice
ISIS No. *Kidney % BW *Liver % BW *Spleen % BW
PBS 1.00 1.00 1.00
486178 1.05 1.05 1.03
445569 1.07 1.09 1.23
570808 0.94 1.27 1.43
594292 1.03 1.03 1.16
598768 1.14 1.08 0.97
598769 0.97 1.05 1.04
512497 0.99 1.17 1.38
569473 1.02 1.01 1.09
594300 1.14 1.07 1.02
598777 1.05 1.20 1.01
*Fold change over Saline control group

Example 18

Six Week In Vivo Tolerability Study in Sprague-Dawley Rats

The newly designed ASOs from Table 1, above, were further evaluated in a 6 week study to assess plasma chemistry, body/organ weights and histology. Groups of Sprague-Dawley rats were administered 100 mpk/wk of ISIS 445569 or ISIS 512497. Further groups of Groups of Sprague-Dawley rats were administered 50 mpk/wk of ISIS 486178, ISIS 570808, ISIS 594292, ISIS 598768, ISIS 598769, ISIS 569473, ISIS 594300, and ISIS 598777. After six weeks and two days after each group of mice received the last dose, the mice were sacrificed and tissues were collected for analysis. For each group of mice, analysis to measure alanine transaminase levels, aspartate aminotransferase levels, blood urea nitrogen (BUN) levels, albumin levels, total bilirubin, creatine levels, and urinary creatine levels was measured. Additionally, organ weights were also measured, the results of which are presented in the tables below.

TABLE 28
Plasma Chemistry & Urine Analysis in Sprague-Dawley Rats
ALT AST BUN Total protein T. Bil Creatinine Urine
ISIS No. (U/L) (U/L) (mg/dl) (mg/dl) (mg/dl) (mg/dl) MTP/Creatine
Saline 59.25 100.35 18.05 3.47 0.158 0.30 1.09
569473 101 198.25 25.9 2.74 0.195 0.4025 4.59
512497 211 240.25 19.32 3.58 0.17 0.39 6.18
598768 78.2 103.5 20.6 3.36 0.14 0.38 3.85
598769 84.5 104.5 18.6 3.52 0.15 0.34 3.02
570808 82 141 23.8 3.08 0.21 0.4 2.71
598777 109 119.5 21.65 3.79 0.22 0.37 2.56
445569 117.5 163.2 22.45 3.86 0.18 0.47 6.4
594300 66 80.75 17.53 3.59 0.12 0.29 4.72
486178 56.8 80.75 23.3 5.28 0.08 3.0 4.5
594292 64.5 80.5 19.62 3.38 0.098 0.29 5.17

TABLE 29
Plasma Chemistry & Urine Analysis in Sprague-Dawley Rats
Kidney Liver Spleen
ISIS No (fold)* (fold)* (fold)*
Saline 1 1 1
569473 1.46 1.20 0.82
512497 1.03 1.22 1.94
598768 0.92 0.92 1.49
598769 0.93 1.04 0.98
570808 1.18 0.98 2.43
598777 1.07 0.93 2.31
445569 1 1.13 3.25
594300 1.03 1.04 1.94
486178 0.87 0.89 1.45
594292 1.08 1.01 2.04
*Fold change over Saline control group

Example 19

Thirteen (13) Week In Vivo Study in Cynomolgus Monkeys

Groups of 4 cynomolgus male monkeys were administered 40 mg/kg/wk of ISIS 445569, ISIS 512497, ISIS 486178, ISIS 570808, ISIS 594292, ISIS 598768, ISIS 598769, ISIS 569473, ISIS 594300, and ISIS 598777 via subcutaneous injection. Thirteen weeks after the first dose, the animals were sacrificed and tissue analysis was performed. mRNA was isolated for real-time PCR analysis of rhesus monkey DMPK and normalized to RIBOGREEN® Primer probe set RTS3164 (described above) was used to measure mRNA levels and the results are shown in Table 30 below. Additionally, further mRNA was isolated for real-time PCR analysis of rhesus monkey DMPK and normalized to RIBOGREEN® using primer probe set RTS4447 and the results are shown in Table 31 below. RTS4447 (forward sequence AGCCTGAGCCGGGAGATG, designated herein as SEQ ID NO: 20; reverse sequence GCGTAGTTGACTGGCAAAGTT, designated herein as SEQ ID NO: 21; probe sequence AGGCCATCCGCATGGCCAACC, designated herein as SEQ ID NO: 22).

TABLE 30
Dose-dependent inhibition of DMPK mRNA levels in Cynomolgus
Monkeys using Primer Probe Set RTS3164
hDMPK mRNA levels (% PBS)
ISIS Quad
No. mg/kg/wk TA (Left) Gastroc Kidney Heart Liver
PBS 0 100 100 100 100 100 100
486178 40 26.1 30.8 49.3 55.3 45.8 44.9
445569 40 68.5 82.2 128.9 65.6 91.2 113.5
512497 40 60.3 58.7 66.7 61.9 74.2 68.1
598768 40 69.1 64.9 80.7 58.1 70.6 100.8
594300 40 73.6 80.2 106.0 57.9 97.5 91.6
594292 40 55.6 52.0 71.9 46.2 72.1 81.6
569473 40 44.8 31.7 61.6 44.0 58.7 28.0
598769 40 31.7 28.9 49.7 26.8 45.0 38.6
570808 40 2.5 4.4 6.4 29.7 17.5 7.2
598777 40 53.3 31.8 76.4 42.7 44.6 111.6

TABLE 31
Dose-dependent inhibition of DMPK mRNA levels in Cynomolgus
Monkeys using Primer Probe Set RTS4447
hDMPK mRNA levels (% PBS)
ISIS Quad
No. mg/kg/wk TA (Left) Gastroc Kidney Heart Liver
PBS 0 100.0 100.0 100.0 100.0 100.0 100.0
486178 40 26.7 29.0 32.9 57.0 49.4 58.1
445569 40 85.4 87.4 147.1 77.1 97.2 93.6
512497 40 66.4 70.4 94.2 81.9 87.6 79.5
598768 40 48.3 76.4 106.7 73.7 81.0 85.1
594300 40 100.9 113.5 219.6 96.9 131.0 118.9
594292 40 76.5 75.7 151.7 86.6 107.1 108.6
569473 40 52.6 51.7 114.2 72.9 87.2 53.7
598769 40 45.2 57.6 86.3 56.6 65.4 72.5
570808 40 6.6 8.3 14.8 60.7 27.9 35.0
598777 40 55.1 56.8 124.1 78.6 88.9 131.2

Example 20

Thirteen (13) Week In Vivo Tolerability Study in Cynomolgus Monkeys

Groups of cynomolgus male monkeys were administered 40 mg/kg of ISIS 445569, ISIS 512497, ISIS 486178, ISIS 570808, ISIS 594292, ISIS 598768, ISIS 598769, ISIS 569473, ISIS 594300, and ISIS 598777 via subcutaneous injection on days 1, 3, 5, and 7. Following administration on day 7, each monkey was administered 40 mg/kg/wk of ISIS 445569, ISIS 512497, ISIS 486178, ISIS 570808, ISIS 594292, ISIS 598768, ISIS 598769, ISIS 569473, ISIS 594300, and ISIS 598777 via subcutaneous injection.

48 hours after each monkey received a subcutaneous dose on days 28 and 91, blood and urine samples were taken for analysis. Some of the monkeys had blood and urine taken 48 hours after the dose given on day 56. Alanine aminotransferase (ALT), aspartate aminotransferase (AST), lactate dehydrogenase (LDH), and creatine kinase (CK) were measured for each animal in a treatment group and the average values are presented in the table below. Day of Sample values with a negative represent time point before treatment began. For example, a Day of Treatment value of −7 represents a sample taken 7 days before the first dose. Thirteen weeks after the first dose, the animals were sacrificed and tissue analysis was performed.

TABLE 32
Plasma Chemistry & Urine Analysis in Cynomolgus Monkeys
Day of ALT AST LDH CK
ISIS No. Sample (U/L) (U/L) (mg/dl) (mg/dl)
Saline −14 34.2 25.9 604.0 160.8
−7 38.8 27.8 861.3 249.0
30 43.0 34.4 1029.0 300.0
93 66.1 43.0 1257.3 898.8
486178 −14 37.6 40.5 670.0 236.8
−7 49.8 55.0 1039.8 380.8
30 47.0 41.2 875.4 415.0
93 59.7 43.6 960.6 809.6
594292 −14 38.9 32.0 776.3 375.8
−7 37.8 38.4 877.3 210.0
30 35.4 39.6 666.0 93.8
93 49.8 46.3 958.5 339.0
569473 −14 49.4 49.8 1185.3 365.3
−7 50.4 59.7 1609.5 261.0
30 46.7 52.5 1390.8 107.8
93 56.3 49.8 1483.3 524.5
570808 −14 47.1 46.8 896.0 448.3
−7 44.4 63.6 913.3 257.3
30 47.1 57.7 660.5 125.0
93 79.8 92.2 813.5 294.0
598768 −14 37.9 41.6 666.3 253.8
−7 41.4 53.5 754.0 231.5
30 37.2 38.9 652.3 106.3
93 45.8 41.5 721.3 238.3
598769 −14 44.2 36.1 1106.8 456.8
−7 45.7 41.5 1323.3 214.0
30 40.3 42.0 981.0 147.8
58 56.7 49.9 1101.5 552.3
93 69.0 50.3 1167.3 749.5
512497 −14 31.5 34.3 689.3 293.8
−7 39.0 45.4 1110.3 286.0
30 47.2 60.2 960.5 202.5
93 69.6 87.1 997.0 1118.5
594300 −14 42.0 34.0 935.5 459.5
−7 42.1 53.6 1020.5 272.0
30 28.0 34.6 620.8 124.5
58 42.9 48.5 883.5 169.8
93 45.7 45.7 835.5 252.3
598777 −14 45.6 37.7 707.0 558.5
−7 43.3 50.0 705.8 200.3
30 50.2 47.3 585.3 159.3
93 79.2 56.1 1029.0 785.0
445569 −14 40.2 44.2 835.8 404.0
−7 41.0 46.1 1074.3 305.5
30 45.9 61.7 994.8 283.0
58 51.6 85.1 739.0 117.8
93 99.3 97.5 1583.5 2114.0

Claims

1-167. (canceled)

168. A compound comprising a modified oligonucleotide consisting of 10-30 linked nucleosides and having a nucleobase sequence comprising a portion of at least 8 contiguous nucleobases 100% complementary to an equal length portion of nucleobases 730-748, 1317-1366, 1343-1368, or 2748-2791 of SEQ ID NO: 1 or nucleobases 8603-8619, 10201-10216, 10202-10218, or 13836-13851 of SEQ ID NO: 2, wherein the nucleobase sequence of the modified oligonucleotide is at least 90% complementary to SEQ ID NO: 1 or SEQ ID NO: 2 as measured over the entirety of the modified oligonucleotide.

169. The compound of claim 168, wherein the modified oligonucleotide is a single-stranded oligonucleotide.

170. The compound of claim 169, wherein at least one nucleoside comprises a modified nucleobase.

171. The compound of claim 170, wherein the modified nucleobase is a 5-methylcytosine.

172. The compound of claim 171, wherein at least one internucleoside linkage is a modified internucleoside linkage.

173. The compound of claim 170, wherein each internucleoside linkage is a phosphorothioate internucleoside linkage.

174. The compound of claim 173, wherein at least one nucleoside comprises a modified sugar.

175. The compound of claim 173, wherein at least two nucleosides comprise a modified sugar.

176. The compound of claim 175, wherein each of the modified sugars have the same modification.

177. The compound of claim 175, wherein at least one of the modified sugars has a different modification.

178. The compound of claim 174, wherein the modified sugar is a bicyclic sugar.

179. The compound of claim 178, wherein the bicyclic sugar is selected from among cEt, LNA, α-L-LNA, ENA, and 2′-thio LNA.

180. The compound of claim 174, wherein the at least one nucleoside comprising a modified sugar is a 2′-substituted nucleoside.

181. The compound of claim 180, wherein the 2′-substituted nucleoside is selected from among: 2′-OCH3, 2′-F, and 2′-O-methoxyethyl.

182. The compound of claim 169, wherein the modified oligonucleotide comprises:

a. a gap segment consisting of linked deoxynucleosides;

b. a 5′ wing segment consisting of liked nucleosides;

c. a 3′ wing segment consisting of linked nucleosides;

d. wherein the gap segment is positioned between the 5′ wing segment and the 3′ wing segment and wherein each nucleoside of each wing segment comprises a modified sugar.

183. The compound of claim 182, wherein the modified oligonucleotide consists of 16, 17, 18, 19, or 20 linked nucleosides.

184. A compound comprising a modified oligonucleotide consisting of 10-30 linked nucleosides and having a nucleobase sequence comprising a portion of at least 8 contiguous nucleobases of any of SEQ ID NOs: 23, 25, 26, 28, 29, 30, 31, and 32.

185. The compound of claim 184, wherein the modified oligonucleotide is a single-stranded oligonucleotide.

186. The compound of claim 185, wherein at least one nucleoside comprises a modified nucleobase.

187. The compound of claim 186, wherein the modified nucleobase is a 5-methylcytosine.

188. The compound of claim 187, wherein at least one internucleoside linkage is a modified internucleoside linkage.

189. The compound of claim 188, wherein each internucleoside linkage is a phosphorothioate internucleoside linkage.

190. The compound of claim 189, wherein at least one nucleoside comprises a modified sugar.

191. The compound of claim 189, wherein at least two nucleosides comprise a modified sugar.

192. The compound of claim 191, wherein each of the modified sugars have the same modification.

193. The compound of claim 191, wherein at least one of the modified sugars has a different modification.

194. The compound of claim 190, wherein the modified sugar is a bicyclic sugar.

195. The compound of claim 194, wherein the bicyclic sugar is selected from among cEt, LNA, α-L-LNA, ENA, and 2′-thio LNA.

196. The compound of claim 194, wherein the at least one nucleoside comprising a modified sugar is a 2′-substituted nucleoside.

197. The compound of claim 196, wherein the 2′-substituted nucleoside is selected from among: 2′-OCH3, 2′-F, and 2′-O-methoxyethyl.

198. The compound of claim 185, wherein the modified oligonucleotide comprises:

a. a gap segment consisting of linked deoxynucleosides;

b. a 5′ wing segment consisting of liked nucleosides;

c. a 3′ wing segment consisting of linked nucleosides;

d. wherein the gap segment is positioned between the 5′ wing segment and the 3′ wing segment and wherein each nucleoside of each wing segment comprises a modified sugar.

199. The compound of claim 198, wherein the modified oligonucleotide consists of 16, 17, 18, 19, or 20 linked nucleosides.

200. A compound comprising a modified oligonucleotide having a nucleobase sequence as set forth in SEQ ID NO: 30, wherein the modified oligonucleotide consists of 16 linked nucleosides and comprises:

a. a gap segment consisting of eight linked deoxynucleosides;

b. a 5′ wing segment consisting of four linked nucleosides and having a E-E-K-K 5′-wing motif;

c. a 3′ wing segment consisting of four linked nucleosides and having a K-K-E-E 3′-wing motif;

d. wherein the gap segment is positioned between the 5′ wing segment and the 3′ wing segment;

e. wherein each E represents 2′-O-methoxyethyl sugar and each K represents a cEt sugar;

f. wherein each internucleoside linkage is a phosphorothioate internucleoside linkage; and

g. wherein each cytosine residue is a 5-methyl cytosine.

201. A composition comprising the compound of claim 168 or a salt thereof and a pharmaceutically acceptable carrier or diluent.

202. A composition comprising the compound of claim 184 or a salt thereof and a pharmaceutically acceptable carrier or diluent.

203. A composition comprising the compound of claim 200 or a salt thereof and a pharmaceutically acceptable carrier or diluent.

204. A method of treating DM1 in an animal comprising administering to an animal in need thereof a composition according to claim 201.

205. A method of treating DM1 in an animal comprising administering to an animal in need thereof a composition according to claim 202.

206. A method of treating DM1 in an animal comprising administering to an animal in need thereof a composition according to claim 203.

Resources

Images & Drawings included:

Sources:

Similar patent applications:

Recent applications in this class:

Recent applications for this Assignee: