Patent application title:

INDUCED PLURIPOTENT STEM CELLS

Publication number:

US20170267978A1

Publication date:
Application number:

15/403,653

Filed date:

2017-01-11

Abstract:

Described herein is a major breakthrough in nuclear reprogramming and induced pluripotent stem cell (iPSC) technology. Fusion of the powerful transcription activation domain (TAD) of MyoD to the Oct4 protein makes iPSCs generation faster, more efficient, purer, safer and feeder-free. Also, disclosed herein is the first report of the use of a TAD fused to a transcription factor as a method for making iPSCs. By combining transcription factors and TADs, this approach to nuclear reprogramming can have a range of applications from inducing pluriopotency to inducing transdifferentiation without transitioning through iPSCs.

Inventors:

Interested in similar patents?

Get notified when new applications in this technology area are published.

Classification:

C12N5/0696 »  CPC main

Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor; Animal cells or tissues; Human cells or tissues; Vertebrate cells Artificially induced pluripotent stem cells, e.g. iPS

C07K14/4702 »  CPC further

Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used Regulators; Modulating activity

C12N15/8509 »  CPC further

Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor; Recombinant DNA-technology; Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression; Vectors or expression systems specially adapted for eukaryotic hosts for animal cells for producing genetically modified animals, e.g. transgenic

A01K2207/12 »  CPC further

Modified animals Animals modified by administration of exogenous cells

A01K2227/105 »  CPC further

Animals characterised by species; Mammal Murine

C07K2319/71 »  CPC further

Fusion polypeptide containing domain for protein-protein interaction containing domain for transcriptional activaation, e.g. VP16

C12N2740/15041 »  CPC further

Reverse transcribing RNA viruses; Details; Retroviridae; Lentivirus, not HIV, e.g. FIV, SIV Use of virus, viral particle or viral elements as a vector

C12N2510/00 »  CPC further

Genetically modified cells

C12N2501/602 »  CPC further

Active agents used in cell culture processes, e.g. differentation; Transcription factors Sox-2

C12N2501/603 »  CPC further

Active agents used in cell culture processes, e.g. differentation; Transcription factors Oct-3/4

C12N2501/604 »  CPC further

Active agents used in cell culture processes, e.g. differentation; Transcription factors Klf-4

C12N2501/606 »  CPC further

Active agents used in cell culture processes, e.g. differentation; Transcription factors c-Myc

C12N2506/1307 »  CPC further

Differentiation of animal cells from one lineage to another; Differentiation of pluripotent cells from connective tissue cells, from mesenchymal cells from adult fibroblasts

C07K14/47 IPC

Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals

C12N15/85 IPC

Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor; Recombinant DNA-technology; Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression; Vectors or expression systems specially adapted for eukaryotic hosts for animal cells

Description

RELATED APPLICATIONS

This application is a continuation application and claims the benefit of priority of U.S. patent application Ser. No. 13/811,572, filed Apr. 5, 2013, which is a national stage application under 35 U.S.C. §371 of PCT/US2011/044995, filed Jul. 22, 2011, and published as WO 2012/012708 on Jan. 26, 2012, which claims priority from U.S. Provisional Application Ser. Nos. 61/366,821 filed Jul. 22, 2010 and 61/390,454 filed Oct. 6, 2010, which applications are herein incorporated by reference in their entirety.

STATEMENT OF GOVERNMENT RIGHTS

This invention was made with Government support under United States Grant No. R01 DK082430-01 awarded by the National Institute of Diabetes and Digestive and Kidney Diseases, National Institutes of Health. The government has rights in the invention.

BACKGROUND OF THE INVENTION

Nuclear reprogramming, the process of converting one cell type into another by resetting the pattern of gene expression, can be achieved through forced expression of defined transcription factors. One example is the induced pluripotent stem cells (iPSCs) prepared by transducing four genes (e.g., Oct4, Sox2, Kif4 and c-Myc, called OSKM hereafter) into a cell type to be dedifferentiated. iPSCs are a type of pluripotent stem cell artificially derived by reprogramming a somatic cell. iPSCs are morphologically similar to embryonic stem cells and are capable of differentiating into a variety of different somatic cell types. This technology allows researchers to obtain pluripotent stem cells for use in a research setting. iPSCs also have therapeutic uses for the treatment of disease without the need for stem cells derived from an embryonic source.

However, generally less than 1% of transduced cells are reprogrammed to form iPSCs, and the entire process of establishing iPSC clones is long (over a month).

SUMMARY OF THE INVENTION

Described herein is a novel approach to nuclear reprogramming using a fusion protein (a protein created through the joining of two or more genes or portions thereof in any orientation or copy number (e.g., from about 1 to about 2, about 3, about 4, about 5 or more copies of genes for example) which originally coded for separate proteins or portions thereof) of a transcription activation domain (TAD) of a gene, for example, MyoD and a transcription factor, for example, Oct4 (such a fusion protein is designated herein as M3O) that greatly improves the efficiency of reprogramming and accelerates iPSC production. iPSC colonies emerged five days after transduction of Sox2, Klf4 and c-Myc (SKM) and M3O into fibroblasts, with colonies rapidly enlarging in the absence of feeder cells. The pluripotency of iPSCs was confirmed by genome-wide gene expression analysis, teratoma formation, and chimera formation, including germline transmission. Transduction of M3O and SKM increased chromatin accessibility at the Oct4 promoter, facilitated recruitment of the Oct4-binding Paf1 complex, and remodeled many histone modifications at pluripotency genes to an embryonic stem cell (ESC)-like state more efficiently than transduction of OSKM. Thus, discussed herein is a novel approach to nuclear reprogramming in which a wide variety of TADs can be combined with related or unrelated transcription factors to reprogram the pattern of gene expression, with applications ranging from induction of pluripotency to direct transdifferentiation.

One embodiment provides iPSCs derived by nuclear reprogramming of a somatic cell with a fusion protein. The somatic cell can be a mammalian cell, for example a mouse cell or a human cell. One embodiment provides a fusion protein for induction of pluripotent stem cells. Another embodiment provides such a pluripotent stem cell, wherein the reprogramming comprises contacting the somatic cell with a fusion protein or DNA encoding the fusion protein. The disclosed methods and fusion proteins can be used to conveniently and reproducibly establish iPSCs having pluripotency and growth ability similar to that of ES cells (ESCs).

One embodiment provides a method for preparing an induced pluripotent stem cell by nuclear reprogramming of a somatic cell. which comprises introducing a nucleic acid sequence, by methods available to one of skill in the art, coding for a fusion protein of an unrelated/heterologous transactivation domain and a transcription factor into the somatic cell. One embodiment provides an induced pluripotent stem cell obtained by such a method. The fusion protein can be the fusion of an unrelated/heterologous transactivation domain and a transcription factor (e.g., the TAD is not normally associated with the transcription factor), such as the transactivation domain of MyoD (sequence information for MyoD is provided, for example, at NM_002478.4; NM_010866.2; NP_002469.2; NP_034996.2) or VP16 fused with Oct4 (full length or a bioactive fragment thereof; octamer-binding transcription factor 4 also known as POU5F1 (POU domain, class 5, transcription factor 1); sequence includes, for example, NM_002701; NM_013633.2; NP_002692; NP_038661.2; NM_001009178; NP_001009178; NM_131112; NP_571187). Additional trans-activating domains can include, for example, but are not limited to, those found in p53, VP16, MLL, E2A, HSF1, NF-IL6, NFAT1 and NF-ÎșB.

Additional factors to be introduced into the cell, and/or used to generate a fusion protein with a transactivation domain, can include, but is not limited to, a gene from the Sox family (e.g., SOX genes encode a family of transcription factors that bind to the minor groove in DNA, and belong to a super-family of genes characterized by a homologous sequence called the HMG (high mobility group) box and include, but are not limited to, SoxA, SRY (e.g., NM_003140.1; NM_011564; NP_003131.1; NP_035694), SoxB1, Sox1 (e.g., NM_005986), Sox2 (e.g., NM_003106; NM_011443; NP_003097; NP_035573). Sox3 (e.g., NM_005634; XM_988206; NP_005625; XP_993300), SoxB2, Sox14 (e.g., NM_004189; XM_284529; NP_004180; XP_284529), Sox21 (e.g., NM_007084; XM_979432; NP_009015; XP_984526), SoxC, Sox4 (e.g., NM_003107; NM_009238; NP_003098; NP_033264), Sox11 (e.g., XM_001128542; NM_009234; XP_001128542; NP_033260), Sox12 (e.g., NM_006943; XM_973626: NP_008874; XP_978720). SoxD, Sox5 (e.g., NM_006940; NM_011444; NP_008871; NP_035574), Sox6 (e.g., NM_017508; NM_001025560; NP_059978; NP_001020731), Sox13 (e.g., NM_005686; NM_011439; NP_005677; NP_035569), SoxE, Sox8 (e.g., NM_014587; NM_011447; NP_055402; NP_035577), Sox9 (e.g., NM_000346; NM_011448; NP_000337; NP_035578), Sox10 (e.g., NM_006941; XM_001001494; NP_008872; XP_001001494), SoxF, Sox7, Sox17, Sox18 (e.g., NM_018419; NM_009236; NP_060889; NP_033262), SoxG, Sox15 (e.g., NM_006942; NM_009235; NP_008873; NP_033261), SoxH, Sox30), the Klf (Krueppel-like factor) family (e.g., KLF1 (e.g., NM_006563), KLF2 (e.g., NM_016270; XM_982078; NP_057354; XP_987172), KLF3 (e.g., NM_016531; XM_994052; NP_057615; XP_999146), KLF4 (e.g., NM_004235; NM_010637; NP_004226; NP_034767), KLF5 (e.g., NM_001730; NM_009769; NP_001721; NP_033899), KLF6 (e.g., NM_001008490; NM_011803; NP_001008490; NP_035933), KLF7 (e.g., NM_003709; XM_992457; NP_003700; XP_997551), KLF8 (e.g., NM_007250; NM_173780; NP_009181; NP_776141), KLF9 (e.g., NM_001206; XM_988516; NP_001197; XP_993610), KLF10 (e.g., NM_001032282; NM_013692; NP_001027453; NP_038720), KLF11 (e.g., XM_001129527; NM_178357; XP_001129527: NP_848134), KLF12 (e.g., NM_016285; NM_010636; NP_057369; NP_034766), KLF13 (e.g., NM_015995; NM_021366; NP_057079; NP_067341). KLF14 (e.g., NM_138693; NM_001135093; NP_619638; NP_001128565), KLF15 (e.g., NM_014079; NM_023184; NP_054798; NP_075673), KLF16, KLF17 (e.g., NM_173484.3; NM_029416.2; NP_775755.3; NP_083692.2)), the Myc family (e.g., c-Myc (e.g., NM_002467.4; NM_010849; NP_002458.2; NP_034979)), nanog (e.g., NM_024865.2; NM_028016.2; NP_079141.2; NP_082292.1), Lin28 (e.g., NM_024674; NM_145833; NP_078950: NP_665832) or a combination thereof. Additionally, the cell can also be contacted with a cytokine, such as basic fibroblast growth factor (bFGF) and/or stem cell factor (SCF). In one embodiment, the somatic cell is further contacted with a DNA demethylation reagent.

One embodiment provides a somatic cell derived by inducing differentiation of an induced pluripotent stem cell as disclosed herein. One embodiment also provides a method for stem cell therapy comprising: (1) isolating and collecting a somatic cell from a subject; (2) inducing said somatic cell from the subject into an iPSC (3) inducing differentiation of said iPSCs, and (4) transplanting the differentiated cell from (3) into the subject (e.g., a mammal, such as a human).

BRIEF DESCRIPTION OF THE DRAWINGS

FIGS. 1A, 1B, 1C, 1D, 1E, 1F, 1G and 1H. Establishment of mouse iPSCs with M3O-SKM. (A) Schematic drawing of MyoD-Oct4 chimeric constructs. Numbers indicate amino acid positions delimiting MyoD fragments. The basic helix-loop-helix (bHLH) domain of MyoD corresponds to amino acids 108-167, which was not used in these chimeric constructs. EO indicates a polypeptide consisting of one methionine and a chain of 20 glutamic acids fused to Oct4 (E for glutamic acid). Right column shows percentage of GFP-positive colonies derived from mouse embryonic fibroblasts (MEFs) transduced with each MyoD-Oct4 chimeric construct along with SKM and cultured on feeder cells (FIG. 1B, Protocol A). Data represent the mean±SEM from three independent experiments. (B) Schematic drawings of two protocols for iPSC creation. Whereas transduced MEFs were transferred onto feeder cells on day 4 in Protocol A, MEFs were maintained feeder-free until the end of experiments in Protocol B. (C) Emergence of GFP-positive colonies obtained with M3O-SKM with Protocol B. Bar, 200 Όm. (D) Summary of the efficiency of making GFP-positive colonies with various combinations of the M3O, Sox2, Klf4, and c-Myc genes with Protocol B. Number of GFP-positive colonies peaked by day 14. (E) Drawings of various combinations of the M3 domain and Oct4. The efficiency of making GFP-positive colonies with Protocol B in the presence of SKM is shown on the right. (F) Drawings of TAD replacement constructs in which TADs of Oct4 were replaced with the M3 domain. Constructs were transduced with SKM. (G) Drawings of fusion constructs between the M3 domain and Sox2 or Klf4. Sox2 mutants were transduced with OKM or M3O-KM. The Klf4 mutant was transduced with OSM or M3O-SM. (H) Drawings of fusion constructs between Oct4 and TADs taken from other transactivators. Constructs were transduced with SKM.

FIGS. 2A, 2B and 2C. Characterization of mouse iPSCs prepared with M3O-SKM (M3O-iPSCs). (A) Comparison of GFP-positivity between colonies obtained with M3O-SKM and OSKM using Protocol B. Representative images of the GFP expression patterns used to categorize colonies are shown (top). Percentages of colonies with different GFP expression patterns were calculated from 300 colonies for M3O-SKM and OSKM (bottom). Bar, 200 ÎŒm. (B) qRT-PCR analysis of expression levels of three pluripotency genes in MEFs and GFP-positive colonies obtained with M3O-SKM and OSKM. PCR primers specific to endogenous Oct4 and Sox2 were used for these two genes. Although GFP-positive colonies were harvested on different days based on the time when the GFP signal first emerged for M3O-SKM (day 5) and OSKM (day 10), the intervals between time points is equivalent (bottom of graphs). Expression level of each gene in ESCs (CGR8.8 cells) was defined as 1.0. Five colonies were examined for each condition. Results represent the mean+SEM of three independent experiments. (C) qRT-PCR analysis of expression levels of three fibroblast-enriched genes in MEFs and GFP-positive colonies obtained with M3O-SKM and OSKM.

FIGS. 3A, 3B, 3C, 3D, 3E and 3F. Verification of pluripotency of mouse M3O-iPSCs. (A) Expression level of transcripts in M3O-iPSCs and ESCs relative to MEFs. Log 2 ratios are plotted for transcripts in ESCs/MEFs and iPSCs/MEFs. Red lines indicate a 4-fold difference in transcript levels. Transcripts in M3O-iPSCs were assayed 60 days after transduction. (B) Hematoxylin and eosin staining of teratoma sections derived from M3O-iPSCs. Neural tube and epidermis (ectoderm), striated muscle and bone (mesoderm), and mucous gland and respiratory epithelium (endoderm) are shown. Bar, 50 ÎŒm. (C) X gal staining for cells expressing the lacZ gene in a chimeric embryo prepared with M3O-iPSCs and a control embryo at 13.5 dpc. (D) Chimeric mice prepared with M3O-iPSCs. The agouti coat color indicates a high (right) and low (left) contribution of iPSCs to the skin. The host embryos used to generate mice were derived from the albino mouse strain ICR. (E) Germline contribution of M3O-iPSCs as shown by GFP expression in the gonad of a 13.5 dpc chimeric embryo. (F) Pups obtained from crossing a wild-type ICR female (bottom) with an M3O-iPSC chimeric male (left mouse in panel D).

FIGS. 4A, 4B, 4C, 4D, 4E and 4F. Characterization of human iPSCs established with M3O-SKM. (A) Immunofluorescence staining of NANOG and SSEA4 in human iPSC colonies on day 8 and 15 obtained with M3O-SKM without subculture after day 3 when transferred onto Matrigel. Bar, 100 ÎŒm for (A) and (B). Note that day 15 colonies are substantially larger than day 8 colonies as indicated by the different magnifications. (B) Comparison of the efficiency of making NANOG-positive colonies between M3O-SKM and OSKM. The number of NANOG-positive colonies was divided by the number of seeded dermal fibroblasts at each time point. (C) Immunofluorescence staining of pluripotency markers in cloned human iPSCs obtained with M3O-SKM on day 28 after four passages. (D) Quantitative RT-PCR analysis of pluripotency genes expressed in cloned human iPSCs prepared with M3O-SKM. Ten colonies were harvested on day 30 and the mean+SEM was obtained. The expression level of each gene in human ESCs H9 was defined as 1.0. Endogenous genes were amplified for OCT4, SOX2. KLF4 and c-MYC. (E) Karyotype analysis of a human iPSC established with M3O-SKM. (F) Hematoxylin and eosin staining of teratoma sections derived from human iPSCs prepared with M3O-SKM. Bar, 100 ÎŒm.

FIGS. 5A, 5B, 5C, 5D, 5E and 5F. Chromatin analyses of the Oct4 gene in MEFs transduced with M3O-SKM (M3O-MEFs) and those with OSKM (O-MEFs). (A) DNA methylation patterns at the proximal promoter of the Oct4 gene analyzed with bisulfite sequencing. Black circles indicate methylated CpG and open circles, unmethylated CpG. The proportion of unmethylated CpG sites was calculated by dividing the number of unmethylated CpG sites by the total number of CpG sites in each cell type. (B) Flow cytometry of O-MEFs and M3O-MEFs prepared with Protocol B and harvested on day 9. (C) ChIP analyses of the binding levels of Oct4, Sox2, and the Paf1 complex subunits at the distal enhancer (Region 1) and initiation site (Region 2) of the Oct4 gene in M3O-MEFs and 0-MEFs. Data represent the mean+SEM of three independent experiments. All y axes indicate relative enrichment (fold). Relative enrichment in ESCs was defined as 1.0. ESCs and MEFs were mixed at a 13:87 ratio in the sample labeled as ESCs+MEFs (blue). The difference of the values between the two samples indicated by an asterisk was statistically significant (p<0.01). (D) Analyses of the accessibility of the restriction enzyme NsiI to chromatin at the distal enhancer of the Oct4 gene by Southern blotting. Locations of the enzyme recognition site and probe are shown in relation to the distal enhancer of the Oct4 gene (top). The transcription initiation site was defined as position 1. Appearance of new DNA fragments following digestion with NsiI are shown (bottom). Percentage of digested chromatin was obtained by dividing the combined signal intensity of the bands at 752 and 652 bp by the combined signal intensity of the two bands and the band at 1404 bp. Cloned O-iPSCs and M3O-iPSCs were used for day 30 lanes. GFP-negative population was collected by a FACS and analyzed for the day 9 GFP (−) lane of M3O-MEFs (far right). (E) ChIP analyses of the levels of three histone modifications associated with active genes at the initiation site (Region 2) and a coding region (Region 3) of the Oct4 gene. (F) ChIP analyses of the levels of two histone modifications associated with inactive genes at a coding region of the Oct4 gene (Region 3). Relative enrichment in MEFs was defined as 1.0.

FIGS. 6A, 6B, 6C, 6D and 6E. Effects of M3O-SKM and OSKM on expression of pluripotency markers and cell proliferation. (A) Temporal profiles of expression patterns of alkaline phosphatase. Bar, 100 ÎŒm. (B) Temporal profiles of expression patterns of SSEA1. Bar, 100 ÎŒm. (C) Flow cytometry comparing the expression level of SSEA1 between MEFs transduced with OSKM and those transduced with M3O-SKM. (D) Cell proliferation patterns of MEFs transduced with M3O or Oct4. Means+SEM of three independent experiments are shown. (E) Cell proliferation patterns of MEFs transduced with M3O-SKM or OSKM.

FIGS. 7A, 7B, 7C, 7D, 7E and 7F. Chromatin analyses of day 9 at the Oct4 gene comparing transduction of MEFs with different gene combinations. (A) Flow cytometry of MEFs transduced with M3O-SK and OSK. (B) DNA methylation analysis by bisulfite sequencing. MEFs were transduced with one (1F), two (2F), or three (3F) transcription factor genes. (C) ChIP studies on transcription factor binding at the distal enhancer. (D) Chip analyses on histone modifications associated with active genes. (E) ChIP studies on histone modifications associated with suppressed genes. (F) Hypothetical summary of epigenetic remodeling induced by M3O-SKM (right) in comparison to the lack of remodeling with OSKM (left). Binding sites for Oct4 and Sox2 are located adjacent to each other at the distal enhancer of Oct41. Transduced Oct4 and Sox2 cannot bind to their respective binding sites (blue box and gray box, respectively) in the majority of O-MEFs due to condensed chromatin. In contrast, M3O and Sox2 can effectively bind to each binding site in M3O-MEFs through the effects of the unidentified binding proteins to the MyoD TAD domain. Recruitment of these proteins eventually contributes to DNA demethylation at the proximal promoter and a histone modification pattern typical of active genes at the coding region.

FIG. 8. Immunoblotting of MyoD-Oct4 fusion proteins. Expression of transduced MyoD-Oct4 fusion genes was evaluated with an antibody against Oct4 (top). Expression of histone H2A was examined as a loading control (bottom). Bands correspond to the predicted molecular mass of each protein. Identities of extra bands marked with asterisks are unknown.

FIGS. 9A, 9B and 9C. Chip analyses of the Sox2 gene. (A) Binding of Oct4 and Sox2 at the enhancer. (B) Binding of parafibromin and the levels of histone modifications associated with active genes on day 9. (C) Levels of histone modifications associated with suppressive genes on day 9.

FIGS. 10A and 10B. ChIP analyses on day 9 of the Oct4 gene comparing transduction of one (1F), two (2F), three (3F) and four (4F) transcription factor genes. (A) Transcription factor binding. (B) Histone modifications associated with gene activation.

FIGS. 11A and 11B. ChIP analyses on day 9 of the Sox2 gene comparing transduction of one (1F), two (2F), three (3F) and four (4F) transcription factor genes. (A) Transcription factor binding at the enhancer. (B) Histone modifications associated with gene activation and suppression.

DETAILED DESCRIPTION OF THE INVENTION

iPSC technology is the process of converting an adult specialized cell, such as a skin cell, into a stem cell, a process known as dedifferentiation. iPSCs can be very useful in clinical as well as preclinical settings. For example, iPSCs can be created from human patients and differentiated into many tissues to provide new materials for autologous transplantation, which can avoid immune rejection of the transplanted tissues. For example, pancreatic beta cells differentiated from a patient's iPSCs can be transplanted into the original patient to treat diabetes. Also, iPSCs derived from a patient can be differentiated into the ailing tissue to be used in an in vitro disease model. For example, study of dopaninergic neurons differentiated from a Parkinson's disease patient can provide unprecedented clues for the pathogenesis of the disease. In vitro-differentiated cells derived from iPSCs can be used for drug screening. For instance, many drugs are metabolized in the liver, but there have been no ideal liver cells that can be cultured for a long term for in vitro screening of drug toxicity. Also, iPSCs provide a new opportunity to understand the mechanisms underlying the plasticity of cell differentiation. Thus, the potential of iPSCs for many fields of life science is tremendous.

However, the process of generating iPSCs is slow and inefficient. With the standard protocol, MEFs are transduced with OSKM on day 1 and the cells are transferred onto feeder cells composed of irradiated fibroblasts, which provide a poorly characterized, but optimal environment for the generation of iPSCs, on day 5. iPSC colonies emerge around day 10, which are then picked up and expanded over the next two to three weeks on feeder cells to establish purified iPSC lines. Eventually, only 0.1% of the transduced fibroblasts turn into iPSCs. This slow process and extremely low efficiency make production of iPSCs costly.

It is disclosed herein that a fusion protein combining, for example, the stem cell factor Oct4 (a homeodomain transcription factor associated with undifferentiated cells) with a portion of another protein factor, for example, a transactivation domain, such as that of MyoD, can accelerate the process of making iPSCs. It is also shown herein that heterologous transactivation domains, including the MyoD TAD, promote global chromatin remodeling of stem cell genes. Thus, the process disclosed herein improves the efficiency and quality of iPSCs.

Definitions

As used herein, the terms below are defined by the following meanings:

Induced pluripotent stem cells, commonly abbreviated as iPSCs, are a type of pluripotent stem cell obtained from a non-pluripotent cell, typically an adult somatic cell (a cell of the body, rather than gametes or an embryo), by inducing a “forced” expression of certain genes. iPSCs are believed to be similar to natural pluripotent stem cells, such as ESCs in many respects, such as the expression of certain stem cell genes and proteins, chromatin methylation patterns, doubling time, embryoid body formation, teratoma formation, viable chimera formation, and potency and differentiability.

iPSCs are not adult stem cells, but rather reprogrammed cells (e.g., epithelial cells) given pluripotent capabilities. Using genetic reprogramming with protein transcription factors, pluripotent stem cells equivalent to embryonic stem cells have been derived from human adult skin tissue. Shinya Yamanaka and his colleagues at Kyoto University used the transcription factors Oct3/4, Sox2, c-Myc, and Klf4 in their experiments on cells from humans. Junying Yu, James Thomson, and their colleagues at the University of Wisconsin-Madison used a different set of factors, Oct4, Sox2, Nanog and Lin28, and carried out their experiments using cells from human foreskin to generate iPS cells.

The term “isolated” refers to a factor(s), cell or cells which are not associated with one or more factors, cells or one or more cellular components that are associated with the factor(s), cell or cells in vivo.

“Cells” include cells from, or the “subject” is, a vertebrate, such as a mammal, including a human. Mammals include, but are not limited to, humans, farm animals, sport animals and companion animals. Included in the term “animal” is dog, cat, fish, gerbil, guinea pig, hamster, horse, rabbit, swine, mouse, monkey (e.g., ape, gorilla, chimpanzee, orangutan), rat, sheep, goat, cow and bird.

An “effective amount” generally means an amount which provides the desired local or systemic effect and/or performance.

“Pluripotency” refers to a stem cell that has the potential to differentiate into one, two or three of the three germ layers: endoderm (e.g., interior stomach lining, gastrointestinal tract, the lungs), mesoderm (e.g., muscle, bone, blood, urogenital), or ectoderm (e.g., epidermal tissues and nervous system). Pluripotent stem cells can give rise to any fetal or adult cell type.

“Transdifferentiation” is when a non-stem cell transforms into a different type of cell, or when an already differentiated stem cell creates cells outside its already established differentiation path.

A “transcription factor” (sometimes called a sequence-specific DNA-binding factor) is a protein that binds to specific DNA sequences, thereby controlling the transfer (or transcription) of genetic information from DNA to mRNA. Transcription factors perform this function alone or with other proteins or factors in a complex, by promoting (as an activator), or blocking (as a repressor) the recruitment of RNA polymerase (the enzyme that performs the transcription of genetic information from DNA to RNA) to specific genes. Generally, a defining feature of transcription factors is that they contain one or more DNA-binding domains (DBDs), which attach to specific sequences of DNA adjacent to the genes that they regulate.

A “transcription activation domain,” “transactivation domain” or “trans-activating domain” is generally that portion of a transcription factor that is responsible for recruitment of the transcription machinery needed to transcribe RNA. Transactivation is an increased rate of gene expression triggered either by biological processes or by artificial means. Transactivation can be triggered either by endogenous cellular or viral proteins—transactivators. These protein factors act in trans (i.e., intermolecularly). An “unrelated” or “heterologous transactivation domain” refers to a transactivation domain that is not normally associated with the gene/protein (e.g., transcription factor) of interest (not wild-type).

By “pure” it is meant that the population of cells has the desired purity. For example, iPSC populations can comprise mixed populations of cells. Those skilled in the art can readily determine the percentage of iPSCs in a population using various well-known methods, such as fluorescence activated cell sorting (FACS). Preferable ranges of purity in populations comprising iPSCs are about 1 to about 5%, about 5 to about 10%, about 10 to about 15%, about 15 to about 20%, about 20 to about 25%, about 25 to about 30%, about 30 to about 35%, about 35 to about 40%, about 40 to about 45%, about 45 to about 50%, about 50 to about 55%, about 55 to about 60%, about 60 to about 65%, about 65 to about 70%, about 70 to about 75%, about 75 to about 80%, about 80 to about 85%, about 85 to about 90%, about 90% to about 95% or about 95 to about 100%. Purity of the cells can be determined for example according to the cell surface marker profile within a population.

The terms “comprises.” “comprising,” and the like can have the meaning ascribed to them in U.S. Patent Law and can mean “includes,” “including” and the like. As used herein, “including” or “includes” or the like means including, without limitation.

Rapid and Efficient Production of iPSCs

Through the processes disclosed herein, iPSC colonies emerge as early as about five days (day 5) after transduction of a transactivator domain (or a portion thereof) fused to a transcription factor (or a portion thereof), e.g., M3O (short transactivation domain of MyoD (about 50 to 60 amino acids) fused to the amino terminus of the full-length Oct4), Sox2, Klf4, and c-Myc without feeder cells. The preparation of the nucleic acid molecule coding for the fusion protein(s) as well as the construct(s) of Sox, Klf, c-Myc etc. (either singly or on a polycistronic RNA) can be carried out by methods available to an art worker as well as the transduction thereof into cells (see, for example, Sambrook, Molecular Cloning: A Laboratory Manual).

iPSCs established with the standard OSKM protocol frequently contain partially reprogrammed cells and even established iPSCs occasionally lose pluripotency during prolonged cultures. In contrast, the iPSCs disclosed herein retain pluripotency more tightly and heterogeneity among different colonies is much less apparent than that with the OSKM iPSCs. In addition, iPSC colonies can be obtained without c-Myc (use only M3O, Sox2 and Klf4) at the efficiency of 0.44% around day 7. iPSCs have been prepared without c-Myc (use OSK) before, but the efficiency was low (<0.01%) and it generally took 30 to 40 days for iPSCs to emerge2,3. Additionally, this transactivation domain-based strategy can be applied to amplify the effects of other transcription factors to facilitate their reprogramming capability of cell differentiation. In summary, the use of a TAD, such as the M3 domain, has made iPSC production faster, easier, feeder-free and more efficient than the standard OSKM or other protocols.

Thus, as discussed above, the fusion technology, such as the M3O, technology disclosed herein has significant advantages over wild-type Oct4 (or other transcription factors) in generating iPSCs. First, the fusion technology is faster. While iPSC colonies appear at about day 10 with the standard OSKM protocol (see, Cell Stem Cell 2008, 3, 595 for a general protocol for making iPSCs), iPSC colonies emerge on day 5 with the fusion technology (e.g., M3O-SKM). Second, efficiency of making iPSCs is more than 50-fold higher with the fusions technology (e.g., M3O-SKM) than that with OSKM. Third, purer iPSCs populations can be obtained with the fusions technology described herein (e.g., M3O-SKM) compared with OSKM. Fourth, the fusion technology described herein (e.g., M3O-SKM) does not require feeder cells unlike OSKM. This is noted especially for making iPSCs for transplantation purposes because one would generally need to use patient-derived fibroblasts as feeder cells to avoid immune rejection. Also, the use of feeder cells adds an extra step to make iPSCs. Feeder-free iPSCs have been reported, but they are derived from already undifferentiated cells, such as adipose stem cells. Fibroblasts generally require feeder cells to become iPSCs. Finally, iPSCs can be prepared using only M3O, Sox2 and Klf4 (without c-Myc).

Generally, genes which can be used to create induced pluripotent stem cells, either singly, in combination or as fusions with transactivation domains, include, but are not limited to, one or more of the following: Oct4 (Oct3/4, Pou5f1), Sox (e.g., Sox1, Sox2, Sox3, Sox18, or Sox15), Klf (e.g., Klf4, Klf1, Klf3, Klf2 or Klf5), Myc (e.g., c-myc, N-myc or L-myc), nanog, or LIN28. As examples of sequences for these genes and proteins, the following accession numbers are provided: Mouse MyoD: M84918, NM_010866; Mouse Oct4 (POU5F1): NM_013633; Mouse Sox2: NM_011443; Mouse Klf4: NM_010637; Mouse c-Myc: NM_001177352, NM_001177353, NM_001177354 Mouse Nanog: NM_028016; Mouse Lin28: NM_145833: Human MyoD: NM_002478; Human Oct4 (POU5F1): NM_002701, NM_203289, NM_001173531; Human Sox2: NM_003106; Human Klf4: NM_004235; Human c-Myc: NM_002467; Human Nanog: NM_024865; and/or Human Lin28: NM_024674, for portions or fragments thereof and/or any related sequence available to an art worker (these sequences are incorporated by referenced herein). For example, sequences for use in the invention have at least about 50% or about 60% or about 70%, about 71%, about 72%, about 73%, about 74%, about 75%, about 76%, about 77%, about 78%, or about 79%, or at least about 80%, about 81%, about 82%, about 83%, about 84%, about 85%, about 86%, about 87%, about 88%, or about 89%, or at least about 90%, about 91%, about 92%, about 93%, or about 94%, or at least about 95%, about 96%, about 97%, about 98%, or about 99% sequence identity compared to the sequences and/or accession numbers provided herein and/or any other such sequence available to an art worker, using one of alignment programs available in the art using standard parameters or hybridization techniques. In one embodiment, the differences in sequence are due to conservative amino acid changes. In another embodiment, the protein sequence or DNA sequence has at least 80% sequence identity with the sequences disclosed herein and is bioactive (e.g., retains activity).

Methods of alignment of sequences for comparison are available in the art. Thus, the determination of percent identity between any two sequences can be accomplished using a mathematical algorithm. Computer implementations of these mathematical algorithms can be utilized for comparison of sequences to determine sequence identity. Such implementations include, but are not limited to: CLUSTAL in the PC/Gene program (available from Intelligenetics, Mountain View, Calif.); the ALIGN program (Version 2.0) and GAP, BESTFIT, BLAST, FASTA, and TFASTA in the Wisconsin Genetics Software Package, Version 8 (available from Genetics Computer Group (GCG), 575 Science Drive. Madison, Wis., USA). Alignments using these programs can be performed using the default parameters.

During and after preparation of iPSCs, the cells can be cultured in culture medium that is established in the art and commercially available from the American Type Culture Collection (ATCC), Invitrogen and other companies. Such media include, but are not limited to, Dulbecco's Modified Eagle's Medium (DMEM), DMEM F12 medium, Eagle's Minimum Essential Medium, F-12K medium, Iscove's Modified Dulbecco's Medium, Knockout DMEM, or RPMI-1640 medium. It is within the skill of one in the art to modify or modulate concentrations of media and/or media supplements as needed for the cells used. It will also be apparent that many media are available as low-glucose formulations, with or without sodium pyruvate.

Also contemplated is supplementation of cell culture medium with mammalian sera. Sera often contain cellular factors and components that are needed for viability and expansion. Examples of sera include fetal bovine serum (FBS), bovine serum (BS), calf serum (CS), fetal calf serum (FCS), newborn calf serum (NCS), goat serum (GS), horse serum (HS), human serum, chicken serum, porcine serum, sheep serum, rabbit serum, rat serum (RS), serum replacements (including, but not limited to, KnockOut Serum Replacement (KSR, Invitrogen)), and bovine embryonic fluid. It is understood that sera can be heat-inactivated at 55-65° C. if deemed needed to inactivate components of the complement cascade. Modulation of serum concentrations, or withdrawal of serum from the culture medium can also be used to promote survival of one or more desired cell types. In one embodiment, the cells are cultured in the presence of FBS/or serum specific for the species cell type. For example, cells can be isolated and/or expanded with total serum (e.g., FBS) or serum replacement concentrations of about 0.5% to about 5% or greater including about 5% to about 15% or greater, such as about 20%, about 25% or about 30%. Concentrations of serum can be determined empirically.

Additional supplements can also be used to supply the cells with trace elements for optimal growth and expansion. Such supplements include insulin, transferrin, sodium selenium, and combinations thereof. These components can be included in a salt solution such as, but not limited to, Hanks' Balanced Salt Solutionℱ (HBSS), Earle's Salt Solutionℱ, antioxidant supplements, MCDB-201ℱ supplements, phosphate buffered saline (PBS), N-2-hydroxyethylpiperazine-Nâ€Č-ethanesulfonic acid (HEPES), nicotinamide, ascorbic acid and/or ascorbic acid-2-phosphate, as well as additional amino acids. Many cell culture media already contain amino acids; however some require supplementation prior to culturing cells. Such amino acids include, but are not limited to, L-alanine, L-arginine. L-aspartic acid. L-asparagine, L-cysteine, L-cysteine, L-glutamic acid, L-glutamine, L-glycine, L-histidine, L-inositol, L-isoleucine. L-leucine, L-lysine. L-methionine, L-phenylalanine, L-proline, L-serine, L-threonine, L-tryptophan, L-tyrosine, and L-valine.

Antibiotics are also typically used in cell culture to mitigate bacterial, mycoplasmal, and fungal contamination. Typically, antibiotics or anti-mycotic compounds used are mixtures of penicillin/streptomycin, but can also include, but are not limited to, amphotericin (Fungizoneℱ), ampicillin, gentamicin, bleomycin, hygromycin, kanamycin, mitomycin, mycophenolic acid, nalidixic acid, neomycin, nystatin, paromomycin, polymyxin, puromycin, rifampicin, spectinomycin, tetracycline, tylosin, and zeocin.

Hormones can also be advantageously used in cell culture and include, but are not limited to, D-aldosterone, diethylstilbestrol (DES), dexamethasone, ÎČ-estradiol, hydrocortisone, insulin, prolactin, progesterone, somatostatin/human growth hormone (HGH), thyrotropin, thyroxine, and L-thyronine. ÎČ-mercaptoethanol can also be supplemented in cell culture media.

Lipids and lipid carriers can also be used to supplement cell culture media, depending on the type of cell and the fate of the differentiated cell. Such lipids and carriers can include, but are not limited to cyclodextrin (α, ÎČ, Îł), cholesterol, linoleic acid conjugated to albumin, linoleic acid and oleic acid conjugated to albumin, unconjugated linoleic acid, linoleic-oleic-arachidonic acid conjugated to albumin, oleic acid unconjugated and conjugated to albumin, among others. Albumin can similarly be used in fatty-acid free formulation.

Cells in culture can be maintained either in suspension or attached to a solid support, such as extracellular matrix components and synthetic or biopolymers. Cells often require additional factors that encourage their attachment to a solid support (e.g., attachment factors) such as type I, type II, and type IV collagen, concanavalin A, chondroitin sulfate, fibronectin, “superfibronectin” and/or fibronectin-like polymers, gelatin, laminin, poly-D and poly-L-lysine, Matrigelℱ, thrombospondin, and/or vitronectin.

Cells can be cultured at different densities, e.g., cells can be seeded or maintained in the culture dish at different densities. For example, for cells to be dedifferentiated or iPSCs, the cells can be seeded or maintained at low or high cell densities. For example, at densities, including, but not limited to, densities of less than about 2000 cells/well of a 12-well plate (for example, 12-well flat-bottom growth area: 3.8 cm2 well volume: 6.0 ml or well ID×depth (mm) 22.1×17.5, well capacity (ml) 6.5, growth area (cm2) 3.8), including less than about 1500 cells/well of a 12-well plate, less than about 1,000 cells/well of a 12-well plate, less than about 500 cells/well of a 12-well plate, or less than about 200 cells/well of a 12-well plate. The cells can also be seeded or maintained at higher densities, for example, great than about 2,000 cells/well of a 12-well plate, greater than about 2,500 cells/well of a 12-well plate, greater than about 3,000 cells/well of a 12-well plate, greater than about 3,500 cells/well of a 12-well plate, greater than about 4,000 cells/well of a 12-well plate, greater than about 4,500 cells/well of a 12-well plate, greater than about 5,000 cells/well of a 12-well plate, greater than about 5,500 cells/well of a 12-well plate, greater than about 6,000 cells/well of a 12-well plate, greater than about 6,500 cells/well of a 12-well plate, greater than about 7,000 cells/well of a 12-well plate, greater than about 7,500 cells/well of a 12-well plate or greater than about 8,000 cells/well of a 12-well plate.

The maintenance conditions of cells cultures can also contain cellular factors that allow cells, such as the iPSCs of the invention, to remain in an undifferentiated form. It may be advantageous under conditions where the cell must remain in an undifferentiated state of self-renewal for the medium to contain epidermal growth factor (EGF), platelet derived growth factor (PDGF), leukemia inhibitory factor (LIF), basic fibroblast growth factor (bFGF) and combinations thereof. It is apparent to those skilled in the art that supplements that allow the cell to self-renew (e.g., to produce replicate daughter cells having differentiation potential that is identical to those from which they arose; a similar term used in this context is “proliferation”), but not differentiate should be removed from the culture medium prior to differentiation. It is also apparent that not all cells will require these factors.

EXAMPLES

The following examples are provided in order to demonstrate and further illustrate certain embodiments and aspects of the present invention and are not to be construed as limiting the scope thereof.

Example 1

Materials and Methods

Preparation of Mouse IPSCs

Full-length and deletion mutants of mouse Oct4 cDNA were fused with various TADs and inserted into the pMXs-IP vector4. Polycistronic cDNAs encoding Sox2, Klf4 and c-Myc were transferred from the 4F2A lentiviral vector5 to the pMXs-IP vector, pMXs-IP vectors encoding OSKM separately (Addgene) were also used in some experiments. These pMXs-IP vectors were transfected into Plat-E cells6 with Fugene 6 (Roche). Virus supernatant was harvested 48 and 72 hr later and filtered through a 0.45 Cpm syringe filter. MEFs were prepared from Oct4-GFP mice which harbour an IRES-green fluorescence protein (GFP) fusion cassette downstream of the stop codon of the Oct4 gene (Jackson Laboratory #008214)7. All animal experiments were conducted in accordance with the animal experiment guidelines of University of Minnesota. For chimera experiments, MEFs were prepared from mice that harbour the Oct4-GFP allele and ROSA26-lacZ allele. MEFs were seeded at 3×105 cells/6 cm dish on day −2 in DMEM with 10% fetal bovine serum (FBS). Fresh virus supernatant was added to MEFs on day −1 and day 0 with 10 ÎŒg/ml polybrene. Culture medium was then changed to iPSC medium (DMEM, 15% fetal bovine serum, 100 ÎŒM MEM non-essential amino acids, 55 ÎŒM 2-mercaptoethanol, 2 mM L-glutamine and 1000 u/ml leukemia inhibitory factor) on day 1. Transduced MEFs were subcultured onto irradiated SNL feeder cells at 2×105 cells/6 cm dish on day 4 and maintained on the feeder cells in Protocol A. The maximum number of GFP-positive colonies obtained around day 18 was divided by 2×105 to obtain the efficiency of making iPSCs. In Protocol B, transduced MEFs were maintained without feeder cells. GFP-positive colonies were picked up around day 10 to clone without feeder cells for pluripotency analyses. Retrovirus titer was measured using NIH3T3 cells as described 8. All recombinant DNA research was conducted following the NIH guidelines.

Preparation of Human iPSCs

Full-length human OCT4 cDNA fused with the M3 domain of human MYOD at the amino terminus was inserted into the pMXs-IP vector. pMXs-IP vectors encoding human M3O, OCT4, SOX2, KLF4 and c-MYC (Addgene) were transfected into Plat-A cells (Cell Biolabs) with Lipofectamin 2000 (Invitrogen). Virus supernatant was harvested 48 and 72 hrs later (day −1 and 0, respectively below), filtered through a 0.45 ÎŒm syringe filter and transduced into dermal fibroblasts obtained from a 34-year-old Caucasian female (Cell Applications). On day −2, 2.7×104 fibroblasts were plated in each well of a 12-well plate in DMEM with 10% fetal bovine serum. Fresh virus supernatant was added to the fibroblasts on day −1 and day 0 with 10 ÎŒg/ml polybrene. On day 3 cells were harvested with trypsin and subcultured at 1.7×104 cells per well in 12-well plates coated with BD Matrigel hESC-qualified Matrix (BD Biosciences) in human iPSC medium (KnockOut DMEMF-12 (Invitrogen), 20% Knockout Serum Replacement (Invitrogen), 100 ÎŒM MEM non-essential amino acids, 1% insulin-transferrin-selenium (Invitrogen), 0.1 mM 2-mercaptoethanol, 2 mM L-glutamine and 4 ng/ml basic FGF). The medium was changed every other day.

Chromatin Accessibility to NsiI

One million cells were resuspended in ice-cold lysis buffer containing 0.1% NP40 and incubated on ice for 5 min as previously described9. Nuclei were isolated with centrifugation at 4,000×g for 5 min and digested with 200 u/ml NsiI for 2 hr at 37° C. DNA was purified and double-digested with MspI and BamHI, followed by Southern blotting using the radioactive probe shown in FIG. 5D.

Immunoblotting

MEFs were transduced with MyoD-Oct4 fusion genes and analyzed with immunoblotting five days after transduction. All antibodies are listed in supplemental Table 1. SuperSignal West Dura (Thermo Scientific) was used to detect chemiluminescence signal.

TABLE 1
Antibodies used in immunoblotting, immunofluorescence
staining and ChIP
Immunoblotting (primary antibodies)
Antigen Manufacturer Catalog #
Oct4 Santa Cruz Biotechnology sc-9081
Histone H2A IMAGENEX IMG-358
Immunoblotting (secondary antibodies)
Name Manufacturer Catalog #
Peroxidase-conjugated Jackson ImmunoResearch 211-032-171
anti-rabbit IgG
Peroxidase-conjugated Jackson ImmunoResearch 115-035-174
anti-mouse IgG
Immunofluorescence staining (primary antibodies)
Antigen Manufacturer Catalog #
Oct4 Santa Cruz Biotechnology sc-8628
Nanog Abcam ab21624
SSEA1 R&D Systems FAB2155P
SSEA4, Alexa Fluor BD Biosciences 560308
488-labeled
TRA-1-60, Alexa BD Biosciences 560121
Fluor 555-labeled
TRA-1-81, BD Biosciences 560161
phycoerythrin-labeled
Immunofluorescence staining (secondary antibodies)
Name Manufacturer Catalo g#
PE-labeled anti- BD Biosciences 550589
mouse Ig(M + G)
Alexa Fluor 555-labeled Invitrogen A21429
anti-rabbit IgG
Alexa Fluor 488-labeled Invitrogen A11055
anti-goat IgG
ChIP
Antigen Manufacturer Catalog #
Oct4 Santa Cruz Biotechnology sc-9081
Sox2 Santa Cruz Biotechnology sc-17320
Parafibromin Bethyl Laboratories A300-170A
Paf1 Abcam ab-20662
Leo1 Abcam ab-70630
H3K4me3 Abcam ab-1012
H3K9ac Abcam ab-4441
H3K14ac Millipore 07-353
H3K9me3 Millipore 07-523
H3K27me3 Millipore 07-449
Control IgG Santa Cruz Biotechnology sc-2027

Fluorescence Microscopy

iPSCs were fixed with 4% formaldehyde for 10 min and permeabilized with 0.5% Triton X-100 for 3 min. Cells were then incubated with primary antibody and secondary antibody for 1 hr each at 25° C. DNA was counterstained with Hoechst 33342. Used antibodies are listed in Table 1. Fluorescence signal was captured with a 10× A-Plan Phi Var1 objective (numerical aperture 0.25) and an AxioCam charge coupled device camera attached to an Axiovert 200M fluorescence microscope (all from Zeiss). Photoshop 7.0 (Adobe Systems) was used for image processing.

Alkaline Phosphatase Staining

Alkaline phosphatase was detected with an Alkaline Phosphatase Detection Kit (Millipore SCR004).

Flow Cytometry

The percentage of GFP-positive or SSEA1-positive cells at each time point was determined with a FACSCalibur flow cytometer and analyzed using CellQuest Pro software (both BD Biosciences).

Quantitative RT-PCR (qRT-PCR)

cDNA for mRNA was prepared from iPSC colonies using a Cells-to-cDNA II kit (Ambion). qRT-PCR was performed with GoTaq qPCR Master mix (Promega) on a Realplex 2S system (Eppendorf). PCR primer sequences are listed in Table 2. Expression level of glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was used to normalize the expression levels of mRNAs. The feeder-free ESC line CGR8.8 was used as a positive control.

TABLE 2
Primers used for quantitative RT-PCR, bisulfite sequencing and ChIP
Gene Forward Reverse
Quantitative RT-PCR (mouse)
Oct4 endogenous TCTTTCCACCAGGCCCCCGGCTC TGCGGGCGGACATGGGGAGATCC
(SEQ ID NO: 36) (SEQ ID NO: 37)
Sox2 endogenous AAAGGAGAGAAGTTTGGAGCCCGA GGGCGAAGTGCAATTGGGATGAAA
(SEQ ID NO: 38) (SEQ ID NO: 39)
Nanog AGCAGAAGATGCGGACTGTGTTCT CCGCTTGCACTTCATCCTTTGGTT
(SEQ ID NO: 40) (SEQ ID NO: 41)
Thy1 GCCTGACCCGAGAGAAGAAGAAG TGGTGGTGAAGTTCGCTAGAGTAAG
(SEQ ID NO: 42) (SEQ ID NO: 43)
Col6a2 CCACCACTGAAAGGAACAACAA TCCAACACGAAATACACGTTGAC
(SEQ ID NO: 44) (SEQ ID NO: 45)
Fgf7 CCATGAACAAGGAAGGGAAA TCCGCTGTGTGTCCATTTAG
(SEQ ID NO: 46) (SEQ ID NO: 47)
GAPDH TGCACCACCAACTGCTTAG GATGCAGGGATGATGTTC
(SEQ ID NO: 48) (SEQ ID NO: 49)
Quantitative RT-PCR (human)
OCT4 endogenous CCTCACTTCACTGCACTGTA CAGGTTTTCTTTCCCTAGCT
(SEQ ID NO: 50) (SEQ ID NO: 51)
SOX2 endogenous CCCAGCAGACTTCACATGT CCTCCCATTTCCCTCGTTTT
(SEQ ID NO: 52) (SEQ ID NO: 53)
KLF4 endogenous GATGAACTGACCAGGCACTA GTGGGTCATATCCACTGTCT
(SEQ ID NO: 54) (SEQ ID NO: 55)
c-MYC endo. TGCCTCAAATTGGACTTTGG GATTGAAATTCTGTGTAACTGC
(SEQ ID NO: 56) (SEQ ID NO: 57)
NANOG TGAACCTCAGCTACAAACAG TGGTGGTAGGAAGAGTAAAG
(SEQ ID NO: 58) (SEQ ID NO: 59)
LIN28 GAGCATGCAGAAGCGCAGATCAAA TATGGCTGATGCTCTGGCAGAAGT
(SEQ ID NO: 60) (SEQ ID NO: 61)
DPPA2 AGGCTTCATAGGCATGCTTACCCT TGAAGCCTTGCTCTCTTGGTCACT
(SEQ ID NO: 62) (SEQ ID NO: 63)
DPPA4 AGACACAGATGGTTGGGTTCACCT TGCACTCACTCTCCCTTCTTGCTT
(SEQ ID NO: 64) (SEQ ID NO: 65)
GDF3 ACACCTGTGCCAGACTAAGATGCT TGACGGTGGCAGAGGTTCTTACAA
(SEQ ID NO: 66) (SEQ ID NO: 67)
REX1 TGAATAGCTGACCACCAGCACACT ACAGGCTCCAGCCTCAGTACATTT
(SEQ ID NO: 68) (SEQ ID NO: 69)
TERT TGTGCACCAACATCTACAAG GCGTTCTTGGCTTTCAGGAT
(SEQ ID NO: 70) (SEQ ID NO: 71)
TDGF1 TGCCCAAGAAGTGTTCCCTGTGTA AAAGTGGTAGTACGTGCAGACGGT
(SEQ ID NO: 72) (SEQ ID NO: 73)
GAPDH AACAGCGACACCCACTCCTC CATACCAGGAAATGAGCTTGACAA
(SEQ ID NO: 74) (SEQ ID NO: 75)
Bisulfite sequencing
Oct4 AGGTTGAAAATGAAGGTTTTTT TCCAACCCTACTAACCCATCACC
(SEQ ID NO: 76) (SEQ ID NO: 77)
ChIP
Oct4 Region 1 GGAACTGGGTGTGGGGAGGTTGTA AGCAGATTAAGGAAGGGCTAGGACGAGAG
(SEQ ID NO: 78) (SEQ ID NO: 79)
Oct4 Region 2 AGGTCAAGGGGCTAGAGGGTGGGATT TGAGAAGGCGAAGTCTGAAGCCA
(SEQ ID NO: 80) (SEQ ID NO: 81)
Oct4 Region 3 TAGGAGCTCTTGTTTGGGCCATGT ACAAGGGTCTGCTCGTGTAAAGGT
(SEQ ID NO: 82) (SEQ ID NO: 83)
Sox2 Region 1 TTTTGGTTTTTAGGGTAAGGTACTGGGAAG CCACGTGAATAATCCTATATGCATCACAAT
(SEQ ID NO: 84) (SEQ ID NO: 85)
Sox2 Region 2 CACATGAAGGAGCACCCGGATTAT TCCGGGAAGCGTGTACTTATCCTT
(SEQ ID NO: 86) (SEQ ID NO: 87)

DNA Microarray Analysis

RNA was prepared from CGR8.8 cells, MEFs, and a mouse iPSC clone prepared with the fusion gene between the M3 domain of MyoD and Oct4 (M3O-iPSC) on day 60 with the PureLink RNA total RNA purification system (Invitrogen). RNA was amplified and labeled using the Agilent Quick AmpLabeling Kit (Agilent Technologies) following the manufacturer's protocol. cRNA was hybridized overnight to Agilent Whole Murine Genome Oligo Microarray using the Agilent Gene Expression Hybridization Kit. The fluorescence signals of the hybridized microarrays were detected using Agilent's DNA Microarray Scanner. The Agilent Feature Extraction Software was used to read out and process the image files. Data were processed and visualized with Spotfire DecisionSite for Functional Genomics software. DNA microarray data have been deposited in the NCBI GEO database under the accession number GSE22327.

Karyotyping of Human IPSCs

Adherent cells were arrested with colcemid, harvested, treated with 75 mM KCl hypotonic solution, and fixed with methanol and acetic acid at 3:1. The cells were spread onto glass slides and stained with Wright-Giemsa stain. G-banded metaphases were evaluated using an Olympus BX61 microscope outfitted with 10× and 100× objectives. Metaphase cells were imaged and karyotyped using Applied Spectral Imaging (ASI) software.

Aggregation Chimera and Teratoma Formation

Ten M3O-iPSCs of a cloned line were transferred into a microdrop of KSOMaa solution (Millipore) with a zona-free 8-cell stage mouse embryo of the ICR strain (albino) after brief exposure to acidic Tyrode's solution (Millipore). Aggregated morula stage embryos at 2.5 days post coitum (dpc) that contained GFP-positive iPSCs were transferred into the uteri of 2.5 dpc pseudopregnant recipient mice. Embryos at 13.5 dpc were analyzed for chimera formation with X gal stain or for germline transmission with a fluorescence microscope. To prepare teratomas, one million cloned mouse or human M3O-iPSCs were injected into the limb muscle of NOD/SCID mice. Teratomas were fixed with 10% formalin and embedded with paraffin after three weeks for mouse iPSCs and eight weeks for human iPSCs. Five-ÎŒm thick sections were stained with haematoxylin and eosin for histological analysis.

Chromatin Immunoprecipitation (ChIP)

ChIP was performed as described in the instruction of the EZ Magna ChIP G kit (Millipore). All antibodies are listed in Table 1. PCR primer sequences are listed in Table 2. PCR amplification levels were first normalized against the value obtained with control IgG. The normalized values with ESCs or MEFs were then defined as 1.0 depending on antibodies to obtain relative expression levels in other cells.

DNA Methylation Analysis

Genomic DNA from mouse iPSCs was treated with bisulfite with an EZ DNA Methylation-Gold kit (Zymo Research). The DNA sequence at the Oct4 proximal promoter region was amplified with PCR using the primers listed in Table 2 and cloned into the pCR2.1-TOPO vector (Invitrogen) for sequencing.

Results

Generation of Mouse IPSCs with Heterologous Transactivation Domains

Full-length mouse Oct4 was fused with various fragments of mouse MyoD (FIG. 1A). The basic helix-loop-helix (bHLH) domain of MyoD, used for dimerization and DNA binding, was not included in these constructs to avoid activation of MyoD-target genes. Each chimeric gene was co-transduced with a polycistronic retroviral vector encoding mouse Sox2, Klf4, and c-Myc (SKM)5 into MEFs derived from Oct4-GFP mice, which contain the GFP gene knocked into the Oct4 locus7. In this model, formation of GFP-positive colonies indicates that individual MEFs develop into Oct4-expressing cells capable of clonal growth. Expression of chimeric proteins was confirmed through immunoblotting with antibodies against Oct4 (FIG. 8). As a control, MEFs were transduced with OSKM (O-MEFs) on day −1 and 0 and transferred these cells onto SNL feeder cells on day 4 following a standard protocol (FIG. 1B, Protocol A). GFP-positive colonies emerged around day 10, gradually increasing in number until reaching a peak by day 18. To calculate the percentage of MEFs that were reprogrammed into iPSCs, the number of GFP-positive colonies were divided by the total number of MEFs seeded in a culture dish. It was estimated that 0.08±0.09% of O-MEFs were converted into GFP-positive cells, which is similar to previous reports8,10 (FIG. 1A, right column). MEFs were then transduced with each chimeric gene along with SKM and followed the protocol described above (Protocol A). M3O with SKM (M3O-SKM) increased the percentage of GFP-positive colonies most drastically, with 5.10±0.85% of MEFs (M3O-MEFs) being transformed into GFP-positive cells by day 15. The M3 region encompasses the acidic transactivation domain (TAD) of MyoD (amino acids 3-56)11. However, the simple presence of acidity was insufficient to facilitate iPSC formation, as evidenced by a lack of increase in GFP-positive colonies in MEFs transduced with M6O, which also contains the main acidic amino acid cluster, or a chain of 20 glutamic acids attached to Oct4 (EO) (FIG. 1A). The high efficiency with which M3O created iPSCs as compared to Oct4 was not simply due to a difference in the retrovirus titer for the two virus suspensions. The titer for the M3O virus and Oct4 virus was 1.8±0.2×107 and 2.1±0.4×107 colony forming units/ml, respectively.

While conducting the above experiments, it was noticed that GFP-positive colonies emerged from M3O-MEFs on about day 5 without transfer onto feeder cells (FIG. 1B, Protocol B), and these colonies steadily increased in size and number (FIG. 1C). By around day 12, 3.6±0.5% of M3O-MEFs formed GFP-positive colonies in the absence of feeder cells, perhaps supported by the surrounding MEFs serving as “autologous” feeder cells (FIG. 1D). In contrast, GFP-positive colonies emerged from O-MEFs between day 16 and 18 at an extremely low efficiency (0.0035±0.0006%) with the same protocol. It was next tested if GFP-positive colonies could be obtained without Sox2, Klf4, or c-Myc in the presence of M3O with Protocol B (FIG. 1D). Although M3O still required Sox2 and Klf4, c-Myc was dispensable. Previous studies have reported that iPSCs can be established without c-Myc2,3; however, the uniqueness of M3O-SK lies in the speed and efficiency with which GFP-positive colonies form. While it requires three to four weeks and the presence of feeder cells for OSK to induce GFP-positive colonies at an efficiency of around 0.01%2,3, M3O-SK could generate GFP-positive colonies without feeder cells by day 7 after transduction at an efficiency of 0.44%, over 40-fold more efficient than OSK.

These striking differences between M3O and Oct4 prompted the evaluation of the specificity of the M3O configuration in relation to other host factors and TADs taken from other transcription factors using Protocol B. First, the location and number of the M3 domains in the fusion protein with Oct4 were changed (FIG. 1E). Second, the two TADs in Oct412 were replaced with the M3 domain in various combinations (FIG. 1F). Third, the M3 domain was fused to Sox2 or Klf4 and tested in combination with other members of OSKM and M3O (FIG. 1G). OM3 was as effective as M3O in iPSC creation. In a fourth experiment, TADs taken from other powerful transactivators were fused to Oct4 (FIG. 1H), including the TADs from Tax of human T-lymphotropic virus type 1 (HTLV-1)13, Tat of human immunodeficiency virus type 1 (HIV-1)14,15, Gata416,17 and Mef2c17.

Characterization of M3O-IPSCs

The GFP-positive colonies that emerged on day 5 following transduction with M3O-SKM using Protocol B contained 31-143 cells in 12 colonies, with a median of 43 cells/colony. This number of cells would be produced after less than seven cell divisions assuming even division for each cell, which is strikingly small compared to the median of 70 cell divisions needed before GFP-positive cells appear with OSKM Is. The colonies that emerged with M3O-SKM were usually homogenously GFP-positive from the beginning. On day 7 over 97% of these colonies were homogeneously GFP-positive with Protocol B compared to around 5% of colonies derived with OSKM obtained on day 12 with Protocol A (FIG. 2A). Protocol A was used for OSKM. As a result, GFP-positive colonies were harvested at different time points corresponding to two days after the onset of GFP activation.

The quality of GFP-positive colonies obtained with M3O-SKM and OSKM were compared by quantitative RT-PCR (qRT-PCR) analysis of three pluripotency genes (endogenous Oct4, endogenous Sox2, and Nanog) and three fibroblast-enriched genes (Thy1, Col6a2, and Fgf7)19,21. Homogeneously GFP-positive colonies obtained with M3O-SKM using Protocol B and those with OSKM using Protocol A were selected to represent the colonies for each group. Although cells were harvested at different time points corresponding to the onset of GFP activation, the interval between time points is the same. For OSKM, expression of the three pluripotency genes gradually increased during the initial week after emergence of GFP-positive colonies, indicating a slow maturation process toward pluripotency (FIG. 2B). For M3O-SKM, in contrast, levels of these transcripts reached or exceeded those seen in ESCs at the time of the emergence of GFP-positive colonies and remained at similar levels until day 30. This differential efficiency of transcriptional reprogramming was also evident with suppression of the three fibroblast-enriched genes. For M3O-SKM, expression levels of these genes on day 5 when the GFP signal was apparent were comparable to those seen in ESCs, but it took around one week after the activation of GFP for OSKM to accomplish the same level of gene suppression (FIG. 2C). Together, these results indicate that M3O-SKM can reprogram MEFs to an iPSC state more efficiently than OSKM.

The pluripotency of iPSC clones prepared with M3O-SKM following Protocol B (M3O-iPSCs) was verified using three standard approaches. First, genome-wide transcript analysis demonstrated highly similar gene expression in M3O-iPSCs and ESCs. Out of 41,160 probes, 3,293 were greater than 4-fold differentially expressed (up- or down-regulated) in both ESCs and cloned iPSCs compared to MEFs (FIG. 3A). The commonly up-regulated genes included eight ECS-enriched genes, such as Oct4, Sox2 and Nanog. In addition, Thy1, Col6a2 and Fgf7 were down-regulated more than 16-fold in both ESCs and iPSCs. Second, intramuscular injection of M3O-iPSCs into an NOD/SCID mouse resulted in teratoma formation as shown by the presence of various tissues derived from the three germ layers (FIG. 3B). Third, aggregation of 8-cell stage embryos of the ICR strain with M3O-iPSCs containing the Oct4-GFP allele and ROSA26-lacZ allele formed chimeric mice (FIG. 3C. 3D). M3O-iPSCs contributed to germ cells in some chimeric mice (FIG. 3E). When one of the chimeric males (FIG. 3D left) was crossed with a wild-type female ICR mouse (FIG. 3F, white adult at bottom), all 11 pups showed agouti or black coat color (FIG. 3F).

Establishment of Human iPSCs with M3O-SKM

Next it was evaluated if M3O could also facilitate generation of human iPSCs in comparison to OSKM. Human M3O-SKM and OSKM were transduced into human dermal fibroblasts prepared from a 34-year-old female. Because these cells did not harbor a transgene that could be used as a convenient marker for reprogramming, expression of the pluripotency protein NANOG was monitored by immunofluorescence staining as an iPSC indicator. NANOG-positive human ESC-like colonies emerged around day 8 with M3O-SKM, with the number increasing by around day 15 when 0.30±0.033% of the original fibroblasts were converted to iPSC colonies (FIG. 4A, 4B). In contrast, when OSKM was transduced, NANOG-positive colonies did not emerge until around day 12 and eventually only 0.0052±0.0018% of the fibroblasts were turned into iPSC colonies. This indicates 58-fold increased efficiency with M3O-SKM in comparison to OSKM. Furthermore, while less than 10% of the colonies that appeared with OSKM were NANOG positive, more than 90% of the colonies produced with M3O-SKM were NANOG-positive, consistent with the results for mouse iPSCs. Cloned iPSCs prepared with M3O-SKM also expressed endogenous OCT4 and surface markers SSEA4, TRA-1-60 and TRA-1-81 on day 28 (FIG. 4C). Transduced M3O was suppressed by this day (not shown). In addition, iPSCs prepared with M3O-SKM expressed twelve pluripotency genes as demonstrated by quantitative RT-PCR (FIG. 4D). All twenty mitotic spreads prepared from a cloned M3O-SKM iPSCs demonstrated normal karyotypes (FIG. 4E). Finally, they formed teratomas when injected into an NOD/SCID mouse (FIG. 4F), proving pluripotency of the cells.

Chromatin Analyses of Pluripotency Genes in M3O-MEFs

To understand how M3O-SKM facilitated nuclear reprogramming at the molecular level, several chromatin changes at the Oct4 gene were examined during the early phase of iPSC generation. All analyses were performed with Protocol B on all MEFs in a culture dish including GFP-positive and -negative cells without subculture for 9 days. First, changes in DNA methylation at the promoter of the Oct4 gene were studied. CpG dinucleotides at the proximal promoter of the Oct4 gene are heavily methylated in MEFs, unlike in ESCs and iPSCs22 (FIG. 5A), and this serves as a major inhibitory mechanism for Oct4 transcription. While the number of unmethylated CpG sites remained essentially the same on day 9 in O-MEFs, the number increased approximately twofold in M3O-MEFs on the same day (FIG. 5A, 25.5% vs 55.5%). The more advanced demethylation in M3O-MEFs than in O-MEFs is consistent with the higher percentage of GFP-positive cells in M3O-MEFs than in O-MEFs on day 9 (12.77% vs 0.52%) as shown by flow cytometry (FIG. 5B).

Next, the binding of Oct4 and Sox2 to the distal enhancer of the Oct4 gene1 using chromatin immunoprecipitation (ChIP) was studied. The binding of Oct4 and Sox2 to the distal enhancer remained low with O-MEFs (FIG. 5C). However, Oct4, which was identical to M3O in this case, was already highly bound to the Oct4 distal enhancer in M3O-MEFs as early as day 3 when no GFP-positive colonies had yet appeared (FIG. 5C, the red column in the Oct4 panel). The Oct4-binding level gradually increased subsequently, eventually reaching the level comparable to that seen in ESCs on day 9. The chromatin binding of Sox2 displayed a similar tendency. The binding levels of these two proteins in the mixture of ESCs and MEFs at a 13:87 ratio was studied. This study showed substantially lower binding of Oct4 and Sox2 in comparison to the day 9 levels in M3O-MEFs (FIG. 5C, ESCs+MEFs in blue). This observation indicates that Oct4 and Sox2 were bound to the Oct4 enhancer in the majority of M3O-MEFs including GFP-negative cells on day 9. The increased binding of these two proteins to chromatin in M3O-MEFs prompted us to investigate if chromatin accessibility at the distal enhancer was also increased in M3O-MEFs. Increased chromatin accessibility is generally indicated by higher sensitivity to DNAses23. Chromatin from M3O-MEFs and O-MEFs was digested with the restriction enzyme NsiI and analyzed DNA fragments using Southern blotting. Indeed, chromatin accessibility was consistently higher in M3O-MEFs compared to O-MEFs between day 5 and day 9 (FIG. 5D). Additionally, GFP-negative M3O-MEFs were selected with a FACS on day 9 followed by NsiI digestion analysis. This GFP-negative population also demonstrated increased sensitivity to NsiI (FIG. 5D, far right), indicating that the minor GFP-positive population did not significantly influence the overall result of chromatin accessibility.

Previous reports have shown that the Paf1 complex is recruited to the distal enhancer of the Oct4 gene through binding to the Oct4 protein24,25 and then generally moves to the coding region of the gene26. Three Paf1 complex subunits—parafibromin, Leo1 and Paf1—displayed a gradual increase of binding to the distal enhancer and coding region of the Oct4 gene in M3O-MEFs, but not in O-MEFs, between days 3 and 9 following transduction (FIG. 5C). The Paf1 complex recruits the histone methyltransferase complex COMPASS, which catalyzes trimethylation of lysine 4 on histone H3 (H3K4me3)26. This histone modification, a marker for active genes, was also increased specifically in M3O-MEFs in the coding region of the Oc4 gene (FIG. 5E). Two other markers for active genes, acetylation of lysines 9 and 14 on histone H3 (H3K9ac and H3K14ac)27, were also increased in M3O-MEFs (FIG. 5E). In addition, two markers for suppressed genes, trimethylation of H3K9 (H3K9me3) and H3K27 (H3K27me3)27, were more decreased in M3O-MEFs than those in O-MEFs (FIG. 5F). Similar results were observed at the Sox2 locus (FIG. 9). Among these chromatin changes, the levels of H3K9me3 and H3K27me3 in M3O-MEFs most quickly reached the levels observed in ESCs (FIG. 5F), suggesting that the loss of these suppressive histone markers precedes other chromatin modifications. Taken together, these results demonstrate that chromatin at Oct4 and Sox2 loci was generally remodeled in majority of M3O-MEFs, including the GFP-negative population, toward an ESC pattern during the first ten days after transduction, while chromatin in the majority of O-MEFs was not significantly altered.

In addition to global chromatin remodeling, M3O-SKM also elicited wider expression of two pluripotency markers than OSKM: alkaline phosphatase and SSEA1. Alkaline phosphatase was almost ubiquitously expressed by day 9 in M3O-MEFs, unlike the weak and heterogeneous expression observed in O-MEFs (FIG. 6A). SSEA1 was also more widely expressed in M3O-MEFs than in O-MEFs by day 9 as shown by immunofluorescence microscopy and flow cytometory (FIG. 6B, 6C). While alkaline phosphatase and SSEA1 are not exclusively expressed in pluripotent cells, these findings support the interpretation that M3O-SKM remodeled the chromatin in much more wider population of the cells to a certain degree unlike OSKM. Rapid cell proliferation is known to facilitate iPSC generation as shown using p53-null MEFs18; however, neither M3O-SKM nor M3O alone facilitated MEF proliferation during the initial 9 days after transduction (FIG. 6D, 6E).

Chromatin Analyses of Pluripotency Genes without c-Myc M3O-SK induced GFP-positive colonies over 100-fold more efficiently than OSKM with Protocol B (0.44% with M3O-SK in FIG. 1D vs 0.0035% with OSKM in FIG. 1F). This observation suggests that the M3 domain could compensate for the lack of c-Myc when Oct4 activation was used as an indicator. Although several roles of c-Myc have been proposed, its precise function in iPSC formation remains elusive28. To further understand the roles of c-Myc in the activation of pluripotency genes, chromatin analyses at the Oct4 and Sox2 loci were repeated comparing MEFs transduced with three genes (M3O-SK or OSK) and four genes (M3O-SKM of OSKM) on day 9 when the effects of M3O-SKM were readily detectable. One gene (M3O or Oct4) and two genes (M3O+Sox2 or Oct4+Sox2) were transduced for comparison. At this time point, 3.16% of MEFs were GFP-positive with M3O-SK (FIG. 7A), and no GFP-positive cells were observed with other combinations of one, two, or three genes. However, M3O-SK did not significantly decrease the overall level of DNA methylation compared with other gene combinations (FIG. 7B).

As for transcription factor binding to the enhancer, M3O facilitated binding of Oct4, Sox2, and parafibromin in combination with Sox2 or Sox2 and Klf4 (FIG. 7C, red), with some of these binding levels comparable to levels achieved with M3O-SKM. However, Leo1 and Paf1 were not recruited to the enhancer without c-Myc (FIG. 7C). The binding of parafibromin, Leo1, and Paf1 to the initiation site of Oct4 was also weak without c-Myc (FIG. 10A). Consistent with this partial assembly of the Paf1 complex at the Oct4 gene, the level of H3K4me3 remained low without c-Myc (FIG. 7D, 10B). Another active gene marker, H3K9ac, also remained low without c-Myc (FIG. 7D, 10B). Whereas H3K9me3 was effectively decreased by M3O-S and M3O-SK, H3K27me3 was more resistant to demethylation by any of the gene combinations without c-Myc (FIG. 7E). At the Sox2 gene, compared to the Oct4 gene. M3O did not substantially increase the binding of Oct4 or Sox2 to the enhancer alone or in combination with Sox2 or Sox2 and Klf4 (FIG. 11A). The changes in the levels of H3K4me3, H3K9ac, H3K9me3 and H3K27me3 were all weak in the absence of c-Myc (FIG. 11B). Together, these chromatin studies indicate that while M3O could facilitate formation of GFP-positive colonies without c-Myc, the overall level of chromatin remodeling in GFP-negative MEFs was low in the absence of c-Myc.

Discussion

The present study advances the field of iPSC biology by showing that one of the rate-limiting steps in iPSC formation with OSKM is poor chromatin accessibility at pluripotency genes and that a strong transactivating domain can overcome this problem. Because iPSC formation was dramatically improved with M3O-SKM, the factors required to increase chromatin accessibility most likely already exist within MEFs but are not effectively recruited to pluripotency genes when using OSKM. Our current working model is that the MyoD TAD overcomes the barrier of closed chromatin by effectively attracting chromatin modifying proteins and thereby facilitating the binding of Oct4 and other regulatory proteins as well as epigenetic modifications at pluripotency genes (FIG. 7F). Myc family proteins have been proposed to globally relax chromatin in part through activation of the histone acetyltransferase GCN5 and in part through direct binding to thousands of genomic loci28,29. The results also support c-Myc's potential roles in chromatin remodeling.

One of the central questions related to the molecular mechanisms of iPSC formation is how closed chromatin at the loci of Oct4, Sox2, and Nanog are opened by OSKM. Little is known about this mechanism. One potential mechanism is that chromatin disruption occurs during repeated DNA replication as suggested by a report that 92% of B lymphocytes derived from inducible OSKM transgenic mice become iPSCs after 18 weeks of culture18. Additionally, knockdown of p53 in B cells shortened both cell doubling time and the time required to form iPSCs by twofold. However, this does not seem to be the case for M3O-SKM since it did not facilitate cell proliferation. Additionally, emerging GFP-positive colonies contained far less cells than their counterparts obtained from B cells. It has been difficult to perform biochemical analysis of the early process of iPSC formation, such as epigenetic remodeling at pluripotency genes, because of the presence of feeder cells and non-responsive MEFs that comprise more than 90% of transduced cells. However, the MyoD TAD eliminated the requirement for feeder cells and achieved significant levels of epigenetic remodeling even in those MEFs that eventually fell short of activating GFP with Protocol B. Thus, the MyoD TAD is expected to facilitate the dissection of epigenetic processes during the early phase of iPSC formation.

By combining transcription factors with TADs, this approach to nuclear reprogramming is expected to have a range of applications from inducing pluripotency, as shown in this study, to inducing direct conversion from one differentiated cell type to another without transitioning through iPSCs17,33,34. The strategy of TAD-fusion to potentiate transactivators will further advance the study of nuclear reprogramming. The effect of each TAD may be on dependent on cell types, host transcription factors, and target genes. Other TADs have been used to amplify the activity of transcription factors. For instance, the TAD of VP16 was fused to the transcription factor Pdxl to facilitate conversion of hepatocytes to pancreatic cells36,37. However, the MyoD TAD has not been used in nuclear reprogramming. The TAD-fusion approach is applicable to combinations of many other transcription factors and TADs to amplify the activity of the host transcription factor and control cell fate decisions.

Sequence Information of the Plasmid Constructs

Following is a list of plasmid constructs used in the above work as well as two constructs based on the VP16 gene and data therefor.

1) Mouse M3O

The M3 domain of the mouse MyoD cDNA was fused to the amino terminus of the full-length mouse Oct4 cDNA using PCR and inserted into the EcoRI site of the pMXs-IP vector.

PCR for Mouse M3O

The cDNA encoding the M3 domain of mouse MyoD (amino acids 1-62) was amplified with two primer sets, MyoDOct4F4 (GAGAATTCGCCATGGAGCTTCTATCGCCGCCAC; SEQ ID NO:1) and MOΔ63-109R1 (CAGGTGTCCAGCCATGTGCTCCTCCGGTTTCAG; SEQ ID NO:2). Full length Oct4 cDNA was amplified with two primer sets, MOΔ63-109F1 (CTGAAACCGGAGGAGCACATGGCTGGACACCTG; SEQ ID NO:3) and MyoDOct4R5 (CGGAATTCTCTCAGTTGAATGCATGGGAGAG; SEQ ID NO:4). The two PCR products of each first PCR were used as a template for the secondary PCR with the primer set MyoDOct4F4 and MyoDOct4R5. M3O was directly subcloned into EcoRI site of pMXs-IP.

PCR parameters
Denature 94° C. 2 min
Denature 94° C. 15 sec*
Anneal 57° C. 30 sec*
Extend 68° C. 1 min*
Final extension 68° C. 7 min
*Repeat 25 cycles

The DNA sequence of mouse M3O taken from mouse
MyoD
(SEQ ID NO: 5)
atggagcttctatcgccgccactccgggacatagacttgacaggccccg
acggctctctctgctcctttgagacagcagacgacttctatgatgatcc
gtgtttcgactcaccagacctgcgcttttttgaggacctggacccgcgc
ctggtgcacgtgggagccctcctgaaaccggaggagcacatggctggac
acctggcttcagacttcgccttctcacccccaccaggtgggggtgatgg
gtcagcagggctggagccgggctgggtggatcctcgaacctggctaagc
ttccaagggcctccaggtgggcctggaatcggaccaggctcagaggtat
tggggatctccccatgtccgcccgcatacgagttctgcggagggatggc
atactgtggacctcaggttggactgggcctagtcccccaagttggcgtg
gagactttgcagcctgagggccaggcaggagcacgagtggaaagcaact
cagagggaacctcctctgagccctgtgccgaccgccccaatgccgtgaa
gttggagaaggtggaaccaactcccgaggagtcccaggacatgaaagcc
ctgcagaaggagctagaacagtttgccaagctgctgaagcagaagagga
tcaccttggggtacacccaggccgacgtggggctcaccctgggcgttct
ctttggaaaggtgttcagccagaccaccatctgtcgcttcgaggccttg
cagctcagccttaagaacatgtgtaagctgcggcccctgctggagaagt
gggtggaggaagccgacaacaatgagaaccttcaggagatatgcaaatc
ggagaccctggtgcaggcccggaagagaaagcgaactagcattgagaac
cgtgtgaggtggagtctggagaccatgtttctgaagtgcccgaagccct
ccctacagcagatcactcacatcgccaatcagcttgggctagagaagga
tgtggttcgagtatggttctgtaaccggcgccagaagggcaaaagatca
agtattgagtattcccaacgagaagagtatgaggctacagggacacctt
tcccagggggggctgtatcctttcctctgcccccaggtccccactttgg
caccccaggctatggaagcccccacttcaccacactctactcagtccct
tttcctgagggcgaggcctttccctctgttcccgtcactgctctgggct
ctcccatgcattcaaactga
Mouse M3O primer sequences
MyoDOct4F4:
(SEQ ID NO: 6)
GAGAATTCGCCATGGAGCTTCTATCGCCGCCAC
MOΔ63-109R1:
(SEQ ID NO: 7)
CAGGTGTCCAGCCATGTGCTCCTCCGGTTTCAG
MOΔ63-109F1:
(SEQ ID NO: 8)
CTGAAACCGGAGGAGCACATGGCTGGACACCTG
MyoDOct4R5:
(SEQ ID NO: 9)
CGGAATTCTCTCAGTTTGAATGCATGGGAGAG

Accession Numbers

Mouse MyoD: M84918, NM_010866

Mouse Oct4 (POU5F1): NM_013633

2) Mouse OM3

The M3 domain of the mouse MyoD cDNA was fused to the carboxy terminus of the mouse full length Oct4 cDNA.

PCR for Mouse OM3

The M3 domain was prepared with PCR using the primer pair M3F1 and M3R1 and inserted into the EcoRI and the XhoI sites of the pMXs-IP vector to create the pMXs-IP M3 vector. Oct4 was then PCR amplified with the primer pair Oct4F1 and Oct4R1, and inserted into the EcoRI site of pMXs-IP M3 vector.

Mouse OM3 sequence
(SEQ ID NO: 10)
atggctggacacctggcttcagacttcgccttctcacccccaccaggtg
ggggtgatgggtcagcagggctggagccgggctgggtggatcctcgaac
ctggctaagcttccaagggcctccaggtgggcctggaatcggaccaggc
tcagaggtattggggatctccccatgtccgcccgcatacgagttctgcg
gagggatggcatactgtggacctcaggttggactgggcctagtccccca
agttggcgtggagactttgcagcctgagggccaggcaggagcacgagtg
gaaagcaactcagagggaacctcctctgagccctgtgccgaccgcccca
atgccgtgaagttggagaaggtggaaccaactcccgaggagtcccagga
catgaaagccctgcagaaggagctagaacagtttgccaagctgctgaag
cagaagaggatcaccttggggtacacccaggccgacgtggggctcaccc
tgggcgttctctttggaaaggtgttcagccagaccaccatctgtcgctt
cgaggccttgcagctcagccttaagaacatgtgtaagctgcggcccctg
ctggagaagtgggtggaggaagccgacaacaatgagaaccttcaggaga
tatgcaaatcggagaccctggtgcaggcccggaagagaaagcgaactag
cattgagaaccgtgtgaggtggagtctggagaccatgtttctgaagtgc
ccgaagccctccctacagcagatcactcacatcgccaatcagcttgggc
tagagaaggatgtggttcgagtatggttctgtaaccggcgccagaaggg
caaaagatcaagtattgagtattcccaacgagaagagtatgaggctaca
gggacacctttcccagggggggctgtatcctttcctctgcccccaggtc
cccactttggcaccccaggctatggaagcccccacttcaccacactcta
ctcagtcccttttcctgagggcgaggcctttccctctgttcccgtcact
gctctgggctctcccatgcattcaaacgaattcatggagcttctatcgc
cgccactccgggacatagacttgacaggccccgacggctctctctgctc
ctttgagacagcagacgacttctatgatgatccgtgtttcgactcacca
gacctgcgcttttttgaggacctggacccgcgcctggtgcacgtgggag
ccctcctgaaaccggaggagcactga
Mouse OM3 primer sequences
Oct4F1:
(SEQ ID NO: 11)
CGAGAATTCATGGCTGGACACCTG
Oct4R1:
(SEQ ID NO: 12)
CGAGAATTCGTTTGAATGCATGGGAGAG
M3F1:
(SEQ ID NO: 13)
CGAGAATTCATGGAGCTTCTATCGCCGCCAC
M3R1:
(SEQ ID NO: 14)
CGACTCGAGTCAGTGCTCCTCCGGTTTCAG

PCR parameters
Denature 94° C. 2 min
Denature 94° C. 15 sec*
Anneal 57° C. 30 sec*
Extend 68° C. 1 min*
Final extension 68° C. 7 min
*Repeat 25 cycles

Accession Number for Mouse OM3

Mouse MyoD: M84918, NM_010866

Mouse Oct4 (POU5F1): NM_013633

Activity Test of Making iPSCs
OM3 converts 3.2% of MEFs to iPSCs.
3) Mouse M3OM3

Mouse M3 was fused to both the amino and carboxy termini of mouse Oct4.

PCR for Mouse M3OM3

Mouse M3 domain was prepared from the mouse MyoD cDNA with PCR using the primer pair M3OF1 and M3OR1. Mouse full length Oct4 was prepared with PCR using the primer set M3OF2 and Oct4R1. To make M3O, the above two PCR products were used as templates for PCR with the primer pair M3OF1 and Oct4R1. Finally, to make M3OM3, M3O was inserted into the EcoRI site of the pMXs-IP M3 vector prepared in the OM3 construct above.

Mouse M3OM3 sequence
(SEQ ID NO: 15)
atggagcttctatcgccgccactccgggacatagacttgacaggcccc
gacggctctctctgctcctttgagacagcagacgacttctatgatgat
ccgtgtttcgactcaccagacctgcgcttttttgaggacctggacccg
cgcctggtgcacgtgggagccctcctgaaaccggaggagcacatggct
ggacacctggcttcagacttcgccttctcacccccaccaggtgggggt
gatgggtcagcagggctggagccgggctgggtggatcctcgaacctgg
ctaagcttccaagggcctccaggtgggcctggaatcggaccaggctca
gaggtattggggatctccccatgtccgcccgcatacgagttctgcgga
gggatggcatactgtggacctcaggttggactgggcctagtcccccaa
gttggcgtggagactttgcagcctgagggccaggcaggagcacgagtg
gaaagcaactcagagggaacctcctctgagccctgtgccgaccgcccc
aatgccgtgaagttggagaaggtggaaccaactcccgaggagtcccag
gacatgaaagccctgcagaaggagctagaacagtttgccaagctgctg
aagcagaagaggatcaccttggggtacacccaggccgacgtggggctc
accctgggcgttctctttggaaaggtgttcagccagaccaccatctgt
cgcttcgaggccttgcagctcagccttaagaacatgtgtaagctgcgg
cccctgctggagaagtgggtggaggaagccgacaacaatgagaacctt
caggagatatgcaaatcggagaccctggtgcaggcccggaagagaaag
cgaactagcattgagaaccgtgtgaggtggagtctggagaccatgttt
ctgaagtgcccgaagccctccctacagcagatcactcacatcgccaat
cagcttgggctagagaaggatgtggttcgagtatggttctgtaaccgg
cgccagaagggcaaaagatcaagtattgagtattcccaacgagaagag
tatgaggctacagggacacctttcccagggggggctgtatcctttcct
ctgcccccaggtccccactttggcaccccaggctatggaagcccccac
ttcaccacactctactcagtcccttttcctgagggcgaggcctttccc
tctgttcccgtcactgctctgggctctcccatgcattcaaacgaattc
atggagcttctatcgccgccactccgggacatagacttgacaggcccc
gacggctctctctgctcctttgagacagcagacgacttctatgatgat
ccgtgtttcgactcaccagacctgcgcttttttgaggacctggacccg
cgcctggtgcacgtgggagccctcctgaaaccggaggagcactga
Mouse M3OM3 primer sequences
M3OF1:
(SEQ ID NO: 16)
GAGAATTCGCCATGGAGCTTCTATCGCCGCCAC
M3OR1:
(SEQ ID NO: 17)
CAGGTGTCCAGCCATATCAGCGTTGGTGGTC
M3OF2:
(SEQ ID NO: 18)
GACCACCAACGCTGATATGGCTGGACACCTG
Oct4R1:
(SEQ ID NO: 19)
CGAGAATTCGTTTGAATGCATGGGAGAG

PCR parameters: the same as that for OM3
Denature 94° C. 2 min
Denature 94° C. 15 sec*
Anneal 57° C. 30 sec*
Extend 68° C. 1 min*
Final extension 68° C. 7 min
*Repeat 25 cycles

Accession Number for Mouse M3OM3

Mouse MyoD: M84918. NM_010866

Mouse Oct4 (POU5F1): NM_013633

4) Human M3O DNA

The M3 domain of the human MyoD cDNA was fused to the amino terminus of the full-length human Oct4 cDNA using PCR and inserted into the EcoRI site of the pMXs-IP vector.

PCR for Human M3O

The M3 domain of human MyoD was PCR amplified with the primer pair of hM3OF1 (see below for sequence) and hM3OR1. Human full length Oct4 was PCR amplified with the primer pair of hM3OF2 and hM3OR2. These two PCR products were used as templates for the third PCR with the primers hM3OF1 and hM3OR2.

PCR parameters
Denature 94° C. 2 min
Denature 94° C. 15 sec*
Anneal 57° C. 30 sec*
Extend 68° C. 1 min*
Final extension 68° C. 7 min
*Repeat 25 cycles

The DNA sequence of human M3O taken from human
MyoD
(SEQ ID NO: 20)
atggagctactgtcgccaccgctccgcgacgtagacctgacggcccccg
acggctctctctgctcctttgccacaacggacgacttctatgacgaccc
gtgtttcgactccccggacctgcgcttcttcgaagacctggacccgcgc
ctgatgcacgtgggcgcgctcctgaaacccgaagagcacatggcgggac
acctggcttcggatttcgccttctcgccccctccaggtggtggaggtga
tgggccaggggggccggagccgggctgggttgatcctcggacctggcta
agcttccaaggccctcctggagggccaggaatcgggccgggggttgggc
caggctctgaggtgtgggggattcccccatgccccccgccgtatgagtt
ctgtggggggatggcgtactgtgggccccaggttggagtggggctagtg
ccccaaggcggcttggagacctctcagcctgagggcgaagcaggagtcg
gggtggagagcaactccgatggggcctccccggagccctgcaccgtcac
ccctggtgccgtgaagctggagaaggagaagctggagcaaaacccggag
gagtcccaggacatcaaagctctgcagaaagaactcgagcaatttgcca
agctcctgaagcagaagaggatcaccctgggatatacacaggccgatgt
ggggctcaccctgggggttctatttgggaaggtattcagccaaacgacc
atctgccgctttgaggctctgcagcttagcttcaagaacatgtgtaagc
tgcggcccttgctgcagaagtgggtggaggaagctgacaacaatgaaaa
tcttcaggagatatgcaaagcagaaaccctcgtgcaggcccgaaagaga
aagcgaaccagtatcgagaaccgagtgagaggcaacctggagaatttgt
tcctgcagtgcccgaaacccacactgcagcagatcagccacatcgccca
gcagcttgggctcgagaaggatgtggtccgagtgtggttctgtaaccgg
cgccagaagggcaagcgatcaagcagcgactatgcacaacgagaggatt
ttgaggctgctgggtctcctttctcagggggaccagtgtcctttcctct
ggccccagggccccattttggtaccccaggctatgggagccctcacttc
actgcactgtactcctcggtccctttccctgagggggaagcctttcccc
ctgtctccgtcaccactctgggctctcccatgcattcaaactga
Human M3O primer sequences
hM3OF1:
(SEQ ID NO: 21)
CGAGAATTCGCCATGGAGCTACTGTCGCCAC
hM3OR1:
(SEQ ID NO: 22)
CAGGTGTCCCGCCATGTGCTCTTCGGGTTTCAG
hM3OF2:
(SEQ ID NO: 23)
CTGAAACCCGAAGAGCACATGGCGGGACACCTG
hM3OR2:
(SEQ ID NO: 24)
CGTGAATTCCTCGAGTCTCAGTTTGAATGCATGGGAGAG

Accession Numbers

Human MyoD: NM_002478

Human Oct4 (POU5F1): NM_002701

5) VP16LO

The full length of the TAD (amino acids 411-490) of VP16 was fused to the amino terminus of the mouse full-length Oct4 cDNA. VP16 is a protein expressed by the herpes simplex virus type I and its transactivation domain is highly powerful.

PCR for VP16LO

The cDNA encoding the transactivation domain of VP16 (amino acids 411-490) was amplified by PCR and inserted into the BamHI and XhoI sites of the pMXs-IP vector to create the pMXs VP16-IP vector. Then the full-length mouse Oct4 cDNA was inserted into the EcoRI and XhoI sites of the pMXs VP16-IP vector.

PCR primers for VP16
VP16F1:
(SEQ ID NO: 25)
CGAGGATCCGCCATGTCGACGGCCCCCCCGACCGATGTC
VP16R1:
(SEQ ID NO: 26)
CGACTCGAGGAATTCCCCACCGTACTCGTC

PCR parameters
Denature 94° C. 2 min
Denature 94° C. 15 sec*
Anneal 57° C. 30 sec*
Extend 68° C. 1 min*
Final extension 68° C. 7 min
*Repeat 25 cycles

VP16LO DNA sequence
(SEQ ID NO: 27)
atgtcgacgcccccccgaccgatgtcagcctgggggacgagctccactt
agacggcgaggacgtggcgatggcgcatgccgacgcgctagacgatttc
gatctggacatgttgggggacggggattccccgggtccgggatttaccc
cccacgactccgccccctacggcgctctggatatggccgacttcgagtt
tgagcagatgtttaccgatgcccttggaattgacgagtacggtggggaa
ttcatggctggacacctggcttcagacttcgccttctcacccccaccag
gtgggggtgatgggtcagcagggctggagccgggctgggtggatcctcg
aacctggctaagcttccaagggcctccaggtgggcctggaatcggacca
ggctcagaggtattggggatctccccatgtccgcccgcatacgagttct
gcggagggatggcatactgtggacctcaggttggactgggcctagtccc
ccaagttggcgtggagactttgcagcctgagggccaggcaggagcacga
gtggaaagcaactcagagggaacctcctctgagccctgtgccgaccgcc
ccaatgccgtgaagttggagaaggtggaaccaactcccgaggagtccca
ggacatgaaagccctgcagaaggagctagaacagtttgccaagctgctg
aagcagaagaggatcaccttggggtacacccaggccgacgtggggctca
ccctgggcgttctctttggaaaggtgttcagccagaccaccatctgtcg
cttcgaggccttgcagctcagccttaagaacatgtgtaagctgcggccc
ctgctggagaagtgggtggaggaagccgacaacaatgagaaccttcagg
agatatgcaaatcggagaccctggtgcaggcccggaagagaaagcgaac
tagcattgagaaccgtgtgaggtggagtctggagaccatgtttctgaag
tgcccgaagccctccctacagcagatcactcacatcgccaatcagcttg
ggctagagaaggatgtggttcgagtatggttctgtaaccggcgccagaa
gggcaaaagatcaagtattgagtattcccaacgagaagagtatgaggct
acagggacacctttcccagggggggctgtatcctttcctctgcccccag
gtccccactttggcaccccaggctatggaagcccccacttcaccacact
ctactcagtcccttttcctgagggcgaggcctttccctctgttcccgtc
actgctctgggctctcccatgcattcaaactga

Accession Number for VP16

Human herpesvirus 1 complete genome: X14112.1
Tegument protein VP16 from human herpes simplex virus type 1: NP_044650
Activity Test of Making iPSCs
VP16LO-SKM converts around 0.5% of mouse embryonic fibroblasts to iPSCs, which is lower than M3O-SKM (5.3%) but still higher than OSKM (0.08%). In addition, VP16LO-SKM does not require feeder cells, unlike OSKM, to make iPSCs.

6) VP16SO

A part of the TAD (amino acids 446-490) of VP16 was fused to the amino terminus of the mouse full-length Oct4 cDNA.

PCR for VP16SO

The cDNA encoding a part of the transactivation domain of VP16 (amino acids 446-490) was amplified with two primer sets, V16F4 (CGAGAATTCGCCATGTTGGGGGACGGGGATC; SEQ ID NO: 28) and V16OR (CAGGTGTCCAGCCATCCCACCGTACTCGTC; SEQ ID NO:29). Full length Oct4 cDNA was amplified with two primer sets. VP16OF (GACGAGTACGGTGGGATGGCTGGACACCTG; SEQ ID NO:30) and Oct4R1 (GCGCTCGAGTCTCAGTTTGAATGCATGGGAGAG; SEQ ID NO:31). The two PCR products of each first PCR were used as a template for the secondary PCR with the primer set V16F4 and Oct4R1. VP16OS was directly subcloned into EcoRI and XhoI site of pMXs-IP.

PCR primers for VP16SO
V16F4:
(SEQ ID NO: 32)
CGAGAATTCGCCATGTTGGGGGACGGGGATTC
V16OR:
(SEQ ID NO: 33)
CAGGTGTCCAGCCATCCCACCGTACTCGTC
VP16OF:
(SEQ ID NO: 34)
GACGAGTACGGTGGGATGGCTGGACACCTG
OctR1:
(SEQ ID NO: 35)
GCGCTCGAGTCTCAGTTTGAATGCATGGGAGAG

PCR parameters
Denature 94° C. 2 min
Denature 94° C. 15 sec*
Anneal 57° C. 30 sec*
Extend 68° C. 1 min*
Final extension 68° C. 7 min
*Repeat 25 cycles

VP16SO DNA sequence
(SEQ ID NO: 36)
atgttgggggacggggattccccgggtccgggatttaccccccacgac
tccgccccctacggcgctctggatatggccgacttcgagtttgagcag
atgtttaccgatgcccttggaattgacgagtacggtgggatggctgga
cacctggcttcagacttcgccttctcacccccaccaggtgggggtgat
gggtcagcagggctggagccgggctgggtggatcctcgaacctggcta
agcttccaagggcctccaggtgggcctggaatcggaccaggctcagag
gtattggggatctccccatgtccgcccgcatacgagttctgcggaggg
atggcatactgtggacctcaggttggactgggcctagtcccccaagtt
ggcgtggagactttgcagcctgagggccaggcaggagcacgagtggaa
agcaactcagagggaacctcctctgagccctgtgccgaccgccccaat
gccgtgaagttggagaaggtggaaccaactcccgaggagtcccaggac
atgaaagccctgcagaaggagctagaacagtttgccaagctgctgaag
cagaagaggatcaccttggggtacacccaggccgacgtggggctcacc
ctgggcgttctctttggaaaggtgttcagccagaccaccatctgtcgc
ttcgaggccttgcagctcagccttaagaacatgtgtaagctgcggccc
ctgctggagaagtgggtggaggaagccgacaacaatgagaaccttcag
gagatatgcaaatcggagaccctggtgcaggcccggaagagaaagcga
actagcattgagaaccgtgtgaggtggagtctggagaccatgtttctg
aagtgcccgaagccctccctacagcagatcactcacatcgccaatcag
cttgggctagagaaggatgtggttcgagtatggttctgtaaccggcgc
cagaagggcaaaagatcaagtattgagtattcccaacgagaagagtat
gaggctacagggacacctttcccagggggggctgtatcctttcctctg
cccccaggtccccactttggcaccccaggctatggaagcccccacttc
accacactctactcagtcccttttcctgagggcgaggcctttccctct
gttcccgtcactgctctgggctctcccatgcattcaaactga

Accession Number for VP16

Human herpesvirus 1 complete genome: X14112.1
Tegument protein VP16 from human herpes simplex virus type 1: NP_044650
The combination of VP16SO and SKM induced mouse iPSCs at a frequency of around 1%.

Example 2

MEFs transduced with M3O-SKM were seeded onto feeder cells at the density of 2000 cells/well of a 12-well plate. This cell density is around 15-fold lower than the density used in protocol described above. In addition, 10% fetal bovine serum was replaced with 15% KnockOut Serum Replacement (KSR, Invitrogen) in the culture medium. Combination of the decreased cell density and KSR increased the efficiency of making iPSCs to around 27% by day 12. In contrast, the efficiency with OSKM was around 1% under the same condition.

The herpes simplex virus type 1 protein VP16 is a powerful transactivator. To test if the VP16 TAD could also raise the efficiency of making iPSCs, two fusion genes were prepared between mouse Oct4 and the VP16 TAD. The first fusion gene called VP16LO is composed of the full-length VP16 TAD (amino acids 411-490) fused to the amino terminus of Oct4. The second fusion gene called VP16SO comprises the second half of the VP16 TAD (amino acids 446-490) fused to the amino terminus of Oct4. The efficiency of making mouse iPSCs was around 5% with VP16LO-SKM and around 14% with VP16SO-SKM on day 12 under the above-mentioned culture conditions (with decreased cell density and KSR). The efficiency with these two combinations was higher than the efficiency with OSKM.

BIBLIOGRAPHY

  • 1. Chew, J. L. et al. Mol Cell Biol 25, 6031-46 (2005).
  • 2. Nakagawa, M. et al. Nat Biotechnol 26, 101-6 (2008).
  • 3. Wernig, M., Meissner. A., Cassady, J. P. & Jaenisch, R. Cell Stem Cell 2, 10-2 (2008).
  • 4. Kitamura, T. et al. Exp Hematol 31, 1007-14 (2003).
  • 5. Carey, B. W. et al. Proc NatlAcad Sci USA 106, 157-62 (2009).
  • 6. Morita, S., Kojima, T. & Kitamura. T. Gene Ther 7, 1063-6 (2000).
  • 7. Lengner, C. J. et al. Cell Stem Cell 1, 403-15 (2007).
  • 8. Takahashi, K. & Yamanaka, Cell 126, 663-76 (2006).
  • 9. Gerber, A. N et al. Genes Dev 11, 436-50 (1997).
  • 10. Huangfu, D. et al. Nat Biotechnol 26, 795-7 (2008).
  • 11. Weintraub, H. et al. Genes Dev 5, 1377-86 (1991).
  • 12. Niwa, H. et al. Cell 123, 917-29 (2005).
  • 13. Boxus, M. et al. Retrovirology 5, 76 (2008).
  • 14. Romani, B., Engelbrecht, S. & Glashoff, R. H. J Gen Virol 91, 1-12 (2010).
  • 15. Pumfery, A. et al. Curr HIV Res 1, 343-62 (2003).
  • 16. Cirillo. L. A. et al. Mol Cell 9, 279-89 (2002).
  • 17. leda, M. et al. Cell 142, 375-386 (2010).
  • 18. Hanna, J. et al. Nature 462, 595-601 (2009).
  • 19. Stadtfeld, M. et al. Cell Stem Cell 2, 230-40 (2008).
  • 20. Gonzalez, F. et al. Proc Natl Acad Sci USA 106, 8918-22 (2009).
  • 21. Maherali, N. et al. Cell Stem Cell 1, 55-70 (2007).
  • 22. Okita, K., Ichisaka, T. & Yamanaka, S. Nature 448, 313-7 (2007).
  • 23. Carey, M. F., Peterson, C. L. & Smale, S. T. In vivo analysis of an endogenous control region, in Transcriptional regulation in eukaryotes (eds. Carey, M. F., Peterson, C. L. & Smale, S. T.) 261-322 (Cold Spring Harbor Laboratory Press, 2009).
  • 24. Ding, L. et al. Cell Stem Cell 4, 403-15 (2009).
  • 25. Ponnusamy, M. P. et al. Stem Cells 27, 3001-11 (2009).
  • 26. Gerber, M. & Shilatifard, J Biol Chem 278, 26303-6 (2003).
  • 27. Kouzarides, T. Cell 128, 693-705 (2007).
  • 28. Knoepfler, P. S. Cell Stem Cell 2, 18-21 (2008).
  • 29. Knoepfler, P. S. et al. EMBO J 25, 2723-34 (2006).
  • 33. Zhou. Q. et al. Nature 455, 627-32 (2008).
  • 34. Vierbuchen, T. et al. Nature 463, 1035-41 (2010).
  • 35. Yamanaka, S. & Blau, H. M. Nature 465, 704-12 (2010).
  • 36. Horb, M. E., Shen, C. N., Tosh, D. & Slack, J. M. Curr Biol 13, 105-15 (2003).
  • 37. Kaneto, H. et al. Diabetes 54, 1009-22 (2005).

All publications, patents and patent applications are incorporated herein by reference. While in the foregoing specification this invention has been described in relation to certain preferred embodiments thereof, and many details have been set forth for purposes of illustration, it will be apparent to those skilled in the art that the invention is susceptible to additional embodiments and that certain of the details described herein may be varied considerably without departing from the basic principles of the invention.

Claims

1. A composition comprising a nucleic acid encoding a fusion protein comprising a transactivation domain from MyoD or VP16 fused to the N-terminus or C-terminus of Oct4 operably linked to a promoter.

2. The composition of claim 1, further comprising at least one nucleic acid encoding Sox2, Klf4, and optionally c-Myc.

3. The composition of claim 1, wherein the transactivation domain is obtained from MyoD.

4. The composition of claim 3, wherein the transactivation domain of MyoD comprises an N-terminus region of MyoD.

5. The composition of claim 4, wherein the transactivation domain comprising amino acids 1-62 of MyoD or is at least 95% identical thereto.

6.-19. (canceled)

20. The composition of claim 1, wherein said composition is contained within a cell.

21. The composition of claim 20, wherein said cell is a mammalian cell.

22. The composition of claim 21, wherein said mammalian cell is human.

23. The composition of claim 2, wherein said composition is contained within a cell.

24. The composition of claim 23, wherein said cell is a mammalian cell.

25. The composition of claim 24, wherein said mammalian cell is human.

26. The composition of claim 2, wherein the nucleic acid is polycistronic.

27. The composition of claim 2, wherein the proteins encoded by said at least one nucleic acid are human.

28. The composition of claim 2, further comprising a cytokine.

29. The composition of claim 28, wherein the cytokine is basic fibroblast growth factor and/or stem cell factor.

Resources

Images & Drawings included:

Sources:

Similar patent applications:

Recent applications in this class: