Patent application title:

MODULATORS OF DNM2 EXPRESSION

Publication number:

US20200392510A1

Publication date:
Application number:

16/962,136

Filed date:

2019-01-15

Abstract:

The present embodiments provide methods, compounds, and compositions useful for inhibiting DNM2 expression, which may be useful for treating, preventing, or ameliorating a disease associated with DNM2.

Inventors:

Interested in similar patents?

Get notified when new applications in this technology area are published.

Classification:

C12N15/1137 »  CPC main

Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor; Recombinant DNA-technology; DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides against enzymes

C12N2310/341 »  CPC further

Structure or type of the nucleic acid; Chemical structure; Spatial arrangement of the modifications Gapmers, i.e. of the type ===---===

C12N2310/3341 »  CPC further

Structure or type of the nucleic acid; Chemical structure of the base; Modified C 5-Methylcytosine

C12N2310/315 »  CPC further

Structure or type of the nucleic acid; Chemical structure of the backbone Phosphorothioates

C12N2320/35 »  CPC further

Applications; Uses; Special therapeutic applications based on a specific dosage / administration regimen

C12N2310/351 »  CPC further

Structure or type of the nucleic acid; Chemical structure; Nature of the modification Conjugate

C12N2310/346 »  CPC further

Structure or type of the nucleic acid; Chemical structure; Spatial arrangement of the modifications having a combination of backbone and sugar modifications

C12N2310/11 »  CPC further

Structure or type of the nucleic acid; Type of nucleic acid Antisense

C12N2310/14 »  CPC further

Structure or type of the nucleic acid; Type of nucleic acid interfering N.A.

C12N2310/3231 »  CPC further

Structure or type of the nucleic acid; Chemical structure of the sugar modified ring structure having an additional ring, e.g. LNA, ENA

C12N15/113 IPC

Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor; Recombinant DNA-technology; DNA or RNA fragments; Modified forms thereof Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides

Description

SEQUENCE LISTING

The present application is being filed along with a Sequence Listing in electronic format. The Sequence Listing is provided as a file entitled BIOL0322WOSEQ_ST25.txt created Jan. 10, 2019 which is 784 kb in size. The information in the electronic format of the sequence listing is incorporated herein by reference in its entirety.

FIELD

The present embodiments provide methods, compounds, and compositions useful for inhibiting DNM2 expression, which can be useful for treating, preventing, or ameliorating a disease associated with DNM2.

BACKGROUND

Dynamin 2 (DNM2) is a large GTPase that is involved in membrane trafficking and microtubule dynamics (See, e.g., Durieux et al. J Mol Med, 88, 339 (2010)). Mutations in DNM2 are associated with several diseases, including centronuclear myopathy (CNM) and Charcot-Marie-Tooth disease. DNM2 is also associated with Duchenne's Muscular Dystrophy (See, e.g., WO 2015/055859 and WO 2016/170162). CNM and CNM-like myopathy are also associated with mutations in MTM1, BIN1, RYR1, TTN, CCDC78, and MTMR14

SUMMARY

Certain embodiments provided herein are directed to potent and tolerable compounds and compositions useful for inhibiting DNM2 expression, which can be useful for treating, preventing, ameliorating, or slowing progression of diseases, such as centronuclear myopathy (CNM), Charcot-Marie-Tooth disease (CMT), and Duchenne's Muscular Dystrophy (DMD). Certain embodiments provided herein comprise modified oligonucleotides complementary to a DNM2 nucleic acid that potently reduce DNM2 expression in animals.

One object of the present invention is a compound comprising a modified oligonucleotide 8 to 50 linked nucleosides in length having a nucleobase sequence comprising at least 8 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 7-3134. Another object of the present invention is a compound comprising a modified oligonucleotide 9 to 50 linked nucleosides in length having a nucleobase sequence comprising at least 9 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 7-3134. Another object of the present invention is a compound comprising a modified oligonucleotide 10 to 50 linked nucleosides in length having a nucleobase sequence comprising at least 10 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 7-3134. Another object of the present invention is a compound comprising a modified oligonucleotide 11 to 50 linked nucleosides in length having a nucleobase sequence comprising at least 11 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 7-3134. Another object of the present invention is a compound comprising a modified oligonucleotide 12 to 50 linked nucleosides in length having a nucleobase sequence comprising at least 12, at least 13, at least 14, or at least 15 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 7-3134. Another object of the present invention is a compound comprising a modified oligonucleotide 16 to 50 linked nucleosides in length having a nucleobase sequence comprising the nucleobase sequence of any of SEQ ID NOs: 7-3134. Another object of the present invention is a compound comprising a modified oligonucleotide having a nucleobase sequence consisting of any one of SEQ ID NOs: 7-3134. Another object of the present invention is a compound comprising a modified oligonucleotide 8 to 50 linked nucleosides in length complementary within nucleobases 3,404-44,737; 83,573-87,287; 87,359-90,915; 90,968-97,263; 97,378-104,979; 81,061-81,199; or 116,048-116,903 of SEQ ID NO: 1, wherein said modified oligonucleotide is at least 85%, 90%, 95%, or 100% complementary to SEQ ID NO: 1. Another object of the present invention is a compound comprising a modified oligonucleotide 8 to 50 linked nucleosides in length having a nucleobase sequence comprising a portion of at least 8 contiguous nucleobases 100% complementary to an equal length portion of nucleobases 3,404-44,737; 83,573-87,287; 87,359-90,915; 90,968-97,263; 97,378-104,979; 81,061-81,199; or 116,048-116,903 of SEQ ID NO: 1, wherein the nucleobase sequence of the modified oligonucleotide is at least 85%, 90%, 95%, or 100% complementary to SEQ ID NO: 1. Another object of the present invention is a compound comprising a modified oligonucleotide 8 to 50 linked nucleosides in length complementary within nucleobases 83,573-87,287 or 87,359-90,915 of SEQ ID NO: 1, wherein said modified oligonucleotide is at least 85%, 90%, 95%, or 100% complementary to SEQ ID NO: 1. Another object of the present invention is a compound comprising a modified oligonucleotide complementary to intron 1 of a human DNM2 pre-mRNA. Another object of the present invention is a compound comprising a modified oligonucleotide complementary to intron 11 of a human DNM2 pre-mRNA. Another object of the present invention is a compound comprising a modified oligonucleotide complementary to intron 12 of a human DNM2 pre-mRNA. Another object of the present invention is a compound comprising a modified oligonucleotide complementary to intron 13 of a human DNM2 pre-mRNA. Another object of the present invention is a compound comprising a modified oligonucleotide complementary to intron 14 of a human DNM2 pre-mRNA. Another object of the present invention is a compound comprising a modified oligonucleotide complementary to exon 10 of a human DNM2 pre-mRNA or human DNM2 mRNA. Another object of the present invention is a compound comprising a modified oligonucleotide complementary to the 3′-UTR of a human DNM2 pre-mRNA or human DNM2 mRNA. Another object of the present invention is a compound comprising a modified oligonucleotide 16 to 50 linked nucleosides in length having a nucleobase sequence comprising any of SEQ ID NOs: 2879, 3056, 2123, 2189, 2453, 2160, or 2232. Another object of the present invention is a compound comprising a modified oligonucleotide having a nucleobase sequence consisting of any one of SEQ ID NOs: 2879, 3056, 2123, 2189, 2453, 2160, or 2232. Another object of the present invention is a compound comprising a modified oligonucleotide having a nucleobase sequence comprising SEQ ID NO: 2879.

Another object of the present invention is a compound comprising a modified oligonucleotide 16 to 50 linked nucleosides in length having a nucleobase sequence comprising any of SEQ ID NOs: 2879, 3056, 2123, 2189, 2453, 2160, or 2232, wherein the modified oligonucleotide comprises:

    • a gap segment consisting of 8-12 linked 2′-deoxynucleosides;
    • a 5′ wing segment consisting of 1-7 linked nucleosides; and
    • a 3′ wing segment consisting of 1-7 linked nucleosides;

wherein the gap segment is positioned between the 5′ wing segment and the 3′ wing segment and wherein each terminal wing nucleoside comprises a modified sugar.

Another object of the present invention is a compound comprising a modified oligonucleotide 16 linked nucleosides in length having a nucleobase sequence consisting of the sequence recited in SEQ ID NO: 2879, 3056, 2123, 2189, 2453, 2160, or 2232, wherein the modified oligonucleotide comprises

    • a gap segment consisting of 10 linked 2′-deoxynucleosides;
    • a 5′ wing segment consisting of 3 linked nucleosides; and
    • a 3′ wing segment consisting of 3 linked nucleosides;

wherein the gap segment is positioned between the 5′ wing segment and the 3′ wing segment; wherein each nucleoside of each wing segment comprises a cEt sugar moiety; wherein each internucleoside linkage is a phosphorothioate linkage; and wherein each cytosine is a 5-methylcytosine.

In one embodiment, the oligonucleotide is at least 80%, 85%, 90%, 95% or 100% complementary to any of SEQ ID NO: 1, 2, 3, or 3135. In one embodiment, the modified oligonucleotide comprises at least one modified internucleoside linkage. In one embodiment, the at least one modified internucleoside linkage is a phosphorothioate internucleoside linkage. In one embodiment, the modified oligonucleotide comprises at least one bicyclic sugar. In one embodiment, the at least one bicyclic sugar is selected from the group consisting of LNA, ENA, and cEt. In one embodiment, the at least one bicyclic sugar moiety is a cEt sugar moiety.

In one embodiment, the modified oligonucleotide comprises at least one 5-methylcytosine. In one embodiment, the modified oligonucleotide comprises:

a gap segment consisting of linked 2′-deoxynucleosides;

a 5′ wing segment consisting of linked nucleosides; and

a 3′ wing segment consisting of linked nucleosides;

wherein the gap segment is positioned immediately adjacent to and between the 5′ wing segment and the 3′ wing segment and wherein each nucleoside of each wing segment comprises a modified sugar moiety.

In one embodiment, the compound is single-stranded. In one embodiment, the compound is double-stranded.

In one embodiment, the compound comprises at least one unmodified ribosyl sugar moiety. In one embodiment, the compound comprises at least one unmodified 2′-deoxyribosyl sugar moiety.

In one embodiment, the modified oligonucleotide consists of 10 to 30 linked nucleosides. In one embodiment, the modified oligonucleotide consists of 12 to 30 linked nucleosides. In one embodiment, the modified oligonucleotide consists of 15 to 30 linked nucleosides. In one embodiment, the modified oligonucleotide consists of 16 to 20 linked nucleosides.

Another object of the present invention is a compound comprising a modified oligonucleotide according to the following formula: Gks Tks Tks Tds Ads Tds Tds Ads Tds Ads Gds Gds Gds mCks Tks Tk; wherein,

    • A=an adenine,
    • mC=a 5-methylcytosine
    • G=a guanine,
    • T=a thymine,
    • k=a cEt sugar moiety,
    • d=a 2′-deoxyribosyl sugar moiety, and
    • s=a phosphorothioate internucleoside linkage.

In one embodiment, the compound of the invention comprises a conjugate group. In one embodiment, the compound of the invention consists of the modified oligonucleotide and the conjugate group.

Another object of the present invention is a compound according to the following formula:

In one embodiment, the compound consists of the modified oligonucleotide.

The present invention further relates to a compound consisting of a pharmaceutically acceptable salt form of any one of the compounds described herein. In one embodiment, the pharmaceutically acceptable salt is a sodium salt. In one embodiment, the pharmaceutically acceptable salt is a potassium salt.

The present invention also relates to a pharmaceutical composition comprising a compound as described herein and at least one pharmaceutically acceptable carrier or diluent.

The present invention further relates to a chirally enriched population of the compounds described herein, wherein the population is enriched for modified oligonucleotides comprising at least one particular phosphorothioate internucleoside linkage having a particular stereochemical configuration. In one embodiment, the population is enriched for modified oligonucleotides comprising at least one particular phosphorothioate internucleoside linkage having the (Sp) configuration. In one embodiment, the population is enriched for modified oligonucleotides comprising at least one particular phosphorothioate internucleoside linkage having the (Rp) configuration. In one embodiment, the population is enriched for modified oligonucleotides having a particular, independently selected stereochemical configuration at each phosphorothioate internucleoside linkage. In one embodiment, the population is enriched for modified oligonucleotides having the (Sp) configuration at each phosphorothioate internucleoside linkage. In one embodiment, the population is enriched for modified oligonucleotides having the (Rp) configuration at each phosphorothioate internucleoside linkage. In one embodiment, the population is enriched for modified oligonucleotides having the (Rp) configuration at one particular phosphorothioate internucleoside linkage and the (Sp) configuration at each of the remaining phosphorothioate internucleoside linkages. In one embodiment, the population is enriched for modified oligonucleotides having at least 3 contiguous phosphorothioate internucleoside linkages in the Sp, Sp, and Rp configurations, in the 5′ to 3′ direction. In one embodiment, all of the phosphorothioate internucleoside linkages of the modified oligonucleotide are stereorandom.

The present invention further relates to a pharmaceutical composition comprising the population of compounds described herein and at least one pharmaceutically acceptable diluent or carrier.

The present invention further relates to a compound described herein, a pharmaceutical composition comprising said compound and at least one pharmaceutically acceptable carrier or diluent, or a pharmaceutical composition comprising the population of compounds described herein and at least one pharmaceutically acceptable carrier or diluent, for use in therapy.

The present invention further relates to a compound described herein, a pharmaceutical composition comprising said compound and at least one pharmaceutically acceptable carrier or diluent, or a pharmaceutical composition comprising the population of compounds described herein and at least one pharmaceutically acceptable carrier or diluent, for use in treating, preventing, or ameliorating centronuclear myopathy, Duchenne Muscular Dystrophy, or Charcot-Marie Tooth disease.

The present invention also relates to a method of treating, preventing, or ameliorating a disease associated with DNM2 in an individual comprising administering to the individual a compound or composition described herein, thereby treating, preventing, or ameliorating the disease.

The present invention also relates to a method of treating, preventing, or ameliorating a disease associated with DNM2 in an individual comprising administering to the individual a compound comprising a modified oligonucleotide 100% complementary to an exon 10, an intron, or the 3′-UTR of a DNM2 nucleic acid transcript, thereby treating, preventing, or ameliorating the disease.

In one embodiment, the disease is centronuclear myopathy, Duchenne Muscular Dystrophy, or Charcot-Marie Tooth disease. In one embodiment, the compound is single-stranded. In one embodiment, the DNM2 nucleic acid transcript is a pre-mRNA. In one embodiment, the disease is X-linked myotubular myopathy, autosomal recessive centronuclear myopathy, or autosomal dominant centronuclear myopathy. In one embodiment, the individual has at least one mutation in at least one gene selected from among MTM1, BIN1, and DNM2. In one embodiment, the administering increases body weight or muscle strength.

The present invention further relates to a method of inhibiting expression of DNM2 in a cell comprising contacting the cell with a single-stranded compound comprising a modified oligonucleotide 100% complementary to exon 10, an intron, or the 3′-UTR of a DNM2 nucleic acid transcript, thereby inhibiting expression of DNM2 in the cell. In one embodiment, the method is an in vitro method. In one embodiment, the cell is in the muscle of an individual. In one embodiment, the individual has, or is at risk of having, a centronuclear myopathy, Duchenne Muscular Dystrophy, or Charcot-Marie Tooth disease.

The present invention further relates to a method of increasing body weight or muscle strength in an individual having, or at risk of having, a disease associated with DNM2 comprising administering a single-stranded compound comprising a modified oligonucleotide 100% complementary to a DNM2 nucleic acid transcript to the individual, thereby increasing body weight or muscle strength in the individual. In one embodiment, the individual has, or is at risk of having, centronuclear myopathy, Duchenne Muscular Dystrophy, or Charcot-Marie Tooth disease.

In one embodiment, the compound is a compound as described herein. In one embodiment, the compound is a member of the chirally enriched population described herein. In one embodiment, the compound is a component of the pharmaceutical composition described herein.

In one embodiment, the compound is administered to the individual via subcutaneous injection. In one embodiment, the compound is administered to the individual via intramuscular injection. In one embodiment, the compound is administered to the individual via intravenous injection.

The present invention further relates to the use of a single-stranded compound comprising a modified oligonucleotide 100% complementary to exon 10, intron 1, intron 11, intron, 12, intron 13, intron 14, or the 3′-UTR of a DNM2 nucleic acid transcript for treating, preventing, or ameliorating a disease associated with DNM2. In one embodiment, the disease is centronuclear myopathy, Duchenne Muscular Dystrophy, or Charcot-Marie Tooth disease.

The present invention further relates to the use of the compound described herein or the composition described herein for treating, preventing, or ameliorating a disease associated with DNM2.

The present invention further relates to the use of the compound described herein or the composition described herein in the manufacture of a medicament for treating, preventing, or ameliorating a disease associated with DNM2.

In one embodiment, the disease is centronuclear myopathy, Duchenne Muscular Dystrophy, or Charcot-Marie Tooth disease. In one embodiment, the disease is X-linked myotubular myopathy, autosomal recessive centronuclear myopathy, or autosomal dominant centronuclear myopathy. In one embodiment, the disease is associated with a mutation in at least one gene selected from among MTM1, BIN1, and DNM2. The present invention further relates to the use of the compound described herein or the composition described herein in the preparation of a medicament for treating, preventing, or ameliorating a disease associated with DNM2. In one embodiment, the disease is centronuclear myopathy, Duchenne Muscular Dystrophy, or Charcot-Marie Tooth disease. In one embodiment, the disease is X-linked myotubular myopathy, autosomal recessive centronuclear myopathy, or autosomal dominant centronuclear myopathy. In one embodiment, the the disease is associated with a mutation in at least one gene selected from among MTM1, BIN1, and DNM2.

DETAILED DESCRIPTION

It is to be understood that both the foregoing general description and the following detailed description are exemplary and explanatory only and are not restrictive of the embodiments, as claimed. Herein, the use of the singular includes the plural unless specifically stated otherwise. As used herein, the use of “or” means “and/or” unless stated otherwise. Furthermore, the use of the term “including” as well as other forms, such as “includes” and “included”, is not limiting.

The section headings used herein are for organizational purposes only and are not to be construed as limiting the subject matter described. All documents, or portions of documents, cited in this application, including, but not limited to, patents, patent applications, articles, books, treatises, and GenBank and NCBI reference sequence records are hereby expressly incorporated by reference for the portions of the document discussed herein, as well as in their entirety.

It is understood that the sequence set forth in each SEQ ID NO contained herein is independent of any modification to a sugar moiety, an internucleoside linkage, or a nucleobase. As such, compounds defined by a SEQ ID NO may comprise, independently, one or more modifications to a sugar moiety, an internucleoside linkage, or a nucleobase.

As used herein, “2′-deoxynucleoside” means a nucleoside comprising 2′-H(H) ribosyl sugar moiety, as found in naturally occurring deoxyribonucleic acids (DNA). In certain embodiments, a 2′-deoxynucleoside may comprise a modified nucleobase or may comprise an RNA nucleobase (uracil).

As used herein, “2′-substituted nucleoside” or “2-modified nucleoside” means a nucleoside comprising a 2′-substituted or 2′-modified sugar moiety. As used herein, “2′-substituted” or “2-modified” in reference to a furanosyl sugar moiety means a sugar moiety comprising at least one 2′-substituent group other than H or OH.

As used herein, “administration” or “administering” refers to routes of introducing a compound or composition provided herein to an individual to perform its intended function. An example of a route of administration that can be used includes, but is not limited to, administration by inhalation.

As used herein, “administered concomitantly” or “co-administration” means administration of two or more compounds in any manner in which the pharmacological effects of both are manifest in the patient. Concomitant administration does not require that both compounds be administered in a single pharmaceutical composition, in the same dosage form, by the same route of administration, or at the same time. The effects of both compounds need not manifest themselves at the same time. The effects need only be overlapping for a period of time and need not be coextensive. Concomitant administration or co-administration encompasses administration in parallel or sequentially.

As used herein, “animal” refers to a human or non-human animal, including, but not limited to, mice, rats, rabbits, dogs, cats, pigs, and non-human primates, including, but not limited to, monkeys and chimpanzees.

As used herein, “antisense activity” means any detectable and/or measurable change attributable to the hybridization of an antisense compound to its target nucleic acid. In certain embodiments, antisense activity is a decrease in the amount or expression of a target nucleic acid or protein encoded by such target nucleic acid compared to target nucleic acid levels or target protein levels in the absence of the antisense compound.

As used herein, “antisense compound” means a compound comprising an antisense oligonucleotide and optionally one or more additional features, such as a conjugate group or terminal group.

As used herein, “antisense oligonucleotide” means an oligonucleotide having a nucleobase sequence that is at least partially complementary to a target nucleic acid.

As used herein, “ameliorate” in reference to a treatment means improvement in at least one symptom relative to the same symptom in the absence of the treatment. In certain embodiments, amelioration is the reduction in the severity or frequency of a symptom or the delayed onset or slowing of progression in the severity or frequency of a symptom.

As used herein, “bicyclic nucleoside” or “BNA” means a nucleoside comprising a bicyclic sugar moiety. As used herein, “bicyclic sugar” or “bicyclic sugar moiety” means a modified sugar moiety comprising two rings, wherein the second ring is formed via a bridge connecting two of the atoms in the first ring thereby forming a bicyclic structure. In certain embodiments, the first ring of the bicyclic sugar moiety is a furanosyl moiety. In certain embodiments, the bicyclic sugar moiety does not comprise a furanosyl moiety.

As used herein, “cEt” or “constrained ethyl” means a bicyclic sugar moiety, wherein the first ring of the bicyclic sugar moiety is a ribosyl sugar moiety, the second ring of the bicyclic sugar is formed via a bridge connecting the 4′-carbon and the 2′-carbon, the bridge has the formula 4′-CH(CH3)—O-2′, and the methyl group of the bridge is in the S configuration. A cEt bicyclic sugar moiety is in the β-D configuration.

As used herein, “chirally enriched population” means a plurality of molecules of identical molecular formula, wherein the number or percentage of molecules within the population that contain a particular stereochemical configuration at a particular chiral center is greater than the number or percentage of molecules expected to contain the same particular stereochemical configuration at the same particular chiral center within the population if the particular chiral center were stereorandom. Chirally enriched populations of molecules having multiple chiral centers within each molecule may contain one or more sterorandom chiral centers. In certain embodiments, the molecules are modified oligonucleotides. In certain embodiments, the molecules are compounds comprising modified oligonucleotides.

As used herein, “complementary” in reference to an oligonucleotide means that at least 70% of the nucleobases of such oligonucleotide or one or more regions thereof and the nucleobases of another nucleic acid or one or more regions thereof are capable of hydrogen bonding with one another when the nucleobase sequence of the oligonucleotide and the other nucleic acid are aligned in opposing directions. Complementary nucleobases are nucleobase pairs that are capable of forming hydrogen bonds with one another. Complementary nucleobase pairs include adenine (A) and thymine (T), adenine (A) and uracil (U), cytosine (C) and guanine (G), 5-methyl cytosine (mC) and guanine (G). Complementary oligonucleotides and/or nucleic acids need not have nucleobase complementarity at each nucleoside. Rather, some mismatches are tolerated. As used herein, “fully complementary” or “100% complementary” in reference to oligonucleotides means that such oligonucleotides are complementary to another oligonucleotide or nucleic acid at each nucleoside of the oligonucleotide.

As used herein, “conjugate group” means a group of atoms that is directly or indirectly attached to an oligonucleotide. Conjugate groups include a conjugate moiety and a conjugate linker that attaches the conjugate moiety to the oligonucleotide.

As used herein, “conjugate linker” means a group of atoms comprising at least one bond that connects a conjugate moiety to an oligonucleotide.

As used herein, “conjugate moiety” means a group of atoms that is attached to an oligonucleotide via a conjugate linker.

As used herein, “contiguous” in the context of an oligonucleotide refers to nucleosides, nucleobases, sugar moieties, or internucleoside linkages that are immediately adjacent to each other. For example, “contiguous nucleobases” means nucleobases that are immediately adjacent to each other in a sequence.

As used herein, “double-stranded antisense compound” means an antisense compound comprising two oligomeric compounds that are complementary to each other and form a duplex, and wherein one of the two said oligomeric compounds comprises an antisense oligonucleotide.

As used herein, “effective amount” means the amount of compound sufficient to effectuate a desired physiological outcome in an individual in need of the compound. The effective amount may vary among individuals depending on the health and physical condition of the individual to be treated, the taxonomic group of the individuals to be treated, the formulation of the composition, assessment of the individual's medical condition, and other relevant factors.

As used herein, “efficacy” means the ability to produce a desired effect.

As used herein “DNM2” means any Dynamin 2 nucleic acid or protein. “DNM2 nucleic acid” means any nucleic acid encoding DNM2. For example, in certain embodiments, a DNM2 nucleic acid includes a DNA chromosomal region encoding DNM2, an RNA transcribed from DNA encoding DNM2 (e.g., a pre-mRNA transcript), and an mRNA transcript encoding DNM2.

As used herein, “expression” includes all the functions by which a gene's coded information is converted into structures present and operating in a cell. Such structures include, but are not limited to, the products of transcription and translation. Methods for measuring expression levels (such as a transcription level or a translation level) are well-known in the field and include, but are not limited to, RT-PCR, RT-qPCR, Northern Blot, hybridization techniques such as, for example, use of microarrays, and combinations thereof including but not limited to, hybridization of amplicons obtained by RT-PCR, sequencing such as, for example, next-generation DNA sequencing (NGS) or RNA-seq (also known as “Whole Transcriptome Shotgun Sequencing”) and the like, immunohistochemistry, Multiplex methods (Luminex), western blot, enzyme-linked immunosorbent assay (ELISA), sandwich ELISA, multiplex ELISA, electrochemiluminescence (ECL) (Elecsys®, Roche Diagnostics), enzyme-linked fluorescent assay (ELFA) (such as VIDAS®, Biomdrieux), fluorescent-linked immunosorbent assay (FLISA), enzyme immunoassay (EIA), radioimmunoassay (RIA), flow cytometry (FACS), surface plasmon resonance (SPR), biolayer interferometry (BLI), immunochromatographic assay (ICA) (such as NEXUS IB10, Sphingotech) and mass spectrometry-based approaches.

As used herein, “gapmer” means an oligonucleotide, such as an antisense oligonucleotide, comprising an internal segment having a plurality of nucleosides that support RNase H cleavage positioned between external segments, each having one or more nucleosides, wherein the nucleosides comprising the internal segment are chemically distinct from the immediately adjacent nucleoside or nucleosides comprising the external segments. The internal segment may be referred to as the “gap” or “gap segment” and the external segments may be referred to as the “wings” or “wing segments”.

As used herein, “hybridization” means the pairing or annealing of complementary oligonucleotides and/or nucleic acids. While not limited to a particular mechanism, the most common mechanism of hybridization involves hydrogen bonding, which may be, for example, Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding, between complementary nucleobases.

As used herein, “individual” means a human or non-human animal selected for treatment or therapy.

As used herein, “inhibiting the expression or activity” refers to a reduction or blockade of the expression or activity relative to the expression or activity in an untreated or control sample and does not necessarily indicate a total elimination of expression or activity. In one embodiment, inhibiting the expression or activity refers to a reduction or blockade of the expression or activity relative to the expression or activity in an untreated or control sample of at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, or at least about 90%. In one embodiment, inhibiting the expression or activity refers to a reduction or blockade of the expression or activity relative to the expression or activity in an untreated or control sample of at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%.

As used herein, the term “about” preceding a figure means plus or less 10% of the value of said figure.

As used herein, the terms “internucleoside linkage” means a group or bond that forms a covalent linkage between adjacent nucleosides in an oligonucleotide. As used herein “modified internucleoside linkage” means any internucleoside linkage other than a naturally occurring, phosphate internucleoside linkage. Non-phosphate linkages are referred to herein as modified internucleoside linkages. “Phosphorothioate linkage” means a modified phosphate linkage in which one of the non-bridging oxygen atoms is replaced with a sulfur atom. A phosphorothioate internucleoside linkage is a modified internucleoside linkage. Modified internucleoside linkages include linkages that comprise abasic nucleosides. As used herein, “abasic nucleoside” means a sugar moiety in an oligonucleotide or oligomeric compound that is not directly connected to a nucleobase. In certain embodiments, an abasic nucleoside is adjacent to one or two nucleosides in an oligonucleotide.

As used herein, “linker-nucleoside” means a nucleoside that links, either directly or indirectly, an oligonucleotide to a conjugate moiety. Linker-nucleosides are located within the conjugate linker of an oligomeric compound. Linker-nucleosides are not considered part of the oligonucleotide portion of an oligomeric compound even if they are contiguous with the oligonucleotide.

As used herein, “non-bicyclic modified sugar” or “non-bicyclic modified sugar moiety” means a modified sugar moiety that comprises a modification, such as a substituent, that does not form a bridge between two atoms of the sugar to form a second ring.

As used herein, “linked nucleosides” are nucleosides that are connected in a continuous sequence (i.e. no additional nucleosides are present between those that are linked).

As used herein, “mismatch” or “non-complementary” means a nucleobase of a first oligonucleotide that is not complementary with the corresponding nucleobase of a second oligonucleotide or target nucleic acid when the first and second oligomeric compound are aligned.

As used herein, “modulating” refers to changing or adjusting a feature in a cell, tissue, organ or organism. For example, modulating DNM2 expression can mean to increase or decrease the level of an DNM2 RNA and/or a DNM2 protein in a cell, tissue, organ or organism. A “modulator” effects the change in the cell, tissue, organ or organism. For example, a compound that modulates DNM2 expression can be a modulator that decreases the amount of a DNM2 RNA and/or a DNM2 protein in a cell, tissue, organ or organism.

As used herein, “MOE” means methoxyethyl. “2′-MOE” or “2′-O-methoxyethyl” means a 2′-OCH2CH2OCH3 group in place of the 2′OH group of a ribosyl ring.

As used herein, “motif” means the pattern of unmodified and/or modified sugar moieties, nucleobases, and/or internucleoside linkages, in an oligonucleotide.

As used herein, “naturally occurring” means found in nature.

As used herein, “nucleobase” means an unmodified nucleobase or a modified nucleobase. As used herein an “unmodified nucleobase” is adenine (A), thymine (T), cytosine (C), uracil (U), and guanine (G). As used herein, a modified nucleobase is a group of atoms capable of pairing with at least one unmodified nucleobase. A universal base is a nucleobase that can pair with any one of the five unmodified nucleobases.

As used herein, “nucleobase sequence” means the order of contiguous nucleobases in a nucleic acid or oligonucleotide independent of any sugar or internucleoside linkage modification.

As used herein, “nucleoside” means a moiety comprising a nucleobase and a sugar moiety. The nucleobase and sugar moiety are each, independently, unmodified or modified. As used herein, “modified nucleoside” means a nucleoside comprising a modified nucleobase and/or a modified sugar moiety.

As used herein, “oligomeric compound” means a compound consisting of an oligonucleotide and optionally one or more additional features, such as a conjugate group or terminal group.

As used herein, “oligonucleotide” means a strand of linked nucleosides connected via internucleoside linkages, wherein each nucleoside and internucleoside linkage may be modified or unmodified. Unless otherwise indicated, oligonucleotides consist of 8-50 linked nucleosides. As used herein, “modified oligonucleotide” means an oligonucleotide, wherein at least one nucleoside or internucleoside linkage is modified. As used herein, “unmodified oligonucleotide” means an oligonucleotide that does not comprise any nucleoside modifications or internucleoside modifications.

As used herein, “pharmaceutically acceptable carrier or diluent” means any substance suitable for use in administering to an animal. Certain such carriers enable pharmaceutical compositions to be formulated as, for example, liquids, powders, or suspensions that can be aerosolized or otherwise dispersed for inhalation by a subject. In certain embodiments, a pharmaceutically acceptable carrier or diluent is sterile water; sterile saline; or sterile buffer solution. In one embodiment, the pharmaceutically acceptable carrier or diluent does not produce an adverse, allergic or other untoward reaction when administered to an animal, preferably a human. It includes any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents and the like. For human administration, preparations should meet sterility, pyrogenicity, general safety and purity standards as required by regulatory offices, such as, for example, FDA Office or EMA.

As used herein “pharmaceutically acceptable salts” means physiologically and pharmaceutically acceptable salts of compounds, such as oligomeric compounds, i.e., salts that retain the desired biological activity of the parent compound and do not impart undesired toxicological effects thereto.

As used herein “pharmaceutical composition” means a mixture of substances suitable for administering to a subject. For example, a pharmaceutical composition may comprise an antisense compound and an aqueous solution.

As used herein, “phosphorus moiety” means a group of atoms comprising a phosphorus atom. In certain embodiments, a phosphorus moiety comprises a mono-, di-, or tri-phosphate, or phosphorothioate.

As used herein “prodrug” means a therapeutic agent in a form outside the body that is converted to a differentform within the body or cells thereof. Typically conversion of a prodrug within the body is facilitated by the action of an enzymes (e.g., endogenous or viral enzyme) or chemicals present in cells or tissues and/or by physiologic conditions.

As used herein, “RNAi compound” means an antisense compound that acts, at least in part, through RISC or Ago2 to modulate a target nucleic acid and/or protein encoded by a target nucleic acid. RNAi compounds include, but are not limited to double-stranded siRNA, single-stranded RNA (ssRNA), and microRNA, including microRNA mimics. In certain embodiments, an RNAi compound modulates the amount, activity, and/or splicing of a target nucleic acid. The term RNAi compound excludes antisense oligonucleotides that act through RNase H.

As used herein, the term “single-stranded” in reference to an antisense compound means such a compound consisting of one oligomeric compound that is not paired with a second oligomeric compound to form a duplex. “Self-complementary” in reference to an oligonucleotide means an oligonucleotide that at least partially hybridizes to itself. A compound consisting of one oligomeric compound, wherein the oligonucleotide of the oligomeric compound is self-complementary, is a single-stranded compound. A single-stranded antisense or oligomeric compound may be capable of binding to a complementary oligomeric compound to form a duplex, in which case the compound would no longer be single-stranded.

As used herein, “standard cell assay” means any of the assays described in Examples 1-9, and reasonable variations thereof.

As used herein, “standard in vivo experiment” means the procedure described in Example 10 and reasonable variations thereof.

As used herein, “stereorandom chiral center” in the context of a population of molecules of identical molecular formula means a chiral center having a random stereochemical configuration. For example, in a population of molecules comprising a stereorandom chiral center, the number of molecules having the (S) configuration of the stereorandom chiral center may be but is not necessarily the same as the number of molecules having the (R) configuration of the stereorandom chiral center. The stereochemical configuration of a chiral center is considered random when it is the result of a synthetic method that is not designed to control the stereochemical configuration. In certain embodiments, a stereorandom chiral center is a stereorandom phosphorothioate internucleoside linkage.

As used herein, “sugar moiety” means an unmodified sugar moiety or a modified sugar moiety. As used herein, “unmodified sugar moiety” means a 2′-OH(H) ribosyl moiety, as found in RNA (an “unmodified RNA sugar moiety”), or a 2′-H(H) moiety, as found in DNA (an “unmodified DNA sugar moiety”). As used herein, “modified sugar moiety” or “modified sugar” means a modified furanosyl sugar moiety or a sugar surrogate. As used herein, modified furanosyl sugar moiety means a furanosyl sugar comprising a non-hydrogen substituent in place of at least one hydrogen of an unmodified sugar moiety. In certain embodiments, a modified furanosyl sugar moiety is a 2′-substituted sugar moiety. Such modified furanosyl sugar moieties include bicyclic sugars and non-bicyclic sugars. As used herein, “sugar surrogate” means a modified sugar moiety having other than a furanosyl moiety that can link a nucleobase to another group, such as an internucleoside linkage, conjugate group, or terminal group in an oligonucleotide. Modified nucleosides comprising sugar surrogates can be incorporated into one or more positions within an oligonucleotide and such oligonucleotides are capable of hybridizing to complementary oligomeric compounds or nucleic acids.

As used herein, “target nucleic acid,” “target RNA,” “target RNA transcript” and “nucleic acid target” mean a nucleic acid that an antisense compound is designed to affect.

As used herein, “target region” means a portion of a target nucleic acid to which an antisense compound is designed to hybridize.

As used herein, “terminal group” means a chemical group or group of atoms that is covalently linked to a terminus of an oligonucleotide.

As used herein, “terminal wing nucleoside” means a nucleoside that is located at the terminus of a wing segment of a gapmer. Any wing segment that comprises or consists of at least two nucleosides has two termini: one that is immediately adjacent to the gap segment; and one that is at the end opposite the gap segment. Thus, any wing segment that comprises or consists of at least two nucleosides has two terminal nucleosides, one at each terminus.

As used herein, “therapeutically effective amount” means an amount of a compound, pharmaceutical agent, or composition that provides a therapeutic benefit to an individual. In certain embodiments, the therapeutically effective amount refers to the level or amount of a compound that treats or ameliorates symptoms of a disease associated with DNM2. In certain embodiments, the therapeutically effective amount may be administered prior to the onset of the disease associated with DNM2 or may be administered after initiation of the disease associated with DNM2.

As used herein, “treat” refers to administering a compound or pharmaceutical composition to an animal in order to effect an alteration or improvement of a disease, disorder, or condition in the animal. In one embodiment, a subject is successfully treated if, after receiving a therapeutically effective amount of a compound according to the present invention, the subject shows observable and/or measurable reduction or relief to some extent of one or more of the symptoms associated with the specific disease associated with DNM2, such as but not limited to reduced morbidity and mortality, improvement in quality of life issues, increased body weight, preservation or increase in muscle strength, decrease in time taken to rise from the floor, decrease in nine-meter walking time, decrease in time taken to climb four stairs, increased ability to lift weight, increased distance of a 6 minute walk, increased leg function grade, improved pulmonary function and/or cardiac function. Parameters for assessing successful treatment and improvement in the disease are readily measurable by routine procedures familiar to a physician.

Certain Embodiments

Certain embodiments provide methods, compounds and compositions for inhibiting DNM2 expression.

Certain embodiments provide methods, compounds and compositions for inhibiting DNM2 expression as compared to an untreated or control sample. In one embodiment, said inhibition is an inhibition of DNM2 expression of at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, or at least about 90%. In one embodiment, inhibiting the expression or activity refers to a reduction or blockade of the expression or activity relative to the expression or activity in an untreated or control sample of at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% as compared to an untreated or control sample.

Certain embodiments provide compounds comprising or consisting of oligonucleotides complementary to a DNM2 nucleic acid. In certain embodiments, the DNM2 nucleic acid has the sequence set forth in RefSeq or GenBank Accession No. NC_000019.10 truncated from nucleosides 10715001 to Ser. No. 10/835,000 (disclosed herein as SEQ ID NO: 1), NM_004945.3 (disclosed herein as SEQ ID NO: 2), NM_001005361.2 (disclosed herein as SEQ ID NO: 3), or NM_001005360.2 (disclosed herein as SEQ ID NO: 3135). In certain embodiments, the compound is an antisense compound or oligomeric compound. In certain embodiments, the compound is single-stranded. In certain embodiments, the compound is double-stranded.

Certain embodiments provide a compound comprising a modified oligonucleotide 8 to 50 linked nucleosides in length and having a nucleobase sequence comprising at least 8 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 7-3134 or of any sequence having at least about 70% identity with any of the nucleobase sequences of SEQ ID NOs: 7-3134, such as, for example, at least about 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% identity or more with any of the nucleobase sequences of SEQ ID NOs: 7-3134.

As used herein, the term “identity” refers to the subunit sequence identity between two nucleic acid molecules, such as, two DNA molecules or two RNA molecules. When a subunit position in both of the two molecules is occupied by the same monomeric subunit; e.g., if a position in each of two DNA molecules is occupied by adenine, then they are identical (or homologous) at that position. The homology between two sequences is a direct function of the number of matching or homologous positions; e.g., if half (e.g., five positions in a polymer ten subunits in length) of the positions in two sequences are homologous, the two sequences are 50% homologous; if 90% of the positions (e.g., 9 of 10), are matched or homologous, the two sequences are 90% homologous. Thus, the term “homologous” or “identical”, when used in a relationship between the sequences of two or more nucleic acid molecules, refers to the degree of sequence relatedness between nucleic acid molecules, as determined by the number of matches between strings of two or more nucleotide residues. “Identity” measures the percent of identical matches between the smaller of two or more sequences with gap alignments (if any) addressed by a particular mathematical model or computer program (i.e., “algorithms”). Identity of related polypeptides can be readily calculated by known methods. Such methods include, but are not limited to, those described in Computational Molecular Biology, Lesk, A. M., ed., Oxford University Press, New York, 1988; Biocomputing: Informatics and Genome Projects, Smith, D. W., ed., Academic Press, New York, 1993; Computer Analysis of Sequence Data, Part 1, Griffin, A. M., and Griffin, H. G., eds., Humana Press, New Jersey, 1994; Sequence Analysis in Molecular Biology, von Heinje, G., Academic Press, 1987; Sequence Analysis Primer, Gribskov, M. and Devereux, J., eds., M. Stockton Press, New York, 1991; and Carillo et al., SIAM J. Applied Math. 48, 1073 (1988). Preferred methods for determining identity are designed to give the largest match between the sequences tested. Methods of determining identity are described in publicly available computer programs. Preferred computer program methods for determining identity between two sequences include the GCG program package, including GAP (Devereux et al., Nucl. Acid. Res. 2, 387 (1984); Genetics Computer Group, University of Wisconsin, Madison, Wis.), BLASTP, BLASTN, and FASTA (Altschul et al., J. MoI. Biol. 215, 403-410 (1990)). The BLASTX program is publicly available from the National Center for Biotechnology Information (NCBI) and other sources (BLAST Manual, Altschul et al. NCB/NLM/NIH Bethesda, Md. 20894; Altschul et al., supra). The well-known Smith Waterman algorithm may also be used to determine identity.

In certain embodiments, the compound is an antisense compound or oligomeric compound. In certain embodiments, the compound is single-stranded. In certain embodiments, the compound is double-stranded. In certain embodiments, the modified oligonucleotide is 10 to 30 linked nucleosides in length.

Certain embodiments provide a compound comprising a modified oligonucleotide 8 to 50 linked nucleosides in length and having a nucleobase sequence comprising at least 8 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 2879, 3056, 2123, 2189, 2453, 2160, or 2232 or at least 8 contiguous nucleobases of a sequence having at least 70% identity with any of the nucleobase sequences of SEQ ID NOs: 2879, 3056, 2123, 2189, 2453, 2160, or 2232. In certain embodiments, the nucleobase sequence of the modified oligonucleotide comprises or consists of SEQ ID NO: 2879 or a sequence having at least 70% identity with SEQ ID NO: 2879. In certain embodiments, the nucleobase sequence of the modified oligonucleotide comprises or consists of SEQ ID NO: 3056 or a sequence having at least 70% identity with SEQ ID NO: 3056. In certain embodiments, the nucleobase sequence of the modified oligonucleotide comprises or consists of SEQ ID NO: 2123 or a sequence having at least 70% identity with SEQ ID NO: 2123. In certain embodiments, the nucleobase sequence of the modified oligonucleotide comprises or consists of SEQ ID NO: 2189 or a sequence having at least 70% identity with SEQ ID NO: 2189. In certain embodiments, the nucleobase sequence of the modified oligonucleotide comprises or consists of SEQ ID NO: 2453 or a sequence having at least 70% identity with SEQ ID NO: 2453. In certain embodiments, the nucleobase sequence of the modified oligonucleotide comprises or consists of SEQ ID NO: 2160 or a sequence having at least 70% identity with SEQ ID NO: 2160. In certain embodiments, the nucleobase sequence of the modified oligonucleotide comprises or consists of SEQ ID NO: 2232 or a sequence having at least 70% identity with SEQ ID NO: 2232. In certain embodiments, the compound is an antisense compound or oligomeric compound. In certain embodiments, the compound is single-stranded. In certain embodiments, the compound is double-stranded. In certain embodiments, the modified oligonucleotide is 10 to 30 linked nucleosides in length. In certain embodiments, the modified oligonucleotide has a nucleobase sequence comprising at least 12 contiguous nucleobases of any of SEQ ID Numbers from 7 to 3134 or of any sequence having at least about 70% identity with any of the nucleobase sequences of SEQ ID NOs: 7-3134, such as, for example, at least about 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% identity or more with any of the nucleobase sequences of SEQ ID NOs: 7-3134.

Certain embodiments provide a compound comprising a modified oligonucleotide 10 to 50 linked nucleosides in length and having a nucleobase sequence comprising at least 10 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 7-3134 or of any sequence having at least about 70% identity with any of the nucleobase sequences of SEQ ID NOs: 7-3134, such as, for example, at least about 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% identity or more with any of the nucleobase sequences of SEQ ID NOs: 7-3134. In certain embodiments, the compound is an antisense compound or oligomeric compound. In certain embodiments, the compound is single-stranded. In certain embodiments, the compound is double-stranded. In certain embodiments, the modified oligonucleotide is 10 to 30 linked nucleosides in length.

Certain embodiments provide a compound comprising a modified oligonucleotide 11 to 50 linked nucleosides in length and having a nucleobase sequence comprising at least 11 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 7-3134 or of any sequence having at least about 70% identity with any of the nucleobase sequences of SEQ ID NOs: 7-3134, such as, for example, at least about 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% identity or more with any of the nucleobase sequences of SEQ ID NOs: 7-3134. In certain embodiments, the compound is an antisense compound or oligomeric compound. In certain embodiments, the compound is single-stranded. In certain embodiments, the compound is double-stranded. In certain embodiments, the modified oligonucleotide is 11 to 30 linked nucleosides in length.

Certain embodiments provide a compound comprising a modified oligonucleotide 12 to 50 linked nucleosides in length and having a nucleobase sequence comprising at least 12 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 7-3134 or of any sequence having at least about 70% identity with any of the nucleobase sequences of SEQ ID NOs: 7-3134, such as, for example, at least about 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% identity or more with any of the nucleobase sequences of SEQ ID NOs: 7-3134. In certain embodiments, the compound is an antisense compound or oligomeric compound. In certain embodiments, the compound is single-stranded. In certain embodiments, the compound is double-stranded. In certain embodiments, the modified oligonucleotide is 12 to 30 linked nucleosides in length.

In certain embodiments, the compound comprises a modified oligonucleotide 16 linked nucleosides in length. In certain embodiments, the compound is an antisense compound or oligomeric compound.

Certain embodiments provide a compound comprising a modified oligonucleotide 16 to 50 linked nucleosides in length and having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 7-3134 or of any sequence having at least about 70% identity with any of the nucleobase sequences of SEQ ID NOs: 7-3134, such as, for example, at least about 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% identity or more with any of the nucleobase sequences of SEQ ID NOs: 7-3134. In certain embodiments, the compound is an antisense compound or oligomeric compound. In certain embodiments, the compound is single-stranded. In certain embodiments, the compound is double-stranded. In certain embodiments, the modified oligonucleotide is 16 to 30 linked nucleosides in length.

Certain embodiments provide a compound comprising a modified oligonucleotide consisting of the nucleobase sequence of any one of SEQ ID NOs: 7-3134 or of any sequence having at least about 70% identity with any of the nucleobase sequences of SEQ ID NOs: 7-3134, such as, for example, at least about 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% identity or more with any of the nucleobase sequences of SEQ ID NOs: 7-3134. In certain embodiments, the compound is an antisense compound or oligomeric compound. In certain embodiments, the compound is single-stranded. In certain embodiments, the compound is double-stranded.

In certain embodiments, compounds comprise or consist of modified oligonucleotides complementary to an intron of a DNM2 nucleic acid transcript. In certain embodiments, modified oligonucleotides are complementary to intron 1, intron 2, intron 3, intron 4, intron 5, intron 6, intron 7, intron 8, intron 9, intron 9-10a, intron 10, intron 10a-11, intron 11, intron 12, intron 13, intron 14, intron 15, intron 16, intron 17, intron 18, intron 19, or intron 19-20a of a DNM2 nucleic acid transcript. In certain such embodiments, modified oligonucleotides are complementary to a sequence within nucleotides 3404-44,737; 44,812-57,478; 57,629-60,702; 60,907-62,117; 62,217-67,959; 68,121-71,563; 71,707-78,719; 78,856-80,371; 80,440-81,060; 80,440-82,379; 81,200-83,485; 82,519-83,485; 83,573-87,287; 87,359-90,915; 90,968-97,263; 97,378-104,979; 105,090-108,787; 108,990-110,056; 110,222-114,035; 114,269-115,126; 115,379-115,977; or 115,379-115,980 of SEQ ID NO: 1. In certain embodiments, compounds comprise or consist of oligonucleotides having at least an 8, 9, 10, 11, 12, 13, 14, 15, or 16 contiguous nucleobase portion complementary to an equal length portion of intron 1, intron 2, intron 3, intron 4, intron 5, intron 6, intron 7, intron 8, intron 9, intron 9-10a, intron 10, intron 10a-11, intron 11, intron 12, intron 13, intron 14, intron 15, intron 16, intron 17, intron 18, intron 19, or intron 19-20a of a DNM2 nucleic acid transcript. In certain embodiments, such oligonucleotides have at least an 8, 9, 10, 11, 12, 13, 14, 15, or 16 contiguous nucleobase portion complementary to an equal length portion within nucleotides 3404-44,737; 44,812-57,478; 57,629-60,702; 60,907-62,117; 62,217-67,959; 68,121-71,563; 71,707-78,719; 78,856-80,371; 80,440-81,060; 80,440-82,379; 81,200-83,485; 82,519-83,485; 83,573-87,287; 87,359-90,915; 90,968-97,263; 97,378-104,979; 105,090-108,787; 108,990-110,056; 110,222-114,035; 114,269-115,126; 115,379-115,977; or 115,379-115,980 of SEQ ID NO: 1. In certain embodiments, these compounds are antisense compounds or oligomeric compounds. Compounds comprising a modified oligonucleotide complementary to certain introns of a DNM2 nucleic acid transcript, e.g., intron 1, intron 11, intron 12, intron 13, or intron 14 of a DNM2 pre-mRNA, are generally especially potent and tolerable. Thus, such certain introns can be considered hot spot regions for targeting a DNM2 nucleic acid transcript.

In certain embodiments, compounds comprise or consist of modified oligonucleotides complementary to intron 1, intron 11, intron 12, intron 13, intron 14, exon 10, or the 3′-UTR of a DNM2 nucleic acid transcript. In certain embodiments, modified oligonucleotides are complementary to a sequence within nucleotides 3,404-44,737; 83,573-87,287; 87,359-90,915; 90,968-97,263; 97,378-104,979; 81,061-81,199; or 116,048-116,903 of SEQ ID NO: 1. In certain embodiments, compounds comprise or consist of oligonucleotides having at least an 8, 9, 10, 11, 12, 13, 14, 15, or 16 contiguous nucleobase portion complementary to an equal length portion of intron 1, intron 11, intron 12, intron 13, intron 14, exon 10, or the 3′-UTR of a DNM2 nucleic acid transcript.

In certain embodiments, such oligonucleotides have at least an 8, 9, 10, 11, 12, 13, 14, 15, or 16 contiguous nucleobase portion complementary to an equal length portion within nucleotides 3,404-44,737; 83,573-87,287; 87,359-90,915; 90,968-97,263; 97,378-104,979; 81,061-81,199; or 116,048-116,903 of SEQ ID NO: 1. In certain embodiments, these compounds are antisense compounds or oligomeric compounds.

In certain embodiments, a compound comprises a modified oligonucleotide 8 to 50 linked nucleosides in length and having at least an 8, 9, 10, 11, 12, 13, 14, 15, or 16 contiguous nucleobase portion complementary to an equal length portion within nucleotides 3,404-44,737; 83,573-87,287; 87,359-90,915; 90,968-97,263; 97,378-104,979; 81,061-81,199; or 116,048-116,903 of SEQ ID NO: 1. In certain embodiments, the modified oligonucleotide is 10 to 30 linked nucleosides in length.

In certain embodiments, compounds comprise or consist of modified oligonucleotides complementary to intron 1, intron 11, intron 12, intron 13, or intron 14 of a DNM2 nucleic acid transcript. In certain embodiments, modified oligonucleotides are complementary to a sequence within nucleotides 3,404-44,737; 83,573-87,287; 87,359-90,915; 90,968-97,263; or 97,378-104,979 of SEQ ID NO: 1. In certain embodiments, compounds comprise or consist of oligonucleotides having at least an 8, 9, 10, 11, 12, 13, 14, 15, or 16 contiguous nucleobase portion complementary to an equal length portion of intron 1, intron 11, intron 12, intron 13, or intron 14 of a DNM2 nucleic acid transcript. In certain embodiments, such oligonucleotides have at least an 8, 9, 10, 11, 12, 13, 14, 15, or 16 contiguous nucleobase portion complementary to an equal length portion within nucleotides 3,404-44,737; 83,573-87,287; 87,359-90,915; 90,968-97,263; or 97,378-104,979 of SEQ ID NO: 1. In certain embodiments, these compounds are antisense compounds or oligomeric compounds.

In certain embodiments, a compound comprises a modified oligonucleotide 8 to 50 linked nucleosides in length and having at least an 8, 9, 10, 11, 12, 13, 14, 15, or 16 contiguous nucleobase portion complementary to an equal length portion within nucleotides 3,404-44,737; 83,573-87,287; 87,359-90,915; 90,968-97,263; or 97,378-104,979; of SEQ ID NO: 1. In certain embodiments, the modified oligonucleotide is 10 to 30 linked nucleosides in length.

In certain embodiments, a compound comprises a modified oligonucleotide 8 to 50 linked nucleosides in length and complementary within nucleotides 89,722-89,737; 83,880-83,895; 90,081-90,096; 94,450-94,465; 11,960-11,975; 93,322-93,337; or 97,855-97,870 of SEQ ID NO: 1. In certain embodiments, the modified oligonucleotide is 10 to 30 linked nucleosides in length.

In certain embodiments, a compound comprises a modified oligonucleotide 8 to 50 linked nucleosides in length and having a nucleobase sequence comprising at least an 8, 9, 10, 11, 12, 13, 14, 15, or 16 contiguous nucleobase portion of the nucleobase sequence of any one of compound numbers 951799, 949935, 950023, 950089, 951372, 950060, or 950132 (SEQ ID NOs: 2879, 3056, 2123, 2189, 2453, 2160, or 2232). In certain embodiments, the modified oligonucleotide is 10 to 30 linked nucleosides in length. In certain embodiments, the nucleobase sequence of the modified oligonucleotide comprises or consists of SEQ ID NO: 2879 or of a sequence having at least 70% identity with SEQ ID NO: 2879. In certain embodiments, the nucleobase sequence of the modified oligonucleotide comprises or consists of SEQ ID NO: 3056 or of a sequence having at least 70% identity with SEQ ID NO: 3056. In certain embodiments, the nucleobase sequence of the modified oligonucleotide comprises or consists of SEQ ID NO: 2123 or of a sequence having at least 70% identity with SEQ ID NO: 2123. In certain embodiments, the nucleobase sequence of the modified oligonucleotide comprises or consists of SEQ ID NO: 2189 or of a sequence having at least 70% identity with SEQ ID NO: 2189. In certain embodiments, the nucleobase sequence of the modified oligonucleotide comprises or consists of SEQ ID NO: 2453 or of a sequence having at least 70% identity with SEQ ID NO: 2453. In certain embodiments, the nucleobase sequence of the modified oligonucleotide comprises or consists of SEQ ID NO: 2160 or of a sequence having at least 70% identity with SEQ ID NO: 2160. In certain embodiments, the nucleobase sequence of the modified oligonucleotide comprises or consists of SEQ ID NO: 2232 or of a sequence having at least 70% identity with SEQ ID NO: 2232.

In certain embodiments, a compound comprises or consists of a modified oligonucleotide 8 to 50 linked nucleosides in length and having a nucleobase sequence comprising the nucleobase sequence of any one of compound numbers 951799, 949935, 950023, 950089, 951372, 950060, or 950132 (SEQ ID NOs: 2879, 3056, 2123, 2189, 2453, 2160, or 2232). In certain embodiments, the modified oligonucleotide is 10 to 30 linked nucleosides in length.

In certain embodiments, a compound comprises or consists of a modified oligonucleotide having a nucleobase sequence consisting of the nucleobase sequence of any one of compound numbers 951799, 949935, 950023, 950089, 951372, 950060, or 950132 (SEQ ID NOs: 2879, 3056, 2123, 2189, 2453, 2160, or 2232). In certain embodiments, a compound comprises or consists of a modified oligonucleotide 8 to 50 linked nucleosides in length and having a nucleobase sequence comprising the nucleobase sequence of the compound number 951799 (SEQ ID NO: 2879). In certain embodiments, the modified oligonucleotide is 10 to 30 linked nucleosides in length.

In certain embodiments, a compound comprising or consisting of a modified oligonucleotide complementary to DNM2 is compound number 951799. Out of the over 3,000 compounds that were screened as described in the Examples section below, compound numbers 951799, 949935, 950023, 950089, 951372, 950060, and 950132 emerged as the top lead compounds. In particular, compound number 951799 exhibited the best combination of properties in terms of potency and tolerability out of over 3,000 compounds.

In certain embodiments, any of the foregoing oligonucleotides is a modified oligonucleotide comprising at least one modified internucleoside linkage, at least one modified sugar, and/or at least one modified nucleobase.

In certain embodiments, any of the foregoing modified oligonucleotides comprises at least one modified sugar. In certain embodiments, at least one modified sugar is a bicyclic sugar, such as a cEt bicyclic sugar, an LNA bicyclic sugar, or an ENA bicyclic sugar.

In certain embodiments, the modified oligonucleotide comprises at least one modified internucleoside linkage, such as a phosphorothioate internucleoside linkage.

In certain embodiments, any of the foregoing modified oligonucleotides comprises at least one modified nucleobase, such as 5-methylcytosine.

In certain embodiments, any of the foregoing modified oligonucleotides comprises:

    • a gap segment consisting of linked 2′-deoxynucleosides;
    • a 5′ wing segment consisting of linked nucleosides; and
    • a 3′ wing segment consisting of linked nucleosides;

wherein the gap segment is positioned between the 5′ wing segment and the 3′ wing segment and wherein each nucleoside of each wing segment comprises a modified sugar. In certain embodiments, the modified oligonucleotide is 16 to 50 linked nucleosides in length having a nucleobase sequence comprising the sequence recited in anyone of SEQ ID NOs: 2879, 3056, 2123, 2189, 2453, 2160, or 2232 or a sequence having at least 70% identity with any one of SEQ ID NOs: 2879, 3056, 2123, 2189, 2453, 2160, or 2232. In certain embodiments, the modified oligonucleotide is 16 to 50 linked nucleosides in length having a nucleobase sequence comprising the sequence recited in SEQ ID NO: 2879 or a sequence having at least 70% identity with SEQ ID NO: 2879. In certain embodiments, the modified oligonucleotide is 10 to 30 linked nucleosides in length having a nucleobase sequence comprising the sequence recited in any one of SEQ ID NOs: 2879, 3056, 2123, 2189, 2453, 2160, or 2232 or a sequence having at least 70% identity with any one of SEQ ID NOs: 2879, 3056, 2123, 2189, 2453, 2160, or 2232. In certain embodiments, the modified oligonucleotide is 10 to 30 linked nucleosides in length having a nucleobase sequence comprising the sequence recited in SEQ ID NO: 2879 or a sequence having at least 70% identity with SEQ ID NO: 2879. In certain embodiments, the modified oligonucleotide is 16 linked nucleosides in length having a nucleobase sequence consisting of the sequence recited in any one of SEQ ID NOs: 2879, 3056, 2123, 2189, 2453, 2160, or 2232 or a sequence having at least 70% identity with any one of SEQ ID NOs: 2879, 3056, 2123, 2189, 2453, 2160, or 2232. In certain embodiments, the modified oligonucleotide is 16 linked nucleosides in length having a nucleobase sequence consisting of the sequence recited in SEQ ID NO: 2879 or a sequence having at least 70% identity with SEQ ID NO: 2879.

In certain embodiments, a compound comprises or consists of a modified oligonucleotide 20-50 linked nucleobases in length having a nucleobase sequence comprising the sequence recited in any one of SEQ ID NOs: 2879, 3056, 2123, 2189, 2453, 2160, or 2232 or a sequence having at least 70% identity with any one of SEQ ID NOs: 2879, 3056, 2123, 2189, 2453, 2160, or 2232, wherein the modified oligonucleotide comprises

a gap segment consisting often linked 2′-deoxynucleosides;

a 5′ wing segment consisting of three linked nucleosides; and

a 3′ wing segment consisting of three linked nucleosides;

wherein the gap segment is positioned between the 5′ wing segment and the 3′ wing segment; wherein the nucleosides of the 5′ wing segment each comprise a cEt bicyclic sugar; wherein the nucleosides of the 3′ wing segment each comprises a cEt bicyclic sugar; wherein each internucleoside linkage is a phosphorothioate linkage; and wherein each cytosine is a 5-methylcytosine. In certain embodiments, the modified oligonucleotide is 16-80 linked nucleosides in length. In certain embodiments, the modified oligonucleotide is 16-30 linked nucleosides in length. In certain embodiments, the modified oligonucleotide is 16 linked nucleosides in length.

In certain embodiments, a compound comprises or consists of a modified oligonucleotide according to one of the following formulas:

(SEQ ID NO: 2879)
Gks Tks Tks Tds Ads Tds Tds Ads Tds Ads Gds Gds
Gds mCks Tks Tk;
(SEQ ID NO: 3056)
Gks Gks Aks Tds Tds Tds Tds Ads Gds Gds Ads Gds
Gds Tks Gks Ak;
(SEQ ID NO: 2123)
Gks mCks Aks Tds Ads Gds Ads mCds Ads Ads Ads Tds
mCds mCks mCks Ak;
(SEQ ID NO: 2189)
Gks mCks Aks Ads Ads Tds Ads Tds Gds Ads Tds Tds
mCds Aks Tks mCk;
(SEQ ID NO: 2453)
Gks Gks Tks mCds Ads Tds Tds Ads Ads Ads Gds Ads
Tds Tks mCks Tk;
(SEQ ID NO: 2160)
Aks Tks Gks Tds Ads Tds Tds Ads mCds mCds Tds Ads
mCds Gks Gks mCk;
or
(SEQ ID NO: 2232)
Gks Tks Aks mCds Ads Ads Tds Gds Tds Ads Ads Gds
mCds mCks Tks Tk

wherein A=an adenine, mC=a 5-methylcytosine, G=a guanine, T=a thymine, k=a cEt sugar moiety, d=a 2′-deoxyribosyl sugar moiety, and s=a phosphorothioate internucleoside linkage.

In certain embodiments, a compound comprises or consists of compound 951799, or salt thereof, a modified oligonucleotide having the following chemical structure:

In certain embodiments, a compound comprises or consists of the sodium salt of compound 951799 having the following chemical structure:

In any of the foregoing embodiments, the compound or oligonucleotide can be at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% complementary to a nucleic acid encoding DNM2.

In any of the foregoing embodiments, the compound can be single-stranded. In certain embodiments, the compound comprises 2′-deoxyribonucleosides. In certain embodiments, the compound is double-stranded. In certain embodiments, the compound is double-stranded and comprises ribonucleosides. In any of the foregoing embodiments, the compound can be an antisense compound or oligomeric compound.

In any of the foregoing embodiments, the compound can be 8 to 80, 10 to 30, 12 to 50, 13 to 30, 13 to 50, 14 to 30, 14 to 50, 15 to 30, 15 to 50, 16 to 30, 16 to 50, 17 to 30, 17 to 50, 18 to 22, 18 to 24, 18 to 30, 18 to 50, 19 to 22, 19 to 30, 19 to 50, or 20 to 30 linked nucleosides in length. In certain embodiments, the compound comprises or consists of an oligonucleotide.

The present invention thus relates to a modified oligonucleotide or compounds comprising modified oligonucleotides complementary to a DNM2 nucleic acid as described hereinabove.

In certain embodiments, a compound comprises a modified oligonucleotide described herein and a conjugate group. In certain embodiments, the conjugate group is linked to the modified oligonucleotide at the 5′ end of the modified oligonucleotide. In certain embodiments, the conjugate group is linked to the modified oligonucleotide at the 3′ end of the modified oligonucleotide.

In certain embodiments, compounds or compositions provided herein comprise a salt of the modified oligonucleotide. In certain embodiments, the salt is a sodium salt. In certain embodiments, the salt is a potassium salt.

In certain embodiments, the compounds or compositions as described herein are active by virtue of having at least one of an in vitro IC50 of less than 300 nM, 200 nM, 100 nM, 80 nM, 50 nM, or 30 nM in a standard cell assay. Standard cell assays are described in the Examples.

In certain embodiments, the compounds or compositions as described herein are highly tolerable as demonstrated by having at least one of an increase an alanine transaminase (ALT) or aspartate transaminase (AST) value of no more than 4 fold, 3 fold, 2 fold, or 1.5 fold over saline treated animals or an increase in liver, spleen, or kidney weight of no more than 30%, 20%, 15%, 12%, 10%, 5%, or 2% compared to control treated animals. In certain embodiments, the compounds or compositions as described herein are highly tolerable as demonstrated by having no increase of ALT or AST over control treated animals. In certain embodiments, the compounds or compositions as described herein are highly tolerable as demonstrated by having no increase in liver, spleen, or kidney weight over control animals.

Certain embodiments provide a composition comprising or consisting essentially of the compound of any of the aforementioned embodiments or salt thereof.

Certain embodiments provide a composition comprising or consisting essentially of the compound of any of the aforementioned embodiments or salt thereof and at least one of a pharmaceutically acceptable carrier or diluent. Therefore, in one embodiment, the composition of the invention is a pharmaceutical composition.

Certain embodiments provide a medicament comprising or consisting essentially of the compound of any of the aforementioned embodiments or salt thereof. Therefore, in one embodiment, the composition of the invention is a medicament.

As used herein, the term “consists essentially of”, with reference to a composition, pharmaceutical composition or medicament, means that the compound of the invention is the only active ingredient, therapeutic agent or agent with a biologic activity within said pharmaceutical composition or medicament.

In certain embodiments, the composition has a viscosity less than about 40 centipoise (cP), less than about 30 cP, less than about 20 cP, less than about 15 cP, less than about 10 cP, less than about 5 cP, or less than about 3 cP, or less than about 1.5 cP. In certain embodiments, the composition having any of the aforementioned viscosities comprises a compound provided herein at a concentration of about 15 mg/mL, 20 mg/mL, 25 mg/mL, 50 mg/mL, 100 mg/mL, 150 mg/mL, or about 200 mg/mL. In certain embodiments, the composition having any of the aforementioned viscosities and/or compound concentrations has a temperature of room temperature or about 20° C., about 21° C., about 22° C., about 23° C., about 24° C., about 25° C., about 26° C., about 27° C., about 28° C., about 29° C., or about 30° C.

Embodiment 1. A compound comprising a modified oligonucleotide 8 to 50 linked nucleosides in length having a nucleobase sequence comprising at least 8 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 7-3134.

Embodiment 2. A compound comprising a modified oligonucleotide 9 to 50 linked nucleosides in length having a nucleobase sequence comprising at least 9 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 7-3134.

Embodiment 3. A compound comprising a modified oligonucleotide 10 to 50 linked nucleosides in length having a nucleobase sequence comprising at least 10 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 7-3134.

Embodiment 4. A compound comprising a modified oligonucleotide 11 to 50 linked nucleosides in length having a nucleobase sequence comprising at least 11 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 7-3134.

Embodiment 5. A compound comprising a modified oligonucleotide 12 to 50 linked nucleosides in length having a nucleobase sequence comprising at least 12, at least 13, at least 14, or at least 15 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 7-3134.

Embodiment 6. A compound comprising a modified oligonucleotide 16 to 50 linked nucleosides in length having a nucleobase sequence comprising the nucleobase sequence of any of SEQ ID NOs: 7-3134.

Embodiment 7. A compound comprising a modified oligonucleotide having a nucleobase sequence consisting of any one of SEQ ID NOs: 7-3134.

Embodiment 8. A compound comprising a modified oligonucleotide 8 to 50 linked nucleosides in length complementary within nucleobases 3,404-44,737; 83,573-87,287; 87,359-90,915; 90,968-97,263; 97,378-104,979; 81,061-81,199; or 116,048-116,903 of SEQ ID NO: 1, wherein said modified oligonucleotide is at least 85%, 90%, 95%, or 100% complementary to SEQ ID NO: 1.

Embodiment 9. A compound comprising a modified oligonucleotide 8 to 50 linked nucleosides in length having a nucleobase sequence comprising a portion of at least 8 contiguous nucleobases 100% complementary to an equal length portion of nucleobases 3,404-44,737; 83,573-87,287; 87,359-90,915; 90,968-97,263; 97,378-104,979; 81,061-81,199; or 116,048-116,903 of SEQ ID NO: 1, wherein the nucleobase sequence of the modified oligonucleotide is at least 85%, 90%, 95%, or 100% complementary to SEQ ID NO: 1.

Embodiment 10. A compound comprising a modified oligonucleotide 8 to 50 linked nucleosides in length complementary within nucleobases 83,573-87,287 or 87,359-90,915 of SEQ ID NO: 1, wherein said modified oligonucleotide is at least 85%, 90%, 95%, or 100% complementary to SEQ ID NO: 1.

Embodiment 11. A compound comprising a modified oligonucleotide complementary to intron 1 of a human DNM2 pre-mRNA.

Embodiment 12. A compound comprising a modified oligonucleotide complementary to intron 11 of a human DNM2 pre-mRNA.

Embodiment 13. A compound comprising a modified oligonucleotide complementary to intron 12 of a human DNM2 pre-mRNA.

Embodiment 14. A compound comprising a modified oligonucleotide complementary to intron 13 of a human DNM2 pre-mRNA.

Embodiment 15. A compound comprising a modified oligonucleotide complementary to intron 14 of a human DNM2 pre-mRNA.

Embodiment 16. A compound comprising a modified oligonucleotide complementary to exon 10 of a human DNM2 pre-mRNA or human DNM2 mRNA.

Embodiment 17. A compound comprising a modified oligonucleotide complementary to the 3′-UTR of a human DNM2 pre-mRNA or human DNM2 mRNA.

Embodiment 18. A compound comprising a modified oligonucleotide 16 to 50 linked nucleosides in length having a nucleobase sequence comprising any of SEQ ID NOs: 2879, 3056, 2123, 2189, 2453, 2160, or 2232.

Embodiment 19. A compound comprising a modified oligonucleotide having a nucleobase sequence consisting of any one of SEQ ID NOs: 2879, 3056, 2123, 2189, 2453, 2160, or 2232.

Embodiment 20. A compound comprising a modified oligonucleotide having a nucleobase sequence comprising SEQ ID NO: 2879.

Embodiment 21. A compound comprising a modified oligonucleotide 16 to 50 linked nucleosides in length having a nucleobase sequence comprising any of SEQ ID NOs: 2879, 3056, 2123, 2189, 2453, 2160, or 2232, wherein the modified oligonucleotide comprises: a gap segment consisting of 8-12 linked 2′-deoxynucleosides; a 5′ wing segment consisting of 1-7 linked nucleosides; and a 3′ wing segment consisting of 1-7 linked nucleosides; wherein the gap segment is positioned between the 5′ wing segment and the 3′ wing segment and wherein each terminal wing nucleoside comprises a modified sugar.

Embodiment 22. A compound comprising a modified oligonucleotide 16 linked nucleosides in length having a nucleobase sequence consisting of the sequence recited in SEQ ID NO: 2879, 3056, 2123, 2189, 2453, 2160, or 2232, wherein the modified oligonucleotide comprises

    • a gap segment consisting of 10 linked 2′-deoxynucleosides;
    • a 5′ wing segment consisting of 3 linked nucleosides; and
    • a 3′ wing segment consisting of 3 linked nucleosides;
    • wherein the gap segment is positioned between the 5′ wing segment and the 3′ wing segment; wherein each nucleoside of each wing segment comprises a cEt sugar moiety; wherein each internucleoside linkage is a phosphorothioate linkage; and wherein each cytosine is a 5-methylcytosine.

Embodiment 23. The compound of any one of embodiments 1-22, wherein the oligonucleotide is at least 80%, 85%, 90%, 95% or 100% complementary to any of SEQ ID NO: 1, 2, 3, or 3135.

Embodiment 24. The compound of any one of embodiments 1-23, wherein the modified oligonucleotide comprises at least one modified internucleoside linkage.

Embodiment 25. The compound of embodiments 24, wherein the at least one modified internucleoside linkage is a phosphorothioate internucleoside linkage.

Embodiment 26. The compound of any one of embodiments 1-21 or 23-25, wherein the modified oligonucleotide comprises at least one bicyclic sugar.

Embodiment 27. The compound of Embodiments 26, wherein the at least one bicyclic sugar is selected from the group consisting of LNA, ENA, and cEt.

Embodiment 28. The compound of embodiment 27, wherein the at least one bicyclic sugar moiety is a cEt sugar moiety.

Embodiment 29. The compound of any one of embodiments 1-28, wherein the modified oligonucleotide comprises at least one 5-methylcytosine.

Embodiment 30. The compound of any one of embodiments 1-29, wherein the modified oligonucleotide comprises:

a gap segment consisting of linked 2′-deoxynucleosides;

a 5′ wing segment consisting of linked nucleosides; and

a 3′ wing segment consisting of linked nucleosides;

wherein the gap segment is positioned immediately adjacent to and between the 5′ wing segment and the 3′ wing segment and wherein each nucleoside of each wing segment comprises a modified sugar moiety.

Embodiment 31. The compound of any one of embodiments 1-30, wherein the compound is single-stranded.

Embodiment 32. The compound of any one of embodiments 1-30, wherein the compound is double-stranded.

Embodiment 33. The compound of any one of embodiments 1-32, wherein the compound comprises at least one unmodified ribosyl sugar moiety.

Embodiment 34. The compound of any one of embodiments 1-33, wherein the compound comprises at least one unmodified 2′-deoxyribosyl sugar moiety.

Embodiment 35. The compound of any one of embodiments 1-34, wherein the modified oligonucleotide consists of 10 to 30 linked nucleosides.

Embodiment 36. The compound of any one of embodiments 1-34, wherein the modified oligonucleotide consists of 12 to 30 linked nucleosides.

Embodiment 37. The compound of any one of embodiments 1-34, wherein the modified oligonucleotide consists of 15 to 30 linked nucleosides.

Embodiment 38. The compound of any one of embodiments 1-34, wherein the modified oligonucleotide consists of 16 to 20 linked nucleosides.

Embodiment 39. A compound comprising a modified oligonucleotide according to the following formula: Gks Tks Tks Tds Ads Tds Tds Ads Tds Ads Gds Gds Gds mCks Tks Tk; wherein,

    • A=an adenine,
    • mC=a 5-methylcytosine
    • G=a guanine,
    • T=a thymine,
    • k=a cEt sugar moiety,
    • d=a 2′-deoxyribosyl sugar moiety, and
    • s=a phosphorothioate internucleoside linkage.

Embodiment 40. The compound of any one of embodiments 1-39 comprising a conjugate group.

Embodiment 41. The compound of embodiment 40, wherein the compound consists of the modified oligonucleotide and the conjugate group.

Embodiment 42. A compound according to the following formula:

Embodiment 43. The compound of any one of embodiments 1-39 or 42, wherein the compound

consists of the

modified oligonucleotide.

Embodiment 44. A compound consisting of a pharmaceutically acceptable salt form of any one of the compounds of embodiments 1-43.

Embodiment 45. The compound of embodiment 44, wherein the pharmaceutically acceptable salt is a sodium salt.

Embodiment 46. The compound of embodiment 44, wherein the pharmaceutically acceptable salt is a potassium salt.

Embodiment 47. A pharmaceutical composition comprising the compound of any one of embodiments 1-44 and at least one pharmaceutically acceptable carrier or diluent.

Embodiment 48. A chirally enriched population of the compounds of any one of embodiments 1-46, wherein the population is enriched for modified oligonucleotides comprising at least one particular phosphorothioate internucleoside linkage having a particular stereochemical configuration.

Embodiment 49. The chirally enriched population of embodiment 48, wherein the population is enriched for modified oligonucleotides comprising at least one particular phosphorothioate internucleoside linkage having the (Sp) configuration.

Embodiment 50. The chirally enriched population of embodiment 48, wherein the population is enriched for modified oligonucleotides comprising at least one particular phosphorothioate internucleoside linkage having the (Rp) configuration.

Embodiment 51. The chirally enriched population of embodiment 48, wherein the population is enriched for modified oligonucleotides having a particular, independently selected stereochemical configuration at each phosphorothioate internucleoside linkage

Embodiment 52. The chirally enriched population of embodiment 51, wherein the population is enriched for modified oligonucleotides having the (Sp) configuration at each phosphorothioate internucleoside linkage.

Embodiment 53. The chirally enriched population of embodiment 51, wherein the population is enriched for modified oligonucleotides having the (Rp) configuration at each phosphorothioate internucleoside linkage.

Embodiment 54. The chirally enriched population of embodiment 51, wherein the population is enriched for modified oligonucleotides having the (Rp) configuration at one particular phosphorothioate internucleoside linkage and the (Sp) configuration at each of the remaining phosphorothioate internucleoside linkages.

Embodiment 55. The chirally enriched population of embodiment 48 or embodiment 51, wherein the population is enriched for modified oligonucleotides having at least 3 contiguous phosphorothioate internucleoside linkages in the Sp, Sp, and Rp configurations, in the 5′ to 3′ direction.

Embodiment 56. A chirally enriched population of the compounds of any one of embodiments 1-46, wherein all of the phosphorothioate internucleoside linkages of the modified oligonucleotide are stereorandom.

Embodiment 57. A pharmaceutical composition comprising the population of compounds of any one of embodiments 48-56 and at least one pharmaceutically acceptable diluent or carrier.

Embodiment 58. The compound of any one of embodiments 1-46, a pharmaceutical composition comprising the compound of any one of embodiments 1-46 and at least one pharmaceutically acceptable carrier or diluent, or a pharmaceutical composition comprising the population of compounds of any one of embodiments 48-56 and at least one pharmaceutically acceptable carrier or diluent, for use in therapy.

Embodiment 59. The compound or composition of embodiment 58, for use in treating, preventing, or ameliorating centronuclear myopathy, Duchenne Muscular Dystrophy, or Charcot-Marie Tooth disease.

Embodiment 60. A method of treating, preventing, or ameliorating a disease associated with DNM2 in an individual comprising administering to the individual any of the compounds or compositions of embodiment 1-59, thereby treating, preventing, or ameliorating the disease.

Embodiment 61. A method of treating, preventing, or ameliorating a disease associated with DNM2 in an individual comprising administering to the individual a compound comprising a modified oligonucleotide 100% complementary to an exon 10, an intron, or the 3′-UTR of a DNM2 nucleic acid transcript, thereby treating, preventing, or ameliorating the disease.

Embodiment 62. The method of embodiment 60 or 61, wherein the disease is centronuclear myopathy, Duchenne Muscular Dystrophy, or Charcot-Marie Tooth disease.

Embodiment 63. The method of any one of embodiments 60-62, wherein the compound is single-stranded.

Embodiment 64. The method of any one of embodiments 60-63, wherein the DNM2 nucleic acid transcript is a pre-mRNA.

Embodiment 65. The method of any one of embodiments 60-64, wherein the disease is X-linked myotubular myopathy, autosomal recessive centronuclear myopathy, or autosomal dominant centronuclear myopathy.

Embodiment 66. The method of embodiment 65, wherein the individual has at least one mutation in at least one gene selected from among MTM1, BIN1, and DNM2.

Embodiment 67. The method of any one of embodiments 60-66, wherein the administering increases body weight or muscle strength.

Embodiment 68. A method of inhibiting expression of DNM2 in a cell comprising contacting the cell with a single-stranded compound comprising a modified oligonucleotide 100% complementary to exon 10, an intron, or the 3′-UTR of a DNM2 nucleic acid transcript, thereby inhibiting expression of DNM2 in the cell.

Embodiment 69. The method of embodiment 68, wherein the cell is in the muscle of an individual.

Embodiment 70. The method of embodiment 69, wherein the individual has, or is at risk of having, a centronuclear myopathy, Duchenne Muscular Dystrophy, or Charcot-Marie Tooth disease.

Embodiment 71. A method of increasing body weight or muscle strength in an individual having, or at risk of having, a disease associated with DNM2 comprising administering a single-stranded compound comprising a modified oligonucleotide 100% complementary to a DNM2 nucleic acid transcript to the individual, thereby increasing body weight or muscle strength in the individual.

Embodiment 72. The method of embodiment 71, wherein the individual has, or is at risk of having, centronuclear myopathy, Duchenne Muscular Dystrophy, or Charcot-Marie Tooth disease.

Embodiment 73. The method of any one of embodiments 60-72, wherein the compound is the compound of any one of embodiments 1-46.

Embodiment 74. The method of any one of embodiments 60-72, wherein the compound is a member of the chirally enriched population of any one of embodiments 48-56.

Embodiment 75. The method of any one of embodiments 60-72, wherein the compound is a component of the pharmaceutical composition of embodiment 57.

Embodiment 76. The method any one of embodiments 60-67 or 69-75, wherein the compound is administered to the individual via subcutaneous injection.

Embodiment 77. The method any one of embodiments 60-67 or 69-75, wherein the compound is administered to the individual via intramuscular injection.

Embodiment 78. The method of any one of embodiments 60-67 or 69-77, wherein the compound is administered to the individual via intravenous injection.

Embodiment 79. Use of a single-stranded compound comprising a modified oligonucleotide 100% complementary to exon 10, intron 1, intron 11, intron, 12, intron 13, intron 14, or the 3′-UTR of a DNM2 nucleic acid transcript for treating, preventing, or ameliorating a disease associated with DNM2.

Embodiment 80. The use of embodiment 79, wherein the disease is centronuclear myopathy, Duchenne Muscular Dystrophy, or Charcot-Marie Tooth disease.

Embodiment 81. Use of the compound of any one of embodiments 1-46 or the composition of embodiment 57 for treating, preventing, or ameliorating a disease associated with DNM2.

Embodiment 82. Use of the compound of any one of embodiments 1-46 or the composition of embodiment 57 in the manufacture of a medicament for treating, preventing, or ameliorating a disease associated with DNM2.

Embodiment 83. The use of embodiment 81 or 82, wherein the disease is centronuclear myopathy, Duchenne Muscular Dystrophy, or Charcot-Marie Tooth disease.

Embodiment 84. The use of embodiment 80 or 83, wherein the disease is X-linked myotubular myopathy, autosomal recessive centronuclear myopathy, or autosomal dominant centronuclear myopathy.

Embodiment 85. The use of embodiment 84, wherein the disease is associated with a mutation in at least one gene selected from among MTM1, BIN1, and DNM2.

Embodiment 86. Use of the compound of any one of embodiments 1-46 or the composition of embodiment 57 in the preparation of a medicament for treating, preventing, or ameliorating a disease associated with DNM2.

Embodiment 87. The use of embodiment 86, wherein the disease is centronuclear myopathy, Duchenne Muscular Dystrophy, or Charcot-Marie Tooth disease.

Embodiment 88. The use of embodiment 87, wherein the disease is X-linked myotubular myopathy, autosomal recessive centronuclear myopathy, or autosomal dominant centronuclear myopathy.

Embodiment 89. The use of embodiment 88, wherein the disease is associated with a mutation in at least one gene selected from among MTM1, BIN1, and DNM2.

Certain Indications

Certain embodiments provided herein relate to methods of inhibiting DNM2 expression, which can be useful for treating, preventing, or ameliorating a disease associated with DNM2 in an individual, by administration of a compound that targets DNM2, such as the compound described herein. In certain diseases associated with DNM2, modest or partial inhibition of DNM2 expression is sufficient to treat, prevent, or ameliorate the disease (See, e.g., Cowling et al. J Clin. Invest. 124, 1350-1363 (2014) and Tasfaout et al. Nat. Commun. June 7; 8:15661 (2017).) In certain embodiments, the compound can be an antisense compound, oligomeric compound, or oligonucleotide complementary to DNM2, such as the ones described herein.

Examples of diseases associated with DNM2 that are treatable, preventable, and/or ameliorable with the methods provided herein include centronuclear myopathy (CNM), Charcot-Marie-Tooth disease (CMT), and Duchenne's Muscular Dystrophy (DMD). Centronuclear myopathy includes X-linked CNM (XLCNM), autosomal dominant CNM (ADCNM) and autosomal recessive CNM (ARCNM). Mutations in several genes are associated with CNM, including mutations in MTM1, BIN1, and DNM2. Other genes have been linked to a CNM-like myopathy: RYR1 encoding for the ryanodine receptor, TTN encoding Titin, CCDC78 (OMIM 614807) and the phosphoinositides phosphatase MTMR14 (called hJUMPY; OMIM 160150).

In certain embodiments, a method of treating, preventing, or ameliorating a disease associated with DNM2 in an individual comprises administering to the individual a compound comprising an antisense compound targeted to DNM2, thereby treating, preventing, or ameliorating the disease. In certain embodiments, the compound comprises an oligonucleotide complementary to a DNM2 nucleic acid transcript. In certain embodiments, the compound is a compound as described herein. In certain embodiments, the compound comprises or consists of a modified oligonucleotide complementary to intron 1, intron 11, intron 12, intron 13, intron 14, exon 10, or the 3′-UTR of a DNM2 nucleic acid transcript. In certain embodiments, the modified oligonucleotide is complementary to a sequence within nucleotides 3,404-44,737; 83,573-87,287; 87,359-90,915; 90,968-97,263; 97,378-104,979; 81,061-81,199; or 116,048-116,903 of SEQ ID NO: 1. In certain embodiments, the compound comprises or consists of a modified oligonucleotide complementary to intron 1, intron 11, intron 12, intron 13, or intron 14 of a DNM2 nucleic acid transcript. In certain embodiments, the modified oligonucleotide is complementary to a sequence within nucleotides 3,404-44,737; 83,573-87,287; 87,359-90,915; 90,968-97,263; or 97,378-104,979 of SEQ ID NO: 1. In certain embodiments, the compound comprises a modified oligonucleotide 8 to 50 linked nucleosides in length and having a nucleobase sequence comprising at least 8 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 7-3134. In certain embodiments, the compound comprises a modified oligonucleotide 12 to 50 linked nucleosides in length and having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 7-3134. In certain embodiments, the compound comprises a modified oligonucleotide consisting of the nucleobase sequence of any one of SEQ ID NOs: 7-3134. In certain embodiments, the compound comprises a modified oligonucleotide 16 to 50 linked nucleosides in length having a nucleobase sequence comprising any one of SEQ ID NOs: 2879, 3056, 2123, 2189, 2453, 2160, or 2232. In certain embodiments, the compound comprises a modified oligonucleotide having a nucleobase sequence consisting of any one of SEQ ID NOs: 2879, 3056, 2123, 2189, 2453, 2160, or 2232. In any of the foregoing embodiments, the modified oligonucleotide can be 10 to 30 linked nucleosides in length. In certain embodiments, the compound is compound number 951799, 949935, 950023, 950089, 951372, 950060, or 950132. In any of the foregoing embodiments, the compound can be single-stranded or double-stranded. In any of the foregoing embodiments, the compound can be an antisense compound or oligomeric compound. In certain embodiments, the compound is administered to the individual subcutaneously, intradermally, intranodally, intramedullary, intramuscularly, intrasternally, by intravenous (i.v.) injection, by infusion techniques or intraperitoneally. In certain embodiments, the compound is administered to the individual via subcutaneous injection. In certain embodiments, administering the compound increases or preserves body weight or muscle strength.

In certain embodiments, a method of treating, preventing, or ameliorating CNM, DMD, or CMT comprises administering to the individual a compound comprising a modified oligonucleotide complementary to a DNM2 nucleic acid, thereby treating, preventing, or ameliorating CNM, DMD, or CMT. In certain embodiments, the compound is a compound as described herein. In certain embodiments, the compound is an antisense compound targeted to DNM2. In certain embodiments, the compound comprises or consists of a modified oligonucleotide complementary to intron 1, intron 11, intron 12, intron 13, intron 14, exon 10, or the 3′-UTR of a DNM2 nucleic acid transcript. In certain embodiments, the modified oligonucleotide is complementary to a sequence within nucleotides 3,404-44,737; 83,573-87,287; 87,359-90,915; 90,968-97,263; 97,378-104,979; 81,061-81,199; or 116,048-116,903 of SEQ ID NO: 1. In certain embodiments, the compound comprises or consists of a modified oligonucleotide complementary to intron 1, intron 11, intron 12, intron 13, or intron 14 of a DNM2 nucleic acid transcript. In certain embodiments, the modified oligonucleotide is complementary to a sequence within nucleotides 3,404-44,737; 83,573-87,287; 87,359-90,915; 90,968-97,263; or 97,378-104,979 of SEQ ID NO: 1. In certain embodiments, the compound comprises a modified oligonucleotide 8 to 50 linked nucleosides in length and having a nucleobase sequence comprising at least 8 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 7-3134. In certain embodiments, the compound comprises a modified oligonucleotide 12 to 50 linked nucleosides in length and having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 7-3134. In certain embodiments, the compound comprises a modified oligonucleotide consisting of the nucleobase sequence of any one of SEQ ID NOs: 7-3134. In certain embodiments, the compound comprises a modified oligonucleotide 16 to 50 linked nucleosides in length having a nucleobase sequence comprising any one of SEQ ID NOs: 2879, 3056, 2123, 2189, 2453, 2160, or 2232. In certain embodiments, the compound comprises a modified oligonucleotide having a nucleobase sequence consisting of any one of SEQ ID NOs: 2879, 3056, 2123, 2189, 2453, 2160, or 2232. In any of the foregoing embodiments, the modified oligonucleotide can be 10 to 30 linked nucleosides in length. In certain embodiments, the compound is compound number 951799, 949935, 950023, 950089, 951372, 950060, or 950132. In any of the foregoing embodiments, the compound can be single-stranded or double-stranded. In any of the foregoing embodiments, the compound can be an antisense compound or oligomeric compound. In certain embodiments, the compound is administered to the individual subcutaneously, intradermally, intratumorally, intranodally, intramedullary, intramuscularly, intrasternally, by intravenous (i.v.) injection, by infusion techniques or intraperitoneally. In certain embodiments, the compound is administered to the individual systemically, e.g., via subcutaneous or intramuscular injection. In certain embodiments, administering the compound increases or preserves body weight or muscle strength. In certain such embodiments, time taken to rise from the floor, nine-meter walking time, or time taken to climb four stairs is decreased. In certain embodiments, ability to lift weight, distance of a 6 minute walk, or leg function grade is increased. In certain embodiments, pulmonary function or cardiac function is improved. In certain embodiments, the individual is identified as having or at risk of having a disease associated with DNM2. Examples of factors of risk of having a disease associated with DNM2 include, but are not limited to, genetic predisposition, such as, for example, a mutation in at least one gene selected from among MTM1, BIN1, and DNM2.

In certain embodiments, a method of inhibiting expression of DNM2 in an individual having, or at risk of having, a disease associated with DNM2 comprises administering to the individual a compound comprising a modified oligonucleotide complementary to a DNM2 nucleic acid, thereby inhibiting expression of DNM2 in the individual. In certain embodiments, administering the compound inhibits expression of DNM2 in skeletal muscle. In certain embodiments, the individual has, or is at risk of having CNM, DMD, or CMT. In certain embodiments, the compound comprises an antisense compound targeted to DNM2. In certain embodiments, the antisense compound comprises an oligonucleotide complementary to a DNM2 nucleic acid transcript. In certain embodiments, the compound is a compound as described herein. In certain embodiments, the compound comprises or consists of a modified oligonucleotide complementary to intron 1, intron 11, intron 12, intron 13, intron 14, exon 10, or the 3′-UTR of a DNM2 nucleic acid transcript. In certain embodiments, the modified oligonucleotide is complementary to a sequence within nucleotides 3,404-44,737; 83,573-87,287; 87,359-90,915; 90,968-97,263; 97,378-104,979; 81,061-81,199; or 116,048-116,903 of SEQ ID NO: 1. In certain embodiments, the compound comprises or consists of a modified oligonucleotide complementary to intron 1, intron 11, intron 12, intron 13, or intron 14 of a DNM2 nucleic acid transcript. In certain embodiments, the modified oligonucleotide is complementary to a sequence within nucleotides 3,404-44,737; 83,573-87,287; 87,359-90,915; 90,968-97,263; or 97,378-104,979 of SEQ ID NO: 1. In certain embodiments, the compound comprises a modified oligonucleotide 8 to 50 linked nucleosides in length and having a nucleobase sequence comprising at least 8 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 7-3134. In certain embodiments, the compound comprises a modified oligonucleotide 12 to 50 linked nucleosides in length and having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 7-3134. In certain embodiments, the compound comprises a modified oligonucleotide consisting of the nucleobase sequence of any one of SEQ ID NOs: 7-3134. In certain embodiments, the compound comprises a modified oligonucleotide 16 to 50 linked nucleosides in length having a nucleobase sequence comprising any one of SEQ ID NOs: 2879, 3056, 2123, 2189, 2453, 2160, or 2232. In certain embodiments, the compound comprises a modified oligonucleotide having a nucleobase sequence consisting of any one of SEQ ID NOs: 2879, 3056, 2123, 2189, 2453, 2160, or 2232. In any of the foregoing embodiments, the modified oligonucleotide can be 10 to 30 linked nucleosides in length. In certain embodiments, the compound is compound number 951799, 949935, 950023, 950089, 951372, 950060, or 950132. In any of the foregoing embodiments, the compound can be single-stranded or double-stranded. In any of the foregoing embodiments, the compound can be an antisense compound or oligomeric compound. In certain embodiments, the compound is administered to the individual subcutaneously, intradermally, intranodally, intramedullary, intramuscularly, intrasternally, by intravenous (i.v.) injection, by infusion techniques or intraperitoneally. In certain embodiments, the compound is administered to the individual systemically, e.g., via subcutaneous or intramuscular injection. In certain embodiments, administering the compound increases or preserves body weight or muscle strength. In certain embodiments, the individual is identified as having or at risk of having a disease associated with DNM2.

In certain embodiments, a method of inhibiting expression of DNM2 in a cell comprises contacting the cell with a compound comprising an antisense compound targeted to DNM2, thereby inhibiting expression of DNM2 in the cell. In one embodiment, the expression of DNM2 is inhibited by at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, or at least about 90%. In one embodiment, the expression of DNM2 is inhibited by at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% as compared to an untreated or control sample. In one embodiment, the method is an in vitro method. In certain embodiments, the cell is a muscle cell. In certain embodiments, the cell is a skeletal muscle cell. In certain embodiments, the muscle cell is in an individual who has, or is at risk of having CNM, DMD, or CMT. In certain embodiments, the compound comprises an oligonucleotide complementary to a DNM2 nucleic acid transcript. In certain embodiments, the compound is a compound as described herein. In certain embodiments, the compound comprises or consists of a modified oligonucleotide complementary to intron 1, intron 11, intron 12, intron 13, intron 14, exon 10, or the 3′-UTR of a DNM2 nucleic acid transcript. In certain embodiments, the modified oligonucleotide is complementary to a sequence within nucleotides 3,404-44,737; 83,573-87,287; 87,359-90,915; 90,968-97,263; 97,378-104,979; 81,061-81,199; or 116,048-116,903 of SEQ ID NO: 1. In certain embodiments, the compound comprises or consists of a modified oligonucleotide complementary to intron 1, intron 11, intron 12, intron 13, or intron 14 of a DNM2 nucleic acid transcript. In certain embodiments, the modified oligonucleotide is complementary to a sequence within nucleotides 3,404-44,737; 83,573-87,287; 87,359-90,915; 90,968-97,263; or 97,378-104,979 of SEQ ID NO: 1. In certain embodiments, the compound comprises a modified oligonucleotide 8 to 50 linked nucleosides in length and having a nucleobase sequence comprising at least 8 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 7-3134. In certain embodiments, the compound comprises a modified oligonucleotide 12 to 50 linked nucleosides in length and having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 7-3134. In certain embodiments, the compound comprises a modified oligonucleotide consisting of the nucleobase sequence of any one of SEQ ID NOs: 7-3134. In certain embodiments, the compound comprises a modified oligonucleotide 16 to 50 linked nucleosides in length having a nucleobase sequence comprising any one of SEQ ID NOs: 2879, 3056, 2123, 2189, 2453, 2160, or 2232. In certain embodiments, the compound comprises a modified oligonucleotide having a nucleobase sequence consisting of any one of SEQ ID NOs: 2879, 3056, 2123, 2189, 2453, 2160, or 2232. In any of the foregoing embodiments, the modified oligonucleotide can be 10 to 30 linked nucleosides in length. In certain embodiments, the compound is compound number 951799, 949935, 950023, 950089, 951372, 950060, or 950132. In any of the foregoing embodiments, the compound can be single-stranded or double-stranded. In any of the foregoing embodiments, the compound can be an antisense compound or oligomeric compound.

In certain embodiments, a method of increasing or preserving body weight or muscle strength of an individual having, or at risk of having, a disease associated with DNM2 comprises administering to the individual a compound comprising an antisense compound targeted to DNM2, increasing or preserving body weight or muscle strength of the individual. In certain such embodiments, time taken to rise from the floor, nine-meter walking time, or time taken to climb four stairs is decreased. In certain embodiments, ability to lift weight, distance of a 6 minute walk, or leg function grade is increased. In certain embodiments, pulmonary function or cardiac function is improved. In certain embodiments, the individual has, or is at risk of having, CNM, DMD, or CMT. In certain embodiments, the compound comprises an oligonucleotide complementary to a DNM2 nucleic acid transcript. In certain embodiments, the compound is a compound as described herein. In certain embodiments, the compound comprises or consists of a modified oligonucleotide complementary to intron 1, intron 11, intron 12, intron 13, intron 14, exon 10, or the 3′-UTR of a DNM2 nucleic acid transcript. In certain embodiments, the modified oligonucleotide is complementary to a sequence within nucleotides 3,404-44,737; 83,573-87,287; 87,359-90,915; 90,968-97,263; 97,378-104,979; 81,061-81,199; or 116,048-116,903 of SEQ ID NO: 1. In certain embodiments, the compound comprises or consists of a modified oligonucleotide complementary to intron 1, intron 11, intron 12, intron 13, or intron 14 of a DNM2 nucleic acid transcript. In certain embodiments, the modified oligonucleotide is complementary to a sequence within nucleotides 3,404-44,737; 83,573-87,287; 87,359-90,915; 90,968-97,263; or 97,378-104,979 of SEQ ID NO: 1. In certain embodiments, the compound comprises a modified oligonucleotide 8 to 50 linked nucleosides in length and having a nucleobase sequence comprising at least 8 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 7-3134. In certain embodiments, the compound comprises a modified oligonucleotide 12 to 50 linked nucleosides in length and having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 7-3134. In certain embodiments, the compound comprises a modified oligonucleotide consisting of the nucleobase sequence of any one of SEQ ID NOs: 7-3134. In certain embodiments, the compound comprises a modified oligonucleotide 16 to 50 linked nucleosides in length having a nucleobase sequence comprising any one of SEQ ID NOs: 2879, 3056, 2123, 2189, 2453, 2160, or 2232. In certain embodiments, the compound comprises a modified oligonucleotide having a nucleobase sequence consisting of any one of SEQ ID NOs: 2879, 3056, 2123, 2189, 2453, 2160, or 2232. In any of the foregoing embodiments, the modified oligonucleotide can be 10 to 30 linked nucleosides in length. In certain embodiments, the compound is compound number 951799, 949935, 950023, 950089, 951372, 950060, or 950132. In any of the foregoing embodiments, the compound can be single-stranded or double-stranded. In any of the foregoing embodiments, the compound can be an antisense compound or oligomeric compound. In certain embodiments, the compound is administered to the individual subcutaneously, intradermally, intranodally, intramedullary, intramuscularly, intrasternally, by intravenous (i.v.) injection, by infusion techniques or intraperitoneally. In certain embodiments, the compound is administered to the individual systemically, e.g., via subcutaneous or intramuscular injection. In certain embodiments, the individual is identified as having or at risk of having a disease associated with DNM2.

Certain embodiments are drawn to a compound comprising an antisense compound targeted to DNM2 for use in treating a disease associated with DNM2. In certain embodiments, the disease is CNM, DMD, or CMT. In certain embodiments, the compound comprises an oligonucleotide complementary to a DNM2 nucleic acid transcript. In certain embodiments, the compound is a compound as described herein. In certain embodiments, the compound comprises or consists of a modified oligonucleotide complementary to intron 1, intron 11, intron 12, intron 13, intron 14, exon 10, or the 3′-UTR of a DNM2 nucleic acid transcript. In certain embodiments, the modified oligonucleotide is complementary to a sequence within nucleotides 3,404-44,737; 83,573-87,287; 87,359-90,915; 90,968-97,263; 97,378-104,979; 81,061-81,199; or 116,048-116,903 of SEQ ID NO: 1. In certain embodiments, the compound comprises or consists of a modified oligonucleotide complementary to intron 1, intron 11, intron 12, intron 13, or intron 14 of a DNM2 nucleic acid transcript. In certain embodiments, the modified oligonucleotide is complementary to a sequence within nucleotides 3,404-44,737; 83,573-87,287; 87,359-90,915; 90,968-97,263; or 97,378-104,979 of SEQ ID NO: 1. In certain embodiments, the compound comprises a modified oligonucleotide 8 to 50 linked nucleosides in length and having a nucleobase sequence comprising at least 8 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 7-3134. In certain embodiments, the compound comprises a modified oligonucleotide 12 to 50 linked nucleosides in length and having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 7-3134. In certain embodiments, the compound comprises a modified oligonucleotide consisting of the nucleobase sequence of any one of SEQ ID NOs: 7-3134. In certain embodiments, the compound comprises a modified oligonucleotide 16 to 50 linked nucleosides in length having a nucleobase sequence comprising any one of SEQ ID NOs: 2879, 3056, 2123, 2189, 2453, 2160, or 2232. In certain embodiments, the compound comprises a modified oligonucleotide having a nucleobase sequence consisting of any one of SEQ ID NOs: 2879, 3056, 2123, 2189, 2453, 2160, or 2232. In any of the foregoing embodiments, the modified oligonucleotide can be 10 to 30 linked nucleosides in length. In certain embodiments, the compound is compound number 951799, 949935, 950023, 950089, 951372, 950060, or 950132. In any of the foregoing embodiments, the compound can be single-stranded or double-stranded. In any of the foregoing embodiments, the compound can be an antisense compound or oligomeric compound. In certain embodiments, the compound is administered to the individual subcutaneously, intradermally, intranodally, intramedullary, intramuscularly, intrasternally, by intravenous (i.v.) injection, by infusion techniques or intraperitoneally. In certain embodiments, the compound is to be administered to the individual systemically, e.g., via subcutaneous or intramuscular injection.

Certain embodiments are drawn to a compound comprising an antisense compound targeted to DNM2 for use in increasing or preserving body weight or muscle strength of an individual having or at risk of having CNM, DMD, or CMT. In certain embodiments, the compound comprises an oligonucleotide complementary to a DNM2 nucleic acid transcript. In certain embodiments, the compound is a compound as described herein. In certain embodiments, the compound comprises or consists of a modified oligonucleotide complementary to intron 1, intron 11, intron 12, intron 13, intron 14, exon 10, or the 3′-UTR of a DNM2 nucleic acid transcript. In certain embodiments, the modified oligonucleotide is complementary to a sequence within nucleotides 3,404-44,737; 83,573-87,287; 87,359-90,915; 90,968-97,263; 97,378-104,979; 81,061-81,199; or 116,048-116,903 of SEQ ID NO: 1. In certain embodiments, the compound comprises or consists of a modified oligonucleotide complementary to intron 1, intron 11, intron 12, intron 13, or intron 14 of a DNM2 nucleic acid transcript. In certain embodiments, the modified oligonucleotide is complementary to a sequence within nucleotides 3,404-44,737; 83,573-87,287; 87,359-90,915; 90,968-97,263; or 97,378-104,979 of SEQ ID NO: 1. In certain embodiments, the compound comprises a modified oligonucleotide 8 to 50 linked nucleosides in length and having a nucleobase sequence comprising at least 8 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 7-3134. In certain embodiments, the compound comprises a modified oligonucleotide 12 to 50 linked nucleosides in length and having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 7-3134. In certain embodiments, the compound comprises a modified oligonucleotide consisting of the nucleobase sequence of any one of SEQ ID NOs: 7-3134. In certain embodiments, the compound comprises a modified oligonucleotide 16 to 50 linked nucleosides in length having a nucleobase sequence comprising any one of SEQ ID NOs: 2879, 3056, 2123, 2189, 2453, 2160, or 2232. In certain embodiments, the compound comprises a modified oligonucleotide having a nucleobase sequence consisting of any one of SEQ ID NOs: 2879, 3056, 2123, 2189, 2453, 2160, or 2232. In any of the foregoing embodiments, the modified oligonucleotide can be 10 to 30 linked nucleosides in length. In certain embodiments, the compound is compound number 951799, 949935, 950023, 950089, 951372, 950060, or 950132. In any of the foregoing embodiments, the compound can be single-stranded or double-stranded. In any of the foregoing embodiments, the compound can be an antisense compound or oligomeric compound.

Certain embodiments are drawn to use of the compound comprising an antisense compound targeted to DNM2 for the manufacture or preparation of a medicament for treating a disease associated with DNM2. Certain embodiments are drawn to use of the compound comprising an antisense compound targeted to DNM2 for the preparation of a medicament for treating a disease associated with DNM2. In certain embodiments, the disease is CNM, DMD, or CMT. In certain embodiments, the compound comprises an oligonucleotide complementary to a DNM2 nucleic acid transcript. In certain embodiments, the compound is a compound as described herein. In certain embodiments, the compound comprises or consists of a modified oligonucleotide complementary to intron 1, intron 11, intron 12, intron 13, intron 14, exon 10, or the 3′-UTR of a DNM2 nucleic acid transcript. In certain embodiments, the modified oligonucleotide is complementary to a sequence within nucleotides 3,404-44,737; 83,573-87,287; 87,359-90,915; 90,968-97,263; 97,378-104,979; 81,061-81,199; or 116,048-116,903 of SEQ ID NO: 1. In certain embodiments, the compound comprises or consists of a modified oligonucleotide complementary to intron 1, intron 11, intron 12, intron 13, or intron 14 of a DNM2 nucleic acid transcript. In certain embodiments, the modified oligonucleotide is complementary to a sequence within nucleotides 3,404-44,737; 83,573-87,287; 87,359-90,915; 90,968-97,263; or 97,378-104,979 of SEQ ID NO: 1. In certain embodiments, the compound comprises a modified oligonucleotide 8 to 50 linked nucleosides in length and having a nucleobase sequence comprising at least 8 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 7-3134. In certain embodiments, the compound comprises a modified oligonucleotide 12 to 50 linked nucleosides in length and having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 7-3134. In certain embodiments, the compound comprises a modified oligonucleotide consisting of the nucleobase sequence of any one of SEQ ID NOs: 7-3134. In certain embodiments, the compound comprises a modified oligonucleotide 16 to 50 linked nucleosides in length having a nucleobase sequence comprising any one of SEQ ID NOs: 2879, 3056, 2123, 2189, 2453, 2160, or 2232. In certain embodiments, the compound comprises a modified oligonucleotide having a nucleobase sequence consisting of any one of SEQ ID NOs: 2879, 3056, 2123, 2189, 2453, 2160, or 2232. In any of the foregoing embodiments, the modified oligonucleotide can be 10 to 30 linked nucleosides in length. In certain embodiments, the compound is compound number 951799, 949935, 950023, 950089, 951372, 950060, or 950132. In any of the foregoing embodiments, the compound can be single-stranded or double-stranded. In any of the foregoing embodiments, the compound can be an antisense compound or oligomeric compound.

Certain embodiments are drawn to use of a compound comprising an antisense compound targeted to DNM2 for the manufacture or preparation of a medicament for increasing or preserving body weight or muscle strength of an individual having or at risk of having CNM, DMD, or CMT. In certain embodiments, the compound comprises an oligonucleotide complementary to a DNM2 nucleic acid transcript. In certain embodiments, the compound is a compound as described herein. In certain embodiments, the compound comprises or consists of a modified oligonucleotide complementary to intron 1, intron 11, intron 12, intron 13, intron 14, exon 10, or the 3′-UTR of a DNM2 nucleic acid transcript. In certain embodiments, the modified oligonucleotide is complementary to a sequence within nucleotides 3,404-44,737; 83,573-87,287; 87,359-90,915; 90,968-97,263; 97,378-104,979; 81,061-81,199; or 116,048-116,903 of SEQ ID NO: 1. In certain embodiments, the compound comprises or consists of a modified oligonucleotide complementary to intron 1, intron 11, intron 12, intron 13, or intron 14 of a DNM2 nucleic acid transcript. In certain embodiments, the modified oligonucleotide is complementary to a sequence within nucleotides 3,404-44,737; 83,573-87,287; 87,359-90,915; 90,968-97,263; or 97,378-104,979 of SEQ ID NO: 1. In certain embodiments, the compound comprises a modified oligonucleotide 8 to 50 linked nucleosides in length and having a nucleobase sequence comprising at least 8 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 7-3134. In certain embodiments, the compound comprises a modified oligonucleotide 12 to 50 linked nucleosides in length and having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 7-3134. In certain embodiments, the compound comprises a modified oligonucleotide consisting of the nucleobase sequence of any one of SEQ ID NOs: 7-3134. In certain embodiments, the compound comprises a modified oligonucleotide 16 to 50 linked nucleosides in length having a nucleobase sequence comprising any one of SEQ ID NOs: 2879, 3056, 2123, 2189, 2453, 2160, or 2232. In certain embodiments, the compound comprises a modified oligonucleotide having a nucleobase sequence consisting of any one of SEQ ID NOs: 2879, 3056, 2123, 2189, 2453, 2160, or 2232. In any of the foregoing embodiments, the modified oligonucleotide can be 10 to 30 linked nucleosides in length. In certain embodiments, the compound is compound number 951799, 949935, 950023, 950089, 951372, 950060, or 950132. In any of the foregoing embodiments, the compound can be single-stranded or double-stranded. In any of the foregoing embodiments, the compound can be an antisense compound or oligomeric compound.

In any of the foregoing methods or uses, the compound can be targeted to a DNM2 nucleic acid transcript. In certain embodiments, the compound comprises or consists of a modified oligonucleotide, for example a modified oligonucleotide 8 to 50 linked nucleosides in length, 10 to 30 linked nucleosides in length, 12 to 30 linked nucleosides in length, or 20 linked nucleosides in length. In certain embodiments, the modified oligonucleotide is at least 80%, 85%, 90%, 95% or 100% complementary to any of the nucleobase sequences recited in SEQ ID NOs: 1, 2, 3, or 3135. In certain embodiments, the modified oligonucleotide comprises at least one modified internucleoside linkage, at least one modified sugar, and at least one modified nucleobase. In certain such embodiments, the at least one modified internucleoside linkage is a phosphorothioate internucleoside linkage, the at least one modified sugar is a bicyclic sugar, and the at least one modified nucleobase is a 5-methylcytosine. In certain embodiments, the modified oligonucleotide comprises a gap segment consisting of linked 2′-deoxynucleosides; a 5′ wing segment consisting of linked nucleosides; and a 3′ wing segment consisting of linked nucleosides, wherein the gap segment is positioned immediately adjacent to and between the 5′ wing segment and the 3′ wing segment and wherein each terminal wing nucleoside comprises a modified sugar.

In any of the foregoing embodiments, the modified oligonucleotide may be 12 to 30, 15 to 30, 15 to 25, 15 to 24, 16 to 24, 17 to 24, 18 to 24, 19 to 24, 20 to 24, 19 to 22, 20 to 22, 16 to 20, or 17 or 20 linked nucleosides in length. In certain embodiments, the modified oligonucleotide is at least 80%, 85%, 90%, 95% or 100% complementary to any of the nucleobase sequences recited in SEQ ID NOs: 1, 2, 3, or 3135. In certain embodiments, the modified oligonucleotide comprises at least one modified internucleoside linkage, at least one modified sugar, and at least one modified nucleobase. In certain embodiments, the at least one modified internucleoside linkage is a phosphorothioate internucleoside linkage, the at least one modified sugar is a bicyclic sugar, and the at least one modified nucleobase is a 5-methylcytosine. In certain embodiments, the modified oligonucleotide comprises a gap segment consisting of linked 2′-deoxynucleosides; a 5′ wing segment consisting of linked nucleosides; and a 3′ wing segment consisting of linked nucleosides, wherein the gap segment is positioned immediately adjacent to and between the 5′ wing segment and the 3′ wing segment and wherein each terminal wing nucleoside comprises a modified sugar.

In any of the foregoing methods or uses, the compound may comprise or consist of a modified oligonucleotide 16 to 30 linked nucleosides in length and having a nucleobase sequence comprising any one of SEQ ID NOs: 2879, 3056, 2123, 2189, 2453, 2160, or 2232, wherein the modified oligonucleotide comprises:

    • a gap segment consisting of linked 2′-deoxynucleosides;
    • a 5′ wing segment consisting of linked nucleosides; and
    • a 3′ wing segment consisting of linked nucleosides;

wherein the gap segment is positioned between the 5′ wing segment and the 3′ wing segment and wherein each nucleoside of each wing segment comprises a modified sugar.

In any of the foregoing methods or uses, the compound may comprise or consist of a modified oligonucleotide 16 to 30 linked nucleosides in length and having a nucleobase sequence comprising any one of SEQ ID NOs: 2879, 3056, 2123, 2189, 2453, 2160, or 2232, wherein the modified oligonucleotide comprises:

    • a gap segment consisting of linked 2′-deoxynucleosides;
    • a 5′ wing segment consisting of linked nucleosides; and
    • a 3′ wing segment consisting of linked nucleosides;

wherein the gap segment is positioned between the 5′ wing segment and the 3′ wing segment, wherein each terminal wing nucleoside comprises a modified sugar.

In any of the foregoing methods or uses, the compound may comprise or consist of a modified oligonucleotide 16 to 50 linked nucleobases in length having a nucleobase sequence comprising or consisting of the sequence recited in any one of SEQ ID NOs: 2879, 3056, 2123, 2189, 2453, 2160, or 2232, wherein the modified oligonucleotide comprises:

    • a gap segment consisting of 10 linked 2′-deoxynucleosides;
    • a 5′ wing segment consisting of 3 linked nucleosides; and
    • a 3′ wing segment consisting of 3 linked nucleosides;

wherein the gap segment is positioned between the 5′ wing segment and the 3′ wing segment, wherein each nucleoside of each wing segment comprises a cEt sugar; wherein each internucleoside linkage is a phosphorothioate linkage and wherein each cytosine is a 5-methylcytosine. In certain embodiments, the modified oligonucleotide consists of 16-30 linked nucleosides. In certain embodiments, the modified oligonucleotide consists of 16 linked nucleosides.

In one embodiment, in any of the foregoing methods or uses, the compound has the following chemical structure:

In one embodiment, in any of the foregoing methods or uses, the compound can be administered systemically. In certain embodiments, the compound of any of the foregoing methods or uses can be administered through injection or infusion. In certain embodiments, the compound of any of the foregoing methods or uses can be administered via subcutaneous administration, intravenous administration, intramuscular administration, intraarterial administration, intraperitoneal administration, or intracranial administration, e.g. intrathecal or intracerebroventricular administration. In certain embodiments, the compound is administered to the individual intradermally, intranodally, intramedullary or intrasternally. In certain embodiments, the compound of any of the foregoing methods or uses can be administered orally.

Certain Combinations and Combination Therapies

In certain embodiments, a first agent comprising the compound described herein is co-administered with one or more secondary agents. In certain embodiments, such second agents are designed to treat the same disease, disorder, or condition as the first agent described herein. In certain embodiments, such second agents are designed to treat a different disease, disorder, or condition as the first agent described herein. In certain embodiments, a first agent is designed to treat an undesired side effect of a second agent. In certain embodiments, second agents are co-administered with the first agent to treat an undesired effect of the first agent. In certain embodiments, such second agents are designed to treat an undesired side effect of one or more pharmaceutical compositions as described herein. In certain embodiments, second agents are co-administered with the first agent to produce a combinational effect. In certain embodiments, second agents are co-administered with the first agent to produce a synergistic effect. In certain embodiments, the co-administration of the first and second agents permits use of lower dosages than would be required to achieve a therapeutic or prophylactic effect if the agents were administered as independent therapy.

In certain embodiments, one or more compounds or compositions provided herein are co-administered with one or more secondary agents. In certain embodiments, one or more compounds or compositions provided herein and one or more secondary agents, are administered at different times. In certain embodiments, one or more compounds or compositions provided herein and one or more secondary agents, are prepared together in a single formulation. In certain embodiments, one or more compounds or compositions provided herein and one or more secondary agents, are prepared separately.

Certain embodiments are directed to the use of a compound comprising a modified oligonucleotide complementary to a DNM2 nucleic acid transcript as described herein in combination with a secondary agent. In particular embodiments such use is in a method of treating a patient suffering from CNM, DMD, or CMT, or in the preparation or manufacture of a medicament for treating CNM, DMD, or CMT.

In certain embodiments the compound comprising a modified oligonucleotide complementary to a DNM2 nucleic acid transcript as described herein and the secondary agent are used in combination treatment by administering the two agents simultaneously, separately or sequentially. In certain embodiments the two agents are formulated as a fixed dose combination product. In other embodiments the two agents are provided to the patient as separate units which can then either be taken simultaneously or serially (sequentially).

Certain Compounds

In certain embodiments, compounds described herein can be antisense compounds. In certain embodiments, the antisense compound comprises or consists of an oligomeric compound. In certain embodiments, the oligomeric compound comprises or consists of a modified oligonucleotide. In certain embodiments, the modified oligonucleotide has a nucleobase sequence complementary to that of a target nucleic acid.

In certain embodiments, a compound described herein comprises or consists of a modified oligonucleotide. In certain embodiments, the modified oligonucleotide has a nucleobase sequence complementary to that of a target nucleic acid.

In certain embodiments, a compound or antisense compound is single-stranded. Such a single-stranded compound or antisense compound comprises or consists of an oligomeric compound. In certain embodiments, such an oligomeric compound comprises or consists of an oligonucleotide and optionally a conjugate group. In certain embodiments, the oligonucleotide is an antisense oligonucleotide. In certain embodiments, the oligonucleotide is modified. In certain embodiments, the oligonucleotide of a single-stranded antisense compound or oligomeric compound comprises a self-complementary nucleobase sequence.

In certain embodiments, a compound or antisense compound is double-stranded. Such double-stranded compounds comprise a first oligomeric compound comprising or consisting of a first modified oligonucleotide having a region complementary to a target nucleic acid and a second oligomeric compound comprising or consisting of a second oligonucleotide having a region complementary to the first modified oligonucleotide. In certain embodiments, the first oligonucleotide is 100% complementary to the second oligonucleotide. In certain embodiments, the first and second oligonucleotides include non-complementary, overhanging nucleosides. In certain embodiments, the first modified oligonucleotide comprises unmodified ribosyl sugar moieties as those found in RNA. In such embodiments, thymine nucleobases in the first and/or second oligonucleotide are replaced by uracil nucleobases. In certain embodiments, the first and/or second oligomeric compound comprises a conjugate group. In certain embodiments, the first modified oligonucleotide is 12-30 linked nucleosides in length and the second oligonucleotide is 12-30 linked nucleosides in length. In certain embodiments, the second oligonucleotide is modified. In certain embodiments, the first modified oligonucleotide has a nucleobase sequence comprising at least 8 contiguous nucleobases of any of SEQ ID NOs: 7-3134.

Examples of single-stranded and double-stranded compounds include but are not limited to oligonucleotides, siRNAs, microRNA targeting oligonucleotides, and single-stranded RNAi compounds, such as small hairpin RNAs (shRNAs), single-stranded siRNAs (ssRNAs), and microRNA mimics.

In certain embodiments, a compound described herein has a nucleobase sequence that, when written in the 5′ to 3′ direction, comprises the reverse complement of the target segment of a target nucleic acid to which it is targeted.

In certain embodiments, a compound described herein comprises an oligonucleotide 10 to 30 linked subunits in length. In certain embodiments, a compound described herein comprises an oligonucleotide 12 to 30 linked subunits in length. In certain embodiments, a compound described herein comprises an oligonucleotide 12 to 22 linked subunits in length. In certain embodiments, compound described herein comprises an oligonucleotide 14 to 30 linked subunits in length. In certain embodiments, compound described herein comprises an oligonucleotide 14 to 20 linked subunits in length. In certain embodiments, a compound described herein comprises an oligonucleotide 15 to 30 linked subunits in length. In certain embodiments, a compound described herein comprises an oligonucleotide 15 to 20 linked subunits in length. In certain embodiments, a compound described herein comprises an oligonucleotide 16 to 30 linked subunits in length. In certain embodiments, a compound described herein comprises an oligonucleotide 16 to 20 linked subunits in length. In certain embodiments, a compound described herein comprises an oligonucleotide 17 to 30 linked subunits in length. In certain embodiments, a compound described herein comprises an oligonucleotide 17 to 20 linked subunits in length. In certain embodiments, a compound described herein comprises an oligonucleotide 18 to 30 linked subunits in length. In certain embodiments, a compound described herein comprises an oligonucleotide 18 to 21 linked subunits in length. In certain embodiments, a compound described herein comprises an oligonucleotide 18 to 20 linked subunits in length. In certain embodiments, a compound described herein comprises an oligonucleotide 20 to 30 linked subunits in length. In other words, such oligonucleotides are 12 to 30 linked subunits, 14 to 30 linked subunits, 14 to 20 subunits, 15 to 30 subunits, 15 to 20 subunits, 16 to 30 subunits, 16 to 20 subunits, 17 to 30 subunits, 17 to 20 subunits, 18 to 30 subunits, 18 to 20 subunits, 18 to 21 subunits, 20 to 30 subunits, or 12 to 22 linked subunits in length, respectively. In certain embodiments, a compound described herein comprises an oligonucleotide 14 linked subunits in length. In certain embodiments, a compound described herein comprises an oligonucleotide 16 linked subunits in length. In certain embodiments, a compound described herein comprises an oligonucleotide 17 linked subunits in length. In certain embodiments, compound described herein comprises an oligonucleotide 18 linked subunits in length. In certain embodiments, a compound described herein comprises an oligonucleotide 19 linked subunits in length. In certain embodiments, a compound described herein comprises an oligonucleotide 20 linked subunits in length. In other embodiments, a compound described herein comprises an oligonucleotide 8 to 80, 12 to 50, 13 to 30, 13 to 50, 14 to 30, 14 to 50, 15 to 30, 15 to 50, 16 to 30, 16 to 50, 17 to 30, 17 to 50, 18 to 22, 18 to 24, 18 to 30, 18 to 50, 19 to 22, 19 to 30, 19 to 50, or 20 to 30 linked subunits. In certain such embodiments, the compound described herein comprises an oligonucleotide 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 linked subunits in length, or a range defined by any two of the above values. In some embodiments the linked subunits are nucleotides, nucleosides, or nucleobases.

In certain embodiments, the compound may further comprise additional features or elements, such as a conjugate group, that are attached to the oligonucleotide. In certain embodiments, such compounds are antisense compounds. In certain embodiments, such compounds are oligomeric compounds. In embodiments where a conjugate group comprises a nucleoside (i.e. a nucleoside that links the conjugate group to the oligonucleotide), the nucleoside of the conjugate group is not counted in the length of the oligonucleotide.

In certain embodiments, compounds may be shortened or truncated. For example, a single subunit may be deleted from the 5′ end (5′ truncation), or alternatively from the 3′ end (3′ truncation). A shortened or truncated compound targeted to a DNM2 nucleic acid may have two subunits deleted from the 5′ end, or alternatively may have two subunits deleted from the 3′ end, of the compound. Alternatively, the deleted nucleosides may be dispersed throughout the compound.

When a single additional subunit is present in a lengthened compound, the additional subunit may be located at the 5′ or 3′ end of the compound. When two or more additional subunits are present, the added subunits may be adjacent to each other, for example, in a compound having two subunits added to the 5′ end (5′ addition), or alternatively to the 3′ end (3′ addition), of the compound. Alternatively, the added subunits may be dispersed throughout the compound.

It is possible to increase or decrease the length of a compound, such as an oligonucleotide, and/or introduce mismatch bases without eliminating activity (Woolf et al. Proc. Nat. Acad. Sci. USA 1992, 89:7305-7309; Gautschi et al. J Nat. Cancer Inst. March 2001, 93:463-471; Maher and Dolnick Nuc. Acid. Res. 1998, 16:3341-3358). However, seemingly small changes in oligonucleotide sequence, chemistry and motif can make large differences in one or more of the many properties required for clinical development (Seth et al. J Med. Chem. 2009, 52, 10; Egli et al. J. Am. Chem. Soc. 2011, 133, 16642).

In certain embodiments, compounds described herein are interfering RNA compounds (RNAi), which include double-stranded RNA compounds (also referred to as short-interfering RNA or siRNA) and single-stranded RNAi compounds (or ssRNA). Such compounds work at least in part through the RISC pathway to degrade and/or sequester a target nucleic acid (thus, include microRNA/microRNA-mimic compounds). As used herein, the term siRNA is meant to be equivalent to other terms used to describe nucleic acid molecules that are capable of mediating sequence specific RNAi, for example short interfering RNA (siRNA), double-stranded RNA (dsRNA), micro-RNA (miRNA), short hairpin RNA (shRNA), short interfering oligonucleotide, short interfering nucleic acid, short interfering modified oligonucleotide, chemically modified siRNA, post-transcriptional gene silencing RNA (ptgsRNA), and others. In addition, as used herein, the term “RNAi” is meant to be equivalent to other terms used to describe sequence specific RNA interference, such as post transcriptional gene silencing, translational inhibition, or epigenetics.

In certain embodiments, a compound described herein can comprise any of the oligonucleotide sequences targeted to a DNM2 nucleic acid transcript described herein. In certain embodiments, the compound can be double-stranded. In certain embodiments, the compound comprises a first strand comprising at least an 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 contiguous nucleobase portion of any one of SEQ ID NOs: 7-3134 and a second strand. In certain embodiments, the compound can be double-stranded. In certain embodiments, the compound comprises a first strand comprising at least an 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 contiguous nucleobase portion of any one of SEQ ID NOs: 2879, 3056, 2123, 2189, 2453, 2160, or 2232 and a second strand. In certain embodiments, the compound can be double-stranded. In certain embodiments, the compound comprises a first strand comprising at least an 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 contiguous nucleobase portion of SEQ ID NO: 2879 and a second strand. In certain embodiments, the compound comprises a first strand comprising the nucleobase sequence of any one of SEQ ID NOs: 7-3134 and a second strand. In certain embodiments, the compound comprises a first strand comprising the nucleobase sequence of any one of SEQ ID NOs: 2879, 3056, 2123, 2189, 2453, 2160, or 2232 and a second strand. In certain embodiments, the compound comprises a first strand comprising the nucleobase sequence of SEQ ID NO: 2879 and a second strand. In certain embodiments, the compound comprises ribonucleotides in which the first strand has uracil (U) in place of thymine (T) in any one of SEQ ID NOs: 7-3134. In certain embodiments, the compound comprises (i) a first strand comprising a nucleobase sequence complementary to the site on a DNM2 nucleic acid to which any of SEQ ID NOs: 7-3134 is complementary, and (ii) a second strand. In certain embodiments, the compound comprises one or more modified nucleotides in which the 2′ position in the sugar contains a halogen (such as fluorine group; 2′-F) or contains an alkoxy group (such as a methoxy group; 2′-OMe). In certain embodiments, the compound comprises at least one 2′-F sugar modification and at least one 2′-OMe sugar modification. In certain embodiments, the at least one 2′-F sugar modification and at least one 2′-OMe sugar modification are arranged in an alternating pattern for at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 contiguous nucleobases along a strand of the dsRNA compound. In certain embodiments, the compound comprises one or more linkages between adjacent nucleotides other than a naturally-occurring phosphodiester linkage. Examples of such linkages include phosphoramide, phosphorothioate, and phosphorodithioate linkages. The compounds may also be chemically modified nucleic acid molecules as taught in U.S. Pat. No. 6,673,661. In other embodiments, the compound contains one or two capped strands, as disclosed, for example, by WO 00/63364, filed Apr. 19, 2000.

In certain embodiments, the first strand of the compound is an siRNA guide strand and the second strand of the compound is an siRNA passenger strand. In certain embodiments, the second strand of the compound is complementary to the first strand. In certain embodiments, each strand of the compound is 16, 17, 18, 19, 20, 21, 22, or 23 linked nucleosides in length. In certain embodiments, the first or second strand of the compound can comprise a conjugate group.

In certain embodiments, a compound described herein can comprise any of the oligonucleotide sequences targeted to a DNM2 nucleic acid described herein. In certain embodiments, the compound is single-stranded. In certain embodiments, such a compound is a single-stranded RNAi (ssRNAi) compound. In certain embodiments, the compound comprises at least an 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 contiguous nucleobase portion of any one of SEQ ID NOs: 7-3134. In certain embodiments, the compound comprises at least an 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 contiguous nucleobase portion of any one of SEQ ID NOs: 2879, 3056, 2123, 2189, 2453, 2160, or 2232. In certain embodiments, the compound comprises at least an 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 contiguous nucleobase portion of SEQ ID NO: 2879. In certain embodiments, the compound comprises the nucleobase sequence of any one of SEQ ID NOs: 7-3134. In certain embodiments, the compound comprises the nucleobase sequence of any one of SEQ ID NOs: 2879, 3056, 2123, 2189, 2453, 2160, or 2232. In certain embodiments, the compound comprises the nucleobase sequence of SEQ ID NO: 2879. In certain embodiments, the compound comprises ribonucleotides in which uracil (U) is in place of thymine (T) in any one of SEQ ID NOs: 7-3134. In certain embodiments, the compound comprises a nucleobase sequence complementary to the site on DNM2 to which any of SEQ ID NOs: 7-3134 is targeted. In certain embodiments, the compound comprises one or more modified nucleotides in which the 2′ position in the sugar contains a halogen (such as fluorine group; 2′-F) or contains an alkoxy group (such as a methoxy group; 2′-OMe). In certain embodiments, the compound comprises at least one 2′-F sugar modification and at least one 2′-OMe sugar modification. In certain embodiments, the at least one 2′-F sugar modification and at least one 2′-OMe sugar modification are arranged in an alternating pattern for at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 contiguous nucleobases along a strand of the compound. In certain embodiments, the compound comprises one or more linkages between adjacent nucleotides other than a naturally-occurring phosphodiester linkage. Examples of such linkages include phosphoramide, phosphorothioate, and phosphorodithioate linkages. The compounds may also be chemically modified nucleic acid molecules as taught in U.S. Pat. No. 6,673,661. In other embodiments, the compound contains a capped strand, as disclosed, for example, by WO 00/63364, filed Apr. 19, 2000. In certain embodiments, the compound consists of 16, 17, 18, 19, 20, 21, 22, or 23 linked nucleosides. In certain embodiments, the compound can comprise a conjugate group.

Certain compounds described herein (e.g., modified oligonucleotides) have one or more asymmetric center and thus give rise to enantiomers, diastereomers, and other stereoisomeric configurations that may be defined, in terms of absolute stereochemistry, as (R) or (S), as α or β, such as for sugar anomers, or as (D) or (L), such as for amino acids, etc. Compounds provided herein that are drawn or described as having certain stereoisomeric configurations include only the indicated compounds. Compounds provided herein that are drawn or described with undefined stereochemistry include all such possible isomers, including their stereorandom and optically pure forms. All tautomeric forms of the compounds provided herein are included unless otherwise indicated.

The compounds described herein include variations in which one or more atoms are replaced with a non-radioactive isotope or radioactive isotope of the indicated element. For example, compounds herein that comprise hydrogen atoms encompass all possible deuterium substitutions for each of the 1H hydrogen atoms. Isotopic substitutions encompassed by the compounds herein include but are not limited to: 2H or 3H in place of 1H, 13C or 14C in place of 12C, 15N in place of 14N, 17O or 18O in place of 16O, and 33S, 34S, 35S, or 36S in place of 32S. In certain embodiments, non-radioactive isotopic substitutions may impart new properties on the oligomeric compound that are beneficial for use as a therapeutic or research tool. In certain embodiments, radioactive isotopic substitutions may make the compound suitable for research or diagnostic purposes such as imaging.

Certain Mechanisms

In certain embodiments, compounds described herein comprise or consist of modified oligonucleotides. In certain embodiments, compounds described herein are antisense compounds. In certain embodiments, compounds comprise oligomeric compounds. In certain embodiments, compounds described herein are capable of hybridizing to a DNM2 target nucleic acid, resulting in at least one antisense activity. In certain embodiments, compounds described herein selectively affect one or more target nucleic acid. Such compounds comprise a nucleobase sequence that hybridizes to one or more target nucleic acid, resulting in one or more desired antisense activity and does not hybridize to one or more non-target nucleic acid or does not hybridize to one or more non-target nucleic acid in such a way that results in a significant undesired antisense activity.

In certain antisense activities, hybridization of a compound described herein to a target nucleic acid results in recruitment of a protein that cleaves the target nucleic acid. For example, certain compounds described herein result in RNase H mediated cleavage of the target nucleic acid. RNase H is a cellular endonuclease that cleaves the RNA strand of an RNA:DNA duplex. The DNA in such an RNA:DNA duplex need not be unmodified DNA. In certain embodiments, compounds described herein are sufficiently “DNA-like” to elicit RNase H activity. Further, in certain embodiments, one or more non-DNA-like nucleoside in the gap of a gapmer is tolerated.

In certain antisense activities, compounds described herein or a portion of the compound is loaded into an RNA-induced silencing complex (RISC), ultimately resulting in cleavage of the target nucleic acid. For example, certain compounds described herein result in cleavage of the target nucleic acid by Argonaute. Compounds that are loaded into RISC are RNAi compounds. RNAi compounds may be double-stranded (siRNA) or single-stranded (ssRNA).

Antisense activities may be observed directly or indirectly. In certain embodiments, observation or detection of an antisense activity involves observation or detection of a change in an amount of a target nucleic acid or protein encoded by such target nucleic acid, a change in the ratio of splice variants of a nucleic acid or protein, and/or a phenotypic change in a cell or animal.

Target Nucleic Acids, Target Regions and Nucleotide Sequences

In certain embodiments, compounds described herein comprise or consist of an oligonucleotide comprising a region that is complementary to a target nucleic acid. In certain embodiments, the target nucleic acid is an endogenous RNA molecule. In certain embodiments, the target nucleic acid encodes a protein. In certain such embodiments, the target nucleic acid is selected from: an mRNA and a pre-mRNA, including intronic, exonic and untranslated regions. In certain embodiments, the target RNA is an mRNA. In certain embodiments, the target nucleic acid is a pre-mRNA. In certain embodiments, a pre-mRNA and corresponding mRNA are both target nucleic acids of a single compound. In certain such embodiments, the target region is entirely within an intron of a target pre-mRNA. In certain embodiments, the target region spans an intron/exon junction. In certain embodiments, the target region is at least 50% within an intron. Target nucleic acid sequences that encode DNM2 include, without limitation, the following: RefSeq or GenBank Accession No. NC_000019.10 truncated from nucleosides 10715001 to Ser. No. 10/835,000, NM_004945.3, NM_001005361.2, or NM_001005360.2 (SEQ ID Nos: 1, 2, 3, and 3135, respectively).

Hybridization

In some embodiments, hybridization occurs between a compound disclosed herein and a DNM2 nucleic acid. The most common mechanism of hybridization involves hydrogen bonding (e.g., Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding) between complementary nucleobases of the nucleic acid molecules.

Hybridization can occur under varying conditions. Hybridization conditions are sequence-dependent and are determined by the nature and composition of the nucleic acid molecules to be hybridized.

Methods of determining whether a sequence is specifically hybridizable to a target nucleic acid are well known in the art. In certain embodiments, the compounds provided herein are specifically hybridizable with a DNM2 nucleic acid.

Complementarity

In certain embodiments, compounds described herein comprise or consist of modified oligonucleotides. In certain embodiments, compounds described herein are antisense compounds. In certain embodiments, compounds comprise oligomeric compounds. In certain embodiments, oligonucleotides complementary to a DNM2 nucleic acid comprise nucleobase that are non-complementary with the DNM2 nucleic acid, yet may be tolerated provided that the compound remains able to specifically hybridize to a target nucleic acid. Moreover, a compound may hybridize over one or more segments of a DNM2 nucleic acid such that intervening or adjacent segments are not involved in the hybridization event (e.g., a loop structure, mismatch or hairpin structure).

In certain embodiments, the compounds provided herein, or a specified portion thereof, are, are at least, or are up to 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% complementary to a DNM2 nucleic acid, a target region, target segment, or specified portion thereof. In certain embodiments, the compounds provided herein, or a specified portion thereof, are 70% to 75%, 75% to 80%, 80% to 85%, 85% to 90%, 90% to 95%, 95% to 100%, or any number in between these ranges, complementary to a DNM2 nucleic acid, a target region, target segment, or specified portion thereof. Percent complementarity of a compound with a target nucleic acid can be determined using routine methods.

For example, a compound in which 18 of 20 nucleobases of the compound are complementary to a target region, and would therefore specifically hybridize, would represent 90 percent complementarity. In this example, the remaining non-complementary nucleobases may be clustered or interspersed with complementary nucleobases and need not be contiguous to each other or to complementary nucleobases. As such, a compound which is 18 nucleobases in length having four non-complementary nucleobases which are flanked by two regions of complete complementarity with the target nucleic acid would have 77.8% overall complementarity with the target nucleic acid. Percent complementarity of a compound with a region of a target nucleic acid can be determined routinely using BLAST programs (basic local alignment search tools) and PowerBLAST programs known in the art (Altschul et al., J Mol. Biol., 1990, 215, 403 410; Zhang and Madden, Genome Res., 1997, 7, 649 656). Percent homology, sequence identity or complementarity, can be determined by, for example, the Gap program (Wisconsin Sequence Analysis Package, Version 8 for Unix, Genetics Computer Group, University Research Park, Madison Wis.), using default settings, which uses the algorithm of Smith and Waterman (Adv. Appl. Math., 1981, 2, 482 489).

In certain embodiments, compounds described herein, or specified portions thereof, are fully complementary (i.e. 100% complementary) to a target nucleic acid, or specified portion thereof. For example, a compound may be 100% complementary to a DNM2 nucleic acid, or a target region, or a target segment or target sequence thereof. As used herein, “fully complementary” means each nucleobase of a compound is complementary to the corresponding nucleobase of a target nucleic acid. For example, a 20 nucleobase compound is fully complementary to a target sequence that is 400 nucleobases long, so long as there is a corresponding 20 nucleobase portion of the target nucleic acid that is fully complementary to the compound. Fully complementary can also be used in reference to a specified portion of the first and/or the second nucleic acid. For example, a 20 nucleobase portion of a 30 nucleobase compound can be “fully complementary” to a target sequence that is 400 nucleobases long. The 20 nucleobase portion of the 30 nucleobase compound is fully complementary to the target sequence if the target sequence has a corresponding 20 nucleobase portion wherein each nucleobase is complementary to the 20 nucleobase portion of the compound. At the same time, the entire 30 nucleobase compound may or may not be fully complementary to the target sequence, depending on whether the remaining 10 nucleobases of the compound are also complementary to the target sequence.

In certain embodiments, compounds described herein comprise one or more mismatched nucleobases relative to the target nucleic acid. In certain such embodiments, antisense activity against the target is reduced by such mismatch, but activity against a non-target is reduced by a greater amount. Thus, in certain such embodiments selectivity of the compound is improved. In certain embodiments, the mismatch is specifically positioned within an oligonucleotide having a gapmer motif. In certain such embodiments, the mismatch is at position 1, 2, 3, 4, 5, 6, 7, or 8 from the 5′-end of the gap segment. In certain such embodiments, the mismatch is at position 9, 8, 7, 6, 5, 4, 3, 2, 1 from the 3′-end of the gap segment. In certain such embodiments, the mismatch is at position 1, 2, 3, or 4 from the 5′-end of the wing segment. In certain such embodiments, the mismatch is at position 4, 3, 2, or 1 from the 3′-end of the wing segment. In certain embodiments, the mismatch is specifically positioned within an oligonucleotide not having a gapmer motif. In certain such embodiments, the mismatch is at position 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 from the 5′-end of the oligonucleotide. In certain such embodiments, the mismatch is at position 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 from the 3′-end of the oligonucleotide.

The location of a non-complementary nucleobase may be at the 5′ end or 3′ end of the compound. Alternatively, the non-complementary nucleobase or nucleobases may be at an internal position of the compound. When two or more non-complementary nucleobases are present, they may be contiguous (i.e., linked) or non-contiguous. In one embodiment, a non-complementary nucleobase is located in the wing segment of a gapmer oligonucleotide.

In certain embodiments, compounds described herein that are, or are up to 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleobases in length comprise no more than 4, no more than 3, no more than 2, or no more than 1 non-complementary nucleobase(s) relative to a target nucleic acid, such as a DNM2 nucleic acid, or specified portion thereof.

In certain embodiments, compounds described herein that are, or are up to 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleobases in length comprise no more than 6, no more than 5, no more than 4, no more than 3, no more than 2, or no more than 1 non-complementary nucleobase(s) relative to a target nucleic acid, such as a DNM2 nucleic acid, or specified portion thereof.

In certain embodiments, compounds described herein also include those which are complementary to a portion (a defined number of contiguous nucleobases within a region or segment) of a target nucleic acid. In certain embodiments, the compounds, are complementary to at least an 8 nucleobase portion of a target segment. In certain embodiments, the compounds are complementary to at least a 9 nucleobase portion of a target segment. In certain embodiments, the compounds are complementary to at least a 10 nucleobase portion of a target segment. In certain embodiments, the compounds are complementary to at least an 11 nucleobase portion of a target segment. In certain embodiments, the compounds are complementary to at least a 12 nucleobase portion of a target segment. In certain embodiments, the compounds are complementary to at least a 13 nucleobase portion of a target segment. In certain embodiments, the compounds are complementary to at least a 14 nucleobase portion of a target segment. In certain embodiments, the compounds are complementary to at least a 15 nucleobase portion of a target segment. In certain embodiments, the compounds are complementary to at least a 16 nucleobase portion of a target segment. Also contemplated are compounds that are complementary to at least a 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more nucleobase portion of a target segment, or a range defined by any two of these values.

Certain Compounds

In certain embodiments, compounds described herein comprise or consist of oligonucleotides consisting of linked nucleosides. Oligonucleotides may be unmodified oligonucleotides (RNA or DNA) or may be modified oligonucleotides. Modified oligonucleotides comprise at least one modification relative to unmodified RNA or DNA (i.e., comprise at least one modified nucleoside (comprising a modified sugar moiety and/or a modified nucleobase) and/or at least one modified internucleoside linkage).

I. Modifications

A. Modified Nucleosides

Modified nucleosides comprise a modified sugar moiety or a modified nucleobase or both a modified sugar moiety and a modified nucleobase.

1. Modified Sugar Moieties

In certain embodiments, sugar moieties are non-bicyclic modified sugar moieties. In certain embodiments, modified sugar moieties are bicyclic or tricyclic sugar moieties. In certain embodiments, modified sugar moieties are sugar surrogates. Such sugar surrogates may comprise one or more substitutions corresponding to those of other types of modified sugar moieties.

In certain embodiments, modified sugar moieties are non-bicyclic modified furanosyl sugar moieties comprising one or more acyclic substituent, including but not limited to substituents at the 2′, 4′, and/or 5′ positions. In certain embodiments, the furanosyl sugar moiety is a ribosyl sugar moiety. In certain embodiments one or more acyclic substituent of non-bicyclic modified sugar moieties is branched. Examples of 2′-substituent groups suitable for non-bicyclic modified sugar moieties include but are not limited to: 2′-F, 2′-OCH3 (“OMe” or “O-methyl”), and 2′-O(CH2)2OCH3 (“MOE”). In certain embodiments, 2′-substituent groups are selected from among: halo, allyl, amino, azido, SH, CN, OCN, CF3, OCF3, O—C1-C10 alkoxy, O—C1-C10 substituted alkoxy, C1-C10 alkyl, O—C1-C10 substituted alkyl, S-alkyl, N(Rm)-alkyl, O-alkenyl, S-alkenyl, N(Rm)-alkenyl, O-alkynyl, S-alkynyl, N(Rm)-alkynyl, O-alkylenyl-O-alkyl, alkynyl, alkaryl, aralkyl, O-alkaryl, O-aralkyl, O(CH2)2SCH3, O(CH2)2N(Rm)(Rn) or OCH2C(═O)—N(Rm)(Rn), where each Rm and Rn is, independently, H, an amino protecting group, or substituted or unsubstituted C1-C10 alkyl, and the 2′-substituent groups described in Cook et al., U.S. Pat. No. 6,531,584; Cook et al., U.S. Pat. No. 5,859,221; and Cook et al., U.S. Pat. No. 6,005,087. Certain embodiments of these 2′-substituent groups can be further substituted with one or more substituent groups independently selected from among: hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro (NO2), thiol, thioalkoxy, thioalkyl, halogen, alkyl, aryl, alkenyl and alkynyl. Examples of 4′-substituent groups suitable for non-bicyclic modified sugar moieties include but are not limited to alkoxy (e.g., methoxy), alkyl, and those described in Manoharan et al., WO 2015/106128. Examples of 5′-substituent groups suitable for non-bicyclic modified sugar moieties include but are not limited to: 5′-methyl (R or S), 5′-vinyl, and 5′-methoxy. In certain embodiments, non-bicyclic modified sugars comprise more than one non-bridging sugar substituent, for example, 2′-F-5′-methyl sugar moieties and the modified sugar moieties and modified nucleosides described in Migawa et al., WO 2008/101157 and Rajeev et al., US2013/0203836).

In certain embodiments, a 2′-substituted nucleoside or 2′-non-bicyclic modified nucleoside comprises a sugar moiety comprising a non-bridging 2′-substituent group selected from: F, NH2, N3, OCF3, OCH3, O(CH2)3NH2, CH2CH═CH2, OCH2CH═CH2, OCH2CH2OCH3, O(CH2)2SCH3, O(CH2)20N(Rm)(Rn), O(CH2)2O(CH2)2N(CH3)2, and N-substituted acetamide (OCH2C(═O)—N(Rm)(Rn)), where each Rm and Rn is, independently, H, an amino protecting group, or substituted or unsubstituted C1-C10 alkyl.

In certain embodiments, a 2′-substituted nucleoside or 2′-non-bicyclic modified nucleoside comprises a sugar moiety comprising a non-bridging 2′-substituent group selected from: F, OCF3, OCH3, OCH2CH2OCH3, O(CH2)2SCH3, O(CH2)20N(CH3)2, O(CH2)2O(CH2)2N(CH3)2, and OCH2C(═O)—N(H)CH3 (“NMA”).

In certain embodiments, a 2′-substituted nucleoside or 2′-non-bicyclic modified nucleoside comprises a sugar moiety comprising a non-bridging 2′-substituent group selected from: F, OCH3, and OCH2CH2OCH3.

Nucleosides comprising modified sugar moieties, such as non-bicyclic modified sugar moieties, may be referred to by the position(s) of the substitution(s) on the sugar moiety of the nucleoside. For example, nucleosides comprising 2′-substituted or 2-modified sugar moieties are referred to as 2′-substituted nucleosides or 2-modified nucleosides.

Certain modified sugar moieties comprise a bridging sugar substituent that forms a second ring resulting in a bicyclic sugar moiety. In certain such embodiments, the bicyclic sugar moiety comprises a bridge between the 4′ and the 2′ furanose ring atoms. In certain such embodiments, the furanose ring is a ribose ring. Examples of such 4′ to 2′ bridging sugar substituents include but are not limited to: 4′-CH2-2′, 4′-(CH2)2-2′, 4′-(CH2)3-2′, 4′-CH2—O-2′ (“LNA”), 4′-CH2—S-2′, 4′-(CH2)2—O-2′ (“ENA”), 4′- CH(CH3)—O-2′ (referred to as “constrained ethyl” or “cEt” when in the S configuration), 4′-CH2—O—CH2-2′, 4′-CH2—N(R)-2′, 4′-C—H(CH2OCH3)—O-2′ (“constrained MOE” or “cMOE”) and analogs thereof (see, e.g., Seth et al., U.S. Pat. No. 7,399,845, Bhat et al., U.S. Pat. No. 7,569,686, Swayze et al., U.S. Pat. No. 7,741,457, and Swayze et al., U.S. Pat. No. 8,022,193), 4′-C(CH3)(CH3)—O-2′ and analogs thereof (see, e.g., Seth et al., U.S. Pat. No. 8,278,283), 4′-CH2—N(OCH3)-2′ and analogs thereof (see, e.g., Prakash et al., U.S. Pat. No. 8,278,425), 4′-CH2—O—N(CH3)-2′ (see, e.g., Allerson et al., U.S. Pat. No. 7,696,345 and Allerson et al., U.S. Pat. No. 8,124,745), 4′-CH2—C(H)(CH3)-2′ (see, e.g., Zhou, et al., J Org. Chem., 2009, 74, 118-134), 4′-CH2—C(═CH2)-2′ and analogs thereof (see e.g., Seth et al., U.S. Pat. No. 8,278,426), 4′-C(RaRb)—N(R)—O-2′, 4′-C(RaRb)—O—N(R)-2′, 4′-CH2—N(R)-2′, and 4′-CH2—N(R)—O-2′, wherein each R, Ra, and Rb is, independently, H, a protecting group, or C1-C12 alkyl (see, e.g. Imanishi et al., U.S. Pat. No. 7,427,672).

In certain embodiments, such 4′ to 2′ bridges independently comprise from 1 to 4 linked groups independently selected from: —[C(Ra)(Rb)]n—, —[C(Ra)(Rb)]n—O—, —C(Ra)═C(Rb)—, —C(Ra)═N—, —C(═NRa)—, —C(═O)—, —C(═S)—, —O—, —Si(Ra)2—, —S(═O)x—, and —N(Ra)—;

wherein:

x is 0, 1, or 2;

n is 1, 2, 3, or 4;

each Ra and Rb is, independently, H, a protecting group, hydroxyl, C1-C12 alkyl, substituted C1-C12 alkyl, C2-C12 alkenyl, substituted C2-C12 alkenyl, C2-C12 alkynyl, substituted C2-C12 alkynyl, C5-C20 aryl, substituted C5-C20 aryl, heterocycle radical, substituted heterocycle radical, heteroaryl, substituted heteroaryl, C5-C7 alicyclic radical, substituted C5-C7 alicyclic radical, halogen, OJ1, NJ1J2, SJ1, N3, COOJ1, acyl (C(═O)—H), substituted acyl, CN, sulfonyl (S(═O)2-J1), or sulfoxyl (S(═O)-J1); and

each J1 and J2 is, independently, H, C1-C12 alkyl, substituted C1-C12 alkyl, C2-C12 alkenyl, substituted C2-C12 alkenyl, C2-C12 alkynyl, substituted C2-C12 alkynyl, C5-C20 aryl, substituted C5-C20 aryl, acyl (C(═O)—H), substituted acyl, a heterocycle radical, a substituted heterocycle radical, C1-C12 aminoalkyl, substituted C1-C12 aminoalkyl, or a protecting group.

Additional bicyclic sugar moieties are known in the art, see, for example: Freier et al., Nucleic Acids Research, 1997, 25(22), 4429-4443, Albaek et al., J Org. Chem., 2006, 71, 7731-7740, Singh et al., Chem. Commun., 1998, 4, 455-456; Koshkin et al., Tetrahedron, 1998, 54, 3607-3630; Kumar et al., Bioorg. Med. Chem. Lett., 1998, 8, 2219-2222; Singh et al., J Org. Chem., 1998, 63, 10035-10039; Srivastava et al., J Am. Chem. Soc., 20017, 129, 8362-8379; Elayadi et al., Wengel et a., U.S. Pat. No. 7,053,207; Imanishi et al., U.S. Pat. No. 6,268,490; Imanishi et al. U.S. Pat. No. 6,770,748; Imanishi et al., U.S. RE44,779; Wengel et al., U.S. Pat. No. 6,794,499; Wengel et al., U.S. Pat. No. 6,670,461; Wengel et al., U.S. Pat. No. 7,034,133; Wengel et al., U.S. Pat. No. 8,080,644; Wengel et al., U.S. Pat. No. 8,034,909; Wengel et al., U.S. Pat. No. 8,153,365; Wengel et al., U.S. Pat. No. 7,572,582; and Ramasamy et al., U.S. Pat. No. 6,525,191; Torsten et al., WO 2004/106356; Wengel et al., WO 1999/014226; Seth et al., WO 2007/134181; Seth et al., U.S. Pat. No. 7,547,684; Seth et al., U.S. Pat. No. 7,666,854; Seth et al., U.S. Pat. No. 8,088,746; Seth et al., U.S. Pat. No. 7,750,131; Seth et al., U.S. Pat. No. 8,030,467; Seth et al., U.S. Pat. No. 8,268,980; Seth et al., U.S. Pat. No. 8,546,556; Seth et al., U.S. Pat. No. 8,530,640; Migawa et al., U.S. Pat. No. 9,012,421; Seth et al., U.S. Pat. No. 8,501,805; and U.S. Patent Publication Nos. Allerson et al., US2008/0039618 and Migawa et al., US2015/0191727.

In certain embodiments, bicyclic sugar moieties and nucleosides incorporating such bicyclic sugar moieties are further defined by isomeric configuration. For example, an LNA nucleoside (described herein) may be in the α-L configuration or in the β-D configuration.

α-L-methyleneoxy (4′-CH2—O-2′) or α-L-LNA bicyclic nucleosides have been incorporated into antisense oligonucleotides that showed antisense activity (Frieden et al., Nucleic Acids Research, 2003, 21, 6365-6372). Herein, general descriptions of bicyclic nucleosides include both isomeric configurations. When the positions of specific bicyclic nucleosides (e.g., LNA) are identified in exemplified embodiments herein, they are in the f-D configuration, unless otherwise specified.

In certain embodiments, modified sugar moieties comprise one or more non-bridging sugar substituent and one or more bridging sugar substituent (e.g., 5′-substituted and 4′-2′ bridged sugars).

In certain embodiments, modified sugar moieties are sugar surrogates. In certain such embodiments, the oxygen atom of the sugar moiety is replaced, e.g., with a sulfur, carbon or nitrogen atom. In certain such embodiments, such modified sugar moieties also comprise bridging and/or non-bridging substituents as described herein. For example, certain sugar surrogates comprise a 4′-sulfur atom and a substitution at the 2′-position (see, e.g., Bhat et al., U.S. Pat. No. 7,875,733 and Bhat et al., U.S. Pat. No. 7,939,677) and/or the 5′ position.

In certain embodiments, sugar surrogates comprise rings having other than 5 atoms. For example, in certain embodiments, a sugar surrogate comprises a six-membered tetrahydropyran (“THP”). Such tetrahydropyrans may be further modified or substituted. Nucleosides comprising such modified tetrahydropyrans include but are not limited to hexitol nucleic acid (“HNA”), anitol nucleic acid (“ANA”), mannitol nucleic acid (“MNA”) (see, e.g., Leumann, C J. Bioorg. & Med. Chem. 2002, 10, 841-854), fluoro HNA:

(“F-HNA”, see e.g. Swayze et al., U.S. Pat. No. 8,088,904; Swayze et al., U.S. Pat. No. 8,440,803; Swayze et al., U.S. Pat. No. 8,796,437; and Swayze et al., U.S. Pat. No. 9,005,906; F-HNA can also be referred to as a F-THP or 3′-fluoro tetrahydropyran), and nucleosides comprising additional modified THP compounds having the formula:

wherein, independently, for each of said modified THP nucleoside:

Bx is a nucleobase moiety;

T3 and T4 are each, independently, an internucleoside linking group linking the modified THP nucleoside to the remainder of an oligonucleotide or one of T3 and T4 is an internucleoside linking group linking the modified THP nucleoside to the remainder of an oligonucleotide and the other of T3 and T4 is H, a hydroxyl protecting group, a linked conjugate group, or a 5′ or 3-terminal group; q1, q2, q3, q4, q5, q6 and q7 are each, independently, H, C1-C6 alkyl, substituted C1-C6 alkyl, C2-C6 alkenyl, substituted C2-C6 alkenyl, C2-C6 alkynyl, or substituted C2-C6 alkynyl; and

each of R1 and R2 is independently selected from among: hydrogen, halogen, substituted or unsubstituted alkoxy, NJ1J2, SJ1, N3, OC(═X)J1, OC(═X)NJ1J2, NJ3C(═X)NJ1J2, and CN, wherein X is O, S or NJ1, and each J1, J2, and J3 is, independently, H or C1-C6 alkyl.

In certain embodiments, modified THP nucleosides are provided wherein q1, q2, q3, q4, q5, q6 and q7 are each H. In certain embodiments, at least one of q1, q2, q3, q4, q5, q6 and q7 is other than H. In certain embodiments, at least one of q1, q2, q3, q4, q5, q6 and q7 is methyl. In certain embodiments, modified THP nucleosides are provided wherein one of R1 and R2 is F. In certain embodiments, R1 is F and R2 is H, in certain embodiments, R1 is methoxy and R2 is H, and in certain embodiments, R1 is methoxyethoxy and R2 is H.

In certain embodiments, sugar surrogates comprise rings having more than 5 atoms and more than one heteroatom. For example, nucleosides comprising morpholino sugar moieties and their use in oligonucleotides have been reported (see, e.g., Braasch et al., Biochemistry, 2002, 41, 4503-4510 and Summerton et al., U.S. Pat. No. 5,698,685; Summerton et al., U.S. Pat. No. 5,166,315; Summerton et al., U.S. Pat. No. 5,185,444; and Summerton et al., U.S. Pat. No. 5,034,506). As used here, the term “morpholino” means a sugar surrogate having the following structure:

In certain embodiments, morpholinos may be modified, for example by adding or altering various substituent groups from the above morpholino structure. Such sugar surrogates are referred to herein as “modified morpholinos.”

In certain embodiments, sugar surrogates comprise acyclic moieties. Examples of nucleosides and oligonucleotides comprising such acyclic sugar surrogates include but are not limited to: peptide nucleic acid (“PNA”), acyclic butyl nucleic acid (see, e.g., Kumar et al., Org. Biomol. Chem., 2013, 11, 5853-5865), and nucleosides and oligonucleotides described in Manoharan et al., WO2011/133876.

Many other bicyclic and tricyclic sugar and sugar surrogate ring systems are known in the art that can be used in modified nucleosides).

2. Modified Nucleobases

In certain embodiments, modified nucleobases are selected from: 5-substituted pyrimidines, 6-azapyrimidines, alkyl or alkynyl substituted pyrimidines, alkyl substituted purines, and N-2, N-6 and O-6 substituted purines. In certain embodiments, modified nucleobases are selected from: 2-aminopropyladenine, 5-hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-N-methylguanine, 6-N-methyladenine, 2-propyladenine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-propynyl (—C≡C—CH3) uracil, 5-propynylcytosine, 6-azouracil, 6-azocytosine, 6-azothymine, 5-ribosyluracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl, 8-aza and other 8-substituted purines, 5-halo, particularly 5-bromo, 5-trifluoromethyl, 5-halouracil, and 5-halocytosine, 7-methylguanine, 7-methyladenine, 2-F-adenine, 2-aminoadenine, 7-deazaguanine, 7-deazaadenine, 3-deazaguanine, 3-deazaadenine, 6-N-benzoyladenine, 2-N-isobutyrylguanine, 4-N-benzoylcytosine, 4-N-benzoyluracil, 5-methyl 4-N-benzoylcytosine, 5-methyl 4-N-benzoyluracil, universal bases, hydrophobic bases, promiscuous bases, size-expanded bases, and fluorinated bases. Further modified nucleobases include tricyclic pyrimidines, such as 1,3-diazaphenoxazine-2-one, 1,3-diazaphenothiazine-2-one and 9-(2-aminoethoxy)-1,3-diazaphenoxazine-2-one (G-clamp). Modified nucleobases may also include those in which the purine or pyrimidine base is replaced with other heterocycles, for example 7-deaza-adenine, 7-deazaguanosine, 2-aminopyridine and 2-pyridone. Further nucleobases include those disclosed in Merigan et al., U.S. Pat. No. 3,687,808, those disclosed in The Concise Encyclopedia Of Polymer Science And Engineering, Kroschwitz, J. I., Ed., John Wiley & Sons, 1990, 858-859; Englisch et al., Angewandte Chemie, International Edition, 1991, 30, 613; Sanghvi, Y. S., Chapter 15, Antisense Research and Applications, Crooke, S. T. and Lebleu, B., Eds., CRC Press, 1993, 273-288; and those disclosed in Chapters 6 and 15, Antisense Drug Technology, Crooke S. T., Ed., CRC Press, 2008, 163-166 and 442-443.

Publications that teach the preparation of certain of the above noted modified nucleobases as well as other modified nucleobases include without limitation, Manohara et al., US2003/0158403; Manoharan et al., US2003/0175906; Dinh et al., U.S. Pat. No. 4,845,205; Spielvogel et al., U.S. Pat. No. 5,130,302; Rogers et al., U.S. Pat. No. 5,134,066; Bischofberger et al., U.S. Pat. No. 5,175,273; Urdea et al., U.S. Pat. No. 5,367,066; Benner et al., U.S. Pat. No. 5,432,272; Matteucci et al., U.S. Pat. No. 5,434,257; Gmeiner et al., U.S. Pat. No. 5,457,187; Cook et al., U.S. Pat. No. 5,459,255; Froehler et al., U.S. Pat. No. 5,484,908; Matteucci et al., U.S. Pat. No. 5,502,177; Hawkins et al., U.S. Pat. No. 5,525,711; Haralambidis et al., U.S. Pat. No. 5,552,540; Cook et al., U.S. Pat. No. 5,587,469; Froehler et al., U.S. Pat. No. 5,594,121; Switzer et al., U.S. Pat. No. 5,596,091; Cook et al., U.S. Pat. No. 5,614,617; Froehler et al., U.S. Pat. No. 5,645,985; Cook et al., U.S. Pat. No. 5,681,941; Cook et al., U.S. Pat. No. 5,811,534; Cook et al., U.S. Pat. No. 5,750,692; Cook et al., U.S. Pat. No. 5,948,903; Cook et al., U.S. Pat. No. 5,587,470; Cook et al., U.S. Pat. No. 5,457,191; Matteucci et al., U.S. Pat. No. 5,763,588; Froehler et al., U.S. Pat. No. 5,830,653; Cook et al., U.S. Pat. No. 5,808,027; Cook et al., 6,166,199; and Matteucci et al., U.S. Pat. No. 6,005,096.

In certain embodiments, compounds comprise or consist of a modified oligonucleotide complementary to an α-DNM2 nucleic acid comprising one or more modified nucleobases. In certain embodiments, the modified nucleobase is 5-methylcytosine. In certain embodiments, each cytosine is a 5-methylcytosine.

B. Modified Internucleoside Linkages

In certain embodiments, compounds described herein having one or more modified internucleoside linkages are selected over compounds having only phosphodiester internucleoside linkages because of desirable properties such as, for example, enhanced cellular uptake, enhanced affinity for target nucleic acids, and increased stability in the presence of nucleases.

In certain embodiments, compounds comprise or consist of a modified oligonucleotide complementary to a DNM2 nucleic acid comprising one or more modified internucleoside linkages. In certain embodiments, the modified internucleoside linkages are phosphorothioate linkages. In certain embodiments, each internucleoside linkage of an antisense compound is a phosphorothioate internucleoside linkage.

In certain embodiments, nucleosides of modified oligonucleotides may be linked together using any internucleoside linkage. The two main classes of internucleoside linking groups are defined by the presence or absence of a phosphorus atom. Representative phosphorus-containing internucleoside linkages include but are not limited to phosphates, which contain a phosphodiester bond (“P═O”) (also referred to as unmodified or naturally occurring linkages), phosphotriesters, methylphosphonates, phosphoramidates, and phosphorothioates (“P═S”), and phosphorodithioates (“HS—P=S”). Representative non-phosphorus containing internucleoside linking groups include but are not limited to methylenemethylimino (—CH2—N(CH3)—O—CH2—), thiodiester, thionocarbamate (—O—C(═O)(NH)—S—); siloxane (—O—SiH2—O—); and N,N′-dimethylhydrazine (—CH2—N(CH3)—N(CH3)—). Modified internucleoside linkages, compared to naturally occurring phosphate linkages, can be used to alter, typically increase, nuclease resistance of the oligonucleotide. Methods of preparation of phosphorous-containing and non-phosphorous-containing internucleoside linkages are well known to those skilled in the art.

Representative internucleoside linkages having a chiral center include but are not limited to alkylphosphonates and phosphorothioates. Modified oligonucleotides comprising internucleoside linkages having a chiral center can be prepared as populations of modified oligonucleotides comprising stereorandom internucleoside linkages, or as populations of modified oligonucleotides comprising phosphorothioate linkages in particular stereochemical configurations. In certain embodiments, populations of modified oligonucleotides comprise phosphorothioate internucleoside linkages wherein all of the phosphorothioate internucleoside linkages are stereorandom. Such modified oligonucleotides can be generated using synthetic methods that result in random selection of the stereochemical configuration of each phosphorothioate linkage. Nonetheless, as is well understood by those of skill in the art, each individual phosphorothioate of each individual oligonucleotide molecule has a defined stereoconfiguration. In certain embodiments, populations of modified oligonucleotides are enriched for modified oligonucleotides comprising one or more particular phosphorothioate internucleoside linkages in a particular, independently selected stereochemical configuration. In certain embodiments, the particular configuration of the particular phosphorothioate linkage is present in at least 65% of the molecules in the population. In certain embodiments, the particular configuration of the particular phosphorothioate linkage is present in at least 70% of the molecules in the population. In certain embodiments, the particular configuration of the particular phosphorothioate linkage is present in at least 80% of the molecules in the population. In certain embodiments, the particular configuration of the particular phosphorothioate linkage is present in at least 90% of the molecules in the population. In certain embodiments, the particular configuration of the particular phosphorothioate linkage is present in at least 99% of the molecules in the population. Such chirally enriched populations of modified oligonucleotides can be generated using synthetic methods known in the art, e.g., methods described in Oka et al., JACS 125, 8307 (2003), Wan et al. Nuc. Acid. Res. 42, 13456 (2014), and WO 2017/015555. In certain embodiments, a population of modified oligonucleotides is enriched for modified oligonucleotides having at least one indicated phosphorothioate in the (Sp) configuration. In certain embodiments, a population of modified oligonucleotides is enriched for modified oligonucleotides having at least one phosphorothioate in the (Rp) configuration. In certain embodiments, modified oligonucleotides comprising (Rp) and/or (Sp) phosphorothioates comprise one or more of the following formulas, respectively, wherein “B” indicates a nucleobase:

Unless otherwise indicated, chiral internucleoside linkages of modified oligonucleotides described herein can be stereorandom or in a particular stereochemical configuration.

Neutral internucleoside linkages include, without limitation, phosphotriesters, methylphosphonates, MMI (3′-CH2—N(CH3)—O-5′), amide-3 (3′-CH2—C(═O)—N(H)-5′), amide-4 (3′-CH2—N(H)—C(═O)-5′), formacetal (3′-O—CH2—O-5′), methoxypropyl, and thioformacetal (3′-S—CH2—O-5′). Further neutral internucleoside linkages include nonionic linkages comprising siloxane (dialkylsiloxane), carboxylate ester, carboxamide, sulfide, sulfonate ester and amides (See for example: Carbohydrate Modifications in Antisense Research; Y. S. Sanghvi and P. D. Cook, Eds., ACS Symposium Series 580; Chapters 3 and 4, 40-65). Further neutral internucleoside linkages include nonionic linkages comprising mixed N, O, S and CH2 component parts.

II. Certain Motifs

In certain embodiments, compounds described herein comprise or consist of oligonucleotides. Oligonucleotides can have a motif, e.g. a pattern of unmodified and/or modified sugar moieties, nucleobases, and/or internucleoside linkages. In certain embodiments, modified oligonucleotides comprise one or more modified nucleoside comprising a modified sugar. In certain embodiments, modified oligonucleotides comprise one or more modified nucleosides comprising a modified nucleobase. In certain embodiments, modified oligonucleotides comprise one or more modified internucleoside linkage. In such embodiments, the modified, unmodified, and differently modified sugar moieties, nucleobases, and/or internucleoside linkages of a modified oligonucleotide define a pattern or motif. In certain embodiments, the patterns or motifs of sugar moieties, nucleobases, and internucleoside linkages are each independent of one another. Thus, a modified oligonucleotide may be described by its sugar motif, nucleobase motif and/or internucleoside linkage motif (as used herein, nucleobase motif describes the modifications to the nucleobases independent of the sequence of nucleobases).

A. Certain Sugar Motifs

In certain embodiments, compounds described herein comprise or consist of oligonucleotides. In certain embodiments, oligonucleotides comprise one or more type of modified sugar and/or unmodified sugar moiety arranged along the oligonucleotide or region thereof in a defined pattern or sugar motif. In certain instances, such sugar motifs include but are not limited to any of the sugar modifications discussed herein.

In certain embodiments, modified oligonucleotides comprise or consist of a region having a gapmer motif, which comprises two external segments or “wings” and a central or internal segment or “gap.” The three segments of a gapmer motif (the 5′-wing, the gap, and the 3′-wing) form a contiguous sequence of nucleosides wherein at least some of the sugar moieties of the nucleosides of each of the wings differ from at least some of the sugar moieties of the nucleosides of the gap. Specifically, at least the sugar moieties of the nucleosides of each wing that are immediately adjacent to the gap (the 3′-terminal wing nucleoside of the 5′-wing and the 5′-terminal wing nucleoside of the 3′-wing) differ from the sugar moiety of the adjacent gap nucleosides. In certain embodiments, the sugar moieties within the gap are the same as one another. In certain embodiments, the gap includes one or more nucleoside having a sugar moiety that differs from the sugar moiety of one or more other nucleosides of the gap.

In certain embodiments, the wings of a gapmer each comprise 1-5 nucleosides. In certain embodiments, the wings of a gapmer each comprise 2-5 nucleosides. In certain embodiments, the wings of a gapmer each comprise 3-5 nucleosides. In certain embodiments, the nucleosides of the wings of a gapmer are all modified nucleosides. In certain such embodiments, the sugar moieties of the wings of a gapmer are all modified sugar moieties.

In certain embodiments, the gap of a gapmer comprises 7-12 nucleosides. In certain embodiments, the gap of a gapmer comprises 7-10 nucleosides. In certain embodiments, the gap of a gapmer comprises 8-10 nucleosides. In certain embodiments, the gap of a gapmer comprises 10 nucleosides. In certain embodiments, each nucleoside of the gap of a gapmer is a 2′-deoxynucleoside.

In certain embodiments, the gapmer is a deoxy gapmer. In such embodiments, the nucleosides on the gap side of each wing/gap junction are 2′-deoxynucleosides and the terminal wing nucleosides immediately adjacent to the gap comprise modified sugar moieties. In certain such embodiments, each nucleoside of the gap is a 2′-deoxynucleoside. In certain such embodiments, each nucleoside of each wing comprises a modified sugar moiety.

In certain embodiments, a modified oligonucleotide has a fully modified sugar motif wherein each nucleoside of the modified oligonucleotide comprises a modified sugar moiety. In certain embodiments, modified oligonucleotides comprise or consist of a region having a fully modified sugar motif wherein each nucleoside of the region comprises a modified sugar moiety. In certain embodiments, modified oligonucleotides comprise or consist of a region having a fully modified sugar motif, wherein each nucleoside within the fully modified region comprises the same modified sugar moiety, referred to herein as a uniformly modified sugar motif. In certain embodiments, a fully modified oligonucleotide is a uniformly modified oligonucleotide. In certain embodiments, each nucleoside of a uniformly modified oligonucleotide comprises the same 2′-modification.

B. Certain Nucleobase Motifs

In certain embodiments, compounds described herein comprise or consist of oligonucleotides. In certain embodiments, oligonucleotides comprise modified and/or unmodified nucleobases arranged along the oligonucleotide or region thereof in a defined pattern or motif. In certain embodiments, each nucleobase is modified. In certain embodiments, none of the nucleobases are modified. In certain embodiments, each purine or each pyrimidine is modified. In certain embodiments, each adenine is modified. In certain embodiments, each guanine is modified. In certain embodiments, each thymine is modified. In certain embodiments, each uracil is modified. In certain embodiments, each cytosine is modified. In certain embodiments, some or all of the cytosine nucleobases in a modified oligonucleotide are 5-methylcytosines.

In certain embodiments, modified oligonucleotides comprise a block of modified nucleobases. In certain such embodiments, the block is at the 3′-end of the oligonucleotide. In certain embodiments the block is within 3 nucleosides of the 3′-end of the oligonucleotide. In certain embodiments, the block is at the 5′-end of the oligonucleotide. In certain embodiments the block is within 3 nucleosides of the 5′-end of the oligonucleotide.

In certain embodiments, oligonucleotides having a gapmer motif comprise a nucleoside comprising a modified nucleobase. In certain such embodiments, one nucleoside comprising a modified nucleobase is in the gap of an oligonucleotide having a gapmer motif. In certain such embodiments, the sugar moiety of said nucleoside is a 2′-deoxyribosyl moiety. In certain embodiments, the modified nucleobase is selected from: a 2-thiopyrimidine and a 5-propynepyrimidine.

C. Certain Internucleoside Linkage Motifs

In certain embodiments, compounds described herein comprise or consist of oligonucleotides. In certain embodiments, oligonucleotides comprise modified and/or unmodified internucleoside linkages arranged along the oligonucleotide or region thereof in a defined pattern or motif. In certain embodiments, each internucleoside linking group is a phosphodiester internucleoside linkage (P═O). In certain embodiments, each internucleoside linking group of a modified oligonucleotide is a phosphorothioate internucleoside linkage (P═S). In certain embodiments, each internucleoside linkage of a modified oligonucleotide is independently selected from a phosphorothioate internucleoside linkage and phosphodiester internucleoside linkage. In certain embodiments, each phosphorothioate internucleoside linkage is independently selected from a stereorandom phosphorothioate, a (Sp) phosphorothioate, and a (Rp) phosphorothioate. In certain embodiments, the sugar motif of a modified oligonucleotide is a gapmer and the internucleoside linkages within the gap are all modified. In certain such embodiments, some or all of the internucleoside linkages in the wings are unmodified phosphate linkages. In certain embodiments, the terminal internucleoside linkages are modified. In certain embodiments, the sugar motif of a modified oligonucleotide is a gapmer, and the internucleoside linkage motif comprises at least one phosphodiester internucleoside linkage in at least one wing, wherein the at least one phosphodiester linkage is not a terminal internucleoside linkage, and the remaining internucleoside linkages are phosphorothioate internucleoside linkages. In certain such embodiments, all of the phosphorothioate linkages are stereorandom. In certain embodiments, all of the phosphorothioate linkages in the wings are (Sp) phosphorothioates, and the gap comprises at least one Sp, Sp, Rp motif. In certain embodiments, populations of modified oligonucleotides are enriched for modified oligonucleotides comprising such internucleoside linkage motifs.

In certain embodiments, oligonucleotides comprise a region having an alternating internucleoside linkage motif. In certain embodiments, oligonucleotides comprise a region of uniformly modified internucleoside linkages. In certain such embodiments, the internucleoside linkages are phosphorothioate internucleoside linkages. In certain embodiments, all of the internucleoside linkages of the oligonucleotide are phosphorothioate internucleoside linkages. In certain embodiments, each internucleoside linkage of the oligonucleotide is selected from phosphodiester or phosphate and phosphorothioate. In certain embodiments, each internucleoside linkage of the oligonucleotide is selected from phosphodiester or phosphate and phosphorothioate and at least one internucleoside linkage is phosphorothioate.

In certain embodiments, the oligonucleotide comprises at least 6 phosphorothioate internucleoside linkages. In certain embodiments, the oligonucleotide comprises at least 8 phosphorothioate internucleoside linkages. In certain embodiments, the oligonucleotide comprises at least 10 phosphorothioate internucleoside linkages. In certain embodiments, the oligonucleotide comprises at least one block of at least 6 consecutive phosphorothioate internucleoside linkages. In certain embodiments, the oligonucleotide comprises at least one block of at least 8 consecutive phosphorothioate internucleoside linkages. In certain embodiments, the oligonucleotide comprises at least one block of at least 10 consecutive phosphorothioate internucleoside linkages. In certain embodiments, the oligonucleotide comprises at least block of at least one 12 consecutive phosphorothioate internucleoside linkages. In certain such embodiments, at least one such block is located at the 3′ end of the oligonucleotide. In certain such embodiments, at least one such block is located within 3 nucleosides of the 3′ end of the oligonucleotide.

In certain embodiments, oligonucleotides comprise one or more methylphosphonate linkages. In certain embodiments, oligonucleotides having a gapmer nucleoside motif comprise a linkage motif comprising all phosphorothioate linkages except for one or two methylphosphonate linkages. In certain embodiments, one methylphosphonate linkage is in the gap of an oligonucleotide having a gapmer sugar motif.

In certain embodiments, it is desirable to arrange the number of phosphorothioate internucleoside linkages and phosphodiester internucleoside linkages to maintain nuclease resistance. In certain embodiments, it is desirable to arrange the number and position of phosphorothioate internucleoside linkages and the number and position of phosphodiester internucleoside linkages to maintain nuclease resistance. In certain embodiments, the number of phosphorothioate internucleoside linkages may be decreased and the number of phosphodiester internucleoside linkages may be increased. In certain embodiments, the number of phosphorothioate internucleoside linkages may be decreased and the number of phosphodiester internucleoside linkages may be increased while still maintaining nuclease resistance. In certain embodiments it is desirable to decrease the number of phosphorothioate internucleoside linkages while retaining nuclease resistance. In certain embodiments it is desirable to increase the number of phosphodiester internucleoside linkages while retaining nuclease resistance.

III. Certain Modified Oligonucleotides

In certain embodiments, compounds described herein comprise or consist of modified oligonucleotides. In certain embodiments, the above modifications (sugar, nucleobase, internucleoside linkage) are incorporated into a modified oligonucleotide. In certain embodiments, modified oligonucleotides are characterized by their modifications, motifs, and overall lengths. In certain embodiments, such parameters are each independent of one another. Thus, unless otherwise indicated, each internucleoside linkage of an oligonucleotide having a gapmer sugar motif may be modified or unmodified and may or may not follow the gapmer modification pattern of the sugar modifications. Likewise, such gapmer oligonucleotides may comprise one or more modified nucleobase independent of the gapmer pattern of the sugar modifications. Furthermore, in certain instances, an oligonucleotide is described by an overall length or range and by lengths or length ranges of two or more regions (e.g., a region of nucleosides having specified sugar modifications), in such circumstances it may be possible to select numbers for each range that result in an oligonucleotide having an overall length falling outside the specified range. In such circumstances, both elements must be satisfied. For example, in certain embodiments, a modified oligonucleotide consists of 15-20 linked nucleosides and has a sugar motif consisting of three regions or segments, A, B, and C, wherein region or segment A consists of 2-6 linked nucleosides having a specified sugar motif, region or segment B consists of 6-10 linked nucleosides having a specified sugar motif, and region or segment C consists of 2-6 linked nucleosides having a specified sugar motif. Such embodiments do not include modified oligonucleotides where A and C each consist of 6 linked nucleosides and B consists of 10 linked nucleosides (even though those numbers of nucleosides are permitted within the requirements for A, B, and C) because the overall length of such oligonucleotide is 22, which exceeds the upper limit of 20 for the overall length of the modified oligonucleotide. Unless otherwise indicated, all modifications are independent of nucleobase sequence except that the modified nucleobase 5-methylcytosine is necessarily a “C” in an oligonucleotide sequence.

In certain embodiments, oligonucleotides consist of X to Y linked nucleosides, where X represents the fewest number of nucleosides in the range and Y represents the largest number nucleosides in the range. In certain such embodiments, X and Y are each independently selected from 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, and 50; provided that X≤Y. For example, in certain embodiments, oligonucleotides consist of 12 to 13, 12 to 14, 12 to 15, 12 to 16, 12 to 17, 12 to 18, 12 to 19, 12 to 20, 12 to 21, 12 to 22, 12 to 23, 12 to 24, 12 to 25, 12 to 26, 12 to 27, 12 to 28, 12 to 29, 12 to 30, 13 to 14, 13 to 15, 13 to 16, 13 to 17, 13 to 18, 13 to 19, 13 to 20, 13 to 21, 13 to 22, 13 to 23, 13 to 24, 13 to 25, 13 to 26, 13 to 27, 13 to 28, 13 to 29, 13 to 30, 14 to 15, 14 to 16, 14 to 17, 14 to 18, 14 to 19, 14 to 20, 14 to 21, 14 to 22, 14 to 23, 14 to 24, 14 to 25, 14 to 26, 14 to 27, 14 to 28, 14 to 29, 14 to 30, 15 to 16, 15 to 17, 15 to 18, 15 to 19, 15 to 20, 15 to 21, 15 to 22, 15 to 23, 15 to 24, 15 to 25, 15 to 26, 15 to 27, 15 to 28, 15 to 29, 15 to 30, 16 to 17, 16 to 18, 16 to 19, 16 to 20, 16 to 21, 16 to 22, 16 to 23, 16 to 24, 16 to 25, 16 to 26, 16 to 27, 16 to 28, 16 to 29, 16 to 30, 17 to 18, 17 to 19, 17 to 20, 17 to 21, 17 to 22, 17 to 23, 17 to 24, 17 to 25, 17 to 26, 17 to 27, 17 to 28, 17 to 29, 17 to 30, 18 to 19, 18 to 20, 18 to 21, 18 to 22, 18 to 23, 18 to 24, 18 to 25, 18 to 26, 18 to 27, 18 to 28, 18 to 29, 18 to 30, 19 to 20, 19 to 21, 19 to 22, 19 to 23, 19 to 24, 19 to 25, 19 to 26, 19 to 29, 19 to 28, 19 to 29, 19 to 30, 20 to 21, 20 to 22, 20 to 23, 20 to 24, 20 to 25, 20 to 26, 20 to 27, 20 to 28, 20 to 29, 20 to 30, 21 to 22, 21 to 23, 21 to 24, 21 to 25, 21 to 26, 21 to 27, 21 to 28, 21 to 29, 21 to 30, 22 to 23, 22 to 24, 22 to 25, 22 to 26, 22 to 27, 22 to 28, 22 to 29, 22 to 30, 23 to 24, 23 to 25, 23 to 26, 23 to 27, 23 to 28, 23 to 29, 23 to 30, 24 to 25, 24 to 26, 24 to 27, 24 to 28, 24 to 29, 24 to 30, 25 to 26, 25 to 27, 25 to 28, 25 to 29, 25 to 30, 26 to 27, 26 to 28, 26 to 29, 26 to 30, 27 to 28, 27 to 29, 27 to 30, 28 to 29, 28 to 30, or 29 to 30 linked nucleosides.

In certain embodiments oligonucleotides have a nucleobase sequence that is complementary to a second oligonucleotide or an identified reference nucleic acid, such as a target nucleic acid. In certain embodiments, a region of an oligonucleotide has a nucleobase sequence that is complementary to a second oligonucleotide or an identified reference nucleic acid, such as a target nucleic acid. In certain embodiments, the nucleobase sequence of a region or entire length of an oligonucleotide is at least 70%, at least 80%, at least 90%, at least 95%, or 100% complementary to the second oligonucleotide or nucleic acid, such as a target nucleic acid.

IV. Certain Conjugated Compounds

In certain embodiments, the compounds described herein comprise or consist of an oligonucleotide (modified or unmodified) and optionally one or more conjugate groups and/or terminal groups. Conjugate groups consist of one or more conjugate moiety and a conjugate linker that links the conjugate moiety to the oligonucleotide. Conjugate groups may be attached to either or both ends of an oligonucleotide and/or at any internal position. In certain embodiments, conjugate groups are attached to the 2-position of a nucleoside of a modified oligonucleotide. In certain embodiments, conjugate groups that are attached to either or both ends of an oligonucleotide are terminal groups. In certain such embodiments, conjugate groups or terminal groups are attached at the 3′ and/or 5′-end of oligonucleotides. In certain such embodiments, conjugate groups (or terminal groups) are attached at the 3′-end of oligonucleotides. In certain embodiments, conjugate groups are attached near the 3′-end of oligonucleotides. In certain embodiments, conjugate groups (or terminal groups) are attached at the 5′-end of oligonucleotides. In certain embodiments, conjugate groups are attached near the 5′-end of oligonucleotides.

Examples of terminal groups include but are not limited to conjugate groups, capping groups, phosphate moieties, protecting groups, modified or unmodified nucleosides, and two or more nucleosides that are independently modified or unmodified.

A. Certain Conjugate Groups

In certain embodiments, oligonucleotides are covalently attached to one or more conjugate groups. In certain embodiments, conjugate groups modify one or more properties of the attached oligonucleotide, including but not limited to pharmacodynamics, pharmacokinetics, stability, binding, absorption, tissue distribution, cellular distribution, cellular uptake, charge and clearance. In certain embodiments, conjugate groups impart a new property on the attached oligonucleotide, e.g., fluorophores or reporter groups that enable detection of the oligonucleotide.

Certain conjugate groups and conjugate moieties have been described previously, for example: cholesterol moiety (Letsinger et al., Proc. Natl. Acad. Sci. USA, 1989, 86, 6553-6556), cholic acid (Manoharan et al., Bioorg. Med. Chem. Lett., 1994, 4, 1053-1060), a thioether, e.g., hexyl-S-tritylthiol (Manoharan et al., Ann. N.Y. Acad. Sci., 1992, 660, 306-309; Manoharan et al., Bioorg. Med. Chem. Lett., 1993, 3, 2765-2770), a thiocholesterol (Oberhauser et al., Nucl. Acids Res., 1992, 20, 533-538), an aliphatic chain, e.g., do-decan-diol or undecyl residues (Saison-Behmoaras et al., EMBO J., 1991, 10, 1111-1118; Kabanov et al., FEBS Lett., 1990, 259, 327-330; Svinarchuk et al., Biochimie, 1993, 75, 49-54), a phospholipid, e.g., di-hexadecyl-rac-glycerol or triethyl-ammonium 1,2-di-O-hexadecyl-rac-glycero-3-H-phosphonate (Manoharan et al., Tetrahedron Lett., 1995, 36, 3651-3654; Shea et al., Nucl. Acids Res., 1990, 18, 3777-3783), a polyamine or a polyethylene glycol chain (Manoharan et al., Nucleosides & Nucleotides, 1995, 14, 969-973), or adamantane acetic, a palmityl moiety (Mishra et al., Biochim. Biophys. Acta, 1995, 1264, 229-237), an octadecylamine or hexylamino-carbonyl-oxycholesterol moiety (Crooke et al., J Pharmacol. Exp. Ther., 1996, i, 923-937), a tocopherol group (Nishina et al., Molecular Therapy Nucleic Acids, 2015, 4, e220; doi:10.1038/mtna.2014.72 and Nishina et al., Molecular Therapy, 2008, 16, 734-740), or a GalNAc cluster (e.g., WO2014/179620).

1. Conjugate Moieties

Conjugate moieties include, without limitation, intercalators, reporter molecules, polyamines, polyamides, peptides, carbohydrates (e.g., GalNAc), vitamin moieties, polyethylene glycols, thioethers, polyethers, cholesterols, thiocholesterols, cholic acid moieties, folate, lipids, phospholipids, biotin, phenazine, phenanthridine, anthraquinone, adamantane, acridine, fluoresceins, rhodamines, coumarins, fluorophores, and dyes.

In certain embodiments, a conjugate moiety comprises an active drug substance, for example, aspirin, warfarin, phenylbutazone, ibuprofen, suprofen, fen-bufen, ketoprofen, (S)-(+)-pranoprofen, carprofen, dansylsarcosine, 2,3,5-triiodobenzoic acid, fingolimod, flufenamic acid, folinic acid, a benzothiadiazide, chlorothiazide, a diazepine, indo-methicin, a barbiturate, a cephalosporin, a sulfa drug, an antidiabetic, an antibacterial or an antibiotic.

2. Conjugate Linkers

Conjugate moieties are attached to oligonucleotides through conjugate linkers. In certain compounds, a conjugate group is a single chemical bond (i.e. conjugate moiety is attached to an oligonucleotide via a conjugate linker through a single bond). In certain embodiments, the conjugate linker comprises a chain structure, such as a hydrocarbyl chain, or an oligomer of repeating units such as ethylene glycol, nucleosides, or amino acid units.

In certain embodiments, a conjugate linker comprises one or more groups selected from alkyl, amino, oxo, amide, disulfide, polyethylene glycol, ether, thioether, and hydroxylamino. In certain such embodiments, the conjugate linker comprises groups selected from alkyl, amino, oxo, amide and ether groups. In certain embodiments, the conjugate linker comprises groups selected from alkyl and amide groups. In certain embodiments, the conjugate linker comprises groups selected from alkyl and ether groups. In certain embodiments, the conjugate linker comprises at least one phosphorus moiety. In certain embodiments, the conjugate linker comprises at least one phosphate group. In certain embodiments, the conjugate linker includes at least one neutral linking group.

In certain embodiments, conjugate linkers, including the conjugate linkers described above, are bifunctional linking moieties, e.g., those known in the art to be useful for attaching conjugate groups to parent compounds, such as the oligonucleotides provided herein. In general, a bifunctional linking moiety comprises at least two functional groups. One of the functional groups is selected to bind to a particular site on a compound and the other is selected to bind to a conjugate group. Examples of functional groups used in a bifunctional linking moiety include but are not limited to electrophiles for reacting with nucleophilic groups and nucleophiles for reacting with electrophilic groups. In certain embodiments, bifunctional linking moieties comprise one or more groups selected from amino, hydroxyl, carboxylic acid, thiol, alkyl, alkenyl, and alkynyl.

Examples of conjugate linkers include but are not limited to pyrrolidine, 8-amino-3,6-dioxaoctanoic acid (ADO), succinimidyl 4-(N-maleimidomethyl) cyclohexane-1-carboxylate (SMCC) and 6-aminohexanoic acid (AHEX or AHA). Other conjugate linkers include but are not limited to substituted or unsubstituted C1-C10 alkyl, substituted or unsubstituted C2-C10 alkenyl or substituted or unsubstituted C2-C10 alkynyl, wherein a nonlimiting list of preferred substituent groups includes hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro, thiol, thioalkoxy, halogen, alkyl, aryl, alkenyl and alkynyl.

In certain embodiments, conjugate linkers comprise 1-10 linker-nucleosides. In certain embodiments, such linker-nucleosides are modified nucleosides. In certain embodiments such linker-nucleosides comprise a modified sugar moiety. In certain embodiments, linker-nucleosides are unmodified. In certain embodiments, linker-nucleosides comprise an optionally protected heterocyclic base selected from a purine, substituted purine, pyrimidine or substituted pyrimidine. In certain embodiments, a cleavable moiety is a nucleoside selected from uracil, thymine, cytosine, 4-N-benzoylcytosine, 5-methylcytosine, 4-N-benzoyl-5-methylcytosine, adenine, 6-N-benzoyladenine, guanine and 2-N-isobutyrylguanine. It is typically desirable for linker-nucleosides to be cleaved from the compound after it reaches a target tissue. Accordingly, linker-nucleosides are typically linked to one another and to the remainder of the compound through cleavable bonds. In certain embodiments, such cleavable bonds are phosphodiester bonds.

Herein, linker-nucleosides are not considered to be part of the oligonucleotide. Accordingly, in embodiments in which a compound comprises an oligonucleotide consisting of a specified number or range of linked nucleosides and/or a specified percent complementarity to a reference nucleic acid and the compound also comprises a conjugate group comprising a conjugate linker comprising linker-nucleosides, those linker-nucleosides are not counted toward the length of the oligonucleotide and are not used in determining the percent complementarity of the oligonucleotide for the reference nucleic acid. For example, a compound may comprise (1) a modified oligonucleotide consisting of 8-30 nucleosides and (2) a conjugate group comprising 1-10 linker-nucleosides that are contiguous with the nucleosides of the modified oligonucleotide. The total number of contiguous linked nucleosides in such a compound is more than 30. Alternatively, an compound may comprise a modified oligonucleotide consisting of 8-30 nucleosides and no conjugate group. The total number of contiguous linked nucleosides in such a compound is no more than 30. Unless otherwise indicated conjugate linkers comprise no more than 10 linker-nucleosides. In certain embodiments, conjugate linkers comprise no more than 5 linker-nucleosides. In certain embodiments, conjugate linkers comprise no more than 3 linker-nucleosides. In certain embodiments, conjugate linkers comprise no more than 2 linker-nucleosides. In certain embodiments, conjugate linkers comprise no more than 1 linker-nucleoside.

In certain embodiments, it is desirable for a conjugate group to be cleaved from the oligonucleotide. For example, in certain circumstances compounds comprising a particular conjugate moiety are better taken up by a particular cell type, but once the compound has been taken up, it is desirable that the conjugate group be cleaved to release the unconjugated or parent oligonucleotide. Thus, certain conjugate may comprise one or more cleavable moieties, typically within the conjugate linker. In certain embodiments, a cleavable moiety is a cleavable bond. In certain embodiments, a cleavable moiety is a group of atoms comprising at least one cleavable bond. In certain embodiments, a cleavable moiety comprises a group of atoms having one, two, three, four, or more than four cleavable bonds. In certain embodiments, a cleavable moiety is selectively cleaved inside a cell or subcellular compartment, such as a lysosome. In certain embodiments, a cleavable moiety is selectively cleaved by endogenous enzymes, such as nucleases.

In certain embodiments, a cleavable bond is selected from among: an amide, an ester, an ether, one or both esters of a phosphodiester, a phosphate ester, a carbamate, or a disulfide. In certain embodiments, a cleavable bond is one or both of the esters of a phosphodiester. In certain embodiments, a cleavable moiety comprises a phosphate or phosphodiester. In certain embodiments, the cleavable moiety is a phosphate linkage between an oligonucleotide and a conjugate moiety or conjugate group.

In certain embodiments, a cleavable moiety comprises or consists of one or more linker-nucleosides. In certain such embodiments, one or more linker-nucleosides are linked to one another and/or to the remainder of the compound through cleavable bonds. In certain embodiments, such cleavable bonds are unmodified phosphodiester bonds. In certain embodiments, a cleavable moiety is 2′-deoxy nucleoside that is attached to either the 3′ or 5′-terminal nucleoside of an oligonucleotide by a phosphate internucleoside linkage and covalently attached to the remainder of the conjugate linker or conjugate moiety by a phosphate or phosphorothioate linkage. In certain such embodiments, the cleavable moiety is 2′-deoxyadenosine.

3. Certain Cell-Targeting Conjugate Moieties

In certain embodiments, a conjugate group comprises a cell-targeting conjugate moiety. In certain embodiments, a conjugate group has the general formula:

    • wherein n is from 1 to about 3, m is 0 when n is 1, m is 1 when n is 2 or greater, j is 1 or 0, and k is 1 or 0.

In certain embodiments, n is 1, j is 1 and k is 0. In certain embodiments, n is 1, j is 0 and k is 1. In certain embodiments, n is 1, j is 1 and k is 1. In certain embodiments, n is 2, j is 1 and k is 0. In certain embodiments, n is 2, j is 0 and k is 1. In certain embodiments, n is 2, j is 1 and k is 1. In certain embodiments, n is 3, j is 1 and k is 0. In certain embodiments, n is 3, j is 0 and k is 1. In certain embodiments, n is 3, j is 1 and k is 1.

In certain embodiments, conjugate groups comprise cell-targeting moieties that have at least one tethered ligand. In certain embodiments, cell-targeting moieties comprise two tethered ligands covalently attached to a branching group. In certain embodiments, cell-targeting moieties comprise three tethered ligands covalently attached to a branching group.

In certain embodiments, the cell-targeting moiety comprises a branching group comprising one or more groups selected from alkyl, amino, oxo, amide, disulfide, polyethylene glycol, ether, thioether and hydroxylamino groups. In certain embodiments, the branching group comprises a branched aliphatic group comprising groups selected from alkyl, amino, oxo, amide, disulfide, polyethylene glycol, ether, thioether and hydroxylamino groups. In certain such embodiments, the branched aliphatic group comprises groups selected from alkyl, amino, oxo, amide and ether groups. In certain such embodiments, the branched aliphatic group comprises groups selected from alkyl, amino and ether groups. In certain such embodiments, the branched aliphatic group comprises groups selected from alkyl and ether groups. In certain embodiments, the branching group comprises a mono or polycyclic ring system.

In certain embodiments, each tether of a cell-targeting moiety comprises one or more groups selected from alkyl, substituted alkyl, ether, thioether, disulfide, amino, oxo, amide, phosphodiester, and polyethylene glycol, in any combination. In certain embodiments, each tether is a linear aliphatic group comprising one or more groups selected from alkyl, ether, thioether, disulfide, amino, oxo, amide, and polyethylene glycol, in any combination. In certain embodiments, each tether is a linear aliphatic group comprising one or more groups selected from alkyl, phosphodiester, ether, amino, oxo, and amide, in any combination. In certain embodiments, each tether is a linear aliphatic group comprising one or more groups selected from alkyl, ether, amino, oxo, and amid, in any combination. In certain embodiments, each tether is a linear aliphatic group comprising one or more groups selected from alkyl, amino, and oxo, in any combination. In certain embodiments, each tether is a linear aliphatic group comprising one or more groups selected from alkyl and oxo, in any combination. In certain embodiments, each tether is a linear aliphatic group comprising one or more groups selected from alkyl and phosphodiester, in any combination. In certain embodiments, each tether comprises at least one phosphorus linking group or neutral linking group. In certain embodiments, each tether comprises a chain from about 6 to about 20 atoms in length. In certain embodiments, each tether comprises a chain from about 10 to about 18 atoms in length. In certain embodiments, each tether comprises about 10 atoms in chain length.

In certain embodiments, each ligand of a cell-targeting moiety has an affinity for at least one type of receptor on a target cell. In certain embodiments, each ligand has an affinity for at least one type of receptor on the surface of a mammalian lung cell.

In certain embodiments, each ligand of a cell-targeting moiety is a carbohydrate, carbohydrate derivative, modified carbohydrate, polysaccharide, modified polysaccharide, or polysaccharide derivative. In certain such embodiments, the conjugate group comprises a carbohydrate cluster (see, e.g., Maier et al., “Synthesis of Antisense Oligonucleotides Conjugated to a Multivalent Carbohydrate Cluster for Cellular Targeting,” Bioconjugate Chemistry, 2003, 14, 18-29, or Rensen et al., “Design and Synthesis of Novel N-Acetylgalactosamine-Terminated Glycolipids for Targeting of Lipoproteins to the Hepatic Asiaglycoprotein Receptor,” J. Med. Chem. 2004, 47, 5798-5808, which are incorporated herein by reference in their entirety).

In certain such embodiments, each ligand is an amino sugar or a thio sugar. For example, amino sugars may be selected from any number of compounds known in the art, such as sialic acid, α-D-galactosamine, β-muramic acid, 2-deoxy-2-methylamino-L-glucopyranose, 4,6-dideoxy-4-formamido-2,3-di-O-methyl-D-mannopyranose, 2-deoxy-2-sulfoamino-D-glucopyranose and N-sulfo-D-glucosamine, and N-glycoloyl-α-neuraminic acid. For example, thio sugars may be selected from 5-Thio-β-D-glucopyranose, methyl 2,3,4-tri-O-acetyl-1-thio-6-O-trityl-α-D-glucopyranoside, 4-thio-β-D-galactopyranose, and ethyl 3,4,6,7-tetra-O-acetyl-2-deoxy-1,5-dithio-α-D-gluco-heptopyranoside.

In certain embodiments compounds described herein comprise a conjugate group found in any of the following references: Lee, Carbohydr Res, 1978, 67, 509-514; Connolly et al., J Biol Chem, 1982, 257, 939-945; Pavia et al., Int J Pep Protein Res, 1983, 22, 539-548; Lee et al., Biochem, 1984, 23, 4255-4261; Lee et al., Glycoconjugate J, 1987, 4, 317-328; Toyokuni et al., Tetrahedron Lett, 1990, 31, 2673-2676; Biessen et al., J Med Chem, 1995, 38, 1538-1546; Valentijn et al., Tetrahedron, 1997, 53, 759-770; Kim et al., Tetrahedron Lett, 1997, 38, 3487-3490; Lee et al., Bioconjug Chem, 1997, 8, 762-765; Kato et al., Glycobiol, 2001, 11, 821-829; Rensen et al., J Biol Chem, 2001, 276, 37577-37584; Lee et al., Methods Enzymol, 2003, 362, 38-43; Westerlind et al., Glycoconj J, 2004, 21, 227-241; Lee et al., Bioorg Med Chem Lett, 2006, 16(19), 5132-5135; Maierhofer et al., Bioorg Med Chem, 2007, 15, 7661-7676; Khorev et al., Bioorg Med Chem, 2008, 16, 5216-5231; Lee et al., Bioorg Med Chem, 2011, 19, 2494-2500; Korilova et al., Analyt Biochem, 2012, 425, 43-46; Pujol et al., Angew Chemie Int Ed Engl, 2012, 51, 7445-7448; Biessen et al., J Med Chem, 1995, 38, 1846-1852; Sliedregt et al., J Med Chem, 1999, 42, 609-618; Rensen et al., J Med Chem, 2004, 47, 5798-5808; Rensen et al., Arterioscler Thromb Vasc Biol, 2006, 26, 169-175; van Rossenberg et al., Gene Ther, 2004, 11, 457-464; Sato et al., J Am Chem Soc, 2004, 126, 14013-14022; Lee et al., J Org Chem, 2012, 77, 7564-7571; Biessen et al., FASEB J, 2000, 14, 1784-1792; Rajur et al., Bioconjug Chem, 1997, 8, 935-940; Duff et al., Methods Enzymol, 2000, 313, 297-321; Maier et al., Bioconjug Chem, 2003, 14, 18-29; Jayaprakash et al., Org Lett, 2010, 12, 5410-5413; Manoharan, Antisense Nucleic Acid Drug Dev, 2002, 12, 103-128; Merwin et al., Bioconjug Chem, 1994, 5, 612-620; Tomiya et al., Bioorg Med Chem, 2013, 21, 5275-5281; International applications WO1998/013381; WO2011/038356; WO1997/046098; WO2008/098788; WO2004/101619; WO2012/037254; WO2011/120053; WO2011/100131; WO2011/163121; WO2012/177947; WO2013/033230; WO2013/075035; WO2012/083185; WO2012/083046; WO2009/082607; WO2009/134487; WO2010/144740; WO2010/148013; WO1997/020563; WO2010/088537; WO2002/043771; WO2010/129709; WO2012/068187; WO2009/126933; WO2004/024757; WO2010/054406; WO2012/089352; WO2012/089602; WO2013/166121; WO2013/165816; U.S. Pat. Nos. 4,751,219; 8,552,163; 6,908,903; 7,262,177; 5,994,517; 6,300,319; 8,106,022; 7,491,805; 7,491,805; 7,582,744; 8,137,695; 6,383,812; 6,525,031; 6,660,720; 7,723,509; 8,541,548; 8,344,125; 8,313,772; 8,349,308; 8,450,467; 8,501,930; 8,158,601; 7,262,177; 6,906,182; 6,620,916; 8,435,491; 8,404,862; 7,851,615; Published U.S. Patent Application Publications US2011/0097264; US2011/0097265; US2013/0004427; US2005/0164235; US2006/0148740; US2008/0281044; US2010/0240730; US2003/0119724; US2006/0183886; US2008/0206869; US2011/0269814; US2009/0286973; US2011/0207799; US2012/0136042; US2012/0165393; US2008/0281041; US2009/0203135; US2012/0035115; US2012/0095075; US2012/0101148; US2012/0128760; US2012/0157509; US2012/0230938; US2013/0109817; US2013/0121954; US2013/0178512; US2013/0236968; US2011/0123520; US2003/0077829; US2008/0108801; and US2009/0203132.

Compositions and Methods for Formulating Pharmaceutical Compositions

Compounds described herein may be admixed with pharmaceutically acceptable active or inert substances for the preparation of pharmaceutical compositions. Compositions and methods for the formulation of pharmaceutical compositions are dependent upon a number of criteria, including, but not limited to, route of administration, extent of disease, or dose to be administered.

Certain embodiments provide pharmaceutical compositions comprising one or more compounds or a salt thereof. Certain embodiments provide pharmaceutical compositions comprising one or more compounds described herein or a salt thereof. In certain embodiments, the compounds are antisense compounds or oligomeric compounds. In certain embodiments, the compounds comprise or consist of a modified oligonucleotide. In certain such embodiments, the pharmaceutical composition comprises a suitable pharmaceutically acceptable diluent or carrier. In certain embodiments, a pharmaceutical composition comprises a sterile saline solution and one or more compound. In certain embodiments, such pharmaceutical composition consists of a sterile saline solution and one or more compound. In certain embodiments, the sterile saline is pharmaceutical grade saline. In certain embodiments, a pharmaceutical composition comprises one or more compound and sterile water. In certain embodiments, a pharmaceutical composition consists of one compound and sterile water. In certain embodiments, the sterile water is pharmaceutical grade water. In certain embodiments, a pharmaceutical composition comprises or consists of one or more compound and phosphate-buffered saline (PBS). In certain embodiments, a pharmaceutical composition consists of one or more compound and sterile PBS. In certain embodiments, the sterile PBS is pharmaceutical grade PBS. Compositions and methods for the formulation of pharmaceutical compositions are dependent upon a number of criteria, including, but not limited to, route of administration, extent of disease, or dose to be administered.

A compound described herein complementary to a DNM2 nucleic acid can be utilized in pharmaceutical compositions by combining the compound with a suitable pharmaceutically acceptable diluent or carrier and/or additional components such that the pharmaceutical composition is suitable for injection. In certain embodiments, a pharmaceutically acceptable diluent is phosphate buffered saline. Accordingly, in one embodiment, employed in the methods described herein is a pharmaceutical composition comprising a compound complementary to a DNM2 nucleic acid and a pharmaceutically acceptable diluent. In certain embodiments, the pharmaceutically acceptable diluent is phosphate buffered saline. In certain embodiments, the compound comprises or consists of a modified oligonucleotide provided herein.

Pharmaceutical compositions comprising compounds provided herein encompass any pharmaceutically acceptable salts, esters, or salts of such esters, or any other oligonucleotide which, upon administration to an animal, including a human, is capable of providing (directly or indirectly) the biologically active metabolite or residue thereof. In certain embodiments, the compounds are antisense compounds or oligomeric compounds. In certain embodiments, the compound comprises or consists of a modified oligonucleotide. Accordingly, for example, the disclosure is also drawn to pharmaceutically acceptable salts of compounds, prodrugs, pharmaceutically acceptable salts of such prodrugs, and other bioequivalents. Suitable pharmaceutically acceptable salts include, but are not limited to, sodium and potassium salts.

A prodrug can include the incorporation of additional nucleosides at one or both ends of a compound which are cleaved by endogenous nucleases within the body, to form the active compound.

In certain embodiments, the compounds or compositions further comprise a pharmaceutically acceptable carrier or diluent.

EXAMPLES

The Examples below describe the screening process used to identify lead compounds targeted to DNM2. Out of over 3,000 oligonucleotides that were screened, many potent and tolerable oligonucleotides were identified, and compounds 951799, 949935, 950023, 950089, 951372, 950060, and 950132 emerged as the top lead compounds. In particular, compound 951799 exhibited the best combination of properties in terms of potency and tolerability.

Non-Limiting Disclosure and Incorporation by Reference

Although the sequence listing accompanying this filing identifies each sequence as either “RNA” or “DNA” as required, in reality, those sequences may be modified with any combination of chemical modifications. One of skill in the art will readily appreciate that such designation as “RNA” or “DNA” to describe modified oligonucleotides is, in certain instances, arbitrary. For example, an oligonucleotide comprising a nucleoside comprising a 2′-OH sugar moiety and a thymine nucleobase could be described as a DNA having an RNA sugar, or as an RNA having a DNA nucleobase.

Accordingly, nucleic acid sequences provided herein, including, but not limited to those in the sequence listing, are intended to encompass nucleic acids containing any combination of unmodified or modified RNA and/or DNA, including, but not limited to such nucleic acids having modified nucleobases. By way of further example and without limitation, an oligonucleotide having the nucleobase sequence “ATCGATCG” encompasses any oligonucleotides having such nucleobase sequence, whether modified or unmodified, including, but not limited to, such compounds comprising RNA bases, such as those having sequence “AUCGAUCG” and those having some DNA bases and some RNA bases such as “AUCGATCG” and compounds having other modified nucleobases, such as “ATmCGAUCG,” wherein mC indicates a cytosine base comprising a methyl group at the 5-position.

While certain compounds, compositions and methods described herein have been described with specificity in accordance with certain embodiments, the following examples serve only to illustrate the compounds described herein and are not intended to limit the same. Each of the references recited in the present application is incorporated herein by reference in its entirety.

Example 1: Effect of Modified Oligonucleotides Complementary to Dynamin 2 In Vitro

Modified oligonucleotides complementary to one or more dynamin 2 (DNM2) nucleic acids were designed and tested for their effect on dynamin 2 mRNA expression in vitro. The modified oligonucleotides were tested in a series of experiments that had similar culture conditions.

A431 cells were cultured at a density of 10,000 cells per well and treated with 4,000 nM modified oligonucleotide via free uptake or no modified oligonucleotide for untreated controls. After approximately 24 hours, RNA was isolated from the cells and DNM2 mRNA levels were measured by quantitative real-time PCR. Human primer probe set RTS36027 (forward sequence GACCTCATGCCAAAGACCAT, designated herein as SEQ ID NO: 4; reverse sequence GTCTGCCGAGGAGTATAGGTA, designated herein as SEQ ID NO: 5; probe sequence CCTTCATCCACCACGAGCTGCT, designated herein as SEQ ID: 6) was used to measure mRNA levels. DNM2 mRNA levels were normalized to total RNA content, as measured by RIBOGREEN®. Results are presented in the tables below as normalized DNM2 mRNA level, relative to untreated control cells.

The modified oligonucleotides in the tables below each have a 3-10-3 cEt gapmer motif, wherein the central gap segment contains ten 2′-deoxynucleosides and is flanked by wing segments on the 3′ and 5′ ends, each containing three cEt nucleosides. All cytosine residues throughout each modified oligonucleotide are 5-methyl cytosines. All internucleoside linkages are phosphorothioate internucleoside linkages.

Each modified oligonucleotide listed in the table below is 100% complementary to human DNM2 nucleic acid sequence GENBANK Number NC_000019.10, truncated from 10715001 to 1083500 (designated herein as SEQ ID NO: 1) and/or GENBANK Number NM_004945.3 (designated herein as SEQ ID NO: 2). “Start Site” indicates the 5′-most nucleoside of the DNM2 nucleic acid to which the oligonucleotide is complementary. “Stop Site” indicates the 3′-most nucleoside of the DNM2 nucleic acid to which the oligonucleotide is complementary. ‘N/A’ indicates that the modified oligonucleotide is not 10000 complementary to the particular nucleic acid. Several oligonucleotides match two or more sites on a nucleic acid, as shown in the table below. As shown below, modified oligonucleotides complementary to human DNM2 inhibited human DNM2 mRNA expression.

TABLE 1
DNM2 mRNA Expression
SEQ SEQ
SEQ ID: SEQ ID: ID: 2 ID 2: SEQ
Compound 1 Start 1 Stop DNM2 Start Stop ID
Number Site Site Sequence (%Control) Site Site NO
694793 3066 3081 CTCAGGCGACACCCGA 96 14 29 7
694833 60707 60722 GATGAGGGTCAAGTTC 20 580 595 8
694838 60773 60788 CTTGATCTGGTACTCG 5 646 661 9
694852 N/A N/A GTCCGTAGGCCTTGGG 46 774 789 10
694853 62119 62134 ACCGATGGTCCGTAGG 76 781 796 11
695014 115999 116014 AATGGTGGGCCGGCTG 99 N/A N/A 12
695171 82451 82466 ACACACTTCAAACTCG 7 N/A N/A 13
695171 82451 82466 ACACACTTCAAACTCG 9 N/A N/A 13
695171 82451 82466 ACACACTTCAAACTCG 5 N/A N/A 13
695171 82451 82466 ACACACTTCAAACTCG 6 N/A N/A 13
695171 82451 82466 ACACACTTCAAACTCG 7 N/A N/A 13
695171 82451 82466 ACACACTTCAAACTCG 8 N/A N/A 13
695171 82451 82466 ACACACTTCAAACTCG 6 N/A N/A 13
695171 82451 82466 ACACACTTCAAACTCG 6 N/A N/A 13
907925 3055 3070 CCCGACCCGAGCGACC 96 3 18 14
907926 3057 3072 CACCCGACCCGAGCGA 77 5 20 15
907927 3059 3074 GACACCCGACCCGAGC 115 7 22 16
907928 3062 3077 GGCGACACCCGACCCG 96 10 25 17
907929 3069 3084 GTTCTCAGGCGACACC 101 17 32 18
907930 3072 3087 CCGGTTCTCAGGCGAC 95 20 35 19
907931 3075 3090 CATCCGGTTCTCAGGC 58 23 38 20
907932 3078 3093 CCTCATCCGGTTCTCA 47 26 41 21
907933 3083 3098 CGCCGCCTCATCCGGT 69 31 46 22
907934 3086 3101 GGTCGCCGCCTCATCC 65 34 49 23
907935 3089 3104 CACGGTCGCCGCCTCA 29 37 52 24
907936 3091 3106 CTCACGGTCGCCGCCT 42 39 54 25
907937 3093 3108 GCCTCACGGTCGCCGC 65 41 56 26
907938 3095 3110 CGGCCTCACGGTCGCC 106 43 58 27
907939 3098 3113 GCTCGGCCTCACGGTC 44 46 61 28
907940 3101 3116 CCGGCTCGGCCTCACG 87 49 64 29
907941 3111 3126 ACGCCCGCTCCCGGCT 100 59 74 30
907942 3123 3138 GGCCTCGGCAAGACGC 96 71 86 31
907943 3126 3141 CCGGGCCTCGGCAAGA 97 74 89 32
907944 3129 3144 CGCCCGGGCCTCGGCA 84 77 92 33
907945 3144 3159 CCGTTGCTCCCCGCCC 5 92 107 34
907946 3146 3161 AGCCGTTGCTCCCCGC 12 94 109 35
907947 3149 3164 TGTAGCCGTTGCTCCC 10 97 112 36
907948 3153 3168 CGTCTGTAGCCGTTGC 8 101 116 37
907949 3171 3186 AACGACCTGGCCCCGC 12 119 134 38
907950 3177 3192 ACCCTCAACGACCTGG 41 125 140 39
907951 3180 3195 CCGACCCTCAACGACC 26 128 143 40
907952 3182 3197 CGCCGACCCTCAACGA 54 130 145 41
907953 3186 3201 CCGCCGCCGACCCTCA 35 134 149 42
907954 3190 3205 TCGCCCGCCGCCGACC 61 138 153 43
907955 3196 3211 CGCTCCTCGCCCGCCG 52 144 159 44
907956 3198 3213 TGCGCTCCTCGCCCGC 120 146 161 45
907957 3201 3216 CCCTGCGCTCCTCGCC 32 149 164 46
907958 3204 3219 GCGCCCTGCGCTCCTC 105 152 167 47
907959 3220 3235 GCGGCCCCCGGCCCGA 90 168 183 48
907960 3302 3317 CTGGCCGATGGAGCTG 129 250 265 49
907961 3304 3319 CTCTGGCCGATGGAGC 70 252 267 50
907962 3308 3323 GCAGCTCTGGCCGATG 46 256 271 51
907963 N/A N/A GGGAAGGAAGTCCCGG 97 349 364 52
907964 44749 44764 ATTCCTGAACCGCGGG 89 363 378 53
907965 44751 44766 CGATTCCTGAACCGCG 47 365 380 54
907966 44753 44768 GACGATTCCTGAACCG 11 367 382 55
907967 57491 57506 GACTTGCAGTGCAAAA 6 438 453 56
907968 57493 57508 TGGACTTGCAGTGCAA 15 440 455 57
907969 57495 57510 TTTGGACTTGCAGTGC 2 442 457 58
907970 57499 57514 ACTTTTTGGACTTGCA 5 446 461 59
907971 57526 57541 CCTGCCGGACTTCATC 17 473 488 60
907972 57529 57544 TCTCCTGCCGGACTTC 13 476 491 61
907973 57532 57547 CAATCTCCTGCCGGAC 20 479 494 62
907974 57534 57549 TTCAATCTCCTGCCGG 25 481 496 63
907975 60711 60726 GGTCGATGAGGGTCAA 8 584 599 64
907976 60716 60731 CGGGAGGTCGATGAGG 66 589 604 65
907977 60718 60733 CCCGGGAGGTCGATGA 117 591 606 66
907978 60722 60737 GATACCCGGGAGGTCG 55 595 610 67
907979 60724 60739 GTGATACCCGGGAGGT 11 597 612 68
907980 60728 60743 CTTGGTGATACCCGGG 57 601 616 69
907981 60734 60749 AGGCACCTTGGTGATA 40 607 622 70
907982 60776 60791 GTCCTTGATCTGGTAC 28 649 664 71
907983 60778 60793 ATGTCCTTGATCTGGT 8 651 666 72
907984 60784 60799 AGGATCATGTCCTTGA 58 657 672 73
907985 60788 60803 CTGCAGGATCATGTCC 35 661 676 74
907986 60798 60813 GGCTGATGAACTGCAG 56 671 686 75
907987 60806 60821 GCTCTCCCGGCTGATG 40 679 694 76
907988 60809 60824 GCTGCTCTCCCGGCTG 68 682 697 77
907989 60826 60841 GTGACAGCCAGAATGA 26 699 714 78
907990 60842 60857 GTCCATGTTGGCGGGC 66 715 730 79
907991 60882 60897 CGACTTCCTTGGCCAG 68 755 770 80
907992 60884 60899 ATCGACTTCCTTGGCC 99 757 772 81
907993 N/A N/A TGGTCCGTAGGCCTTG 72 776 791 82
907994 62116 62131 GATGGTCCGTAGGCCT 68 778 793 83
907995 62195 62210 TCAACGGGAGCAACTT 18 857 872 84
907996 N/A N/A GCCTCTTCTCAACGGG 105 865 880 85
907997 N/A N/A TAGCCTCTTCTCAACG 17 867 882 86
907998 68005 68020 GCACGGATGTCCTTCT 8 924 939 87
907999 68008 68023 GCTGCACGGATGTCCT 25 927 942 88
908000 68013 68028 CCAGTGCTGCACGGAT 17 932 947 89
908001 68057 68072 GTGCCGGTAGGCCGGG 91 976 991 90
908002 68059 68074 ATGTGCCGGTAGGCCG 83 978 993 91
908003 68062 68077 GCCATGTGCCGGTAGG 77 981 996 92
908004 68064 68079 CGGCCATGTGCCGGTA 90 983 998 93
908005 68096 68111 CGTCTTCTGCAGATGT 26 1015 1030 94
908006 71583 71598 GCCGGCAGCGACTCCC 107 1059 1074 95
908007 71586 71601 AGGGCCGGCAGCGACT 64 1062 1077 96
908008 71589 71604 CGTAGGGCCGGCAGCG 67 1065 1080 97
908009 71603 71618 TCTGTAGTTTGCTACG 34 1079 1094 98
908010 71605 71620 GCTCTGTAGTTTGCTA 42 1081 1096 99
908011 71659 71674 GTCGGGCCGAAAGTTC 15 1135 1150 100
908012 71681 71696 CTTTGGTTTTGCGGGT 36 1157 1172 101
908013 78772 78787 GAGTGTCCACCTGATC 11 1235 1250 102
908014 78786 78801 CCCGGAGAGCTCCAGA 58 1249 1264 103
908015 78789 78804 GCCCCCGGAGAGCTCC 71 1252 1267 104
908016 78791 78806 GCGCCCCCGGAGAGCT 129 1254 1269 105
908017 78804 78819 GCGATTGATTCGGGCG 50 1267 1282 106
908018 78808 78823 AGATGCGATTGATTCG 14 1271 1286 107
908019 80422 80437 GACTCCATGGATGTTC 91 1369 1384 108
908020 N/A N/A GCCCGGTCCTGACTCC 54 1379 1394 109
908021 N/A N/A AAGCCCGGTCCTGACT 81 1381 1396 110
908022 81058 81073 GAAAAGCCCGGTCCTG 35 1384 1399 111
908023 81061 81076 GGTGAAAAGCCCGGTC 58 1387 1402 112
908024 81076 81091 GAATGCCAAGTCCGGG 43 1402 1417 113
908025 81079 81094 CTCGAATGCCAAGTCC 8 1405 1420 114
908026 81082 81097 GGCCTCGAATGCCAAG 169 1408 1423 115
908027 81103 81118 GACGACCTGCTTTTTC 4 1429 1444 116
908028 81106 81121 CTTGACGACCTGCTTT 13 1432 1447 117
908029 81107 81122 GCTTGACGACCTGCTT 14 1433 1448 118
908030 81109 81124 CAGCTTGACGACCTGC 33 1435 1450 119
908031 81111 81126 TTCAGCTTGACGACCT 5 1437 1452 120
908032 81113 81128 CTTTCAGCTTGACGAC 22 1439 1454 121
908033 81115 81130 CTCTTTCAGCTTGACG 7 1441 1456 122
908034 81137 81152 GGTCGACACATTTCAG 13 1463 1478 123
908035 81139 81154 CAGGTCGACACATTTC 2 1465 1480 124
908036 81147 81162 TGGATAACCAGGTCGA 14 1473 1488 125
908037 81160 81175 ATTGATTAGCTCCTGG 2 1486 1501 126
908038 81170 81185 GCCTAACTGTATTGAT 22 1496 1511 127
908039 81172 81187 CTGCCTAACTGTATTG 28 1498 1513 128
908040 81175 81190 ACACTGCCTAACTGTA 54 1501 1516 129
908041 81182 81197 TACTGGTACACTGCCT 4 1508 1523 130
908042 N/A N/A CTGAGCTTACTGGTAC 19 1515 1530 131
908043 N/A N/A GAACTGAGCTTACTGG 10 1518 1533 132
908044 N/A N/A GGTAGGAACTGAGCTT 8 1523 1538 133
908045 83499 83514 TCCTCTCGCAACCGGG 46 1539 1554 134
908046 83502 83517 GTCTCCTCTCGCAACC 34 1542 1557 135
908047 83505 83520 TCTGTCTCCTCTCGCA 11 1545 1560 136
908048 83517 83532 GTGACGATTCGCTCTG 48 1557 1572 137
908049 83522 83537 AAGTGGTGACGATTCG 5 1562 1577 138
908050 83524 83539 GTAAGTGGTGACGATT 17 1564 1579 139
908051 83536 83551 CCGTTCCCGGATGTAA 86 1576 1591 140
908052 83548 83563 CGTTCTCCCCTCCCGT 9 1588 1603 141
908053 N/A N/A CAGAAGAATCTGGTCC 33 1606 1621 142
908054 87290 87305 GTCGATCAGCAGAAGA 33 1615 1630 143
908055 87294 87309 CAATGTCGATCAGCAG 16 1619 1634 144
908056 87296 87311 CTCAATGTCGATCAGC 10 1621 1636 145
908057 87299 87314 CTGCTCAATGTCGATC 18 1624 1639 146
908058 87302 87317 GGACTGCTCAATGTCG 58 1627 1642 147
908059 87304 87319 TAGGACTGCTCAATGT 3 1629 1644 148
908060 87308 87323 GATGTAGGACTGCTCA 19 1633 1648 149
908061 87311 87326 GTTGATGTAGGACTGC 3 1636 1651 150
908062 97288 97303 GGCTGATGTTGTTGAT 31 1760 1775 151
908063 97290 97305 CAGGCTGATGTTGTTG 36 1762 1777 152
908064 97294 97309 TCATCAGGCTGATGTT 100 1766 1781 153
908065 97299 97314 GCCTTTCATCAGGCTG 89 1771 1786 154
908066 97338 97353 TGACTCGGCAGTCAGC 86 1810 1825 155
908067 97341 97356 CAGTGACTCGGCAGTC 24 1813 1828 156
908068 97345 97360 AGGACAGTGACTCGGC 17 1817 1832 157
908069 105015 105030 ATCACGGATCTTGAGG 40 1885 1900 158
908070 105019 105034 CCACATCACGGATCTT 12 1889 1904 159
908071 105020 105035 TCCACATCACGGATCT 31 1890 1905 160
908072 105022 105037 TCTCCACATCACGGAT 72 1892 1907 161
908073 105060 105075 GAAGATGGCGAAGACG 81 1930 1945 162
908074 108791 108806 CAGGTCCTTGTAGACG 60 1963 1978 163
908075 108804 108819 GCTCGATCTGCCGCAG 55 1976 1991 164
908076 108806 108821 CAGCTCGATCTGCCGC 54 1978 1993 165
908077 108857 108872 TCGGAGGAACGAGGCC 80 2029 2044 166
908078 108859 108874 GCTCGGAGGAACGAGG 67 2031 2046 167
908079 108861 108876 CAGCTCGGAGGAACGA 59 2033 2048 168
908080 108863 108878 GCCAGCTCGGAGGAAC 93 2035 2050 169
908081 N/A N/A GCCTGGTCCTTCTCGG 70 2058 2073 170
908082 110075 110090 AGGTGTTCTCCTGGGC 74 2090 2105 171
908083 110077 110092 GAAGGTGTTCTCCTGG 81 2092 2107 172
908084 110080 110095 GGAGAAGGTGTTCTCC 119 2095 2110 173
908085 110160 110175 ATGGACTTGTTGATGA 11 2175 2190 174
908086* 110166 110181 TCGCGGATGGACTTGT 36 2181 2196 175
908087* 110168 110183 GGTCGCGGATGGACTT 58 2183 2198 176
908088* 110171 110186 TGAGGTCGCGGATGGA 4 2186 2201 177
908089* 114042 114057 CGTGGTGGATGAAGGC 3 2243 2258 178
908090* 114069 114084 CCGAGGAGTATAGGTA 17 2270 2285 179
908091* 114072 114087 CTGCCGAGGAGTATAG 14 2273 2288 180
908092* 114074 114089 GTCTGCCGAGGAGTAT 11 2275 2290 181
908093* 114077 114092 CTGGTCTGCCGAGGAG 9 2278 2293 182
908094* 114080 114095 GCTCTGGTCTGCCGAG 39 2281 2296 183
908095 115141 115156 CTGGACACCGGTCGGC 39 2484 2499 184
908096 115144 115159 ATGCTGGACACCGGTC 47 2487 2502 185
908097 115146 115161 GTATGCTGGACACCGG 33 2489 2504 186
908098 115150 115165 GGGTGTATGCTGGACA 11 2493 2508 187
908099 115214 115229 CACGGGAACAGGAATC 25 2557 2572 188
908100 115221 115236 CTGCCCCCACGGGAAC 80 2564 2579 189
908101 115238 115253 CGCCGAGAAGGAGGCT 97 2581 2596 190
908102 115283 115298 GTTGGCAAACACGCTC 16 2626 2641 191
908103 115285 115300 CTGTTGGCAAACACGC 30 2628 2643 192
908104 115292 115307 GAGGTCACTGTTGGCA 9 2635 2650 193
908105 115324 115339 GGCCGAGATGGGATCT 73 2667 2682 194
908106 115326 115341 CTGGCCGAGATGGGAT 45 2669 2684 195
908107 115329 115344 GAACTGGCCGAGATGG 6 2672 2687 196
908108 115332 115347 TCCGAACTGGCCGAGA 33 2675 2690 197
908109 115336 115351 GGGATCCGAACTGGCC 82 2679 2694 198
908110 116010 116025 GCTGGGCGGATAATGG 45 2754 2769 199
908111 116015 116030 GCTCGGCTGGGCGGAT 101 2759 2774 200
908112 116017 116032 TGGCTCGGCTGGGCGG 89 2761 2776 201
908113 116022 116037 AGGGATGGCTCGGCTG 75 2766 2781 202
908114 116030 116045 AGTCGAGCAGGGATGG 53 2774 2789 203
908115 116035 116050 GGCCTAGTCGAGCAGG 104 2779 2794 204
908116 116038 116053 CGAGGCCTAGTCGAGC 79 2782 2797 205
908117 116042 116057 CCCTCGAGGCCTAGTC 87 2786 2801 206
908118 116045 116060 CCCCCCTCGAGGCCTA 69 2789 2804 207
908119 116047 116062 CGCCCCCCTCGAGGCC 89 2791 2806 208
908120 116057 116072 CCCGAGAGCACGCCCC 40 2801 2816 209
908121 116060 116075 CCCCCCGAGAGCACGC 38 2804 2819 210
908122 116063 116078 GGCCCCCCCGAGAGCA 95 2807 2822 211
908123 116068 116083 CGTGAGGCCCCCCCGA 67 2812 2827 212
908124 116088 116103 AAGCTCCTGCGCCGCG 55 2832 2847 213
908125 116096 116111 GACCACTGAAGCTCCT 32 2840 2855 214
908126 116098 116113 CAGACCACTGAAGCTC 38 2842 2857 215
908127 116108 116123 CGGAGGGCCCCAGACC 100 2852 2867 216
908128 116110 116125 GGCGGAGGGCCCCAGA 91 2854 2869 217
908129 116128 116143 TGGTCCCAGCATAGGG 88 2872 2887 218
908130 116130 116145 CCTGGTCCCAGCATAG 73 2874 2889 219
908131 116138 116153 ACTGGGAGCCTGGTCC 72 2882 2897 220
908132 116164 116179 CGTTAAGGAAGAGGCC 69 2908 2923 221
908133 116209 116224 GCGGTGTCCAGCCAGG 49 2953 2968 222
908134 116211 116226 GTGCGGTGTCCAGCCA 37 2955 2970 223
908135 116215 116230 CGCAGTGCGGTGTCCA 13 2959 2974 224
908136 116218 116233 TTGCGCAGTGCGGTGT 29 2962 2977 225
908137 116220 116235 CTTTGCGCAGTGCGGT 15 2964 2979 226
908138 116223 116238 CCCCTTTGCGCAGTGC 12 2967 2982 227
908139 116226 116241 GGGCCCCTTTGCGCAG 101 2970 2985 228
908140 116228 116243 CAGGGCCCCTTTGCGC 92 2972 2987 229
908141 116260 116275 TGCAACACCCCAGCGC 78 3004 3019 230
908142 116265 116280 CAAAGTGCAACACCCC 20 3009 3024 231
908143 116268 116283 CCCCAAAGTGCAACAC 47 3012 3027 232
908144 116300 116315 TGGTCCCCCCTCTGCC 64 3044 3059 233
908145 116309 116324 CAAGGGTTCTGGTCCC 45 3053 3068 234
908146 116312 116327 TGTCAAGGGTTCTGGT 15 3056 3071 235
908147 116314 116329 GGTGTCAAGGGTTCTG 8 3058 3073 236
908148 116318 116333 GGATGGTGTCAAGGGT 7 3062 3077 237
908149 116331 116346 GACCCCTCATTCAGGA 84 3075 3090 238
908150 116333 116348 TGGACCCCTCATTCAG 64 3077 3092 239
908151 116336 116351 GGCTGGACCCCTCATT 80 3080 3095 240
908152 116348 116363 GAGTCCCCCCCAGGCT 63 3092 3107 241
908153 116352 116367 GGTAGAGTCCCCCCCA 31 3096 3111 242
908154 116356 116371 CCTTGGTAGAGTCCCC 3 3100 3115 243
908155 116359 116374 AGACCTTGGTAGAGTC 73 3103 3118 244
908156 116385 116400 CCTACATGGGCTTTCC 37 3129 3144 245
908157 116389 116404 CTGCCCTACATGGGCT 115 3133 3148 246
908158 116398 116413 ATAGAAGGCCTGCCCT 71 3142 3157 247
908159 116400 116415 TTATAGAAGGCCTGCC 41 3144 3159 248
908160 116404 116419 GCACTTATAGAAGGCC 70 3148 3163 249
908161 116408 116423 GCCCGCACTTATAGAA 45 3152 3167 250
908162 116410 116425 GTGCCCGCACTTATAG 66 3154 3169 251
908163 116418 116433 CGCCCTTGGTGCCCGC 62 3162 3177 252
908164 116455 116470 TATACCCCTGCACCCC 11 3199 3214 253
908165 116464 116479 GGAAGTTGATATACCC 29 3208 3223 254
908166 116471 116486 GCTAATGGGAAGTTGA 13 3215 3230 255
908167 116474 116489 CCTGCTAATGGGAAGT 14 3218 3233 256
908168 116477 116492 GCTCCTGCTAATGGGA 139 3221 3236 257
908169 116481 116496 GGGAGCTCCTGCTAAT 102 3225 3240 258
908170 116497 116512 GCCAGGCTTGCCGCTG 80 3241 3256 259
908171 116499 116514 GGGCCAGGCTTGCCGC 87 3243 3258 260
908172 116511 116526 ACCGAGCCCACTGGGC 72 3255 3270 261
908173 116513 116528 CTACCGAGCCCACTGG 57 3257 3272 262
908174 116518 116533 GGGCACTACCGAGCCC 87 3262 3277 263
908175 116523 116538 CAGCTGGGCACTACCG 86 3267 3282 264
908176 116541 116556 TGTACACCTCAGGCCT 83 3285 3300 265
908177 116544 116559 CTATGTACACCTCAGG 10 3288 3303 266
908178 116547 116562 GGACTATGTACACCTC 7 3291 3306 267
908179 116550 116565 GAAGGACTATGTACAC 8 3294 3309 268
908180 116556 116571 GGCCGGGAAGGACTAT 51 3300 3315 269
908181 116558 116573 ATGGCCGGGAAGGACT 78 3302 3317 270
908182 116561 116576 AATATGGCCGGGAAGG 19 3305 3320 271
908183 116565 116580 GGTTAATATGGCCGGG 13 3309 3324 272
908184 116573 116588 GGCTGTGTGGTTAATA 8 3317 3332 273
908185 116603 116618 CCTCTGGCAGCCGAGG 100 3347 3362 274
908186 116606 116621 GCACCTCTGGCAGCCG 73 3350 3365 275
908187 116608 116623 AGGCACCTCTGGCAGC 61 3352 3367 276
908188 116614 116629 TAGCAAAGGCACCTCT 41 3358 3373 277
908189 116617 116632 GCCTAGCAAAGGCACC 146 3361 3376 278
908190 116621 116636 CCGGGCCTAGCAAAGG 60 3365 3380 279
908191 116624 116639 GCTCCGGGCCTAGCAA 123 3368 3383 280
908192 116626 116641 CGGCTCCGGGCCTAGC 97 3370 3385 281
908193 116630 116645 CCAACGGCTCCGGGCC 117 3374 3389 282
908194 116638 116653 GGCCCGGGCCAACGGC 109 3382 3397 283
908195 116640 116655 CCGGCCCGGGCCAACG 104 3384 3399 284
908196 116642 116657 GGCCGGCCCGGGCCAA 99 3386 3401 285
908197 116644 116659 AAGGCCGGCCCGGGCC 86 3388 3403 286
908198 116646 116661 GCAAGGCCGGCCCGGG 88 3390 3405 287
908199 116648 116663 GGGCAAGGCCGGCCCG 125 3392 3407 288
908200 116650 116665 TAGGGCAAGGCCGGCC 99 3394 3409 289
908201 116655 116670 AGGAATAGGGCAAGGC 6 3399 3414 290
908202 116712 116727 ACCACCCACATAGCCC 31 3456 3471 291
908203 116729 116744 CAAGACCCCCCGCCAC 64 3473 3488 292
908204 116732 116747 CCCCAAGACCCCCCGC 59 3476 3491 293
908205 116738 116753 AGAGGCCCCCAAGACC 86 3482 3497 294
908206 116772 116787 GGCCCACCCATCAGGG 110 3516 3531 295
908207 116774 116789 TGGGCCCACCCATCAG 127 3518 3533 296
908208 116789 116804 AGAGAGAGGCCGCCCT 37 3533 3548 297
908209 116791 116806 TCAGAGAGAGGCCGCC 70 3535 3550 298
908210 116808 116823 GAGTGGGTGAGGTCTC 77 3552 3567 299
908211 116815 116830 GAGCGAGGAGTGGGTG 59 3559 3574 300
908212 116819 116834 AACTGAGCGAGGAGTG 55 3563 3578 301
908213 116822 116837 TCAAACTGAGCGAGGA 5 3566 3581 302
908214 116826 116841 GTGGTCAAACTGAGCG 15 3570 3585 303
908215 116832 116847 CTTACAGTGGTCAAAC 10 3576 3591 304
908216 116843 116858 GAGTGCAGGCACTTAC 48 3587 3602 305
908217 116849 116864 AATACAGAGTGCAGGC 4 3593 3608 306
908221 82462 82477 CCACGAGATCAACACA 20 N/A N/A 307
908222 82464 82479 GACCACGAGATCAACA 88 N/A N/A 308
908223 82465 82480 AGACCACGAGATCAAC 82 N/A N/A 309
908224 82468 82483 CTGAGACCACGAGATC 34 N/A N/A 310
908225 82471 82486 GCTCTGAGACCACGAG 59 N/A N/A 311
908226 82482 82497 GACCGTGGCCAGCTCT 52 N/A N/A 312
908227 82484 82499 ATGACCGTGGCCAGCT 54 N/A N/A 313
908228 82485 82500 TATGACCGTGGCCAGC 31 N/A N/A 314
908229 82487 82502 TTTATGACCGTGGCCA 64 N/A N/A 315
908230 82488 82503 TTTTATGACCGTGGCC 102 N/A N/A 316
908231 82498 82513 CGGCACACTTTTTTAT 37 N/A N/A 317
908232 82502 82517 TTCTCGGCACACTTTT 4 N/A N/A 318
908236 N/A N/A CCCCGCCGCGGGCACG 103 3506 3521 319
908237 4387 4402 CCAAAGGAGGGCCCCC 88 N/A N/A 320
908238 4857 4872 CGCCAGCCTAGTGGCC 142 N/A N/A 321
908239 5585 5600 TGGGACTACCACCCTA 129 N/A N/A 322
908240 6095 6110 CTCCATACTGGCCGGC 91 N/A N/A 323
908241 6449 6464 CTTAACGAGGCCAGCC 56 N/A N/A 324
908242 7057 7072 ACCCATCTAGGCCCCA 23 N/A N/A 325
908243 7335 7350 TGGTGCACCGCAGACA 61 N/A N/A 326
908244 8045 8060 TCAGGAGGCGAGATTG 93 N/A N/A 327
908245 8318 8333 CGGGAAAACCCCGCCT 123 N/A N/A 328
908246 8813 8828 AGCCACTAAGTGGCCC 130 N/A N/A 329
908247 9601 9616 GCTAAACTGGCCTCCG 78 N/A N/A 330
908248 9989 10004 GCCAACGGGCATCCGA 104 N/A N/A 331
908249 10650 10665 GTCCACTCCCAGTAGG 77 N/A N/A 332
908250 11631 11646 GGTGATCCGATGCTGG 34 N/A N/A 333
908251 12300 12315 GGCCATCTTCCGCCCT 102 N/A N/A 334
908252 12662 12677 CTAACCTAGGCCGGGT 70 N/A N/A 335
908253 12991 13006 AGACGCAGGGCCACAT 66 N/A N/A 336
908254 13381 13396 GGCTCTAGAGGGCCCA 110 N/A N/A 337
908255 13954 13969 CCGCATACAGCCTTTT 12 N/A N/A 338
908256 14620 14635 GCATTCCACGGGCAGC 34 N/A N/A 339
908257 15396 15411 CACCGCTACCCTAGCT 63 N/A N/A 340
908258 15792 15807 GGGCACCCCGCAGGTT 102 N/A N/A 341
908259 16235 16250 TCTAGAAGGACCCTGT 64 N/A N/A 342
908260 16810 16825 AGCCGGGCTTCCGTCT 84 N/A N/A 343
908261 17238 17253 TTTAAGGGCGCGGTGG 99 N/A N/A 344
908262 17624 17639 TGCACTTCCGGACAGG 82 N/A N/A 345
908263 18173 18188 CACCAGCCCAGGCGCG 117 N/A N/A 346
908264 18617 18632 AGCTAGGTTAATTTCT 64 N/A N/A 347
908265 19070 19085 CAACATCCCGCCAGGC 80 N/A N/A 348
908266 19407 19422 AGCAATCTAGCCTCCC 39 N/A N/A 349
908267 19819 19834 TGCAATGTCCAGTCCT 11 N/A N/A 350
908268 20435 20450 ACCTAGCAAGCCTACC 64 N/A N/A 351
908269 21415 21430 GCTACAGCAATATAGA 67 N/A N/A 352
908270 21839 21854 TCTTAACAGGCTCCCT 63 N/A N/A 353
908271 22199 22214 CCTCAGGGACGACTTC 87 N/A N/A 354
908272 22636 22651 TATACGGGCATGTTGA 55 N/A N/A 355
908273 22916 22931 GTGCATCCCGAGAGGG 89 N/A N/A 356
908274 23292 23307 ATGAAAGTCTCCACTT 61 N/A N/A 357
908275 23543 23558 AACCGCTGGGATCCCC 71 N/A N/A 358
908276 24229 24244 GTACAGGAGTTCCCCA 90 N/A N/A 359
908277 25038 25053 AAATACACCCTAGATG 83 N/A N/A 360
908278 25670 25685 GAAGATTTTGGCCGGG 85 N/A N/A 361
908279 25997 26012 CTCCAGGACACACCGT 42 N/A N/A 362
908280 27088 27103 GGGAGTAGGCTCGACC 51 N/A N/A 363
908281 27400 27415 CCCTATTCCACAGGAC 85 N/A N/A 364
908282 27746 27761 GCTAAGAGCAGCCCTC 80 N/A N/A 365
908283 28198 28213 GGCATCACGGCCGGGC 76 N/A N/A 366
908284 29125 29140 TGTCACCCCAGCCGAA 67 N/A N/A 367
908285 29568 29583 AGCCGGGCACCACCCA 67 N/A N/A 368
908286 30330 30345 GGCAAGGACAGCCGAC 94 N/A N/A 369
908287 30334 30349 GTTTGGCAAGGACAGC 40 N/A N/A 370
908288 30337 30352 GTGGTTTGGCAAGGAC 14 N/A N/A 371
908289 30340 30355 GCAGTGGTTTGGCAAG 46 N/A N/A 372
908290 30342 30357 ATGCAGTGGTTTGGCA 86 N/A N/A 373
908291 30401 30416 TCAACACCTTGAGGGC 34 N/A N/A 374
908292 30498 30513 TGCCTAGGCGATCCTC 88 N/A N/A 375
908293 30928 30943 GACATTGCTGTCGCAG 78 N/A N/A 376
908294 31347 31362 TCCCAAGTGCCCCCCA 90 N/A N/A 377
908295 31703 31718 AGCCGGCACGGTTGCT 125 N/A N/A 378
908296 32187 32202 GAGAACATTCGCCCCA 27 N/A N/A 379
908297 32386 32401 TGACCTGTGGCAATTC 26 N/A N/A 380
908298 32388 32403 GGTGACCTGTGGCAAT 44 N/A N/A 381
908299 32689 32704 TCCCGTATCGGCCCCT 85 N/A N/A 382
908300 33343 33358 GTCCAGCCGCGAGTCC 59 N/A N/A 383
908301 33635 33650 GGCAGACCCGCAGTCA 73 N/A N/A 384
908302 34108 34123 GGGCAAGCCACCCCTC 93 N/A N/A 385
908303 34623 34638 AAGTCGAGCTCCGCCC 63 N/A N/A 386
908304 35031 35046 TGGTCCTAGCCCGTCC 78 N/A N/A 387
908305 35549 35564 GGGTACAGGCAAACCT 88 N/A N/A 388
908306 36028 36043 CCATACCCCCATCTGA 102 N/A N/A 389
908307 36712 36727 GCGCAGAGGGCCTCGC 123 N/A N/A 390
908308 37097 37112 CACTACAGACATCCCT 64 N/A N/A 391
908309 37538 37553 AGCCAGGGCCCGGCTT 93 N/A N/A 392
908310 38044 38059 CTCCAACTGTAGGGCT 87 N/A N/A 393
908311 39735 39750 GCGGATGGTGGCATTC 90 N/A N/A 394
908312 40399 40414 CAGCAGCGGCGGTGAC 84 N/A N/A 395
908313 41143 41158 CTCTTAGCATGGCCCC 73 N/A N/A 396
908314 41620 41635 GGCCTGGGATGCTACC 129 N/A N/A 397
908315 41957 41972 TTAAACCCCCCTCTGG 104 N/A N/A 398
908316 42239 42254 GCCCAAGCCCTCGGCG 147 N/A N/A 399
908317 42806 42821 ATGCACGCGCTACCAT 106 N/A N/A 400
908318 43841 43856 ACATATCCTGGCCGGG 112 N/A N/A 401
908319 44266 44281 CTGGATGTGGGAACGG 94 N/A N/A 402
908320 44817 44832 CCTCAGGCCGCCCCAT 57 N/A N/A 403
908321 45179 45194 GGCCATGGAGGGTCAC 111 N/A N/A 404
908322 45544 45559 GGGACAACTGGCGACA 39 N/A N/A 405
908323 45952 45967 TGGTAGAGGGCTGGTG 78 N/A N/A 406
908324 46827 46842 GCCCATCGGCTGCTGT 153 N/A N/A 407
908325 47604 47619 GGGTAGGCCTGCGCTC 119 N/A N/A 408
908326 48030 48045 TGCCATGATCAGGCGG 109 N/A N/A 409
908327 48530 48545 ACCAAGTGGGCACCTA 92 N/A N/A 410
908328 49088 49103 CCACAAGGCCCCGCCG 103 N/A N/A 411
908329 49883 49898 GTGACCAGGTGCGGGT 84 N/A N/A 412
908330 50310 50325 CTGGGCAGAGCCGATC 95 N/A N/A 413
908331 50840 50855 GACGAGGCTGGCCCTG 36 N/A N/A 414
908332 51504 51519 CCCCACTGTGCTAAAC 91 N/A N/A 415
908333 51765 51780 AGTCAGCCGTCCTCGC 58 N/A N/A 416
908334 52587 52602 CACCAGGCCGAGAGCA 111 N/A N/A 417
908335 53006 53021 GCCCAGGCACCGACCA 92 N/A N/A 418
908336 53680 53695 CCCCGGAACCTCAGGC 85 N/A N/A 419
908337 54271 54286 CAGCACGCTGTGTGCA 65 N/A N/A 420
908338 54667 54682 CACTCGGCCGCTCTTC 80 N/A N/A 421
908339 55325 55340 GCGCACTGCCCTGTCG 77 N/A N/A 422
908340 56452 56467 CAAGAGGGCCCCCTAC 110 N/A N/A 423
908341 56855 56870 TATGAATCCCCCTCCC 99 N/A N/A 424
908342 57413 57428 GCGCATGGACTGCGGG 150 N/A N/A 425
908343 57695 57710 TGGAAGTACACAGGCT 40 N/A N/A 426
908344 58949 58964 GTCTATGGCCCCGGGC 102 N/A N/A 427
908345 59713 59728 GCATAGGCCAACGCAG 88 N/A N/A 428
908346 60635 60650 AAACAGGCCCGCAGCC 95 N/A N/A 429
908347 61004 61019 CCTACAGCGGCCATGG 115 N/A N/A 430
908348 61545 61560 GTGCTAACCGTGTGTG 85 N/A N/A 431
908349 62025 62040 GTCCAGTTGGCCCTGA 84 N/A N/A 432
908350 62964 62979 AACCACCGAAGCTGGG 125 N/A N/A 433
908351 63324 63339 GGAAGATGGCCGGGTG 111 N/A N/A 434
908352 63675 63690 GCTACAATGCCTAGGA 85 N/A N/A 435
908353 64393 64408 GGTCAACGCAGGCTCA 48 N/A N/A 436
908354 64657 64672 AGCCAGGAGCAATCGC 78 N/A N/A 437
908355 65114 65129 GGCAACCAAGGTCTGA 15 N/A N/A 438
908356 65639 65654 CGCCTAGCCTGGGTTC 67 N/A N/A 439
908357 66042 66057 CACCATCACACACGGA 44 N/A N/A 440
908358 66433 66448 GGGAGAGGTGCCGGTC 99 N/A N/A 441
908359 66885 66900 CACCGAGAAGGAGGTA 99 N/A N/A 442
908360 67650 67665 AAAATCTCGGCCGGGA 101 N/A N/A 443
908361 67903 67918 GCCAAGTGGACCTGGC 84 N/A N/A 444
908362 68192 68207 GCCTGAAACAAGTGCC 75 N/A N/A 445
908363 68628 68643 CCCCAGGCAATGCATA 125 N/A N/A 446
908364 68993 69008 AGAACGATAGGCCAGG 52 N/A N/A 447
908365 69310 69325 TCTTTTCCCGGCCCCC 48 N/A N/A 448
908366 71364 71379 CGGCACGGAGCTGCCC 126 N/A N/A 449
908367 71557 71572 GGTCAGTTGCTGCAGG 40 N/A N/A 450
908368 72040 72055 GGCCGGCCAATGCTCA 118 N/A N/A 451
908369 73315 73330 TTGCACTGGCCGGGCT 75 N/A N/A 452
908370 73937 73952 CCCTTAGCCCACGACC 92 N/A N/A 453
908371 74402 74417 CTGCCAGTTTGTCCCC 25 N/A N/A 454
908372 74408 74423 TGTAATCTGCCAGTTT 53 N/A N/A 455
908373 74410 74425 CTTGTAATCTGCCAGT 55 N/A N/A 456
908374 74415 74430 GGCACCTTGTAATCTG 96 N/A N/A 457
908375 74908 74923 TGTGATGGGCATCCCC 56 N/A N/A 458
908376 75761 75776 ATACATGAGGTCCGGG 106 N/A N/A 459
908377 76583 76598 GCCCAACCCACGCTGC 79 N/A N/A 460
908378 77237 77252 CCCCAACTGGGAGAGG 107 N/A N/A 461
908379 77517 77532 TAGAACGGGCCTGGCC 93 N/A N/A 462
908380 78331 78346 TCCATAGGTTCCCGCC 89 N/A N/A 463
908381 78849 78864 GGGCACTACCTTCACC 138 N/A N/A 464
908382 79488 79503 TCCCACGGATTATAGG 140 N/A N/A 465
908383 80002 80017 GCCCAGGAAGGTCGAA 105 N/A N/A 466
908384 80333 80348 ATGCATGGAGGCACCC 93 N/A N/A 467
908385 80626 80641 TGCAATGGACGCAGGA 37 N/A N/A 468
908386 80968 80983 GGCCGGGTCCCCAACA 113 N/A N/A 469
908387 81643 81658 GGCCATTCCCGGAGCT 114 N/A N/A 470
908388 82021 82036 CCTTTTCTAATCGAAG 116 N/A N/A 471
908389 82046 82061 ACCTGTTTGGACTGTT 5 N/A N/A 472
908390 82049 82064 CCAACCTGTTTGGACT 74 N/A N/A 473
908391 82051 82066 TTCCAACCTGTTTGGA 54 N/A N/A 474
908392 82055 82070 CGTTTTCCAACCTGTT 3 N/A N/A 475
908393 82069 82084 GGCTCTAGGACGAGCG 55 N/A N/A 476
908394 82072 82087 CCTGGCTCTAGGACGA 41 N/A N/A 477
908395 82083 82098 TGTCCATGACACCTGG 66 N/A N/A 478
908396 82086 82101 TCATGTCCATGACACC 8 N/A N/A 479
908397 82088 82103 ATTCATGTCCATGACA 25 N/A N/A 480
908398 82704 82719 CCCCACGGGCAGCCAC 127 N/A N/A 481
908399 83290 83305 GGGCACCGTGGACCGG 112 N/A N/A 482
908400 83646 83661 CATATGCAGCTGTCAG 27 N/A N/A 483
83734 83749 N/A N/A
83822 83837 N/A N/A
908401 83647 83662 CCATATGCAGCTGTCA 2 N/A N/A 484
83735 83750 N/A N/A
83823 83838 N/A N/A
908402 83649 83664 TGCCATATGCAGCTGT 27 N/A N/A 485
83737 83752 N/A N/A
83825 83840 N/A N/A
908403 83650 83665 TTGCCATATGCAGCTG 18 N/A N/A 486
83738 83753 N/A N/A
83826 83841 N/A N/A
908404 83651 83666 TTTGCCATATGCAGCT 17 N/A N/A 487
83739 83754 N/A N/A
83827 83842 N/A N/A
908405 83658 83673 GGGTTACTTTGCCATA 7 N/A N/A 488
83746 83761 N/A N/A
83834 83849 N/A N/A
908406 83659 83674 AGGGTTACTTTGCCAT 74 N/A N/A 489
83747 83762 N/A N/A
83835 83850 N/A N/A
908407 83660 83675 AAGGGTTACTTTGCCA 7 N/A N/A 490
83748 83763 N/A N/A
83836 83851 N/A N/A
908408 83661 83676 TAAGGGTTACTTTGCC 2 N/A N/A 491
83749 83764 N/A N/A
83837 83852 N/A N/A
908409 83662 83677 GTAAGGGTTACTTTGC 8 N/A N/A 492
83750 83765 N/A N/A
83838 83853 N/A N/A
908410 83663 83678 GGTAAGGGTTACTTTG 12 N/A N/A 493
83751 83766 N/A N/A
83839 83854 N/A N/A
908411 83664 83679 AGGTAAGGGTTACTTT 17 N/A N/A 494
83752 83767 N/A N/A
83840 83855 N/A N/A
908412 83665 83680 GAGGTAAGGGTTACTT 12 N/A N/A 495
83753 83768 N/A N/A
83841 83856 N/A N/A
908413 83666 83681 TGAGGTAAGGGTTACT 3 N/A N/A 496
83754 83769 N/A N/A
83842 83857 N/A N/A
908414 83667 83682 TTGAGGTAAGGGTTAC 5 N/A N/A 497
83755 83770 N/A N/A
83843 83858 N/A N/A
908415 83669 83684 AACCCTTACCTCAATC 3 N/A N/A 498
83757 83772 N/A N/A
83845 83860 N/A N/A
908416 83670 83685 TGATTGAGGTAAGGGT 4 N/A N/A 499
83758 83773 N/A N/A
83846 83861 N/A N/A
908417 83671 83686 TTGATTGAGGTAAGGG 2 N/A N/A 500
83759 83774 N/A N/A
83847 83862 N/A N/A
908418 83672 83687 CTTGATTGAGGTAAGG 8 N/A N/A 501
83760 83775 N/A N/A
83848 83863 N/A N/A
908419 83673 83688 TCTTGATTGAGGTAAG 5 N/A N/A 502
83761 83776 N/A N/A
83849 83864 N/A N/A
908420 83674 83689 ATCTTGATTGAGGTAA 2 N/A N/A 503
83762 83777 N/A N/A
83850 83865 N/A N/A
908421 83684 83699 ACCGCTCTGTATCTTG 3 N/A N/A 504
83772 83787 N/A N/A
83860 83875 N/A N/A
908422 83685 83700 AACCGCTCTGTATCTT 3 N/A N/A 505
83773 83788 N/A N/A
83861 83876 N/A N/A
908423 83686 83701 AGATACAGAGCGGTTC 28 N/A N/A 506
83774 83789 N/A N/A
83862 83877 N/A N/A
908424 83687 83702 GGAACCGCTCTGTATC 8 N/A N/A 507
83775 83790 N/A N/A
83863 83878 N/A N/A
908425 83688 83703 CGGAACCGCTCTGTAT 13 N/A N/A 508
83776 83791 N/A N/A
83864 83879 N/A N/A
908426 83689 83704 ACGGAACCGCTCTGTA 47 N/A N/A 509
83777 83792 N/A N/A
83865 83880 N/A N/A
908427 83690 83705 GACGGAACCGCTCTGT 21 N/A N/A 510
83778 83793 N/A N/A
83866 83881 N/A N/A
908428 83691 83706 TGACGGAACCGCTCTG 33 N/A N/A 511
83779 83794 N/A N/A
83867 83882 N/A N/A
908429 83692 83707 GTGACGGAACCGCTCT 44 N/A N/A 512
83780 83795 N/A N/A
83868 83883 N/A N/A
908430 83693 83708 GGTGACGGAACCGCTC 27 N/A N/A 513
83781 83796 N/A N/A
83869 83884 N/A N/A
908431 83694 83709 AGCGGTTCCGTCACCT 67 N/A N/A 514
83782 83797 N/A N/A
83870 83885 N/A N/A
908432 83695 83710 GAGGTGACGGAACCGC 69 N/A N/A 515
83783 83798 N/A N/A
83871 83886 N/A N/A
908433 83696 83711 GGAGGTGACGGAACCG 62 N/A N/A 516
83784 83799 N/A N/A
83872 83887 N/A N/A
908434 83697 83712 AGGAGGTGACGGAACC 6 N/A N/A 517
83785 83800 N/A N/A
83873 83888 N/A N/A
908435 83698 83713 TAGGAGGTGACGGAAC 16 N/A N/A 518
83786 83801 N/A N/A
83874 83889 N/A N/A
908436 83699 83714 TTAGGAGGTGACGGAA 14 N/A N/A 519
83787 83802 N/A N/A
83875 83890 N/A N/A
908437 83709 83724 GACAGGGATTTTAGGA 29 N/A N/A 520
83885 83900 N/A N/A
908438 83710 83725 GGACAGGGATTTTAGG 49 N/A N/A 521
83886 83901 N/A N/A
908439 83719 83734 CCTGTCCCTATCATGC 3 N/A N/A 522
83807 83822 N/A N/A
908440 83720 83735 AGCATGATAGGGACAG 4 N/A N/A 523
83808 83823 N/A N/A
908441 83721 83736 CAGCATGATAGGGACA 2 N/A N/A 524
83809 83824 N/A N/A
908442 83722 83737 TCAGCATGATAGGGAC 4 N/A N/A 525
83810 83825 N/A N/A
908443 83723 83738 GTCAGCATGATAGGGA 4 N/A N/A 526
83811 83826 N/A N/A
908444 83724 83739 TGTCAGCATGATAGGG 4 N/A N/A 527
83812 83827 N/A N/A
908445 83725 83740 CTGTCAGCATGATAGG 44 N/A N/A 528
83813 83828 N/A N/A
908446 83726 83741 GCTGTCAGCATGATAG 70 N/A N/A 529
83814 83829 N/A N/A
908447 83727 83742 TATCATGCTGACAGCT 55 N/A N/A 530
83815 83830 N/A N/A
908448 83910 83925 GAGGTTGACTACAAAG 12 N/A N/A 531
908449 83913 83928 TGAGAGGTTGACTACA 6 N/A N/A 532
908450 83915 83930 TTTGAGAGGTTGACTA 17 N/A N/A 533
908451 83921 83936 TGGGTTTTTGAGAGGT 9 N/A N/A 534
908452 84177 84192 GGCGATGGCACGACCA 71 N/A N/A 535
908453 84938 84953 GTATAAGGACGGCCCA 45 N/A N/A 536
908454 85500 85515 TCAGATCCGGCCTGGC 191 N/A N/A 537
908455 86165 86180 GTGGTGTGGCGTGCGC 75 N/A N/A 538
908456 86583 86598 GAACTTACTGTCTCCC 14 N/A N/A 539
908457 87056 87071 AGGCAGGGCCGCTGTC 100 N/A N/A 540
908458 87386 87401 AGGATTGGTGCCGCCC 36 N/A N/A 541
908459 87906 87921 AATCAGCGGGTGATGC 118 N/A N/A 542
908460 88179 88194 GCCCAGTGGCCGCCCT 70 N/A N/A 543
908461 88831 88846 CTACAGCTGGTGCGGT 40 N/A N/A 544
908462 89400 89415 CGCCAGGCTTGGGCCC 100 N/A N/A 545
908463 89711 89726 GCCCAGATAAGAAGCC 38 N/A N/A 546
908464 90096 90111 GGCTAGTTCATGCCGG 63 N/A N/A 547
908465 90743 90758 ACGGCCTGGGCACACG 52 N/A N/A 548
908466 90747 90762 GGAAACGGCCTGGGCA 64 N/A N/A 549
908467 90750 90765 AAGGGAAACGGCCTGG 76 N/A N/A 550
908468 90753 90768 CGCAAGGGAAACGGCC 108 N/A N/A 551
908469 90755 90770 TGCGCAAGGGAAACGG 87 N/A N/A 552
908470 90757 90772 GCTGCGCAAGGGAAAC 124 N/A N/A 553
908471 90761 90776 CCCTTGCGCAGCTCTG 18 N/A N/A 554
908472 90765 90780 CACACAGAGCTGCGCA 57 N/A N/A 555
908473 90778 90793 GAAGCCCCCTGCACAC 37 N/A N/A 556
908474 90781 90796 AGAGAAGCCCCCTGCA 72 N/A N/A 557
908475 90809 90824 CCAAGTGAGCAGCCAC 9 N/A N/A 558
908476 90811 90826 GACCAAGTGAGCAGCC 27 N/A N/A 559
908477 90813 90828 GGGACCAAGTGAGCAG 63 N/A N/A 560
908478 91157 91172 CACTAGGCCCTGCCAG 128 N/A N/A 561
908479 91836 91851 GAGCGGGGGTCTGTGA 58 N/A N/A 562
908480 92802 92817 CAGCACTTTGTCCGGG 82 N/A N/A 563
908481 93315 93330 ACCTACGGCAAGCGCA 31 N/A N/A 564
908482 93568 93583 TACCAGGATCTCCCCC 19 N/A N/A 565
908483 94077 94092 GCTAGAGGAGCGGCAC 74 N/A N/A 566
908484 94531 94546 GCCCATCTCACGCCCC 71 N/A N/A 567
908485 95058 95073 CCAGAGGCCACGGCCA 94 N/A N/A 568
908486 95635 95650 CCGCACACCCCTCGGT 111 N/A N/A 569
908487 96522 96537 CAGGCCGCCCTGTGCG 93 N/A N/A 570
908488 97096 97111 CCCAAGCATTTCCAGC 37 N/A N/A 571
908489 97109 97124 AGTTCCACCCTGTCCC 23 N/A N/A 572
908490 97144 97159 TAGAGACACCTCCAGC 47 N/A N/A 573
908491 97147 97162 CAATAGAGACACCTCC 44 N/A N/A 574
908492 97150 97165 CCGCAATAGAGACACC 43 N/A N/A 575
908493 97152 97167 GACCGCAATAGAGACA 64 N/A N/A 576
908494 97154 97169 GGGACCGCAATAGAGA 94 N/A N/A 577
908495 97157 97172 CTATTGCGGTCCCTGG 31 N/A N/A 578
908496 97159 97174 AGCCAGGGACCGCAAT 85 N/A N/A 579
908497 97426 97441 GCCCACCCGCTCTTCC 80 N/A N/A 580
908498 98041 98056 TGGAACCCCGGTGCCC 119 N/A N/A 581
908499 98971 98986 CTTCACCGTTTGGCCA 45 N/A N/A 582
908500 100149 100164 CGCGGAGCCAGGCCCT 114 N/A N/A 583
908501 101337 101352 CCCCAGAGTCCCGCAG 72 N/A N/A 584
908502 101845 101860 ACACGAAGGGCCCCTC 52 N/A N/A 585
908503 102223 102238 GCAGACTGATAGGGCC 103 N/A N/A 586
908504 102495 102510 GGATAGCCGGCCCCGC 102 N/A N/A 587
908505 102955 102970 CGCGGCCGGAAGCTTC 93 N/A N/A 588
908506 103211 103226 CAGAGCATAGGAGAGG 7 N/A N/A 589
103249 103264 N/A N/A
908507 103213 103228 AGCAGAGCATAGGAGA 12 N/A N/A 590
103251 103266 N/A N/A
908508 103216 103231 GGGAGCAGAGCATAGG 16 N/A N/A 591
103254 103269 N/A N/A
908509 104082 104097 GCCAGCCACGGCTGTC 81 N/A N/A 592
908510 104495 104510 GCTGACGGCACGCACA 65 N/A N/A 593
908511 105108 105123 TGGGGATGGCTCGGGG 79 N/A N/A 594
908512 105526 105541 CACCAGGGCTCCGCCT 107 N/A N/A 595
908513 106268 106283 GGCACACGGCTCAGGG 93 N/A N/A 596
908514 106974 106989 CAGCAAGTGGCTGCCC 107 N/A N/A 597
908515 107645 107660 TGGGAGTGGTACTGCA 70 N/A N/A 598
908516 108733 108748 TGCCATGGGTCTGGCA 86 N/A N/A 599
908517 108893 108908 GCTCCTCACCTGGTCC 92 N/A N/A 600
908518 108899 108914 AGGACGGCTCCTCACC 111 N/A N/A 601
908519 108902 108917 GAGGAGCCGTCCTGCG 85 N/A N/A 602
908520 108906 108921 GCTGCGCAGGACGGCT 104 N/A N/A 603
908521 109226 109241 GGGCGAACCACCCACC 78 N/A N/A 604
908522 109577 109592 GCCCAAAGGATCTGCC 88 N/A N/A 605
908523 109968 109983 CCCTATTGTCCCACCA 43 N/A N/A 606
908524 110612 110627 GTGCACTCTAGGCTTA 100 N/A N/A 607
908525 111378 111393 GGACACAGCGGCTGCC 78 N/A N/A 608
908526 111925 111940 CCGCAGGTTTCTGTGG 122 N/A N/A 609
908527 112198 112213 ACCGATAGGATCGGAG 95 N/A N/A 610
908528 112578 112593 GGCCGTCACAACTTTT 116 N/A N/A 611
908529 112910 112925 CTGGAACCTCCTACTG 87 N/A N/A 612
908530 114292 114307 GGCCGAATGCTTGAGG 97 N/A N/A 613
908531 114921 114936 TCACAGGGCCCCCTCA 68 N/A N/A 614
908532 115371 115386 GGCCTTACCTGGGCAC 101 N/A N/A 615
908533 115837 115852 CCGCAAGCCACCAGGG 87 N/A N/A 616
*Oligos with an asterisk target an amplicon region.

Each modified oligonucleotide listed in the table below is 100% complementary to human DNM2 nucleic acid sequence GENBANK Number NM_001005361.2 (designated herein as SEQ ID NO:3). “Start Site” indicates the 5′-most nucleoside of SEQ ID No: 3 to which the oligonucleotide is complementary. “Stop Site” indicates the 3′-most nucleoside of SEQ ID No: 3 to which the oligonucleotide is complementary. ‘N/A’ indicates that the modified oligonucleotide is not 100% complementary to the particular nucleic acid. As shown below, modified oligonucleotides complementary to DNM2 reduced human DNM2 mRNA expression.

TABLE 2
DNM2 mRNA Expression
SEQ SEQ
ID: 3 ID: 3 SEQ
Compound Start Stop Dynamin2 ID
Number Site Site Sequence (%Control) NO
695118 1728 1743 ATCTCCCCCTGATTGG  60 617
908218 1732 1747 CAGGATCTCCCCCTGA 114 618
908219 1379 1394 GCCCCGTCCTGACTCC  61 619
908220 1381 1396 GAGCCCCGTCCTGACT  92 620
908233 1515 1530 CTGAGCTTCTCGGCAC  70 621
908234 1517 1532 AACTGAGCTTCTCGGC  85 622
908235 1519 1534 GGAACTGAGCTTCTCG  33 623

Example 2: Effect of Modified Oligonucleotides Complementary to Dynamin 2 In Vitro

Modified oligonucleotides complementary to dynamin (DNM2) nucleic acid were designed and tested for their effect on dynamin 2 mRNA in vitro. The modified oligonucleotides were tested in a series of experiments that had similar culture conditions.

A431 cells cultured at a density of 10,000 cells per well were treated with 2,000 nM of modified oligonucleotide via free uptake or no oligonucleotide for untreated controls. After approximately 24 hours, RNA was isolated from the cells and DNM2 mRNA levels were measured by quantitative real-time PCR as described in Example 1.

The modified oligonucleotides in the tables below each have a 3-10-3 cEt gapmer motif, wherein the central gap segment contains ten 2′-deoxynucleosides and is flanked by wing segments on the 3′ and 5′ ends, each containing three cEt nucleosides. All cytosine residues throughout each modified oligonucleotide are 5-methyl cytosines. All internucleoside linkages are phosphorothioate internucleoside linkages.

Each modified oligonucleotide listed in the tables below is 100% complementary to human DNM2 nucleic acid sequence GENBANK Number NC_000019.10, truncated from 10715001 to 1083500 (SEQ ID NO: 1) and/or GENBANK Number NM_004945.3 (SEQ ID NO:2). As shown below, modified oligonucleotides complementary to human DNM2 inhibited human DNM2 mRNA expression.

TABLE 3
DNM2 mRNA Expression
SEQ SEQ
SEQ ID: SEQ ID: ID: 2 ID 2: SEQ
Compound 1 Start 1 Stop Dunamin2 Start Stop ID
Number Site Site Sequence (%Control) Site Site NO
694792 3060 3075 CGACACCCGACCCGAG 26 N/A N/A 624
694812 3317 3332 GTCCAGGTGGCAGCTC 37 265 280 625
694826 57522 57537 CCGGACTTCATCAAAG 82 469 484 626
694999 115263 115278 GTCCAGGCCGGGATGG 92 2606 N/A 627
695015 116005 116020 GCGGATAATGGTGGGC 12 2749 N/A 628
695016 116011 116026 GGCTGGGCGGATAATG 76 2755 N/A 629
695170 82446 82461 CTTCAAACTCGGCTCT 9 N/A N/A 630
695171 82451 82466 ACACACTTCAAACTCG 7 N/A N/A 13
695171 82451 82466 ACACACTTCAAACTCG 12 N/A N/A 13
695171 82451 82466 ACACACTTCAAACTCG 9 N/A N/A 13
695171 82451 82466 ACACACTTCAAACTCG 8 N/A N/A 13
695171 82451 82466 ACACACTTCAAACTCG 11 N/A N/A 13
695171 82451 82466 ACACACTTCAAACTCG 7 N/A N/A 13
695171 82451 82466 ACACACTTCAAACTCG 121 N/A N/A 13
695171 82451 82466 ACACACTTCAAACTCG 14 N/A N/A 13
695171 82451 82466 ACACACTTCAAACTCG 8 N/A N/A 13
695171 82451 82466 ACACACTTCAAACTCG 6 N/A N/A 13
695171 82451 82466 ACACACTTCAAACTCG 31 N/A N/A 13
695171 82451 82466 ACACACTTCAAACTCG 8 N/A N/A 13
695171 82451 82466 ACACACTTCAAACTCG 6 N/A N/A 13
695171 82451 82466 ACACACTTCAAACTCG 10 N/A N/A 13
695171 82451 82466 ACACACTTCAAACTCG 8 N/A N/A 13
695171 82451 82466 ACACACTTCAAACTCG 12 N/A N/A 13
695171 82451 82466 ACACACTTCAAACTCG 11 N/A N/A 13
695171 82451 82466 ACACACTTCAAACTCG 11 N/A N/A 13
695171 82451 82466 ACACACTTCAAACTCG 5 N/A N/A 13
695171 82451 82466 ACACACTTCAAACTCG 12 N/A N/A 13
695171 82451 82466 ACACACTTCAAACTCG 7 N/A N/A 13
695171 82451 82466 ACACACTTCAAACTCG 120 N/A N/A 13
695171 82451 82466 ACACACTTCAAACTCG 6 N/A N/A 13
695171 82451 82466 ACACACTTCAAACTCG 8 N/A N/A 13
695171 82451 82466 ACACACTTCAAACTCG 9 N/A N/A 13
695171 82451 82466 ACACACTTCAAACTCG 7 N/A N/A 13
695171 82451 82466 ACACACTTCAAACTCG 10 N/A N/A 13
695171 82451 82466 ACACACTTCAAACTCG 9 N/A N/A 13
695171 82451 82466 ACACACTTCAAACTCG 9 N/A N/A 13
695171 82451 82466 ACACACTTCAAACTCG 9 N/A N/A 13
695171 82451 82466 ACACACTTCAAACTCG 10 N/A N/A 13
695171 82451 82466 ACACACTTCAAACTCG 7 N/A N/A 13
948484 82379 82394 GTGAAGAGCCCCGTCC 42 N/A N/A 631
948485 82380 82395 GGTGAAGAGCCCCGTC 103 N/A N/A 632
948486 82443 82458 CAAACTCGGCTCTTTG 99 N/A N/A 633
948487 82444 82459 TCAAACTCGGCTCTTT 15 N/A N/A 634
948488 82445 82460 TTCAAACTCGGCTCTT 5 N/A N/A 635
948489 82448 82463 CACTTCAAACTCGGCT 3 N/A N/A 636
948490 82449 82464 ACACTTCAAACTCGGC 1 N/A N/A 637
948491 82450 82465 CACACTTCAAACTCGG 25 N/A N/A 638
948492 82452 82467 AACACACTTCAAACTC 11 N/A N/A 639
948493 82453 82468 CAACACACTTCAAACT 51 N/A N/A 640
948494 82454 82469 TCAACACACTTCAAAC 30 N/A N/A 641
948495 82458 82473 GAGATCAACACACTTC 19 N/A N/A 642
948496 82460 82475 ACGAGATCAACACACT 5 N/A N/A 643
948497 82461 82476 CACGAGATCAACACAC 28 N/A N/A 644
948498 82463 82478 ACCACGAGATCAACAC 50 N/A N/A 645
948499 82467 82482 TGAGACCACGAGATCA 55 N/A N/A 646
948500 82469 82484 TCTGAGACCACGAGAT 107 N/A N/A 647
948501 82470 82485 CTCTGAGACCACGAGA 119 N/A N/A 648
948502 82490 82505 TTTTTTATGACCGTGG 18 N/A N/A 649
948503 82496 82511 GCACACTTTTTTATGA 17 N/A N/A 650
948504 82497 82512 GGCACACTTTTTTATG 54 N/A N/A 651
948505 82499 82514 TCGGCACACTTTTTTA 10 N/A N/A 652
948506 82500 82515 CTCGGCACACTTTTTT 3 N/A N/A 653
948507 82501 82516 TCTCGGCACACTTTTT 3 N/A N/A 654
948508 82503 82518 CTTCTCGGCACACTTT 3 N/A N/A 655
948514 3056 3071 ACCCGACCCGAGCGAC 81 4 19 656
948515 3067 3082 TCTCAGGCGACACCCG 88 15 30 657
948516 3092 3107 CCTCACGGTCGCCGCC 56 40 55 658
948517 3094 3109 GGCCTCACGGTCGCCG 98 42 57 659
948518 3103 3118 TCCCGGCTCGGCCTCA 48 51 66 660
948519 3139 3154 GCTCCCCGCCCGCCCG 71 87 102 661
948520 3141 3156 TTGCTCCCCGCCCGCC 23 89 104 662
948521 3142 3157 GTTGCTCCCCGCCCGC 10 90 105 663
948522 3143 3158 CGTTGCTCCCCGCCCG 50 91 106 664
948523 3145 3160 GCCGTTGCTCCCCGCC 53 93 108 665
948524 3147 3162 TAGCCGTTGCTCCCCG 17 95 110 666
948525 3148 3163 GTAGCCGTTGCTCCCC 14 96 111 667
948526 3150 3165 CTGTAGCCGTTGCTCC 10 98 113 668
948527 3151 3166 TCTGTAGCCGTTGCTC 9 99 114 669
948528 3152 3167 GTCTGTAGCCGTTGCT 13 100 115 670
948529 3168 3183 GACCTGGCCCCGCGGC 76 116 131 671
948530 3169 3184 CGACCTGGCCCCGCGG 83 117 132 672
948531 3170 3185 ACGACCTGGCCCCGCG 36 118 133 673
948532 3172 3187 CAACGACCTGGCCCCG 17 120 135 674
948533 3173 3188 TCAACGACCTGGCCCC 20 121 136 675
948534 3174 3189 CTCAACGACCTGGCCC 30 122 137 676
948535 3175 3190 CCTCAACGACCTGGCC 101 123 138 677
948536 3176 3191 CCCTCAACGACCTGGC 57 124 139 678
948537 3278 3293 CTGCAGTTTGTTGACC 45 226 241 679
948538 3299 3314 GCCGATGGAGCTGAAG 7 247 262 680
948539 3300 3315 GGCCGATGGAGCTGAA 104 248 263 681
948540 N/A N/A AAGGAAGTCCCGGCCC 81 346 361 682
948541 N/A N/A GAAGGAAGTCCCGGCC 101 347 362 683
948542 44750 44765 GATTCCTGAACCGCGG 106 364 379 684
948543 44752 44767 ACGATTCCTGAACCGC 38 366 381 685
948544 44754 44769 TGACGATTCCTGAACC 18 368 383 686
948545 44755 44770 GTGACGATTCCTGAAC 40 369 384 687
948546 44756 44771 GGTGACGATTCCTGAA 42 370 385 688
948547 44758 44773 CGGGTGACGATTCCTG 111 372 387 689
948548 44761 44776 CGCCGGGTGACGATTC 44 375 390 690
948549 44769 44784 TGAGAGGCCGCCGGGT 11 383 398 691
948550 44771 44786 AATGAGAGGCCGCCGG 76 385 400 692
948551 44772 44787 GAATGAGAGGCCGCCG 67 386 401 693
948552 44775 44790 GCAGAATGAGAGGCCG 99 389 404 694
948553 57480 57495 CAAAAACTCGGCATGT 20 427 442 695
948554 57481 57496 GCAAAAACTCGGCATG 15 428 443 696
948555 57490 57505 ACTTGCAGTGCAAAAA 15 437 452 697
948556 57492 57507 GGACTTGCAGTGCAAA 7 439 454 698
948557 57494 57509 TTGGACTTGCAGTGCA 3 441 456 699
948558 57497 57512 TTTTTGGACTTGCAGT 10 444 459 700
948559 57498 57513 CTTTTTGGACTTGCAG 6 445 460 701
948560 57500 57515 AACTTTTTGGACTTGC 3 447 462 702
948561 57501 57516 AAACTTTTTGGACTTG 92 448 463 703
948562 57502 57517 TAAACTTTTTGGACTT 8 449 464 704
948563 57503 57518 GTAAACTTTTTGGACT 26 450 465 705
948564 57504 57519 TGTAAACTTTTTGGAC 15 451 466 706
948565 57524 57539 TGCCGGACTTCATCAA 31 471 486 707
948566 57525 57540 CTGCCGGACTTCATCA 24 472 487 708
948567 57527 57542 TCCTGCCGGACTTCAT 26 474 489 709
948568 57530 57545 ATCTCCTGCCGGACTT 14 477 492 710
948569 57531 57546 AATCTCCTGCCGGACT 18 478 493 711
948570 57535 57550 CTTCAATCTCCTGCCG 29 482 497 712
948571 57597 57612 TCGAAGGTTGATGGGC 89 544 559 713
948572 57598 57613 CTCGAAGGTTGATGGG 88 545 560 714
948573 57599 57614 ACTCGAAGGTTGATGG 75 546 561 715
948574 60706 60721 ATGAGGGTCAAGTTCA 52 579 594 716
948575 60708 60723 CGATGAGGGTCAAGTT 15 581 596 717
948576 60709 60724 TCGATGAGGGTCAAGT 28 582 597 718
948577 60710 60725 GTCGATGAGGGTCAAG 22 583 598 719
948578 60712 60727 AGGTCGATGAGGGTCA 15 585 600 720
948579 60714 60729 GGAGGTCGATGAGGGT 53 587 602 721
948580 60717 60732 CCGGGAGGTCGATGAG 93 590 605 722
948581 60721 60736 ATACCCGGGAGGTCGA 32 594 609 723
948582 60723 60738 TGATACCCGGGAGGTC 34 596 611 724
948583 60725 60740 GGTGATACCCGGGAGG 32 598 613 725
948584 60726 60741 TGGTGATACCCGGGAG 79 599 614 726
948585 60727 60742 TTGGTGATACCCGGGA 27 600 615 727
948586 60729 60744 CCTTGGTGATACCCGG 44 602 617 728
948587 60774 60789 CCTTGATCTGGTACTC 6 647 662 729
948588 60775 60790 TCCTTGATCTGGTACT 20 648 663 730
948589 60777 60792 TGTCCTTGATCTGGTA 12 650 665 731
948590 60779 60794 CATGTCCTTGATCTGG 13 652 667 732
948591 60781 60796 ATCATGTCCTTGATCT 34 654 669 733
948592 60782 60797 GATCATGTCCTTGATC 57 655 670 734
948593 60783 60798 GGATCATGTCCTTGAT 38 656 671 735
948594 60815 60830 AATGAGGCTGCTCTCC 42 688 703 736
948595 60820 60835 GCCAGAATGAGGCTGC 92 693 708 737
948596 60848 60863 GGCCAGGTCCATGTTG 92 721 736 738
948597 N/A N/A GGTCCGTAGGCCTTGG 45 775 790 739
948598 62120 62135 CACCGATGGTCCGTAG 49 782 797 740
948599 62192 62207 ACGGGAGCAACTTGTT 76 854 869 741
948600 62196 62211 CTCAACGGGAGCAACT 48 858 873 742
948601 62197 62212 TCTCAACGGGAGCAAC 45 859 874 743
948602 68004 68019 CACGGATGTCCTTCTT 8 923 938 744
948603 68006 68021 TGCACGGATGTCCTTC 25 925 940 745
948604 68007 68022 CTGCACGGATGTCCTT 5 926 941 746
948605 68009 68024 TGCTGCACGGATGTCC 16 928 943 747
948606 68010 68025 GTGCTGCACGGATGTC 20 929 944 748
948607 68011 68026 AGTGCTGCACGGATGT 22 930 945 749
948608 68012 68027 CAGTGCTGCACGGATG 8 931 946 750
948609 68014 68029 GCCAGTGCTGCACGGA 37 933 948 751
948610 68015 68030 TGCCAGTGCTGCACGG 50 934 949 752
948611 68016 68031 CTGCCAGTGCTGCACG 27 935 950 753
948612 68018 68033 AGCTGCCAGTGCTGCA 107 937 952 754
948613 68056 68071 TGCCGGTAGGCCGGGT 122 975 990 755
948614 71653 71668 CCGAAAGTTCTTGTAC 31 1129 1144 756
948615 71656 71671 GGGCCGAAAGTTCTTG 88 1132 1147 757
948616 71657 71672 CGGGCCGAAAGTTCTT 75 1133 1148 758
948617 71658 71673 TCGGGCCGAAAGTTCT 42 1134 1149 759
948618 71660 71675 CGTCGGGCCGAAAGTT 20 1136 1151 760
948619 71683 71698 GGCTTTGGTTTTGCGG 80 1159 1174 761
948620 78729 78744 ATCCACCCCAAACTGC 45 1192 1207 762
948621 78771 78786 AGTGTCCACCTGATCT 27 1234 1249 763
948622 78773 78788 AGAGTGTCCACCTGAT 11 1236 1251 764
948623 78774 78789 CAGAGTGTCCACCTGA 88 1237 1252 765
948624 78775 78790 CCAGAGTGTCCACCTG 74 1238 1253 766
948625 78777 78792 CTCCAGAGTGTCCACC 51 1240 1255 767
948626 78785 78800 CCGGAGAGCTCCAGAG 98 1248 1263 768
948627 78787 78802 CCCCGGAGAGCTCCAG 44 1250 1265 769
948628 78805 78820 TGCGATTGATTCGGGC 11 1268 1283 770
948629 78806 78821 ATGCGATTGATTCGGG 3 1269 1284 771
948630 78810 78825 GAAGATGCGATTGATT 10 1273 1288 772
948631 78811 78826 GGAAGATGCGATTGAT 3 1274 1289 773
948632 78812 78827 TGGAAGATGCGATTGA 9 1275 1290 774
948633 78813 78828 GTGGAAGATGCGATTG 8 1276 1291 775
948634 78829 78844 CAAATGGGAACCGCTC 60 1292 1307 776
948335 78830 78845 TCAAATGGGAACCGCT 65 1293 1308 777
948636 78831 78846 CTCAAATGGGAACCGC 81 1294 1309 778
948637 78832 78847 GCTCAAATGGGAACCG 58 1295 1310 779
948638 78833 78848 AGCTCAAATGGGAACC 43 1296 1311 780
948639 78837 78852 CACCAGCTCAAATGGG 70 1300 1315 781
948640 80420 80435 CTCCATGGATGTTCTT 42 1367 1382 782
948641 81059 81074 TGAAAAGCCCGGTCCT 38 1385 1400 783
948642 81060 81075 GTGAAAAGCCCGGTCC 37 1386 1401 784
948643 81062 81077 GGGTGAAAAGCCCGGT 120 1388 1403 785
948644 81077 81092 CGAATGCCAAGTCCGG 84 1403 1418 786
948645 81078 81093 TCGAATGCCAAGTCCG 28 1404 1419 787
948646 81080 81095 CCTCGAATGCCAAGTC 13 1406 1421 788
948647 81081 81096 GCCTCGAATGCCAAGT 73 1407 1422 789
948648 81084 81099 ATGGCCTCGAATGCCA 94 1410 1425 790
948649 81088 81103 CACAATGGCCTCGAAT 35 1414 1429 791
948650 81104 81119 TGACGACCTGCTTTTT 15 1430 1445 792
948651 81105 81120 TTGACGACCTGCTTTT 21 1431 1446 793
948652 81108 81123 AGCTTGACGACCTGCT 84 1434 1449 794
948653 81110 81125 TCAGCTTGACGACCTG 61 1436 1451 795
948654 81112 81127 TTTCAGCTTGACGACC 11 1438 1453 796
948655 81114 81129 TCTTTCAGCTTGACGA 27 1440 1455 797
948656 81116 81131 GCTCTTTCAGCTTGAC 3 1442 1457 798
948657 81117 81132 GGCTCTTTCAGCTTGA 59 1443 1458 799
948658 81118 81133 GGGCTCTTTCAGCTTG 73 1444 1459 800
948659 81120 81135 CAGGGCTCTTTCAGCT 75 1446 1461 801
948660 81132 81147 ACACATTTCAGACAGG 3 1458 1473 802
948661 81134 81149 CGACACATTTCAGACA 7 1460 1475 803
948662 81135 81150 TCGACACATTTCAGAC 10 1461 1476 804
948663 81136 81151 GTCGACACATTTCAGA 51 1462 1477 805
948664 81138 81153 AGGTCGACACATTTCA 3 1464 1479 806
948665 81140 81155 CCAGGTCGACACATTT 6 1466 1481 807
948666 81141 81156 ACCAGGTCGACACATT 8 1467 1482 808
948667 81142 81157 AACCAGGTCGACACAT 34 1468 1483 809
948668 81146 81161 GGATAACCAGGTCGAC 34 1472 1487 810
948669 81148 81163 CTGGATAACCAGGTCG 43 1474 1489 811
948670 81149 81164 CCTGGATAACCAGGTC 111 1475 1490 812
948671 81150 81165 TCCTGGATAACCAGGT 100 1476 1491 813
948672 81152 81167 GCTCCTGGATAACCAG 51 1478 1493 814
948673 81159 81174 TTGATTAGCTCCTGGA 2 1485 1500 815
948674 81161 81176 TATTGATTAGCTCCTG 8 1487 1502 816
948675 81162 81177 GTATTGATTAGCTCCT 2 1488 1503 817
948676 81163 81178 TGTATTGATTAGCTCC 1 1489 1504 818
948677 81164 81179 CTGTATTGATTAGCTC 2 1490 1505 819
948678 81165 81180 ACTGTATTGATTAGCT 7 1491 1506 820
948679 81168 81183 CTAACTGTATTGATTA 56 1494 1509 821
948680 81169 81184 CCTAACTGTATTGATT 44 1495 1510 822
948681 81171 81186 TGCCTAACTGTATTGA 25 1497 1512 823
948682 81177 81192 GTACACTGCCTAACTG 23 1503 1518 824
948683 81180 81195 CTGGTACACTGCCTAA 14 1506 1521 825
948684 81181 81196 ACTGGTACACTGCCTA 8 1507 1522 826
948685 81183 81198 TTACTGGTACACTGCC 2 1509 1524 827
948686 81184 81199 CTTACTGGTACACTGC 1 1510 1525 828
948687 N/A N/A GCTTACTGGTACACTG 6 1511 1526 829
948688 N/A N/A AGCTTACTGGTACACT 26 1512 1527 830
948689 N/A N/A GAGCTTACTGGTACAC 12 1513 1528 831
948690 N/A N/A ACTGAGCTTACTGGTA 47 1516 1531 832
948691 N/A N/A AACTGAGCTTACTGGT 24 1517 1532 833
948692 N/A N/A GGAACTGAGCTTACTG 10 1519 1534 834
948693 N/A N/A AGGAACTGAGCTTACT 12 1520 1535 835
948694 N/A N/A TAGGAACTGAGCTTAC 17 1521 1536 836
948695 N/A N/A GTAGGAACTGAGCTTA 15 1522 1537 837
948696 83484 83499 GGGTAGGAACTGAGCT 28 1524 1539 838
948697 83500 83515 CTCCTCTCGCAACCGG 56 1540 1555 839
948698 83503 83518 TGTCTCCTCTCGCAAC 44 1543 1558 840
948699 83504 83519 CTGTCTCCTCTCGCAA 27 1544 1559 841
948700 83506 83521 CTCTGTCTCCTCTCGC 5 1546 1561 842
948701 83507 83522 GCTCTGTCTCCTCTCG 8 1547 1562 843
948702 83508 83523 CGCTCTGTCTCCTCTC 5 1548 1563 844
948703 83510 83525 TTCGCTCTGTCTCCTC 5 1550 1565 845
948704 83514 83529 ACGATTCGCTCTGTCT 69 1554 1569 846
948705 83515 83530 GACGATTCGCTCTGTC 91 1555 1570 847
948706 83516 83531 TGACGATTCGCTCTGT 37 1556 1571 848
948707 83521 83536 AGTGGTGACGATTCGC 5 1561 1576 849
948708 83523 83538 TAAGTGGTGACGATTC 25 1563 1578 850
948709 83525 83540 TGTAAGTGGTGACGAT 21 1565 1580 851
948710 83526 83541 ATGTAAGTGGTGACGA 27 1566 1581 852
948711 83527 83542 GATGTAAGTGGTGACG 37 1567 1582 853
948712 83530 83545 CCGGATGTAAGTGGTG 60 1570 1585 854
948713 83543 83558 TCCCCTCCCGTTCCCG 40 1583 1598 855
948714 83545 83560 TCTCCCCTCCCGTTCC 30 1585 1600 856
948715 83546 83561 TTCTCCCCTCCCGTTC 43 1586 1601 857
948716 83547 83562 GTTCTCCCCTCCCGTT 14 1587 1602 858
948717 N/A N/A GCAGAAGAATCTGGTC 27 1607 1622 859
948718 87287 87302 GATCAGCAGAAGAATC 126 1612 1627 860
948719 87289 87304 TCGATCAGCAGAAGAA 70 1614 1629 861
948720 87291 87306 TGTCGATCAGCAGAAG 27 1616 1631 862
948721 87292 87307 ATGTCGATCAGCAGAA 51 1617 1632 863
948722 87293 87308 AATGTCGATCAGCAGA 41 1618 1633 864
948723 87295 87310 TCAATGTCGATCAGCA 17 1620 1635 865
948724 87297 87312 GCTCAATGTCGATCAG 14 1622 1637 866
948725 87298 87313 TGCTCAATGTCGATCA 41 1623 1638 867
948726 87301 87316 GACTGCTCAATGTCGA 91 1626 1641 868
948727 87303 87318 AGGACTGCTCAATGTC 28 1628 1643 869
948728 87305 87320 GTAGGACTGCTCAATG 136 1630 1645 870
948729 87306 87321 TGTAGGACTGCTCAAT 2 1631 1646 871
948730 87307 87322 ATGTAGGACTGCTCAA 18 1632 1647 872
948731 87309 87324 TGATGTAGGACTGCTC 6 1634 1649 873
948732 87310 87325 TTGATGTAGGACTGCT 13 1635 1650 874
948733 87312 87327 TGTTGATGTAGGACTG 39 1637 1652 875
948734 87313 87328 GTGTTGATGTAGGACT 22 1638 1653 876
948735 87314 87329 CGTGTTGATGTAGGAC 3 1639 1654 877
948736 N/A N/A GGCATTGGCAAACCCG 106 1672 1687 878
948737 97293 97308 CATCAGGCTGATGTTG 43 1765 1780 879
948738 97296 97311 TTTCATCAGGCTGATG 90 1768 1783 880
948739 97340 97355 AGTGACTCGGCAGTCA 100 1812 1827 881
948740 97342 97357 ACAGTGACTCGGCAGT 25 1814 1829 882
948741 97343 97358 GACAGTGACTCGGCAG 13 1815 1830 883
948742 97344 97359 GGACAGTGACTCGGCA 33 1816 1831 884
948743 97346 97361 CAGGACAGTGACTCGG 23 1818 1833 885
948744 97347 97362 CCAGGACAGTGACTCG 36 1819 1834 886
948745 97348 97363 ACCAGGACAGTGACTC 23 1820 1835 887
948746 97349 97364 TACCAGGACAGTGACT 93 1821 1836 888
948747 105014 105029 TCACGGATCTTGAGGT 27 1884 1899 889
948748 105016 105031 CATCACGGATCTTGAG 52 1886 1901 890
948749 105017 105032 ACATCACGGATCTTGA 43 1887 1902 891
948750 105018 105033 CACATCACGGATCTTG 19 1888 1903 892
948751 105021 105036 CTCCACATCACGGATC 60 1891 1906 893
948752 105024 105039 CTTCTCCACATCACGG 4 1894 1909 894
948753 105061 105076 TGAAGATGGCGAAGAC 52 1931 1946 895
948754 105062 105077 TTGAAGATGGCGAAGA 101 1932 1947 896
948755 105063 105078 GTTGAAGATGGCGAAG 83 1933 1948 897
948756 108794 108809 CCGCAGGTCCTTGTAG 60 1966 1981 898
948757 108796 108811 TGCCGCAGGTCCTTGT 42 1968 1983 899
948758 108809 108824 GGCCAGCTCGATCTGC 85 1981 1996 900
948759 108855 108870 GGAGGAACGAGGCCTT 80 2027 2042 901
948760 108856 108871 CGGAGGAACGAGGCCT 107 2028 2043 902
948761 108858 108873 CTCGGAGGAACGAGGC 111 2030 2045 903
948762 108864 108879 CGCCAGCTCGGAGGAA 125 2036 2051 904
948763 110079 110094 GAGAAGGTGTTCTCCT 98 2094 2109 905
948764 110082 110097 ATGGAGAAGGTGTTCT 112 2097 2112 906
948765 110158 110173 GGACTTGTTGATGATG 9 2173 2188 907
948766 110159 110174 TGGACTTGTTGATGAT 10 2174 2189 908
948767 110161 110176 GATGGACTTGTTGATG 12 2176 2191 909
948768 110162 110177 GGATGGACTTGTTGAT 8 2177 2192 910
948769 110163 110178 CGGATGGACTTGTTGA 10 2178 2193 911
948770 110164 110179 GCGGATGGACTTGTTG 36 2179 2194 912
948771 110165 110180 CGCGGATGGACTTGTT 78 2180 2195 913
948772 110173 110188 CATGAGGTCGCGGATG 25 2188 2203 914
948773 110174 110189 GCATGAGGTCGCGGAT 4 2189 2204 915
948774 110176 110191 TGGCATGAGGTCGCGG 9 2191 2206 916
948775 114037 114052 TGGATGAAGGCCTTCG 6 2238 2253 917
948776 114065 114080 GGAGTATAGGTAGGCC 15 2266 2281 918
948777 114067 114082 GAGGAGTATAGGTAGG 7 2268 2283 919
948778 114070 114085 GCCGAGGAGTATAGGT 51 2271 2286 920
948779 114071 114086 TGCCGAGGAGTATAGG 17 2272 2287 921
948780 114152 114167 CTTGAGGGCATGGTAC 48 2353 2368 922
948781 114225 114240 TGTCATCGACAGGCGG 32 2426 2441 923
948782 115139 115154 GGACACCGGTCGGCGC 103 2482 2497 924
948783 115140 115155 TGGACACCGGTCGGCG 43 2483 2498 925
948784 115145 115160 TATGCTGGACACCGGT 33 2488 2503 926
948785 115147 115162 TGTATGCTGGACACCG 22 2490 2505 927
948786 115148 115163 GTGTATGCTGGACACC 78 2491 2506 928
948787 115149 115164 GGTGTATGCTGGACAC 79 2492 2507 929
948788 115212 115227 CGGGAACAGGAATCAG 13 2555 2570 930
948789 115213 115228 ACGGGAACAGGAATCA 19 2556 2571 931
948790 115217 115232 CCCCACGGGAACAGGA 101 2560 2575 932
948791 115235 115250 CGAGAAGGAGGCTGCT 45 2578 2593 933
948792 115236 115251 CCGAGAAGGAGGCTGC 37 2579 2594 934
948793 115237 115252 GCCGAGAAGGAGGCTG 124 2580 2595 935
948794 115279 115294 GCAAACACGCTCTGGG 6 2622 2637 936
948795 115280 115295 GGCAAACACGCTCTGG 11 2623 2638 937
948796 115281 115296 TGGCAAACACGCTCTG 31 2624 2639 938
948797 115282 115297 TTGGCAAACACGCTCT 23 2625 2640 939
948798 115284 115299 TGTTGGCAAACACGCT 15 2627 2642 940
948799 115286 115301 ACTGTTGGCAAACACG 66 2629 2644 941
948800 115287 115302 CACTGTTGGCAAACAC 39 2630 2645 942
948801 115288 115303 TCACTGTTGGCAAACA 28 2631 2646 943
948802 115289 115304 GTCACTGTTGGCAAAC 17 2632 2647 944
948803 115290 115305 GGTCACTGTTGGCAAA 16 2633 2648 945
948804 115291 115306 AGGTCACTGTTGGCAA 9 2634 2649 946
948805 115293 115308 AGAGGTCACTGTTGGC 3 2636 2651 947
948806 115294 115309 AAGAGGTCACTGTTGG 7 2637 2652 948
948807 115295 115310 GAAGAGGTCACTGTTG 19 2638 2653 949
948808 115297 115312 GGGAAGAGGTCACTGT 13 2640 2655 950
948809 115321 115336 CGAGATGGGATCTGAG 33 2664 2679 951
948810 115322 115337 CCGAGATGGGATCTGA 18 2665 2680 952
948811 115323 115338 GCCGAGATGGGATCTG 28 2666 2681 953
948812 115327 115342 ACTGGCCGAGATGGGA 13 2670 2685 954
948813 115328 115343 AACTGGCCGAGATGGG 20 2671 2686 955
948814 115330 115345 CGAACTGGCCGAGATG 27 2673 2688 956
948815 115331 115346 CCGAACTGGCCGAGAT 46 2674 2689 957
948816 115333 115348 ATCCGAACTGGCCGAG 35 2676 2691 958
948817 115334 115349 GATCCGAACTGGCCGA 105 2677 2692 959
948818 115991 116006 GCCGGCTGGGCGCAGC 124 2735 2750 960
948819 116000 116015 TAATGGTGGGCCGGCT 83 2744 2759 961
948820 116002 116017 GATAATGGTGGGCCGG 96 2746 2761 962
948821 116003 116018 GGATAATGGTGGGCCG 73 2747 2762 963
948822 116004 116019 CGGATAATGGTGGGCC 41 2748 2763 964
948823 116014 116029 CTCGGCTGGGCGGATA 109 2758 2773 965
948824 116023 116038 CAGGGATGGCTCGGCT 48 2767 2782 966
948825 116028 116043 TCGAGCAGGGATGGCT 84 2772 2787 967
948826 116029 116044 GTCGAGCAGGGATGGC 135 2773 2788 968
948827 116034 116049 GCCTAGTCGAGCAGGG 84 2778 2793 969
948828 116055 116070 CGAGAGCACGCCCCCC 37 2799 2814 970
948829 116058 116073 CCCCGAGAGCACGCCC 73 2802 2817 971
948830 116092 116107 ACTGAAGCTCCTGCGC 75 2836 2851 972
948831 116109 116124 GCGGAGGGCCCCAGAC 94 2853 2868 973
948832 116163 116178 GTTAAGGAAGAGGCCA 27 2907 2922 974
948833 116210 116225 TGCGGTGTCCAGCCAG 42 2954 2969 975
948834 116212 116227 AGTGCGGTGTCCAGCC 24 2956 2971 976
948835 116213 116228 CAGTGCGGTGTCCAGC 9 2957 2972 977
948836 116214 116229 GCAGTGCGGTGTCCAG 11 2958 2973 978
948837 116216 116231 GCGCAGTGCGGTGTCC 60 2960 2975 979
948838 116217 116232 TGCGCAGTGCGGTGTC 58 2961 2976 980
948839 116221 116236 CCTTTGCGCAGTGCGG 57 2965 2980 981
948840 116222 116237 CCCTTTGCGCAGTGCG 21 2966 2981 982
948841 116224 116239 GCCCCTTTGCGCAGTG 104 2968 2983 983
948842 116225 116240 GGCCCCTTTGCGCAGT 98 2969 2984 984
948843 116261 116276 GTGCAACACCCCAGCG 58 3005 3020 985
948844 116266 116281 CCAAAGTGCAACACCC 31 3010 3025 986
948845 116267 116282 CCCAAAGTGCAACACC 82 3011 3026 987
948846 116288 116303 TGCCACCCTGAGACTC 62 3032 3047 988
948847 116310 116325 TCAAGGGTTCTGGTCC 10 3054 3069 989
948848 116311 116326 GTCAAGGGTTCTGGTC 28 3055 3070 990
948849 116313 116328 GTGTCAAGGGTTCTGG 8 3057 3072 991
948850 116315 116330 TGGTGTCAAGGGTTCT 6 3059 3074 992
948851 116316 116331 ATGGTGTCAAGGGTTC 5 3060 3075 993
948852 116317 116332 GATGGTGTCAAGGGTT 6 3061 3076 994
948853 116319 116334 AGGATGGTGTCAAGGG 13 3063 3078 995
948854 116320 116335 CAGGATGGTGTCAAGG 11 3064 3079 996
948855 116321 116336 TCAGGATGGTGTCAAG 13 3065 3080 997
948856 116323 116338 ATTCAGGATGGTGTCA 13 3067 3082 998
948857 116325 116340 TCATTCAGGATGGTGT 20 3069 3084 999
948858 116327 116342 CCTCATTCAGGATGGT 82 3071 3086 1000
948859 116351 116366 GTAGAGTCCCCCCCAG 22 3095 3110 1001
948860 116353 116368 TGGTAGAGTCCCCCCC 44 3097 3112 1002
948861 116354 116369 TTGGTAGAGTCCCCCC 19 3098 3113 1003
948862 116355 116370 CTTGGTAGAGTCCCCC 9 3099 3114 1004
948863 116357 116372 ACCTTGGTAGAGTCCC 4 3101 3116 1005
948864 116358 116373 GACCTTGGTAGAGTCC 94 3102 3117 1006
948865 116361 116376 GAAGACCTTGGTAGAG 6 3105 3120 1007
948866 116363 116378 AAGAAGACCTTGGTAG 17 3107 3122 1008
948867 116364 116379 CAAGAAGACCTTGGTA 60 3108 3123 1009
948868 116365 116380 CCAAGAAGACCTTGGT 62 3109 3124 1010
948869 116366 116381 CCCAAGAAGACCTTGG 70 3110 3125 1011
948870 116367 116382 GCCCAAGAAGACCTTG 60 3111 3126 1012
948871 116384 116399 CTACATGGGCTTTCCC 85 3128 3143 1013
948872 116386 116401 CCCTACATGGGCTTTC 98 3130 3145 1014
948873 116399 116414 TATAGAAGGCCTGCCC 100 3143 3158 1015
948874 116401 116416 CTTATAGAAGGCCTGC 20 3145 3160 1016
948875 116402 116417 ACTTATAGAAGGCCTG 25 3146 3161 1017
948876 116403 116418 CACTTATAGAAGGCCT 34 3147 3162 1018
948877 116405 116420 CGCACTTATAGAAGGC 57 3149 3164 1019
948878 116406 116421 CCGCACTTATAGAAGG 83 3150 3165 1020
948879 116450 116465 CCCTGCACCCCAGCAA 128 3194 3209 1021
948880 116454 116469 ATACCCCTGCACCCCA 18 3198 3213 1022
948881 116456 116471 ATATACCCCTGCACCC 45 3200 3215 1023
948882 116457 116472 GATATACCCCTGCACC 11 3201 3216 1024
948883 116458 116473 TGATATACCCCTGCAC 13 3202 3217 1025
948884 116459 116474 TTGATATACCCCTGCA 9 3203 3218 1026
948885 116460 116475 GTTGATATACCCCTGC 4 3204 3219 1027
948886 116465 116480 GGGAAGTTGATATACC 14 3209 3224 1028
948887 116466 116481 TGGGAAGTTGATATAC 20 3210 3225 1029
948888 116468 116483 AATGGGAAGTTGATAT 59 3212 3227 1030
948889 116469 116484 TAATGGGAAGTTGATA 49 3213 3228 1031
948890 116470 116485 CTAATGGGAAGTTGAT 15 3214 3229 1032
948891 116472 116487 TGCTAATGGGAAGTTG 12 3216 3231 1033
948892 116473 116488 CTGCTAATGGGAAGTT 4 3217 3232 1034
948893 116475 116490 TCCTGCTAATGGGAAG 2 3219 3234 1035
948894 116476 116491 CTCCTGCTAATGGGAA 86 3220 3235 1036
948895 116479 116494 GAGCTCCTGCTAATGG 94 3223 3238 1037
948896 116498 116513 GGCCAGGCTTGCCGCT 99 3242 3257 1038
948897 116512 116527 TACCGAGCCCACTGGG 103 3256 3271 1039
948898 116515 116530 CACTACCGAGCCCACT 82 3259 3274 1040
948899 116517 116532 GGCACTACCGAGCCCA 64 3261 3276 1041
948900 116520 116535 CTGGGCACTACCGAGC 92 3264 3279 1042
948901 116525 116540 GCCAGCTGGGCACTAC 149 3269 3284 1043
948902 116526 116541 TGCCAGCTGGGCACTA 130 3270 3285 1044
948903 116539 116554 TACACCTCAGGCCTGC 28 3283 3298 1045
948904 116540 116555 GTACACCTCAGGCCTG 98 3284 3299 1046
948905 116542 116557 ATGTACACCTCAGGCC 77 3286 3301 1047
948906 116543 116558 TATGTACACCTCAGGC 9 3287 3302 1048
948907 116545 116560 ACTATGTACACCTCAG 5 3289 3304 1049
948908 116546 116561 GACTATGTACACCTCA 16 3290 3305 1050
948909 116548 116563 AGGACTATGTACACCT 125 3292 3307 1051
948910 116549 116564 AAGGACTATGTACACC 5 3293 3308 1052
948911 116551 116566 GGAAGGACTATGTACA 11 3295 3310 1053
948912 116552 116567 GGGAAGGACTATGTAC 28 3296 3311 1054
948913 116553 116568 CGGGAAGGACTATGTA 16 3297 3312 1055
948914 116554 116569 CCGGGAAGGACTATGT 60 3298 3313 1056
948915 116555 116570 GCCGGGAAGGACTATG 40 3299 3314 1057
948916 116560 116575 ATATGGCCGGGAAGGA 21 3304 3319 1058
948917 116562 116577 TAATATGGCCGGGAAG 2 3306 3321 1059
948918 116563 116578 TTAATATGGCCGGGAA 9 3307 3322 1060
948919 116564 116579 GTTAATATGGCCGGGA 16 3308 3323 1061
948920 116566 116581 TGGTTAATATGGCCGG 37 3310 3325 1062
948921 116567 116582 GTGGTTAATATGGCCG 45 3311 3326 1063
948922 116568 116583 TGTGGTTAATATGGCC 10 3312 3327 1064
948923 116570 116585 TGTGTGGTTAATATGG 3 3314 3329 1065
948924 116571 116586 CTGTGTGGTTAATATG 4 3315 3330 1066
948925 116572 116587 GCTGTGTGGTTAATAT 7 3316 3331 1067
948926 116574 116589 AGGCTGTGTGGTTAAT 3 3318 3333 1068
948927 116618 116633 GGCCTAGCAAAGGCAC 118 3362 3377 1069
948928 116631 116646 GCCAACGGCTCCGGGC 119 3375 3390 1070
948929 116637 116652 GCCCGGGCCAACGGCT 96 3381 3396 1071
948930 116645 116660 CAAGGCCGGCCCGGGC 131 3389 3404 1072
948931 116647 116662 GGCAAGGCCGGCCCGG 104 3391 3406 1073
948932 116652 116667 AATAGGGCAAGGCCGG 65 3396 3411 1074
948933 116653 116668 GAATAGGGCAAGGCCG 126 3397 3412 1075
948934 116654 116669 GGAATAGGGCAAGGCC 22 3398 3413 1076
948935 116656 116671 GAGGAATAGGGCAAGG 7 3400 3415 1077
948936 116657 116672 AGAGGAATAGGGCAAG 4 3401 3416 1078
948937 116658 116673 GAGAGGAATAGGGCAA 6 3402 3417 1079
948938 116660 116675 AGGAGAGGAATAGGGC 8 3404 3419 1080
948939 116705 116720 ACATAGCCCAAGCCCA 54 3449 3464 1081
948940 116706 116721 CACATAGCCCAAGCCC 72 3450 3465 1082
948941 116707 116722 CCACATAGCCCAAGCC 90 3451 3466 1083
948942 116709 116724 ACCCACATAGCCCAAG 71 3453 3468 1084
948943 116767 116782 ACCCATCAGGGAGGCA 93 3511 3526 1085
948944 116790 116805 CAGAGAGAGGCCGCCC 43 3534 3549 1086
948945 116793 116808 CCTCAGAGAGAGGCCG 134 3537 3552 1087
948946 116814 116829 AGCGAGGAGTGGGTGA 43 3558 3573 1088
948947 116817 116832 CTGAGCGAGGAGTGGG 57 3561 3576 1089
948948 116818 116833 ACTGAGCGAGGAGTGG 34 3562 3577 1090
948949 116820 116835 AAACTGAGCGAGGAGT 64 3564 3579 1091
948950 116821 116836 CAAACTGAGCGAGGAG 7 3565 3580 1092
948951 116823 116838 GTCAAACTGAGCGAGG 5 3567 3582 1093
948952 116824 116839 GGTCAAACTGAGCGAG 5 3568 3583 1094
948953 116825 116840 TGGTCAAACTGAGCGA 9 3569 3584 1095
948954 116827 116842 AGTGGTCAAACTGAGC 5 3571 3586 1096
948955 116828 116843 CAGTGGTCAAACTGAG 64 3572 3587 1097
948956 116829 116844 ACAGTGGTCAAACTGA 73 3573 3588 1098
948957 116830 116845 TACAGTGGTCAAACTG 69 3574 3589 1099
948958 116831 116846 TTACAGTGGTCAAACT 34 3575 3590 1100
948959 116833 116848 ACTTACAGTGGTCAAA 17 3577 3592 1101
948960 116834 116849 CACTTACAGTGGTCAA 11 3578 3593 1102
948961 116835 116850 GCACTTACAGTGGTCA 4 3579 3594 1103
948962 116836 116851 GGCACTTACAGTGGTC 45 3580 3595 1104
948963 116837 116852 AGGCACTTACAGTGGT 5 3581 3596 1105
948964 116841 116856 GTGCAGGCACTTACAG 43 3585 3600 1106
948965 116844 116859 AGAGTGCAGGCACTTA 7 3588 3603 1107
948966 116846 116861 ACAGAGTGCAGGCACT 8 3590 3605 1108
948967 116847 116862 TACAGAGTGCAGGCAC 12 3591 3606 1109
948968 116848 116863 ATACAGAGTGCAGGCA 6 3592 3607 1110
948969 116850 116865 GAATACAGAGTGCAGG 6 3594 3609 1111
948970 116851 116866 AGAATACAGAGTGCAG 2 3595 3610 1112
948971 116852 116867 TAGAATACAGAGTGCA 1 3596 3611 1113
948972 116854 116869 AATAGAATACAGAGTG 6 3598 3613 1114
948973 3394 3409 GCTCACCGGCCCACGA 72 N/A N/A 1115
948974 3500 3515 CGCGGGCACGCAAGCG 144 N/A N/A 1116
948975 3607 3622 CGTGACACCGCCCCTG 71 N/A N/A 1117
948976 3715 3730 ATCTACCCCAGACCCA 63 N/A N/A 1118
948977 3725 3740 CAGAAGAGGGATCTAC 99 N/A N/A 1119
948978 3776 3791 CAATAGATATCTAGAT 144 N/A N/A 1120
948979 3778 3793 CCCAATAGATATCTAG 59 N/A N/A 1121
948980 3815 3830 AGATACAAGAACAAGC 67 N/A N/A 1122
948981 3934 3949 AGCTAGCCAGACAGCA 146 N/A N/A 1123
948982 4010 4025 CAACAGAGGGACTGCT 85 N/A N/A 1124
948983 4035 4050 ACAGTAGAGGCCAGCT 96 N/A N/A 1125
948984 4130 4145 CGGAAGAGAGGAGCCA 84 N/A N/A 1126
948985 4135 4150 TCACACGGAAGAGAGG 63 N/A N/A 1127
948986 4142 4157 GAAGAATTCACACGGA 50 N/A N/A 1128
948987 4262 4277 GTCCAAACCTCCTCCT 63 N/A N/A 1129
948988 4315 4330 TCCTGAAGTAAGGTAC 96 N/A N/A 1130
948989 4326 4341 TCGGAAAGGAATCCTG 40 N/A N/A 1131
948990 4371 4386 AATTTGTAGGCTGTAG 21 N/A N/A 1132
948991 4388 4403 TCCAAAGGAGGGCCCC 140 N/A N/A 1133
948992 4476 4491 CACCGCGGCTTCTCAA 38 N/A N/A 1134
948993 4624 4639 GAGAAGTGGCCGCCCA 75 N/A N/A 1135
948994 4649 4664 CCACAAATGAGTAGTT 49 N/A N/A 1136
948995 4730 4745 CATTATCCCTTGACAA 115 N/A N/A 1137
948996 4742 4757 ATCAAGAAGGGACATT 85 N/A N/A 1138
948997 4838 4853 GGTGATCACAGTCCCT 72 N/A N/A 1139
948998 4938 4953 AGAGACAAGGTAGCAA 45 N/A N/A 1140
948999 4950 4965 AGGCAATGAGCTAGAG 39 N/A N/A 1141
949000 5049 5064 GAAGATGGTCACTCAA 47 N/A N/A 1142
949001 5051 5066 AGGAAGATGGTCACTC 32 N/A N/A 1143
949002 5162 5177 GTCAACCAAGACTTAG 48 N/A N/A 1144
949003 5545 5560 TAGAATGGCATCTTGT 28 N/A N/A 1145
949004 5710 5725 CCGGATCTGGTTCTGT 88 N/A N/A 1146
949005 5810 5825 AACCAGCCAGATAAAC 94 N/A N/A 1147
949006 5872 5887 GCTTAAGTGTGTAACG 8 N/A N/A 1148
949007 5873 5888 GGCTTAAGTGTGTAAC 10 N/A N/A 1149
949008 5898 5913 GATTATAGCAATGCCT 22 N/A N/A 1150
949009 5940 5955 GCTCAGCTATCTGAGC 107 N/A N/A 1151
949010 6074 6089 CCAGACACCATGGTAG 33 N/A N/A 1152
949011 6150 6165 ATATAATGAGCAACTC 47 N/A N/A 1153
949012 6174 6189 GTGAGACTCGGTGTAA 10 N/A N/A 1154
949013 6298 6313 GTGGTAACGCGCGCCT 41 N/A N/A 1155
949014 6455 6470 AATACTCTTAACGAGG 95 N/A N/A 1156
949015 6556 6571 ACCTTATCTCTTACAC 63 N/A N/A 1157
949016 6697 6712 TCCAGGCTCGGCGCAA 83 N/A N/A 1158
949017 6752 6767 AGCTATAGGGCTGAAC 129 N/A N/A 1159
949018 6816 6831 CGCAGGTAAAACAAAA 38 N/A N/A 1160
949019 6817 6832 ACGCAGGTAAAACAAA 56 N/A N/A 1161
949020 6821 6836 AGCTACGCAGGTAAAA 66 N/A N/A 1162
949021 6824 6839 AAAAGCTACGCAGGTA 27 N/A N/A 1163
949022 6870 6885 CCGGATATTGACTGGA 46 N/A N/A 1164
949023 6891 6906 TGTCTTAGAGCCACAA 131 N/A N/A 1165
949024 6906 6921 CTCTATAGATCTGAGT 123 N/A N/A 1166
949025 6918 6933 GACAACTCAGAACTCT 93 N/A N/A 1167
949026 7031 7046 TACCACCCTCAGCTTA 69 N/A N/A 1168
949027 7131 7146 CGCCAGGTGAAACTGA 86 N/A N/A 1169
949028 7155 7170 CCACAAGGGACAAAGG 89 N/A N/A 1170
949029 7170 7185 TCGAAGCCATTACTGC 89 N/A N/A 1171
949030 7248 7263 TGCTAGGGAGTAGTGG 47 N/A N/A 1172
949031 7273 7288 GCAAAATGATCTAGGC 26 N/A N/A 1173
949032 7328 7343 CCGCAGACAAGCCAGG 99 N/A N/A 1174
949033 7351 7366 CCAAAGTTCTATCTGC 15 N/A N/A 1175
949034 7395 7410 TGACAAGGGTCAAGAG 91 N/A N/A 1176
949035 7400 7415 CTAAATGACAAGGGTC 22 N/A N/A 1177
949036 7402 7417 GGCTAAATGACAAGGG 47 N/A N/A 1178
949037 7645 7660 GTATAAGACCCTATCT 83 N/A N/A 1179
949038 7849 7864 ATTTGAGGCGAGGAGG 58 N/A N/A 1180
949050 8567 8582 TTTTAAAGAAGACGGG 51 N/A N/A 1181
949051 8584 8599 TGCTATTATAACTCCT 15 N/A N/A 1182
949052 8671 8686 GAACAACACCTAATGT 47 N/A N/A 1183
949053 8675 8690 GAACGAACAACACCTA 8 N/A N/A 1184
949054 8678 8693 AATGAACGAACAACAC 22 N/A N/A 1185
949055 8705 8720 AGTAAAAGTACTCAGG 8 N/A N/A 1186
949056 8740 8755 TGGTAACTTGCTCAGG 16 N/A N/A 1187
949057 8773 8788 GCTGAAAGGCCAGCTC 83 N/A N/A 1188
949058 8949 8964 CTACAGGTGTCACCAT 100 N/A N/A 1189
949059 9093 9108 ACTTATCGCCTTTTTT 11 N/A N/A 1190
949061 9613 9628 CTCCACTGGCCTGCTA 4 N/A N/A 1191
949062 9724 9739 AGGGACAGCAGTAGCG 69 N/A N/A 1192
949063 9830 9845 AGAAAAATGGCACGGG 41 N/A N/A 1193
949064 9883 9898 TAAAAACGCAGCTGGA 79 N/A N/A 1194
949065 9971 9986 TGCACTGGTGCAGCAC 115 N/A N/A 1195
949066 10072 10087 GGCTCTAAACTAATAA 143 N/A N/A 1196
949067 10260 10275 TCGGGATTCACTATGT 28 N/A N/A 1197
949068 10379 10394 CGCTTACTGCAAGTTC 40 N/A N/A 1198
949069 10481 10496 CCTAACCGAGCCTTGC 78 N/A N/A 1199
949070 10675 10690 ACAACAATTTGCTACG 45 N/A N/A 1200
949071 10677 10692 TCACAACAATTTGCTA 23 N/A N/A 1201
949072 11266 11281 TGACACCAAACTGAGC 92 N/A N/A 1202
949073 11356 11371 AAAGAAACTAAGGCCG 87 N/A N/A 1203
949074 11384 11399 TAATGATGAGTTCCTT 14 N/A N/A 1204
949075 11392 11407 CAACAGAGTAATGATG 54 N/A N/A 1205
949076 11496 11511 CGATATTTCAGGATCT 88 N/A N/A 1206
949077 11597 11612 CTCATCACCGTACACA 9 N/A N/A 1207
949078 11881 11896 CCCTATCATTGGTTTT 55 N/A N/A 1208
949079 11984 11999 TAACAGGTCTTGTGCA 55 N/A N/A 1209
949080 12093 12108 ACGATTCACATGTGGG 11 N/A N/A 1210
949081 12141 12156 AACCTAATCCCCAAAC 104 N/A N/A 1211
949082 12195 12210 AGCACTTGGACAGCCT 36 N/A N/A 1212
949083 12200 12215 GAAAAAGCACTTGGAC 31 N/A N/A 1213
949084 12214 12229 CAATAAGTAACTCTGA 52 N/A N/A 1214
949085 12318 12333 ATCTACAACTGTCCCC 25 N/A N/A 1215
949086 12555 12570 AATAATGAGACCCCAC 145 N/A N/A 1216
949087 12667 12682 TAAATCTAACCTAGGC 126 N/A N/A 1217
949088 12778 12793 CAGAAGTTTGGCAGAT 5 N/A N/A 1218
949089 12788 12803 TCAAATCGGGCAGAAG 22 N/A N/A 1219
949090 12858 12873 AAATTACGGTTTACAT 71 N/A N/A 1220
949091 12859 12874 TAAATTACGGTTTACA 20 N/A N/A 1221
949092 12878 12893 TTGTAGTTGGCAATCC 12 N/A N/A 1222
949093 12892 12907 GGCTTAATTACAGCTT 86 N/A N/A 1223
949094 12901 12916 CACAATAAGGGCTTAA 10 N/A N/A 1224
949095 12902 12917 ACACAATAAGGGCTTA 10 N/A N/A 1225
949096 12947 12962 CCCTATAAATATCTCA 23 N/A N/A 1226
949097 13037 13052 ACGCACCCGGAAGCAG 71 N/A N/A 1227
949098 13140 13155 AAACAGTCATCCAGCT 105 N/A N/A 1228
949099 13208 13223 TGGCACACGGTGATTC 57 N/A N/A 1229
949100 13215 13230 GCACATGTGGCACACG 27 N/A N/A 1230
949101 13273 13288 AGGGATGCTAAGAGCA 69 N/A N/A 1231
949102 13281 13296 TATAAAGCAGGGATGC 117 N/A N/A 1232
949103 13391 13406 CCATATGTGTGGCTCT 21 N/A N/A 1233
949104 13520 13535 GCATATCCAAAGCCAC 38 N/A N/A 1234
949105 13635 13650 CATTTAACTGTTCACC 28 N/A N/A 1235
949106 13812 13827 CGACAGACAAGTACCA 46 N/A N/A 1236
949107 13952 13967 GCATACAGCCTTTTTT 38 N/A N/A 1237
949108 13953 13968 CGCATACAGCCTTTTT 15 N/A N/A 1238
949109 13955 13970 ACCGCATACAGCCTTT 9 N/A N/A 1239
949110 13956 13971 CACCGCATACAGCCTT 46 N/A N/A 1240
949111 13959 13974 AACCACCGCATACAGC 50 N/A N/A 1241
949112 13961 13976 TGAACCACCGCATACA 40 N/A N/A 1242
949113 14262 14277 TGCAACCTTCAAGTAA 94 N/A N/A 1243
949114 14390 14405 GCAAACCGCTTCTCAC 74 N/A N/A 1244
949115 14492 14507 CCCCAAGTCCTGGCGG 99 N/A N/A 1245
949116 14629 14644 GAAAAGTCGGCATTCC 74 N/A N/A 1246
949117 14757 14772 TGACAGTGGTGCTCCC 66 N/A N/A 1247
949118 15000 15015 TGGCATGTGGTTGTTG 26 N/A N/A 1248
949119 15165 15180 AACAAATATATGCACG 20 N/A N/A 1249
949120 15370 15385 TCGCACCTCGGGATTC 92 N/A N/A 1250
949121 15507 15522 GTGAAATTCACTCCAT 40 N/A N/A 1251
949122 15612 15627 GGAAGATGTCCTTGCT 49 N/A N/A 1252
949123 15643 15658 ATAGATGGAGCAAATC 77 N/A N/A 1253
949124 15647 15662 TTATATAGATGGAGCA 32 N/A N/A 1254
949125 15708 15723 ACGCAGATAGACACCC 53 N/A N/A 1255
949126 15712 15727 GCCAACGCAGATAGAC 93 N/A N/A 1256
949127 15777 15792 TGCCATACAGGGCCTC 116 N/A N/A 1257
949128 15859 15874 GAAAGAGCAGTGGTGC 73 N/A N/A 1258
949129 15973 15988 GGGCATGGAGGTGTCA 90 N/A N/A 1259
949130 16025 16040 CGCGAAAGTGTGTCAC 64 N/A N/A 1260
949131 16117 16132 TATCACCCAGCAGGCA 75 N/A N/A 1261
949132 16275 16290 GGCCAGCTGGTAGGCC 114 N/A N/A 1262
949134 16714 16729 GTCAAGCTGAGCCAGT 52 N/A N/A 1263
949135 16815 16830 ACAGAAGCCGGGCTTC 127 N/A N/A 1264
949136 16926 16941 ATCAATTTTCACCCAG 19 N/A N/A 1265
949137 16930 16945 GTGCATCAATTTTCAC 127 N/A N/A 1266
949138 17244 17259 AAAGAGTTTAAGGGCG 57 N/A N/A 1267
949139 17282 17297 CCACAACGAGTAAACA 15 N/A N/A 1268
949140 17615 17630 GGACAGGGTGAATTGT 62 N/A N/A 1269
949141 17723 17738 AGTCACACCTAGAAAT 32 N/A N/A 1270
949142 17758 17773 GACTTATAGGCTCACT 12 N/A N/A 1271
949143 17763 17778 TACTAGACTTATAGGC 26 N/A N/A 1272
949144 17765 17780 GTTACTAGACTTATAG 19 N/A N/A 1273
949145 17766 17781 TGTTACTAGACTTATA 40 N/A N/A 1274
949146 17834 17849 ATATAGCAGGGACCTG 70 N/A N/A 1275
949147 17838 17853 CTAAATATAGCAGGGA 36 N/A N/A 1276
949148 17840 17855 CACTAAATATAGCAGG 24 N/A N/A 1277
949149 18278 18293 TTTGAGCCCGAGAGGG 46 N/A N/A 1278
949150 18486 18501 TTATTTCTAGGCAGGG 13 N/A N/A 1279
949151 18524 18539 GTAAATTTGAAGCTTA 144 N/A N/A 1280
949152 18583 18598 AATTAGAGGACACTGG 19 N/A N/A 1281
949153 18665 18680 GCTTTAACTCCTAGAC 61 N/A N/A 1282
949154 19040 19055 GTATACCAAGGTTAAT 56 N/A N/A 1283
949155 19050 19065 CTTAATAGTAGTATAC 96 N/A N/A 1284
949156 19458 19473 CACACGAGGTCTCACT 44 N/A N/A 1285
949157 19461 19476 CTACACACGAGGTCTC 72 N/A N/A 1286
949158 19663 19678 TACATTCTGGCTTTGG 12 N/A N/A 1287
949159 19763 19778 TCTCAGTATGTATACT 12 N/A N/A 1288
949160 19814 19829 TGTCCAGTCCTAAGAC 101 N/A N/A 1289
949161 19816 19831 AATGTCCAGTCCTAAG 81 N/A N/A 1290
949162 19817 19832 CAATGTCCAGTCCTAA 19 N/A N/A 1291
949163 19818 19833 GCAATGTCCAGTCCTA 4 N/A N/A 1292
949164 19820 19835 ATGCAATGTCCAGTCC 13 N/A N/A 1293
949165 19821 19836 GATGCAATGTCCAGTC 70 N/A N/A 1294
949166 19822 19837 AGATGCAATGTCCAGT 13 N/A N/A 1295
949167 19824 19839 CTAGATGCAATGTCCA 12 N/A N/A 1296
949168 19843 19858 GCTTAAGGAGATCCGA 17 N/A N/A 1297
949169 19844 19859 GGCTTAAGGAGATCCG 85 N/A N/A 1298
949170 19872 19887 GGCTGAGTTGCTTCCC 79 N/A N/A 1299
949171 19935 19950 TTCCAGATAAGCCCTA 32 N/A N/A 1300
949172 19986 20001 CACCAATGGCCTTCTT 42 N/A N/A 1301
949173 20328 20343 GAAGATGGCTGGACGA 34 N/A N/A 1302
949174 20330 20345 CAGAAGATGGCTGGAC 34 N/A N/A 1303
949175 20378 20393 CAATAATTTATCAGTC 68 N/A N/A 1304
949176 20440 20455 GGGAAACCTAGCAAGC 80 N/A N/A 1305
949177 20487 20502 CCCAAAGGATAGAGTA 23 N/A N/A 1306
949178 20735 20750 TTACATGAGTCTAGGA 50 N/A N/A 1307
949179 20737 20752 TATTACATGAGTCTAG 68 N/A N/A 1308
949180 20740 20755 GATTATTACATGAGTC 49 N/A N/A 1309
949181 20748 20763 GGCAAGAGGATTATTA 53 N/A N/A 1310
949182 20844 20859 AGCAACTTTAGGGAGA 5 N/A N/A 1311
949183 20899 20914 GAACAGACAGTTCAGG 76 N/A N/A 1312
949184 20947 20962 AAGATATGTGGTTTTG 35 N/A N/A 1313
949185 21341 21356 GAGCATCACCAGCCCA 127 N/A N/A 1314
949186 21403 21418 TAGAAATGAGTGGGCG 116 N/A N/A 1315
949187 21416 21431 AGCTACAGCAATATAG 43 N/A N/A 1316
949188 21449 21464 ACTCACATGGCCTGAT 81 N/A N/A 1317
949189 21491 21506 CTAGACTAGACAAAAC 91 N/A N/A 1318
949190 21514 21529 ATATATATGTGGAGGC 4 N/A N/A 1319
949191 21561 21576 CTAATACACAATGATC 34 N/A N/A 1320
949192 21591 21606 CAAAAAACTAATACCG 105 N/A N/A 1321
949193 21698 21713 AACCAGTACCAGCTGG 98 N/A N/A 1322
949194 21758 21773 AGAAACTGTACTGGTC 25 N/A N/A 1323
949195 21845 21860 GGATATTCTTAACAGG 26 N/A N/A 1324
949196 21854 21869 AGCTAGGAAGGATATT 83 N/A N/A 1325
949197 22009 22024 AAGTATGCGCTGCCAT 38 N/A N/A 1326
949198 22018 22033 TGGGACTGTAAGTATG 63 N/A N/A 1327
949199 22133 22148 GGATATAGGGTCTCCC 138 N/A N/A 1328
949200 22243 22258 CATGAGGTAGGACAGC 54 N/A N/A 1329
949201 22251 22266 GAAAAAGCCATGAGGT 100 N/A N/A 1330
949202 22301 22316 CCACAGGGTTATCTGG 119 N/A N/A 1331
949203 22345 22360 AAGGAGGCTTTTAAGC 92 N/A N/A 1332
949204 22446 22461 AGGAATGACAAGTGGT 17 N/A N/A 1333
949205 22466 22481 CGCATAGGTGGAACAA 58 N/A N/A 1334
949206 22478 22493 CAAGAAACCAAACGCA 81 N/A N/A 1335
949207 22638 22653 AATATACGGGCATGTT 82 N/A N/A 1336
949208 22639 22654 AAATATACGGGCATGT 110 N/A N/A 1337
949209 22641 22656 AAAAATATACGGGCAT 104 N/A N/A 1338
949210 22643 22658 ACAAAAATATACGGGC 67 N/A N/A 1339
949211 22644 22659 TACAAAAATATACGGG 33 N/A N/A 1340
949212 22780 22795 TCAAACAAATAGGCCG 86 N/A N/A 1341
949213 22862 22877 ATGCAAGGGACTGCGC 66 N/A N/A 1342
949214 22883 22898 ACCTATCGCATGCCAG 17 N/A N/A 1343
949215 23000 23015 GTTCAGGTCAGAGCCT 51 N/A N/A 1344
949216 23297 23312 TCTCAATGAAAGTCTC 10 N/A N/A 1345
949217 23548 23563 GTAACAACCGCTGGGA 27 N/A N/A 1346
949218 23555 23570 TTAAAGAGTAACAACC 75 N/A N/A 1347
949219 23715 23730 GCCCAGCTAACTAACT 108 N/A N/A 1348
949220 24040 24055 GACTACAGTACAGGCG 74 N/A N/A 1349
949221 24201 24216 AGAACAAGGGAACACG 80 N/A N/A 1350
949222 24210 24225 CCCCATAGAAGAACAA 138 N/A N/A 1351
949223 24289 24304 GATTAGGTATTATGGT 12 N/A N/A 1352
949224 24296 24311 TCAAAAGGATTAGGTA 25 N/A N/A 1353
949225 24315 24330 ATCCACTGAATAGTAT 32 N/A N/A 1354
949226 24364 24379 CTACAAAATCAGATAG 91 N/A N/A 1355
949227 24438 24453 GACATTAGTGGCTTCC 35 N/A N/A 1356
949228 24561 24576 AACCAGCATGGATGAA 87 N/A N/A 1357
949229 24782 24797 TGCAACCTTGCCCCCC 11 N/A N/A 1358
949230 24934 24949 TAGTATTCAAAAAACG 80 N/A N/A 1359
949231 25044 25059 CAAATTAAATACACCC 62 N/A N/A 1360
949232 25058 25073 GAATACTATTCTAACA 118 N/A N/A 1361
949233 25210 25225 CACCACAATTTGCTCT 63 N/A N/A 1362
949234 25305 25320 TCAGAAAAGGAGGGTA 109 N/A N/A 1363
949235 25321 25336 TTCCACTTCAAGAACC 87 N/A N/A 1364
949236 25696 25711 TGTAAGCAACTGTATT 49 N/A N/A 1365
949237 25788 25803 TGAGAAGATATGCTGA 26 N/A N/A 1366
949238 25822 25837 AACCTATGTATCAAAG 87 N/A N/A 1367
949239 25925 25940 CAAAGTAGTTCCTCCA 34 N/A N/A 1368
949240 25927 25942 TACAAAGTAGTTCCTC 68 N/A N/A 1369
949241 26042 26057 CCCAAGAGTAAAATAC 105 N/A N/A 1370
949242 26084 26099 ACGAAACCAATAAGAC 104 N/A N/A 1371
949243 26090 26105 GAAAATACGAAACCAA 99 N/A N/A 1372
949244 26133 26148 TAATAATGGATGGAAC 84 N/A N/A 1373
949245 26155 26170 TGGTATCAGGCAAGAA 35 N/A N/A 1374
949246 27033 27048 CATGATGCTGCAATCA 97 N/A N/A 1375
949247 27177 27192 CACAAGCCTGCGGACC 110 N/A N/A 1376
949248 27191 27206 GAGCATAGCAGACACA 65 N/A N/A 1377
949249 27254 27269 GGCAACATCACTCTAA 62 N/A N/A 1378
949250 27289 27304 CAAAGAGCCTTGGCAC 111 N/A N/A 1379
949251 27390 27405 CAGGACTAGTTCACTA 78 N/A N/A 1380
949252 27473 27488 ATGAAATTGGGATAAC 60 N/A N/A 1381
949253 27509 27524 ATGAAGGCTGCCACTT 103 N/A N/A 1382
949254 27575 27590 AGCAAGATCATTGGGT 65 N/A N/A 1383
949255 27634 27649 GGAAACCTTGGACTCC 91 N/A N/A 1384
949256 27761 27776 GTCTATTGGCACACAG 38 N/A N/A 1385
949257 27775 27790 GATTAAGTCATCCGGT 70 N/A N/A 1386
949258 27872 27887 GGGCACTGCACAAAGC 86 N/A N/A 1387
949259 27975 27990 AGTCAGCGGAGACTGA 98 N/A N/A 1388
949260 28212 28227 CGGCAAAAGAAGCTGG 133 N/A N/A 1389
949261 28320 28335 AGCTAGAGCATCAGCT 122 N/A N/A 1390
949262 28971 28986 CTGGAAACAGTCTCGC 29 N/A N/A 1391
949263 29116 29131 AGCCGAAGTGTAGTGG 51 N/A N/A 1392
949264 29258 29273 GGCCAAGTCTCCCATC 117 N/A N/A 1393
949265 29370 29385 CCGGACCCGTTCTTGA 85 N/A N/A 1394
949266 29501 29516 AGGTAGTGACCTCCAG 114 N/A N/A 1395
949267 29557 29572 ACCCACAGTCTGCATT 97 N/A N/A 1396
949268 29591 29606 GCCCAAGTGAACTAGA 94 N/A N/A 1397
949269 29625 29640 ATGTATGGATTTCCAG 62 N/A N/A 1398
949270 29642 29657 TTACAGGGTGGTCAGC 82 N/A N/A 1399
949271 29721 29736 GTAAAACGGTTGTGGT 30 N/A N/A 1400
949272 29739 29754 CAACAGGTGTCCTGCT 64 N/A N/A 1401
949273 29842 29857 TGTCATCCTAACTGCT 57 N/A N/A 1402
949274 29943 29958 AGAAACTGGCCGGCCC 132 N/A N/A 1403
949275 30052 30067 TTTATAGTCTCCAACG 34 N/A N/A 1404
949276 30178 30193 ACGGACTGGATTATGC 27 N/A N/A 1405
949277 30248 30263 GGCTAAATCAATCTTG 60 N/A N/A 1406
949278 30282 30297 CGATAATGACCTAAAT 84 N/A N/A 1407
949279 30283 30298 CCGATAATGACCTAAA 8 N/A N/A 1408
949280 30406 30421 GAATATCAACACCTTG 35 N/A N/A 1409
949281 30508 30523 AGTGATATGCTGCCTA 39 N/A N/A 1410
949282 30705 30720 GGTTTATTTGCACCTC 39 N/A N/A 1411
949283 30830 30845 TACCAGGGACTCAACT 111 N/A N/A 1412
949284 30933 30948 GGCCAGACATTGCTGT 142 N/A N/A 1413
949285 31273 31288 CACATTGGTGGTCAAG 98 N/A N/A 1414
949286 31373 31388 CTCATAACATTTGACG 45 N/A N/A 1415
949287 31708 31723 AAAAAAGCCGGCACGG 120 N/A N/A 1416
949288 32027 32042 AAAATTGGTTGAGTGC 40 N/A N/A 1417
949289 32161 32176 GTAAAACTCAGGCTGA 81 N/A N/A 1418
949290 32192 32207 CAAAAGAGAACATTCG 64 N/A N/A 1419
949291 32264 32279 TGTTATGTGGGAATGA 35 N/A N/A 1420
949292 32420 32435 AGGGACACAACAGGCT 85 N/A N/A 1421
949293 32560 32575 CACAATCCACTCCTGG 100 N/A N/A 1422
949294 32561 32576 CCACAATCCACTCCTG 83 N/A N/A 1423
949295 32615 32630 TTGCAGAACAATGGGC 105 N/A N/A 1424
949296 32697 32712 GCGCAGGGTCCCGTAT 95 N/A N/A 1425
949297 32719 32734 TATTAGAGTGGCAGCC 86 N/A N/A 1426
949298 32799 32814 TGCCACTCACAACTGG 104 N/A N/A 1427
949299 32852 32867 CGCCATAGGAAGCTGC 111 N/A N/A 1428
949300 32895 32910 GAGCAGGCGGGCAGCT 82 N/A N/A 1429
949301 32899 32914 AACAGAGCAGGCGGGC 92 N/A N/A 1430
949302 32900 32915 TAACAGAGCAGGCGGG 103 N/A N/A 1431
949303 32903 32918 CATTAACAGAGCAGGC 119 N/A N/A 1432
949304 32904 32919 GCATTAACAGAGCAGG 46 N/A N/A 1433
949305 33006 33021 AGCCACATATGCCTCC 91 N/A N/A 1434
949306 33148 33163 TGTTATGGGCCCTCCT 82 N/A N/A 1435
949307 33277 33292 TCCAAGGCTGTCAGCG 106 N/A N/A 1436
949308 33391 33406 CACGAGGCTGCAGACC 40 N/A N/A 1437
949309 33454 33469 CCGCAGGTAGGTGCCA 56 N/A N/A 1438
949310 33488 33503 GCCCAAGCCTTACAGT 117 N/A N/A 1439
949311 33512 33527 AGCCATTGGTCACCCA 43 N/A N/A 1440
949312 33618 33633 CCGCACCCACCTCAGG 132 N/A N/A 1441
949313 33644 33659 CACCAATGAGGCAGAC 69 N/A N/A 1442
949314 33725 33740 GTGGACTGAGGTTCAG 101 N/A N/A 1443
949315 33826 33841 CTCTAACCCCATCTCG 81 N/A N/A 1444
949316 33927 33942 TCGGCAGGAGCCCACA 108 N/A N/A 1445
949317 34028 34043 CCATATGCTCAGCACA 30 N/A N/A 1446
949318 34029 34044 ACCATATGCTCAGCAC 45 N/A N/A 1447
949319 34159 34174 GATAAGCCCACAGAGG 107 N/A N/A 1448
949320 34164 34179 CAACAGATAAGCCCAC 83 N/A N/A 1449
949321 34281 34296 ACAGACCACAAGGCTC 65 N/A N/A 1450
949322 34283 34298 GAACAGACCACAAGGC 82 N/A N/A 1451
949323 34407 34422 CAGGAAGGCGGTAGGG 92 N/A N/A 1452
949324 34539 34554 TGGGAGGACACTTCCA 121 N/A N/A 1453
949325 34546 34561 CATGAAATGGGAGGAC 9 N/A N/A 1454
949326 34561 34576 ACTGACTTGGCCATCC 68 N/A N/A 1455
949327 34654 34669 CCAGACTGTGGAGCCA 35 N/A N/A 1456
949328 34763 34778 GCCAAGACTTCTGCAC 129 N/A N/A 1457
949329 34873 34888 GCCTACCTGGCCATGG 119 N/A N/A 1458
949330 34995 35010 GCTGACCGGGTTCCCC 148 N/A N/A 1459
949331 35150 35165 TCCTATCCATGGGCCC 93 N/A N/A 1460
949332 35178 35193 TACTATTGCATCATTT 33 N/A N/A 1461
949333 35385 35400 CCCTAGTGAACTTCCC 38 N/A N/A 1462
949334 35541 35556 GCAAACCTCAGTCTCG 39 N/A N/A 1463
949335 35921 35936 GCACAATTAAGTAGTT 36 N/A N/A 1464
949336 35950 35965 GCATAGAGTAGGGCTG 55 N/A N/A 1465
949337 35955 35970 CCAAAGCATAGAGTAG 57 N/A N/A 1466
949338 35956 35971 CCCAAAGCATAGAGTA 62 N/A N/A 1467
949339 36021 36036 CCCATCTGAGCTGTGT 79 N/A N/A 1468
949340 36170 36185 TCGAATGACATTTCCT 65 N/A N/A 1469
949341 36211 36226 AGTAAGACAGGGTAAC 136 N/A N/A 1470
949342 36311 36326 GTGCACCCAGGCTGCC 105 N/A N/A 1471
949343 36420 36435 TTCCAGCCTCCGTCAT 90 N/A N/A 1472
949344 36531 36546 CCTAAGGGTTTTCTGG 109 N/A N/A 1473
949345 36532 36547 CCCTAAGGGTTTTCTG 144 N/A N/A 1474
949346 36570 36585 CCAGAAGTCTCCTAGG 108 N/A N/A 1475
949347 36647 36662 CTAAAAGTTCCCAGAC 86 N/A N/A 1476
949348 36757 36772 GGAGACGCAGCTCTCA 103 N/A N/A 1477
949349 36892 36907 GGACAAGCACCCCTCT 26 N/A N/A 1478
949350 36996 37011 CCCGACCCCGGCCAAT 96 N/A N/A 1479
949351 37100 37115 GTTCACTACAGACATC 71 N/A N/A 1480
949352 37105 37120 TTCTAGTTCACTACAG 92 N/A N/A 1481
949353 37243 37258 CATAGTACCCCACACA 56 N/A N/A 1482
949354 37300 37315 TTGTAGTGTGGAATAT 40 N/A N/A 1483
949355 37364 37379 CGCCCAAGAGAACACA 104 N/A N/A 1484
949356 37481 37496 CTCCACTTTGTGTCTG 58 N/A N/A 1485
949357 37583 37598 GCCTTCTGAGCAAACA 90 N/A N/A 1486
949358 37726 37741 AAAATGGGTCTGCTGG 18 N/A N/A 1487
949359 37730 37745 CATTAAAATGGGTCTG 56 N/A N/A 1488
949360 37843 37858 ACCTTAAGTTTCTTGT 70 N/A N/A 1489
949361 37896 37911 TGCAATGGAGTCCAAA 65 N/A N/A 1490
949362 37970 37985 CCTTAAGTTTTTTGGT 132 N/A N/A 1491
949363 38144 38159 TCATGATTATTAACCT 29 N/A N/A 1492
949364 38160 38175 AGGCATTGAGAACTTT 77 N/A N/A 1493
949365 38190 38205 AGCTATTCAACACTGA 65 N/A N/A 1494
949366 38206 38221 CATTAGAGTAGCTAAT 141 N/A N/A 1495
949367 38246 38261 TTGAATTCCGCATCAT 86 N/A N/A 1496
949368 38313 38328 AACAAAACAGGACCCG 108 N/A N/A 1497
949369 38353 38368 GAAGAAAGTCTGTACT 86 N/A N/A 1498
949370 38488 38503 TTGTAGTGATCAGTTT 54 N/A N/A 1499
949371 38588 38603 ATCCATGCTGCTATGC 63 N/A N/A 1500
949372 38688 38703 TTGCACAACAAAGAGC 90 N/A N/A 1501
949373 38948 38963 GATATATTGCTGGGCA 72 N/A N/A 1502
949374 38949 38964 AGATATATTGCTGGGC 44 N/A N/A 1503
949375 39017 39032 ACCTAAGGAAGCTGAC 72 N/A N/A 1504
949376 39062 39077 TTAAAGCCCAGCAACA 93 N/A N/A 1505
949377 39088 39103 ACGAAAAATTCAGATC 104 N/A N/A 1506
949378 39089 39104 GACGAAAAATTCAGAT 83 N/A N/A 1507
949379 39124 39139 ACAGAATTGTTACAAC 104 N/A N/A 1508
949380 39156 39171 GTACAGGGTGGACATT 90 N/A N/A 1509
949381 39162 39177 ACAAAAGTACAGGGTG 66 N/A N/A 1510
949382 39163 39178 TACAAAAGTACAGGGT 86 N/A N/A 1511
949383 39164 39179 ATACAAAAGTACAGGG 54 N/A N/A 1512
949384 39195 39210 AGTCAAGGAGAACATG 63 N/A N/A 1513
949385 39529 39544 TTGTAGTGGGTCACGC 53 N/A N/A 1514
949386 39644 39659 CATGATTGCGCCGTTG 17 N/A N/A 1515
949387 39745 39760 GTAATTCACTGCGGAT 32 N/A N/A 1516
949388 39877 39892 AAACTTGCAGCAGTGG 67 N/A N/A 1517
949389 39981 39996 AAATGGACTAGAAGGG 59 N/A N/A 1518
949390 40014 40029 AGATAGAAATCAGGGC 47 N/A N/A 1519
949391 40058 40073 TCACAGGGTGGACTTG 53 N/A N/A 1520
949392 40089 40104 GTAGACACATGTCCTT 49 N/A N/A 1521
949393 40195 40210 GACTACAGTCTGTTCG 96 N/A N/A 1522
949394 40295 40310 AACACAGGAGCAGCAT 87 N/A N/A 1523
949395 40306 40321 AACGATAAAACAACAC 70 N/A N/A 1524
949396 40409 40424 ACTGAATCACCAGCAG 99 N/A N/A 1525
949397 40837 40852 GCCTTTACTTAAGATA 3 N/A N/A 1526
949398 40961 40976 ACGCAGTGTCTCAGGT 125 N/A N/A 1527
949399 41061 41076 CACAAGTAGCCTTGGC 107 N/A N/A 1528
949400 41107 41122 TCACAGTGGACACCAG 85 N/A N/A 1529
949401 41162 41177 TGACAGACCCCAAAGT 121 N/A N/A 1530
949402 41234 41249 GAACAAGCTACATCAA 100 N/A N/A 1531
949403 41266 41281 TGGAGAGGGTTCTCTG 94 N/A N/A 1532
949404 41272 41287 GATAATTGGAGAGGGT 84 N/A N/A 1533
949405 41393 41408 GCGAACCTTTCTCACT 57 N/A N/A 1534
949406 41447 41462 AAACAGGATACGAGAC 74 N/A N/A 1535
949407 41451 41466 GCACAAACAGGATACG 86 N/A N/A 1536
949408 41497 41512 TAATCCCTTTCCGTCA 92 N/A N/A 1537
949409 41604 41619 TGTCTTCGAGCCACAC 99 N/A N/A 1538
949410 41708 41723 CCCTACAGACACTTGC 101 N/A N/A 1539
949411 41814 41829 CCGTAGGCAGATTCCA 62 N/A N/A 1540
949412 41862 41877 GCGAAACCAGAGAGAT 88 N/A N/A 1541
949413 41863 41878 GGCGAAACCAGAGAGA 86 N/A N/A 1542
949414 41962 41977 AGCTTTTAAACCCCCC 87 N/A N/A 1543
949415 41984 41999 AGCCAGATTATTAACA 58 N/A N/A 1544
949416 42064 42079 GATGAGGAGGCTGGTC 78 N/A N/A 1545
949417 42169 42184 ACGAAGACCCCCCAGG 163 N/A N/A 1546
949418 42203 42218 CATGAGAAAAGGGATC 97 N/A N/A 1547
949419 42249 42264 CAACAAGTCAGCCCAA 100 N/A N/A 1548
949420 42252 42267 ACACAACAAGTCAGCC 78 N/A N/A 1549
949421 42254 42269 CTACACAACAAGTCAG 28 N/A N/A 1550
949422 42318 42333 TTCTAGCCCGTCAGCC 90 N/A N/A 1551
949423 42434 42449 TTCCAGAAGACCTGTT 143 N/A N/A 1552
949424 42507 42522 TAGCACTACAATCATT 71 N/A N/A 1553
949425 42544 42559 AACGAGACAGCATCCT 64 N/A N/A 1554
949426 42577 42592 GCAATTGGTACTGTAC 101 N/A N/A 1555
949427 42584 42599 ACACAGGGCAATTGGT 144 N/A N/A 1556
949428 42727 42742 TCGAACTCAACCTCAG 70 N/A N/A 1557
949429 42860 42875 TGCCTCGGGTTCAAGC 64 N/A N/A 1558
949430 42983 42998 TGAAAGGTTCTAGGCA 64 N/A N/A 1559
949431 42984 42999 GTGAAAGGTTCTAGGC 57 N/A N/A 1560
949432 43017 43032 TCGAAAGGAAATTCTG 89 N/A N/A 1561
949433 43028 43043 ACATTAAAGGCTCGAA 43 N/A N/A 1562
949434 43030 43045 GTACATTAAAGGCTCG 59 N/A N/A 1563
949435 43050 43065 GTAGAAACAGTGGGCT 61 N/A N/A 1564
949436 43094 43109 GTACACTCAGAAAGGA 91 N/A N/A 1565
949437 43141 43156 GTGAATACACCAGGAT 76 N/A N/A 1566
949438 43194 43209 ACTCAGGCACAACCAC 123 N/A N/A 1567
949439 43864 43879 CGACAGAGCTGTTTAA 47 N/A N/A 1568
949440 43884 43899 GCGGAATGTAAATTAC 40 N/A N/A 1569
949441 43918 43933 CTAAAGACCACTAATT 122 N/A N/A 1570
949442 43920 43935 GACTAAAGACCACTAA 53 N/A N/A 1571
949443 44005 44020 GTACAGAGCCATGACT 113 N/A N/A 1572
949444 44161 44176 TAAAAGCCTGGACAAG 77 N/A N/A 1573
949445 44199 44214 TACATCTGGACTATGG 23 N/A N/A 1574
949446 44271 44286 GATACCTGGATGTGGG 80 N/A N/A 1575
949447 44336 44351 GACAAAATAGGATGTG 88 N/A N/A 1576
949448 44351 44366 AGGAAAGTTATTGATG 63 N/A N/A 1577
949449 44356 44371 ATACGAGGAAAGTTAT 112 N/A N/A 1578
949450 44359 44374 AAAATACGAGGAAAGT 80 N/A N/A 1579
949451 44362 44377 GGTAAAATACGAGGAA 23 N/A N/A 1580
949452 44375 44390 CCACATGTATATGGGT 85 N/A N/A 1581
949453 44426 44441 CCATACCCAGGAGATC 57 N/A N/A 1582
949454 44509 44524 AACCATTTCCCTCTGG 58 N/A N/A 1583
949455 44624 44639 GGCGACCTCAGCAAAG 85 N/A N/A 1584
949456 44732 44747 AAGGAAGTCCCTGTGA 106 N/A N/A 1585
949457 44851 44866 GGCAACCACACATCCA 79 N/A N/A 1586
949458 44953 44968 ACTGAGCCGTTTTTCA 42 N/A N/A 1587
949459 45279 45294 CCGAAGTGAGAGGGTC 88 N/A N/A 1588
949460 45364 45379 CAAAATCGGGTTATCT 66 N/A N/A 1589
949461 45365 45380 GCAAAATCGGGTTATC 38 N/A N/A 1590
949462 45412 45427 AAGGATGGATGTGTCA 18 N/A N/A 1591
949463 45503 45518 TGACATGCGGGAATGA 40 N/A N/A 1592
949464 45523 45538 AGTAGAAACTGGGACG 43 N/A N/A 1593
949465 45570 45585 AGCTATAAAACCAGCC 106 N/A N/A 1594
949466 45603 45618 TACAAAAGAGTATAGC 70 N/A N/A 1595
949467 45705 45720 CACCACTGCACGGCCT 97 N/A N/A 1596
949468 45850 45865 AACATAACCCCCATCT 88 N/A N/A 1597
949469 45957 45972 AGCAATGGTAGAGGGC 113 N/A N/A 1598
949470 46279 46294 GCAATGGTGGCCGGGC 96 N/A N/A 1599
949471 46323 46338 TTCAACAGGCTGGGTC 44 N/A N/A 1600
949472 46330 46345 TACTATATTCAACAGG 18 N/A N/A 1601
949473 46344 46359 CCACACATAGGCCATA 35 N/A N/A 1602
949474 46382 46397 ATACACTGAGATCAGG 50 N/A N/A 1603
949475 46431 46446 GCTGGGATATACGCCC 98 N/A N/A 1604
949476 46505 46520 ACGGAGACCCTTACCT 129 N/A N/A 1605
949477 46528 46543 TTGCAGATTAGCAGGG 35 N/A N/A 1606
949478 46560 46575 ACAAACTGAGTGTTGA 73 N/A N/A 1607
949479 46562 46577 ACACAAACTGAGTGTT 78 N/A N/A 1608
949480 46577 46592 CGCAAGAAGACATTAA 54 N/A N/A 1609
949481 46666 46681 GGCAGCATGGCTAAGC 75 N/A N/A 1610
949482 46764 46779 ACGAAAGTGAGGAGTC 66 N/A N/A 1611
949483 46766 46781 GGACGAAAGTGAGGAG 15 N/A N/A 1612
949484 46863 46878 TACGAAATAGCAGAGC 17 N/A N/A 1613
949485 46885 46900 GCCCATTGGCCCATCG 154 N/A N/A 1614
949486 47094 47109 GATCACCCGCCACTGT 105 N/A N/A 1615
949487 47352 47367 CACCAGGGACTCATTA 124 N/A N/A 1616
949488 47466 47481 ACACAGTGGTGGTCCC 59 N/A N/A 1617
949489 47517 47532 TGCTTTAAGGCTAACA 82 N/A N/A 1618
949490 47599 47614 GGCCTGCGCTCTGTGC 87 N/A N/A 1619
949491 47700 47715 TGCCCTAAGGCAAGTG 91 N/A N/A 1620
949492 47797 47812 CAACAGCCACAGGATC 77 N/A N/A 1621
949493 47803 47818 TTCCACCAACAGCCAC 25 N/A N/A 1622
949494 47924 47939 AACTATGCATCCACCT 122 N/A N/A 1623
949495 47927 47942 TGCAACTATGCATCCA 130 N/A N/A 1624
949496 48220 48235 GGCTAGGTGGTGTGCG 116 N/A N/A 1625
949497 48501 48516 GAGATTGGAGCCTGGT 33 N/A N/A 1626
949498 48506 48521 AATAAGAGATTGGAGC 89 N/A N/A 1627
949499 48507 48522 CAATAAGAGATTGGAG 69 N/A N/A 1628
949500 48508 48523 GCAATAAGAGATTGGA 13 N/A N/A 1629
949501 48622 48637 GTGAATCCAACAGACA 70 N/A N/A 1630
949502 48748 48763 CAACATGCCTTCCAGT 124 N/A N/A 1631
949503 48869 48884 TGCCACTCCCTATCCC 79 N/A N/A 1632
949504 48972 48987 GCTTAATGCCTTGCCT 128 N/A N/A 1633
949505 49052 49067 CCGCAATGTGTTCATT 42 N/A N/A 1634
949506 49095 49110 GTATACCCCACAAGGC 73 N/A N/A 1635
949507 49171 49186 GTAAAGGGTGGCAGCC 84 N/A N/A 1636
949508 49196 49211 AGTCACTTTAACAAGT 57 N/A N/A 1637
949509 49218 49233 GCTACCAAGGCACAGA 72 N/A N/A 1638
949510 49265 49280 CATGGCCACGATGGCA 92 N/A N/A 1639
949511 49297 49312 GAAGAGACAGCATACC 69 N/A N/A 1640
949512 49403 49418 AGTTATGGTTCACTGG 29 N/A N/A 1641
949513 49511 49526 ACTCAGAGTTTACGGG 91 N/A N/A 1642
949514 49613 49628 TTCCGGTGAGCACACC 49 N/A N/A 1643
949515 49770 49785 GAATCAGGAGGGAGAT 101 N/A N/A 1644
949516 49888 49903 GGCAAGTGACCAGGTG 55 N/A N/A 1645
949517 49896 49911 ACGAAGGCGGCAAGTG 6 N/A N/A 1646
949518 50269 50284 GCAGAGAGAGTCCATT 38 N/A N/A 1647
949519 50271 50286 GCGCAGAGAGAGTCCA 116 N/A N/A 1648
949520 50402 50417 GCCCAGTAGGCAAGAA 117 N/A N/A 1649
949521 50423 50438 AAGTAACCCCCATCAC 94 N/A N/A 1650
949522 50491 50506 CTAGATACAAGGCTGC 62 N/A N/A 1651
949523 50510 50525 CGCCAGCTTGGTCTGC 70 N/A N/A 1652
949524 50597 50612 ACGCAAATATCTCCCA 41 N/A N/A 1653
949525 50612 50627 CTAATCCGAGGCAATA 59 N/A N/A 1654
949526 50654 50669 GCACACAACACTTCCC 41 N/A N/A 1655
949527 50713 50728 GGCAGGATCCACTCAT 111 N/A N/A 1656
949528 50818 50833 AGGAGAGGAGATCTGC 87 N/A N/A 1657
949529 50847 50862 ACACAATGACGAGGCT 27 N/A N/A 1658
949530 50945 50960 TGTTAGTCTCAGGGAA 54 N/A N/A 1659
949531 50961 50976 ACAAACACGGCTCAGC 77 N/A N/A 1660
949532 51078 51093 CGACACCCAGCTCCGG 95 N/A N/A 1661
949533 51207 51222 TTGAAATGCCCAGGTC 37 N/A N/A 1662
949534 51318 51333 TTCAAAGGAGCTTGTG 100 N/A N/A 1663
949535 51433 51448 TGCAAGCTGCCACCTT 79 N/A N/A 1664
949536 51496 51511 TGCTAAACAGTCAATC 62 N/A N/A 1665
949537 51544 51559 AACCTAGGAGGACATC 62 N/A N/A 1666
949538 51660 51675 CCCTACTGAAGCTGGA 71 N/A N/A 1667
949539 51787 51802 AATCACGCTGCCAAGG 112 N/A N/A 1668
949540 51890 51905 TCAGAGAGGTTCGCAG 57 N/A N/A 1669
949541 51993 52008 CGGCAAACTGCAAAGC 67 N/A N/A 1670
949542 52114 52129 CAACAAGCCACTGAGC 108 N/A N/A 1671
949543 52204 52219 TAACAATCCACTGGCC 116 N/A N/A 1672
949544 52243 52258 GCTCAAGTGCTGGAGA 89 N/A N/A 1673
949545 52494 52509 CAAGATCCTACATGTA 79 N/A N/A 1674
949546 52597 52612 TAAAAGCTTCCACCAG 119 N/A N/A 1675
949547 52610 52625 CCCAATAGAGGTTTAA 100 N/A N/A 1676
949548 52802 52817 TCTCATACTTCGGCCT 111 N/A N/A 1677
949549 52918 52933 CAACAGAGGTTTTTTG 67 N/A N/A 1678
949550 52944 52959 GTGAAAGTAAATGCTG 48 N/A N/A 1679
949551 53030 53045 AACAGAACCACACCAG 216 N/A N/A 1680
949552 53066 53081 CCAGAAAACCGTTTCT 93 N/A N/A 1681
949553 53509 53524 ATGCAGGCTGGGAACC 88 N/A N/A 1682
949554 53548 53563 TGCCAGACTTTGGAGC 92 N/A N/A 1683
949555 53611 53626 CCCAAGTCCGCCCAGT 90 N/A N/A 1684
949556 53712 53727 CTGAATCTAGGTGTCT 54 N/A N/A 1685
949557 53847 53862 CTTGAATGTCCATGCC 60 N/A N/A 1686
949558 53863 53878 ATATAGAGAGCTTTAC 104 N/A N/A 1687
949559 53866 53881 CTAATATAGAGAGCTT 51 N/A N/A 1688
949560 53867 53882 TCTAATATAGAGAGCT 78 N/A N/A 1689
949561 53909 53924 CCCCATAACACTTACT 98 N/A N/A 1690
949562 54006 54021 AGCTACTCTCTCAAGT 53 N/A N/A 1691
949563 54011 54026 GGGCAAGCTACTCTCT 126 N/A N/A 1692
949564 54127 54142 AGCTACGGTCTGAGCA 114 N/A N/A 1693
949565 54237 54252 AGTCAGAGGGCCTGCC 58 N/A N/A 1694
949566 54341 54356 GCTCACTTTGGATTGT 48 N/A N/A 1695
949567 54452 54467 GTCTACAAAGCCCAGC 67 N/A N/A 1696
949568 54562 54577 AAAGAGACCATCTCCC 91 N/A N/A 1697
949569 54673 54688 GGGAAACACTCGGCCG 142 N/A N/A 1698
949570 54784 54799 CAATGAGGACATCTGC 59 N/A N/A 1699
949571 54787 54802 GGGCAATGAGGACATC 54 N/A N/A 1700
949572 54890 54905 AGGAACTTCGCCTCTT 112 N/A N/A 1701
949573 54924 54939 TCCTAAGCCAGATAGC 49 N/A N/A 1702
949574 55043 55058 TCTAAGATCCCCATTT 106 N/A N/A 1703
949575 55144 55159 TTTCACCGTCCCATCA 72 N/A N/A 1704
949576 55247 55262 AATAACACAGCCATGC 84 N/A N/A 1705
949577 55348 55363 ACCCACCCCGGAGATG 100 N/A N/A 1706
949578 55383 55398 TAATAAGTCACACTGG 47 N/A N/A 1707
949579 55384 55399 GTAATAAGTCACACTG 107 N/A N/A 1708
949580 55469 55484 CTATGATCTATGATCA 115 N/A N/A 1709
949581 55678 55693 TCCGTATAAGATGTGA 34 N/A N/A 1710
949582 56054 56069 CTATTATCCAGCACTG 56 N/A N/A 1711
949583 56111 56126 AGCTACTGTAGTGATG 81 N/A N/A 1712
949584 56167 56182 TCGAATTTTCAGAGTA 26 N/A N/A 1713
949585 56229 56244 ACGGAAGGTGGCTGCC 61 N/A N/A 1714
949586 56251 56266 GCAAATATAAGGCATG 60 N/A N/A 1715
949587 56268 56283 CACAGATTGAGGACAA 47 N/A N/A 1716
949588 56319 56334 TGACAAGCAGTGTGGG 48 N/A N/A 1717
949589 56371 56386 GGTATCTGAAAGTCAC 9 N/A N/A 1718
949590 56530 56545 CCACAAGGTAGAGGGA 154 N/A N/A 1719
949591 56538 56553 CAAGGAGCCCACAAGG 114 N/A N/A 1720
949592 56633 56648 GCCCAAGTCCTTGTGG 105 N/A N/A 1721
949593 56691 56706 GATTAAGGTGATGCTG 61 N/A N/A 1722
949594 56692 56707 TGATTAAGGTGATGCT 41 N/A N/A 1723
949595 56734 56749 AGGAAGCACCAGGATA 23 N/A N/A 1724
949596 56860 56875 CATATTATGAATCCCC 66 N/A N/A 1725
949597 56863 56878 TGACATATTATGAATC 105 N/A N/A 1726
949598 56979 56994 ATGACAAGGGTCTTGG 17 N/A N/A 1727
949599 57373 57388 TAATGACCCAGGCTGG 121 N/A N/A 1728
949600 57619 57634 GCCTACCGTGTGGCGA 104 N/A N/A 1729
949601 57654 57669 CCAGAAACGGTCAGTG 132 N/A N/A 1730
949602 57722 57737 TGTGAATGGGCACATG 102 N/A N/A 1731
949603 57840 57855 CAAACAACTTCTTGGC 82 N/A N/A 1732
949604 57948 57963 GAAGACTGGTTCTGGC 60 N/A N/A 1733
949605 57953 57968 TTACAGAAGACTGGTT 91 N/A N/A 1734
949606 58891 58906 GGCAAGGTGGCTAAAA 123 N/A N/A 1735
949607 58993 59008 AGGAACCCATCATGGT 95 N/A N/A 1736
949608 59092 59107 TGACAAGGTAGGTTTT 57 N/A N/A 1737
949609 59093 59108 TTGACAAGGTAGGTTT 25 N/A N/A 1738
949610 59102 59117 CAAAACTGGTTGACAA 47 N/A N/A 1739
949611 59104 59119 TGCAAAACTGGTTGAC 58 N/A N/A 1740
949612 59272 59287 GTGAAGTGCAGTAGCT 88 N/A N/A 1741
949613 59302 59317 TAAGATAGAGGGTCTT 35 N/A N/A 1742
949614 59399 59414 GCTAACAATTTAAGGA 60 N/A N/A 1743
949615 59741 59756 CTGAGAGGCATACAAA 66 N/A N/A 1744
949616 59846 59861 GGAGAAGAAGTGAGCC 109 N/A N/A 1745
949617 60067 60082 ACAAATGGATGAGGCC 129 N/A N/A 1746
949618 60068 60083 GACAAATGGATGAGGC 54 N/A N/A 1747
949619 60379 60394 GACAAACAGATGAGGC 74 N/A N/A 1748
949620 60427 60442 GAATAAATTTCAGCCC 100 N/A N/A 1749
949621 60483 60498 TTCAATGGCACAGTTC 73 N/A N/A 1750
949622 60586 60601 TCAGACTTGAGGATGT 32 N/A N/A 1751
949623 60639 60654 GCACAAACAGGCCCGC 99 N/A N/A 1752
949624 60700 60715 GTCAAGTTCAACACTG 25 N/A N/A 1753
949625 60903 60918 GCTCAGGGTTACCTTG 81 N/A N/A 1754
949626 61033 61048 AGGAAGTGCCATGTTC 64 N/A N/A 1755
949627 61134 61149 TCCCACTCTGGCAACA 79 N/A N/A 1756
949628 61204 61219 AGCTAGATGGGACCTA 102 N/A N/A 1757
949629 61255 61270 GAAGTTCCCGTTCTGA 47 N/A N/A 1758
949630 61336 61351 AAATAGACGATCTCAC 87 N/A N/A 1759
949631 61340 61355 AGGGAAATAGACGATC 96 N/A N/A 1760
949632 61344 61359 TCGAAGGGAAATAGAC 101 N/A N/A 1761
949633 61382 61397 GTAGAAGGATCTGACT 114 N/A N/A 1762
949634 61384 61399 CAGTAGAAGGATCTGA 123 N/A N/A 1763
949635 61480 61495 GTGAAGATCTCTGGTG 88 N/A N/A 1764
949636 61485 61500 CCAGAGTGAAGATCTC 119 N/A N/A 1765
949637 61587 61602 CTGCAGATCAACTGCT 104 N/A N/A 1766
949638 61636 61651 CCACAAGTCATTCCAG 71 N/A N/A 1767
949639 61706 61721 TTCCAGGACTACCTCT 76 N/A N/A 1768
949640 61813 61828 GGCTTTGGGAAACCTC 48 N/A N/A 1769
949641 61839 61854 TATTAAGGACAACCTC 98 N/A N/A 1770
949642 61840 61855 TTATTAAGGACAACCT 81 N/A N/A 1771
949643 61842 61857 TGTTATTAAGGACAAC 125 N/A N/A 1772
949644 61889 61904 TGGCACACGGCAAATA 96 N/A N/A 1773
949645 61904 61919 TCATAAGGGTGAGCCT 70 N/A N/A 1774
949646 61915 61930 TCACAGGGTGGTCATA 68 N/A N/A 1775
949647 61937 61952 GAAGATGGTCACAGCC 51 N/A N/A 1776
949648 61944 61959 GTCGAATGAAGATGGT 38 N/A N/A 1777
949649 62105 62120 GGCCTGAAAGAGCCCA 112 N/A N/A 1778
949650 62252 62267 GATAAGGACCCCACCC 108 N/A N/A 1779
949651 62328 62343 AAAGAAGGAGTTACGG 88 N/A N/A 1780
949652 62378 62393 ACGAATGCATACAAAT 72 N/A N/A 1781
949653 62384 62399 TGAAAAACGAATGCAT 107 N/A N/A 1782
949654 62491 62506 CACCAGTGGCTGTCTG 63 N/A N/A 1783
949655 62887 62902 TCATAATAGGCCGGGT 61 N/A N/A 1784
949656 62969 62984 ATAATAACCACCGAAG 45 N/A N/A 1785
949657 62972 62987 ATAATAATAACCACCG 13 N/A N/A 1786
949658 63350 63365 CCTAGGATTTGTGTTA 101 N/A N/A 1787
949659 63667 63682 GCCTAGGATTTATAGA 96 N/A N/A 1788
949660 63759 63774 CCACAAATGAATGGTA 72 N/A N/A 1789
949661 63780 63795 TGGGATGTGGTCTGGT 98 N/A N/A 1790
949662 63826 63841 CTAATTACCAGCTAAC 46 N/A N/A 1791
949663 63880 63895 ACTTAGGTTACTCCTA 76 N/A N/A 1792
949664 64255 64270 AACTGCTGCTCCGATA 53 N/A N/A 1793
949665 64313 64328 GGCTATAGGGCTGATA 104 N/A N/A 1794
949666 64366 64381 AAATGCACCGCTCTGC 137 N/A N/A 1795
949667 64530 64545 ACAGAATAAGACATCG 55 N/A N/A 1796
949668 64650 64665 AGCAATCGCACATGCC 92 N/A N/A 1797
949669 64984 64999 AGTAGATGCCAGAGGG 54 N/A N/A 1798
949670 65026 65041 GGCTAAGCATGAAGGG 96 N/A N/A 1799
949671 65086 65101 ATCTATCTCAGACATC 110 N/A N/A 1800
949672 65109 65124 CCAAGGTCTGAACTTT 69 N/A N/A 1801
949673 65111 65126 AACCAAGGTCTGAACT 125 N/A N/A 1802
949674 65112 65127 CAACCAAGGTCTGAAC 110 N/A N/A 1803
949675 65113 65128 GCAACCAAGGTCTGAA 31 N/A N/A 1804
949676 65115 65130 TGGCAACCAAGGTCTG 67 N/A N/A 1805
949677 65116 65131 CTGGCAACCAAGGTCT 120 N/A N/A 1806
949678 65117 65132 GCTGGCAACCAAGGTC 156 N/A N/A 1807
949679 65119 65134 ATGCTGGCAACCAAGG 40 N/A N/A 1808
949680 65192 65207 GAATTTAGCCCTGACA 94 N/A N/A 1809
949681 65208 65223 AGCTAAACAGGGTTTT 78 N/A N/A 1810
949682 65343 65358 GTCCAAGGGCAGCCGG 100 N/A N/A 1811
949683 65383 65398 CCCCAAAGGCCCTTAG 97 N/A N/A 1812
949684 65458 65473 GTGGACATCAGTGAGT 53 N/A N/A 1813
949685 65527 65542 CTACAAGTGAGCTGAG 6 N/A N/A 1814
949686 65543 65558 CAAAACGGGAGCAGGC 83 N/A N/A 1815
949687 65544 65559 ACAAAACGGGAGCAGG 51 N/A N/A 1816
949688 65545 65560 CACAAAACGGGAGCAG 76 N/A N/A 1817
949689 65583 65598 AAAAAGGGTCCAGTGG 91 N/A N/A 1818
949690 65599 65614 TCATTAGTACGCCAGG 24 N/A N/A 1819
949691 65686 65701 CCCAACTGTGCTTTCC 26 N/A N/A 1820
949692 66037 66052 TCACACACGGATTTTT 73 N/A N/A 1821
949693 66148 66163 TTCTGCATTGCAGTGG 26 N/A N/A 1822
949694 66218 66233 GTAAAAAGCATCTGGC 83 N/A N/A 1823
949695 66272 66287 GCCAGAGTCACCATCA 73 N/A N/A 1824
949696 66327 66342 TGCCAAGGTGAGGTCA 91 N/A N/A 1825
949697 66373 66388 CGCCAGATCTCTCTTG 104 N/A N/A 1826
949698 66787 66802 TGCCTACCATTGCACT 86 N/A N/A 1827
949699 66882 66897 CGAGAAGGAGGTAGAA 82 N/A N/A 1828
949700 66890 66905 AACTACACCGAGAAGG 101 N/A N/A 1829
949701 66895 66910 TCCAAAACTACACCGA 72 N/A N/A 1830
949702 66973 66988 ATCAAACGAGTATATT 91 N/A N/A 1831
949703 66974 66989 TATCAAACGAGTATAT 101 N/A N/A 1832
949704 66987 67002 AGCTAAAATCCACTAT 110 N/A N/A 1833
949705 66998 67013 CAATAGGGAAGAGCTA 57 N/A N/A 1834
949706 66999 67014 GCAATAGGGAAGAGCT 117 N/A N/A 1835
949707 67000 67015 AGCAATAGGGAAGAGC 75 N/A N/A 1836
949708 67377 67392 ATCAAGACTCTGAATA 86 N/A N/A 1837
949709 67669 67684 TTCAAAGATAGGTGAG 32 N/A N/A 1838
949710 67762 67777 CATTAAGTATTTGGAG 77 N/A N/A 1839
949711 67770 67785 AAGAGCAACATTAAGT 111 N/A N/A 1840
949712 67773 67788 GCGAAGAGCAACATTA 120 N/A N/A 1841
949713 67793 67808 TGCGAATGCACATGGC 138 N/A N/A 1842
949714 67803 67818 ACACAGAGGGTGCGAA 153 N/A N/A 1843
949715 67805 67820 CAACACAGAGGGTGCG 47 N/A N/A 1844
949716 67823 67838 TAACATGTTACTCAGA 75 N/A N/A 1845
949717 67870 67885 TCAAGTATAGAGATGG 46 N/A N/A 1846
949718 68110 68125 AGTACCTGATTCAGCG 147 N/A N/A 1847
949719 68180 68195 TGCCAGTGAGGATTGC 56 N/A N/A 1848
949720 68210 68225 AAAACAAGTGCTGCTC 77 N/A N/A 1849
949721 68491 68506 GAATCAAGTACATTTC 77 N/A N/A 1850
949722 68541 68556 GTAATAGTAGCAGCAC 29 N/A N/A 1851
949723 68542 68557 TGTAATAGTAGCAGCA 20 N/A N/A 1852
949724 68610 68625 GTCTTCTGGGTAAATG 30 N/A N/A 1853
949725 68624 68639 AGGCAATGCATACAGT 25 N/A N/A 1854
949726 68992 69007 GAACGATAGGCCAGGC 90 N/A N/A 1855
949727 68999 69014 AAGAAGAGAACGATAG 67 N/A N/A 1856
949728 69029 69044 GTTTATGCACCATGTG 20 N/A N/A 1857
949729 69102 69117 AAAACAGCGAGGAGGA 90 N/A N/A 1858
949730 69108 69123 TGCTAGAAAACAGCGA 109 N/A N/A 1859
949731 69206 69221 CAGGAACCTACTCTCG 86 N/A N/A 1860
949732 69213 69228 ACAAGGACAGGAACCT 97 N/A N/A 1861
949733 69215 69230 CTACAAGGACAGGAAC 107 N/A N/A 1862
949734 69361 69376 CTAGACACTGACTTCC 89 N/A N/A 1863
949735 69486 69501 GGCCAGCTGGACTTTT 74 N/A N/A 1864
949736 69589 69604 TACTAGGGCACTTAAG 149 N/A N/A 1865
949737 69591 69606 GATACTAGGGCACTTA 69 N/A N/A 1866
949738 69692 69707 ACCAAGGGTCCCTGCC 113 N/A N/A 1867
949739 69781 69796 TACAAAGTGTCTGGCG 53 N/A N/A 1868
949740 69782 69797 ATACAAAGTGTCTGGC 41 N/A N/A 1869
949741 70034 70049 GATTAGGAGACAAGCC 87 N/A N/A 1870
949742 70467 70482 ATCCATTCTGGACAAC 62 N/A N/A 1871
949743 70664 70679 CACTAGAGGATAGGCG 118 N/A N/A 1872
949744 70759 70774 GTAAAGCAGAGTTTGG 25 N/A N/A 1873
949745 70760 70775 TGTAAAGCAGAGTTTG 46 N/A N/A 1874
949746 70766 70781 GCAAAGTGTAAAGCAG 53 N/A N/A 1875
949747 70787 70802 CCATAAAATCAGCCTA 71 N/A N/A 1876
949748 70897 70912 AAAGAACTCGGGAGGT 65 N/A N/A 1877
949749 71020 71035 TTAAGATCAAGAGATC 115 N/A N/A 1878
949750 71155 71170 TCAAGATGAGCTCCCC 65 N/A N/A 1879
949751 71255 71270 GTCCATCCAGACCACG 119 N/A N/A 1880
949752 71260 71275 GGACAGTCCATCCAGA 84 N/A N/A 1881
949753 71369 71384 GGAGACGGCACGGAGC 81 N/A N/A 1882
949754 71371 71386 ACGGAGACGGCACGGA 87 N/A N/A 1883
949755 71473 71488 ACCAAGGGCCAACACC 70 N/A N/A 1884
949756 71697 71712 ACATACTGCAGCAGGG 52 N/A N/A 1885
949757 71797 71812 AATCAATGAGTGGACG 29 N/A N/A 1886
949758 71827 71842 ACGCAGAAGGCTTGCA 87 N/A N/A 1887
949759 71908 71923 CCATTCTGAGCACTCC 41 N/A N/A 1888
949760 72021 72036 TCTAAAGGAGGCTGTT 82 N/A N/A 1889
949761 72175 72190 AGCCTAATTTTGCAAT 133 N/A N/A 1890
949762 72938 72953 GGCCAACACTCATCTT 128 N/A N/A 1891
949763 73188 73203 TGATATGCAGTGACAC 75 N/A N/A 1892
949764 73296 73311 TCCCACACGGCTCCTG 144 N/A N/A 1893
949765 73415 73430 GCACAACCTGCTCTAT 80 N/A N/A 1894
949766 73519 73534 GAGCACCTGAGTCAGT 91 N/A N/A 1895
949767 73639 73654 ACCAACCAAGTCATGG 137 N/A N/A 1896
949768 73653 73668 AGCTAAGCAGCTGCAC 133 N/A N/A 1897
949769 73742 73757 TTACAGGCCAAAAGCC 88 N/A N/A 1898
949770 73868 73883 GAGGAGGCGGTGTCCT 122 N/A N/A 1899
949771 73954 73969 CATAAAAGCACTCTGG 87 N/A N/A 1900
949772 73957 73972 GAGCATAAAAGCACTC 92 N/A N/A 1901
949773 73970 73985 GTCAAGGCTGTCTGAG 56 N/A N/A 1902
949774 74231 74246 GCTGAATCTTGTGTTT 47 N/A N/A 1903
949775 74259 74274 CACAACAACACTTCCT 73 N/A N/A 1904
949776 74351 74366 CTTTAGAGGTGCAGAA 53 N/A N/A 1905
949777 74592 74607 ATCCACTGAAGCCTCT 50 N/A N/A 1906
949778 74872 74887 CTTAACAAGTAGTATT 14 N/A N/A 1907
949779 74874 74889 GGCTTAACAAGTAGTA 38 N/A N/A 1908
949780 74962 74977 GGCAACTGGTTACAAA 58 N/A N/A 1909
949781 74967 74982 TGCAAGGCAACTGGTT 14 N/A N/A 1910
949782 75001 75016 CTCCATGGTGAGAGTG 73 N/A N/A 1911
949783 75055 75070 GCTAAAGCAAGAAGGC 87 N/A N/A 1912
949784 75104 75119 AGAAAGACCGCCCATG 97 N/A N/A 1913
949785 75219 75234 GCGGAGACAGAAGGCT 121 N/A N/A 1914
949786 75320 75335 AAGCATCGGTTAAGGC 142 N/A N/A 1915
949787 75846 75861 CCCAAGTGGTGAGGCT 74 N/A N/A 1916
949788 76007 76022 GTTCAGGCAGGCGGTT 53 N/A N/A 1917
949789 76107 76122 AACAAGAGACCTTGTC 47 N/A N/A 1918
949790 76211 76226 GATCAGGCTACTCAGG 116 N/A N/A 1919
949791 76415 76430 TCATAGCCAATATAAC 42 N/A N/A 1920
949792 76430 76445 TATCACAGGGTGTGCT 67 N/A N/A 1921
949793 76487 76502 TCGGAATGTACTCTTA 23 N/A N/A 1922
949794 76518 76533 GAATTCGGGTTGAATC 107 N/A N/A 1923
949795 76636 76651 GACAAAGCACACCTGG 81 N/A N/A 1924
949796 76637 76652 GGACAAAGCACACCTG 100 N/A N/A 1925
949797 76731 76746 CACTAAACTAATGACA 98 N/A N/A 1926
949798 76734 76749 TAGCACTAAACTAATG 88 N/A N/A 1927
949799 76737 76752 GCATAGCACTAAACTA 83 N/A N/A 1928
949800 76739 76754 AGGCATAGCACTAAAC 80 N/A N/A 1929
949801 76744 76759 AGCAAAGGCATAGCAC 91 N/A N/A 1930
949802 76764 76779 ACCAAACCAGGACCAA 57 N/A N/A 1931
949803 77124 77139 GTTAATGCTTCACCTG 25 N/A N/A 1932
949804 77125 77140 GGTTAATGCTTCACCT 104 N/A N/A 1933
949805 77175 77190 GTAAAGGGTGTGCACA 10 N/A N/A 1934
949806 77224 77239 AGGCAAGCACAAGCTG 115 N/A N/A 1935
949807 77245 77260 CCTTCATACCCCAACT 97 N/A N/A 1936
949808 77343 77358 TACTGAAGTACCTGGG 102 N/A N/A 1937
949809 77421 77436 TCCTAAGCATTCCTAA 113 N/A N/A 1938
949810 77450 77465 GTAGGATGATCTTGTT 27 N/A N/A 1939
949811 77458 77473 GTAAAAAAGTAGGATG 68 N/A N/A 1940
949812 77502 77517 CCTTAAAAAGAGTCTC 75 N/A N/A 1941
949813 77561 77576 GCTCATCTAATGGACA 46 N/A N/A 1942
949814 77634 77649 GGCGAGACAGAGTAAG 12 N/A N/A 1943
949815 77894 77909 TATACTGGACACGGTG 96 N/A N/A 1944
949816 77895 77910 ATATACTGGACACGGT 88 N/A N/A 1945
949817 77897 77912 ATATATACTGGACACG 36 N/A N/A 1946
949818 78035 78050 GTTTTATTGGCCGGGT 20 N/A N/A 1947
949819 78144 78159 AGTCACTGATCCTAAA 74 N/A N/A 1948
949820 78149 78164 CAAGAAGTCACTGATC 69 N/A N/A 1949
949821 78222 78237 ACAAAATGGGTTGAGG 38 N/A N/A 1950
949822 78223 78238 TACAAAATGGGTTGAG 50 N/A N/A 1951
949823 78262 78277 GGACAGGACTTTGCCC 119 N/A N/A 1952
949824 78348 78363 CCACAATTCAGGTGGC 122 N/A N/A 1953
949825 78366 78381 GGAAAGGTAGCCACTT 64 N/A N/A 1954
949826 78470 78485 GCCCACTTATTCCTCC 120 N/A N/A 1955
949827 78561 78576 CCAAATTCAAGAGCTC 45 N/A N/A 1956
949828 78611 78626 TACCATTTTTCAGCAG 25 N/A N/A 1957
949829 78678 78693 TCAAAACGGAGGTTTC 20 N/A N/A 1958
949830 78711 78726 GACCATCCTATGAGGA 106 N/A N/A 1959
949831 78878 78893 GACCAGAGACGGGAGG 58 N/A N/A 1960
949832 78949 78964 GCCTAGAGGTAGGAGC 64 N/A N/A 1961
949833 78961 78976 CCACAAGTTCAGGCCT 107 N/A N/A 1962
949834 79024 79039 TCAAAGCTGAGTGTCA 25 N/A N/A 1963
949835 79143 79158 TGCTAGGGACATCTTC 17 N/A N/A 1964
949836 79212 79227 GTATATATCAGCTCAG 30 N/A N/A 1965
949837 79225 79240 ACATAAGGATGTTGTA 126 N/A N/A 1966
949838 79243 79258 ATCCATGTTCAGTTTC 13 N/A N/A 1967
949839 79330 79345 CGGAAAAAGAAGTCCC 154 N/A N/A 1968
949840 79375 79390 TTCAAGCAAATCACAC 96 N/A N/A 1969
949841 79794 79809 TCAGTATGCACCACCA 6 N/A N/A 1970
949842 79870 79885 AAGCATGACATGACAC 16 N/A N/A 1971
949843 80250 80265 CAGAATATTTAACTCG 26 N/A N/A 1972
949844 80347 80362 GACAAACCAAGCACAT 107 N/A N/A 1973
949845 80435 80450 GTGGAACTTGCCTGAC 86 N/A N/A 1974
949846 80542 80557 TCCAAGAGCCCTCTTA 11 N/A N/A 1975
949847 80662 80677 CCTATTTGATCAGGAG 137 N/A N/A 1976
949848 80759 80774 TGATTCAGTGCCGCCC 7 N/A N/A 1977
949849 80769 80784 CCCAAAACCCTGATTC 17 N/A N/A 1978
949850 80805 80820 TCACGAGGAAGCCATG 54 N/A N/A 1979
949851 80870 80885 GGCGATGGAAGGGCAG 57 N/A N/A 1980
949852 80981 80996 TTTCATTGGCCCTGGC 62 N/A N/A 1981
949853 80987 81002 CAGCAATTTCATTGGC 63 N/A N/A 1982
949854 81187 81202 TACCTTACTGGTACAC 67 N/A N/A 1983
949855 81200 81215 GCCGAGGGAGCAATAC 102 N/A N/A 1984
949856 81201 81216 TGCCGAGGGAGCAATA 49 N/A N/A 1985
949857 81288 81303 GAAAAGGCACCAGTGG 39 N/A N/A 1986
949858 81306 81321 CACAAAGCGATATGGG 7 N/A N/A 1987
949859 81411 81426 GTGCATCTGTCTGGCC 79 N/A N/A 1988
949860 81445 81460 TGCTAGGCTTGGTATC 95 N/A N/A 1989
949861 81530 81545 CAGCAGTTGACGCGGG 127 N/A N/A 1990
949862 81635 81650 CCGGAGCTGAGGGACA 117 N/A N/A 1991
949863 81738 81753 AAAAATGGGCTGCCCC 103 N/A N/A 1992
949864 81740 81755 CCAAAAATGGGCTGCC 90 N/A N/A 1993
949865 81752 81767 GACTAAGTGGATCCAA 2 N/A N/A 1994
949866 81769 81784 GCGCATAGAGGCACTG 56 N/A N/A 1995
949867 81845 81860 AACCAGGCCCGCGGCG 90 N/A N/A 1996
949868 81909 81924 GCGCAAGCACAGACTG 109 N/A N/A 1997
949869 81953 81968 GCAGAAATTCCCTGGC 92 N/A N/A 1998
949870 82004 82019 AGCTTAAGCAGCAAAT 111 N/A N/A 1999
949871 82041 82056 TTTGGACTGTTTTCCC 8 N/A N/A 2000
949872 82043 82058 TGTTTGGACTGTTTTC 2 N/A N/A 2001
949873 82044 82059 CTGTTTGGACTGTTTT 1 N/A N/A 2002
949874 82045 82060 CCTGTTTGGACTGTTT 1 N/A N/A 2003
949875 82047 82062 AACCTGTTTGGACTGT 4 N/A N/A 2004
949876 82048 82063 CAACCTGTTTGGACTG 5 N/A N/A 2005
949877 82050 82065 TCCAACCTGTTTGGAC 27 N/A N/A 2006
949878 82052 82067 TTTCCAACCTGTTTGG 44 N/A N/A 2007
949879 82053 82068 TTTTCCAACCTGTTTG 17 N/A N/A 2008
949880 82054 82069 GTTTTCCAACCTGTTT 4 N/A N/A 2009
949881 82084 82099 ATGTCCATGACACCTG 17 N/A N/A 2010
949882 82085 82100 CATGTCCATGACACCT 39 N/A N/A 2011
949883 82087 82102 TTCATGTCCATGACAC 30 N/A N/A 2012
949884 82089 82104 CATTCATGTCCATGAC 13 N/A N/A 2013
949885 82091 82106 AACATTCATGTCCATG 51 N/A N/A 2014
949886 82154 82169 TACAGAAGGGCCACGG 6 N/A N/A 2015
949887 82155 82170 TTACAGAAGGGCCACG 10 N/A N/A 2016
949888 82259 82274 GATTAGTCCATGCATG 99 N/A N/A 2017
949889 82308 82323 ACACACGCAGGACAGG 85 N/A N/A 2018
949890 82361 82376 GGTCATGCGGAGGGCA 41 N/A N/A 2019
949891 82509 82524 TGTTACCTTCTCGGCA 19 N/A N/A 2020
949892 82529 82544 GCGGAGATGAGAACAA 13 N/A N/A 2021
949893 82619 82634 CTGGTAGGCGGAAGGG 77 N/A N/A 2022
949894 82632 82647 CTCTAAGTGACAACTG 18 N/A N/A 2023
949895 82720 82735 AACAAAGGCTGACCGC 85 N/A N/A 2024
949896 82827 82842 GATGATGTGTTTCCTG 1 N/A N/A 2025
949897 82836 82851 GGCTATACAGATGATG 7 N/A N/A 2026
949898 82948 82963 AACCAGACCTCATGCA 22 N/A N/A 2027
949899 82953 82968 AACTTAACCAGACCTC 12 N/A N/A 2028
949900 82994 83009 CGCCAAATGCCCCCAC 29 N/A N/A 2029
949901 83049 83064 GATAGGAACTCCTTGC 48 N/A N/A 2030
949902 83051 83066 TCGATAGGAACTCCTT 96 N/A N/A 2031
949903 83124 83139 CTGAAGGGCCTCGCCA 119 N/A N/A 2032
949904 83183 83198 TGCCATGCAGGGCTTC 74 N/A N/A 2033
949905 83283 83298 GTGGACCGGAGACAGC 125 N/A N/A 2034
949906 83399 83414 TAGAAAATGCGGAGGG 91 N/A N/A 2035
949907 83424 83439 CGGGAAGCAACATGAA 77 N/A N/A 2036
949908 83429 83444 TGGCACGGGAAGCAAC 87 N/A N/A 2037
949909 83464 83479 GAACAAGCAGAGTGGT 51 N/A N/A 2038
949910 83566 83581 GGCCAGTACCTGGTCC 103 N/A N/A 2039
949911 83622 83637 GAACAGTACACTTGAC 90 N/A N/A 2040
949912 83627 83642 GCACAGAACAGTACAC 100 N/A N/A 2041
949942 83908 83923 GGTTGACTACAAAGGG 5 N/A N/A 2042
949943 83909 83924 AGGTTGACTACAAAGG 3 N/A N/A 2043
949944 83911 83926 AGAGGTTGACTACAAA 4 N/A N/A 2044
949945 83912 83927 GAGAGGTTGACTACAA 2 N/A N/A 2045
949946 83914 83929 TTGAGAGGTTGACTAC 66 N/A N/A 2046
949947 83916 83931 TTTTGAGAGGTTGACT 21 N/A N/A 2047
949948 83918 83933 GTTTTTGAGAGGTTGA 2 N/A N/A 2048
949949 83919 83934 GGTTTTTGAGAGGTTG 3 N/A N/A 2049
949950 83920 83935 GGGTTTTTGAGAGGTT 5 N/A N/A 2050
949951 83922 83937 GTGGGTTTTTGAGAGG 17 N/A N/A 2051
949952 83923 83938 TGTGGGTTTTTGAGAG 25 N/A N/A 2052
949953 83924 83939 CTGTGGGTTTTTGAGA 38 N/A N/A 2053
949954 83926 83941 GCCTGTGGGTTTTTGA 24 N/A N/A 2054
949955 84164 84179 CCATAACTTACTGAAG 69 N/A N/A 2055
949956 84276 84291 GTAGGATAGGGAGCGG 31 N/A N/A 2056
949957 84379 84394 TCCCAAATGCAGACGC 38 N/A N/A 2057
949958 84397 84412 ACAAACAACACGCTTG 88 N/A N/A 2058
949959 84399 84414 CAACAAACAACACGCT 88 N/A N/A 2059
949960 84687 84702 AATTAGGTGGGTAAAG 64 N/A N/A 2060
949961 84860 84875 GCCTTTGCAAGAAAGC 94 N/A N/A 2061
949962 85204 85219 GGTTTCAACAAACAGT 11 N/A N/A 2062
949963 85243 85258 AACAAAGTGACATAGC 8 N/A N/A 2063
949964 85260 85275 GGAGAGGGACCATTTT 94 N/A N/A 2064
949965 85323 85338 AATCAAAACTGGGCGC 100 N/A N/A 2065
949966 85335 85350 AGCAATTGGCCAAATC 55 N/A N/A 2066
949967 85362 85377 GGCATAGGTGGACTGG 21 N/A N/A 2067
949968 85379 85394 AGCTACAGCAGCTATG 83 N/A N/A 2068
949969 85438 85453 CTTACCAACAGTAACA 67 N/A N/A 2069
949970 85541 85556 GGCTGGTTTAGTAAGG 75 N/A N/A 2070
949971 85608 85623 GGGCAAGGCACTCGGA 54 N/A N/A 2071
949972 85618 85633 GAATAAAGTAGGGCAA 44 N/A N/A 2072
949973 85681 85696 CGTCACTGGACTCCCC 75 N/A N/A 2073
949974 85784 85799 CCAGGATGAAGTTGGT 94 N/A N/A 2074
949975 85876 85891 ATCAAGCTAGAAAGGT 19 N/A N/A 2075
949976 85880 85895 AGCTATCAAGCTAGAA 82 N/A N/A 2076
949977 85884 85899 CTCAAGCTATCAAGCT 120 N/A N/A 2077
949978 85946 85961 CCAATTATGAACACTA 7 N/A N/A 2078
949979 85984 85999 GTTCAAAGTGTTGCAT 9 N/A N/A 2079
949980 86329 86344 AGCCACTGCCTTGTAT 74 N/A N/A 2080
949981 86547 86562 AATCATAGCCTCAAAC 85 N/A N/A 2081
949982 86551 86566 GAACAATCATAGCCTC 14 N/A N/A 2082
949983 86933 86948 AATAATGTGCAGTTGT 14 N/A N/A 2083
949984 87041 87056 CCCCAAGGTCTGGAGT 104 N/A N/A 2084
949985 87160 87175 TCCCAGACAGGAGAAC 80 N/A N/A 2085
949986 87349 87364 ACCTACTTGGCAAACC 128 N/A N/A 2086
949987 87359 87374 CTCTAAAAGTACCTAC 127 N/A N/A 2087
949988 87456 87471 CGACAGAGACTGTCTG 130 N/A N/A 2088
949989 87574 87589 CTAAACTAACCATGGG 79 N/A N/A 2089
949990 87595 87610 GAACATAGCACTGCCC 3 N/A N/A 2090
949991 87597 87612 CTGAACATAGCACTGC 3 N/A N/A 2091
949992 87598 87613 TCTGAACATAGCACTG 9 N/A N/A 2092
949993 87680 87695 GCACACTGGTCGCTAA 43 N/A N/A 2093
949994 87782 87797 TTGAAGCTAGGGAGAC 85 N/A N/A 2094
949995 87817 87832 ACGGAAGGTTCTGGTT 69 N/A N/A 2095
949996 87880 87895 GCACACTGAATCGACA 23 N/A N/A 2096
949997 87882 87897 ACGCACACTGAATCGA 43 N/A N/A 2097
949998 87893 87908 TGCCTGAGACCACGCA 152 N/A N/A 2098
949999 88002 88017 TACCAGCGGCACCACC 72 N/A N/A 2099
950000 88014 88029 AGCGAGAGGGCATACC 30 N/A N/A 2100
950001 88119 88134 CACTACACCTTAACGC 70 N/A N/A 2101
950002 88226 88241 CTCTAGAGGCCCTCCC 98 N/A N/A 2102
950003 88271 88286 CACCGATAAATGTTGT 27 N/A N/A 2103
950004 88308 88323 CAGCACGGAACAGATC 51 N/A N/A 2104
950005 88397 88412 AGGGACTTCGGCTCAT 120 N/A N/A 2105
950006 88497 88512 GCAAACCAAAGATGGG 47 N/A N/A 2106
950007 88619 88634 GGTAAGTGGGAAGGCC 73 N/A N/A 2107
950008 88766 88781 CCCCGTAGCTCTTCAG 24 N/A N/A 2108
950009 88878 88893 TTTAAGGACTCCACCT 86 N/A N/A 2109
950010 88992 89007 TGGCATCACCTGACTT 99 N/A N/A 2110
950011 89116 89131 ATCCAAAATCCTCCCC 43 N/A N/A 2111
950012 89192 89207 TCAAATAGCAGCCCAC 38 N/A N/A 2112
950013 89231 89246 CCTAAGGGCCTCCTGG 102 N/A N/A 2113
950014 89335 89350 CACAAGAAGGATTTTC 2 N/A N/A 2114
950015 89459 89474 CAGCAATCGACCCACC 31 N/A N/A 2115
950016 89560 89575 GCTGAGATTACGCACC 38 N/A N/A 2116
950017 89706 89721 CTTATCTGGGCTATTT 7 N/A N/A 2117
950018 89719 89734 TATTATAGGGCTTCTT 20 N/A N/A 2118
950019 89813 89828 GAAAGTAGGCTTCTGT 6 N/A N/A 2119
950020 89966 89981 TGTTACTTATCCATCA 7 N/A N/A 2120
950021 89980 89995 CAACATATATCTCCTG 8 N/A N/A 2121
950022 90075 90090 ACAAATCCCACTATAT 58 N/A N/A 2122
950023 90081 90096 GCATAGACAAATCCCA 3 N/A N/A 2123
950024 90175 90190 CGACAGGGTGTGTTTC 6 N/A N/A 2124
950025 90197 90212 AAATTTAGAGGACATC 38 N/A N/A 2125
950026 90276 90291 AGCCATCCAGTCTTAG 38 N/A N/A 2126
950027 90541 90556 CTCAAGTAGTTCCCCT 12 N/A N/A 2127
950028 90642 90657 CACTAGAATCCCGGAG 18 N/A N/A 2128
950029 90673 90688 ACTTACTAAAGCGCAG 24 N/A N/A 2129
950030 90722 90737 AGTAAATGTATCTGGT 3 N/A N/A 2130
950031 90754 90769 GCGCAAGGGAAACGGC 97 N/A N/A 2131
950032 90804 90819 TGAGCAGCCACAGGTA 31 N/A N/A 2132
950033 90806 90821 AGTGAGCAGCCACAGG 45 N/A N/A 2133
950034 90807 90822 AAGTGAGCAGCCACAG 83 N/A N/A 2134
950035 90808 90823 CAAGTGAGCAGCCACA 27 N/A N/A 2135
950036 90810 90825 ACCAAGTGAGCAGCCA 14 N/A N/A 2136
950037 90812 90827 GGACCAAGTGAGCAGC 54 N/A N/A 2137
950038 90837 90852 GCGAATGTGGCCGTTC 64 N/A N/A 2138
950039 90889 90904 GAACAGACAGGGTTCA 97 N/A N/A 2139
950040 90978 90993 CGGGAGACTGCAGAGG 44 N/A N/A 2140
950041 91083 91098 AGCAGATGGCCTGGTA 18 N/A N/A 2141
950042 91189 91204 ACATAGGGCCTTCTGG 38 N/A N/A 2142
950043 91226 91241 AGCCAAGAGTCAAGTT 36 N/A N/A 2143
950044 91384 91399 CATGAGCCCACCACTC 120 N/A N/A 2144
950045 91538 91553 CTCCTAACATGCTAGA 75 N/A N/A 2145
950046 91825 91840 CGCTCAAGGGAAAAAT 25 N/A N/A 2146
950047 91934 91949 TCCCAAGCTCCCCTGA 51 N/A N/A 2147
950048 92034 92049 GATACAGCCGTTCATA 11 N/A N/A 2148
950049 92059 92074 TAATAAGGTACTGAAG 54 N/A N/A 2149
950050 92634 92649 ACGAAGCTAGGAGGCG 108 N/A N/A 2150
950051 92635 92650 CACGAAGCTAGGAGGC 35 N/A N/A 2151
950052 92814 92829 GCATGATAATCCCAGC 98 N/A N/A 2152
950053 93110 93125 AGCCGCCCAGGCCAGA 96 N/A N/A 2153
950054 93183 93198 GCAGAAATTTTGCGAA 35 N/A N/A 2154
950055 93185 93200 AGGCAGAAATTTTGCG 48 N/A N/A 2155
950056 93235 93250 GGTGGAGTCCCCGCCC 165 N/A N/A 2156
950057 93248 93263 GTGCAAGGTACATGGT 11 N/A N/A 2157
950058 93303 93318 CGCAAAAATAAATCAT 83 N/A N/A 2158
950059 93304 93319 GCGCAAAAATAAATCA 105 N/A N/A 2159
950060 93322 93337 ATGTATTACCTACGGC 7 N/A N/A 2160
950061 93383 93398 CATATTCATGGTGTTA 10 N/A N/A 2161
950062 93496 93511 AGAGATGGAAGGGACG 89 N/A N/A 2162
950063 93586 93601 CCACACTAAGCATGTA 38 N/A N/A 2163
950064 93600 93615 TCTAATGTTTGCTACC 7 N/A N/A 2164
950065 93601 93616 CTCTAATGTTTGCTAC 4 N/A N/A 2165
950066 93612 93627 ACCACTAGATTCTCTA 56 N/A N/A 2166
950067 93648 93663 GAACAGGGAATATTAG 79 N/A N/A 2167
950068 93744 93759 TTATACCCAGGGCAAC 37 N/A N/A 2168
950069 93854 93869 TAAGTATTTGCCATCC 6 N/A N/A 2169
950070 93908 93923 GCTTAAGCGAGATCTT 42 N/A N/A 2170
950071 93921 93936 GAATTCTGGTCTGGCT 26 N/A N/A 2171
950072 93958 93973 CATAGGAGATAGAAGG 4 N/A N/A 2172
950073 93960 93975 TGCATAGGAGATAGAA 34 N/A N/A 2173
950074 94019 94034 CACAAGAGGGCAAGAT 36 N/A N/A 2174
950075 94050 94065 TGCTAGATCAACTAGC 7 N/A N/A 2175
950076 94058 94073 GCAAAGAGTGCTAGAT 89 N/A N/A 2176
950077 94060 94075 AGGCAAAGAGTGCTAG 78 N/A N/A 2177
950078 94065 94080 GCACAAGGCAAAGAGT 89 N/A N/A 2178
950079 94078 94093 TGCTAGAGGAGCGGCA 114 N/A N/A 2179
950080 94153 94168 CTATAGAACAGGAGTG 15 N/A N/A 2180
950081 94155 94170 TGCTATAGAACAGGAG 9 N/A N/A 2181
950082 94164 94179 AGCCACATCTGCTATA 89 N/A N/A 2182
950083 94176 94191 CCTTAATCACTTAGCC 7 N/A N/A 2183
950084 94200 94215 TATCATATAGGGAGAA 16 N/A N/A 2184
950085 94215 94230 GCATAGAGAAGAGGGT 6 N/A N/A 2185
950086 94270 94285 GACAAGAGGCAGCATC 7 N/A N/A 2186
950087 94333 94348 TCACAGGCCAAGGATA 81 N/A N/A 2187
950088 94371 94386 TGGCAGGAAACGGTGC 42 N/A N/A 2188
950089 94450 94465 GCAAATATGATTCATC 1 N/A N/A 2189
950090 94481 94496 AAGGAGGTGTTACCCA 60 N/A N/A 2190
950091 94581 94596 CTATGAGTAGCAGGCT 3 N/A N/A 2191
950092 94652 94667 GTCCAAGTGTAAGAGC 12 N/A N/A 2192
950093 94695 94710 GCAAAAGGGAGCCCCT 69 N/A N/A 2193
950094 94696 94711 AGCAAAAGGGAGCCCC 88 N/A N/A 2194
950095 94770 94785 TGCCAGAAGAGCCCCG 84 N/A N/A 2195
950096 94791 94806 CTACAAGAAAGACCCT 30 N/A N/A 2196
950097 94805 94820 TAGGATCGGCTCAGCT 18 N/A N/A 2197
950098 94810 94825 TGGCATAGGATCGGCT 54 N/A N/A 2198
950099 94920 94935 GAACACATGAGGAACC 24 N/A N/A 2199
950100 94977 94992 GTACAAGGGAGAAGCA 100 N/A N/A 2200
950101 95047 95062 GGCCACGCTCATGACG 97 N/A N/A 2201
950102 95086 95101 GTAGAGATGGGAACCA 4 N/A N/A 2202
950103 95155 95170 AAGCAGGGATCCTCTG 114 N/A N/A 2203
950104 95189 95204 GCGGTATGGGTGGCAG 106 N/A N/A 2204
950105 95227 95242 GGCTAGGGTGCACAGT 60 N/A N/A 2205
950106 95278 95293 CTTAGAAGGAAGTAGG 100 N/A N/A 2206
950107 95378 95393 CCGTTAGCCATCCACC 73 N/A N/A 2207
950108 95416 95431 CCCTAGGGAGCTGCAA 112 N/A N/A 2208
950109 95443 95458 CCACACGGGTTCAGAG 43 N/A N/A 2209
950110 95496 95511 GCACACCAAGCCTTGG 63 N/A N/A 2210
950111 95645 95660 AGGGATGTGCCCGCAC 87 N/A N/A 2211
950112 95745 95760 TGACAACCAGGTGAGG 24 N/A N/A 2212
950113 95854 95869 TGGGAATGCCTCCATT 95 N/A N/A 2213
950114 95954 95969 AGCCCCTGTGAGGTCA 66 N/A N/A 2214
950115 96079 96094 GTACAGACTTATCCCT 28 N/A N/A 2215
950116 96081 96096 GGGTACAGACTTATCC 95 N/A N/A 2216
950117 96178 96193 GGCTAAAGAGTACCCA 63 N/A N/A 2217
950118 96181 96196 GGTGGCTAAAGAGTAC 23 N/A N/A 2218
950119 96298 96313 GACTACCCCGACCCAC 71 N/A N/A 2219
950120 96399 96414 GCACGGCACGGCAGGA 24 N/A N/A 2220
950121 96523 96538 ACGCACAGGGCGGCCT 111 N/A N/A 2221
950122 96527 96542 AGGCACGCACAGGGCG 83 N/A N/A 2222
950123 96646 96661 CTAACGGCAGGCAGCC 71 N/A N/A 2223
950124 96752 96767 CATCAGGGTTTCAGGC 11 N/A N/A 2224
950125 96860 96875 GGCTAGGGTCAAAGGT 21 N/A N/A 2225
950126 96977 96992 GCCCATGGGAGGAGTC 80 N/A N/A 2226
950127 97078 97093 GAAACCAACATGAGGC 20 N/A N/A 2227
950128 97149 97164 CGCAATAGAGACACCT 32 N/A N/A 2228
950129 97221 97236 GAACCTCGCTCCGTGC 165 N/A N/A 2229
950130 97453 97468 AGTGACTGAGTTCTGC 22 N/A N/A 2230
950131 97809 97824 GGTTACGGTTGTTTTT 26 N/A N/A 2231
950132 97855 97870 GTACAATGTAAGCCTT 3 N/A N/A 2232
950133 97920 97935 TGCTAGTGACTCCATC 27 N/A N/A 2233
950134 98046 98061 AGTGATGGAACCCCGG 48 N/A N/A 2234
950135 98098 98113 CGCAGATAGAAAAACT 26 N/A N/A 2235
950136 98099 98114 TCGCAGATAGAAAAAC 60 N/A N/A 2236
950137 98150 98165 GCACACTGTGGCCAAG 70 N/A N/A 2237
950138 98259 98274 AGTGAACGAGTCCCTC 84 N/A N/A 2238
950139 98353 98368 TTCTACATAGGACCAT 13 N/A N/A 2239
950140 98399 98414 AAACATCACAGGGACC 43 N/A N/A 2240
950141 98508 98523 TCAGAAGAGAGGACCT 42 N/A N/A 2241
950142 98643 98658 AGACACAGGGTAATGC 35 N/A N/A 2242
950143 98866 98881 CAACAATGCAACAACG 15 N/A N/A 2243
950144 99310 99325 CGCCAGATTAATTTTG 46 N/A N/A 2244
950145 99477 99492 AACAATTGTCTGGTGT 85 N/A N/A 2245
950146 99478 99493 CAACAATTGTCTGGTG 63 N/A N/A 2246
950147 99481 99496 TAACAACAATTGTCTG 20 N/A N/A 2247
950148 99493 99508 TAAGACTATAGTTAAC 63 N/A N/A 2248
950149 99519 99534 CAACAGAAGAGTAGGG 26 N/A N/A 2249
950150 99522 99537 GTTCAACAGAAGAGTA 25 N/A N/A 2250
950151 99626 99641 GATAAATACTAGAGGC 45 N/A N/A 2251
950152 99810 99825 GATCAGGGCCATAGAA 79 N/A N/A 2252
950153 99823 99838 CAAGAAACGGGTTGAT 71 N/A N/A 2253
950154 99830 99845 AATTAAGCAAGAAACG 114 N/A N/A 2254
950155 99893 99908 CAACAAGCTATCACAC 92 N/A N/A 2255
950156 99912 99927 CTGGACCGCATCAGAG 92 N/A N/A 2256
950157 99924 99939 TTGAAAGCCAACCTGG 105 N/A N/A 2257
950158 100015 100030 TAACACAGCCATGGCT 123 N/A N/A 2258
950159 100020 100035 CCACATAACACAGCCA 28 N/A N/A 2259
950160 100125 100140 TTGCAGCACAGGGTCA 56 N/A N/A 2260
950161 100161 100176 GGCAACAGGAGACGCG 62 N/A N/A 2261
950162 100227 100242 AGAGGCTACATGGTGA 60 N/A N/A 2262
950163 100328 100343 GAAACAACCAATATCC 58 N/A N/A 2263
950164 100399 100414 CACGAAGGGTTGACAC 101 N/A N/A 2264
950165 100435 100450 GGCCAGAGTCCTGACT 98 N/A N/A 2265
950166 100535 100550 GTTACCAGGACAAAAC 126 N/A N/A 2266
950167 100670 100685 TGCCATCCCAGGGACC 105 N/A N/A 2267
950168 100782 100797 CTACAGAGCATTCCCC 89 N/A N/A 2268
950169 100811 100826 TGCCAGCAAGTCCCCA 80 N/A N/A 2269
950170 100929 100944 GCCAAGAGGCCCGCCT 171 N/A N/A 2270
950171 101038 101053 ACCCGAATAGCAAGCG 54 N/A N/A 2271
950172 101155 101170 GAGCATGGGCCCGCAG 139 N/A N/A 2272
950173 101255 101270 GATGATCCTTTCACCC 90 N/A N/A 2273
950174 101362 101377 CACCACCCTGGGTTTA 132 N/A N/A 2274
950175 101483 101498 GCAGACCACGCCTGGC 44 N/A N/A 2275
950176 101603 101618 TGCAAGGCGGAAAGAG 95 N/A N/A 2276
950177 101718 101733 GGCATTCCCACCCAGG 84 N/A N/A 2277
950178 101808 101823 GAAAACTAGACTTGCA 31 N/A N/A 2278
950179 101810 101825 CTGAAAACTAGACTTG 44 N/A N/A 2279
950180 101850 101865 GAAAAACACGAAGGGC 86 N/A N/A 2280
950181 101951 101966 TCATTACGGCCGGCGC 109 N/A N/A 2281
950182 102059 102074 CTAACTTGGGTGGTGG 43 N/A N/A 2282
950183 102159 102174 AGATATTGATGTCTTG 7 N/A N/A 2283
950184 102264 102279 GCAGAGGGAGCCCCGA 90 N/A N/A 2284
950185 102314 102329 TCGCATAGAAGATTCG 38 N/A N/A 2285
950186 102365 102380 CGGCAGGTGAGTGTCA 30 N/A N/A 2286
950187 102465 102480 GACTACCTGTTCAGGA 112 N/A N/A 2287
950188 102585 102600 GAAGAGTGGTGGTTTC 80 N/A N/A 2288
950189 102639 102654 TGCGAGCCGGCCCCAG 61 N/A N/A 2289
950190 102716 102731 CACGATCCCAAACCCT 79 N/A N/A 2290
950191 102830 102845 TGCCGGCACGCACGCG 135 N/A N/A 2291
950192 102935 102950 CAGCAGGGCCAAGTAA 61 N/A N/A 2292
950193 103102 103117 GGTAACACAGGGCCTG 119 N/A N/A 2293
950207 103286 103301 GAGCATAGGAAGAGGG 27 N/A N/A 2294
950208 103302 103317 GCAAAGAAGTAGGGCA 81 N/A N/A 2295
950209 103323 103338 GATTAGCCTGCCAGGC 20 N/A N/A 2296
950210 103425 103440 CCTCATCTATCCAAGG 99 N/A N/A 2297
950211 103552 103567 GGCACATGGGCTCAGC 119 N/A N/A 2298
950212 103672 103687 CTCCAAGTTCAGGAGC 119 N/A N/A 2299
950213 103832 103847 CGCAAGCCACAGCAGG 101 N/A N/A 2300
950214 103971 103986 ACTCACCCAGTGATGT 111 N/A N/A 2301
950215 104100 104115 GTTCAGGAAGCACCAA 20 N/A N/A 2302
950216 104276 104291 AGCCTTACTCCCTTTC 34 N/A N/A 2303
950217 104326 104341 CGCTTTAGGACATCTT 63 N/A N/A 2304
950218 104410 104425 TAGGAGTGAGTTACCT 102 N/A N/A 2305
950219 104458 104473 CACGAAGTGAATGGAA 13 N/A N/A 2306
950220 104486 104501 ACGCACAACACAACTG 63 N/A N/A 2307
950221 104560 104575 TGCCACTGGACTGACT 69 N/A N/A 2308
950222 104606 104621 GACCTAGGTGCCTGAC 27 N/A N/A 2309
950223 104678 104693 ACTCTACCCGCACCCT 96 N/A N/A 2310
950224 104783 104798 CTCCATGATGCTCCCT 63 N/A N/A 2311
950225 104895 104910 GTGTAGCATGCGCCAC 124 N/A N/A 2312
950226 104953 104968 GGGAAAAGAGTCACCC 113 N/A N/A 2313
950227 105113 105128 CTTCACCCCGAGCCAT 90 N/A N/A 2314
950228 105248 105263 CGGGAAGCATCCCTGG 114 N/A N/A 2315
950229 105253 105268 CAGCACGGGAAGCATC 53 N/A N/A 2316
950230 105366 105381 TGCAAGCACCTGAGCC 99 N/A N/A 2317
950231 105479 105494 CCCTATGGGTTCTGGC 78 N/A N/A 2318
950232 105561 105576 TCACAATTGGTGCCTT 16 N/A N/A 2319
950233 105622 105637 CCCCACCTCGGCCAAT 59 N/A N/A 2320
950234 105668 105683 CTAAATGGAGCTCTTG 64 N/A N/A 2321
950235 105671 105686 GGCCTAAATGGAGCTC 79 N/A N/A 2322
950236 105727 105742 CATCACACTCCTCGAT 96 N/A N/A 2323
950237 105864 105879 ATGTACTGTGAGCTTC 12 N/A N/A 2324
950238 106002 106017 GCTAATCCCTGACTCA 37 N/A N/A 2325
950239 106118 106133 ACTCAGCTGGAGTTGG 63 N/A N/A 2326
950240 106174 106189 GACAAATGGGTCTCGA 124 N/A N/A 2327
950241 106213 106228 GCCTAGAAGAGCTATG 97 N/A N/A 2328
950242 106218 106233 GGCAAGCCTAGAAGAG 95 N/A N/A 2329
950243 106269 106284 AGGCACACGGCTCAGG 55 N/A N/A 2330
950244 106276 106291 GTACAGGAGGCACACG 82 N/A N/A 2331
950245 106340 106355 TACTACTCTGGGTTTC 53 N/A N/A 2332
950246 106457 106472 GAACATGCAGGGCCTG 13 N/A N/A 2333
950247 106838 106853 AAGAAGTAGAAGTCGG 36 N/A N/A 2334
950248 106946 106961 GGATGAGGTTGTGTGG 82 N/A N/A 2335
950249 107060 107075 ACGCACATTTTCCTGT 59 N/A N/A 2336
950250 107115 107130 TGCTAAACAGTGCTTG 76 N/A N/A 2337
950251 107478 107493 AAAGTTTAGGCATGGT 22 N/A N/A 2338
950252 107673 107688 CGTCAATACTAAAATA 119 N/A N/A 2339
950253 108115 108130 GCCCGAATGTGTTTTG 72 N/A N/A 2340
950254 108434 108449 CACCAGAACTTTATTA 92 N/A N/A 2341
950255 108584 108599 GGCAAGTGTCTGAGTT 17 N/A N/A 2342
950256 108685 108700 TCTGACTGATCAGGAA 85 N/A N/A 2343
950257 108748 108763 GCACAAGCTTGACCCT 92 N/A N/A 2344
950258 108970 108985 GAAAATGACCTGTCCT 92 N/A N/A 2345
950259 109080 109095 CCGTGAGGGAACTTTC 69 N/A N/A 2346
950260 109124 109139 AAGCAAGTGGGACCCC 79 N/A N/A 2347
950261 109129 109144 GAACAAAGCAAGTGGG 62 N/A N/A 2348
950262 109183 109198 GGCCAAGGGTGGCCAT 143 N/A N/A 2349
950263 109205 109220 CGGCAAGGCATTTTAA 88 N/A N/A 2350
950264 109407 109422 TTTAAGCGATCTCCTG 31 N/A N/A 2351
950265 109408 109423 GTTTAAGCGATCTCCT 39 N/A N/A 2352
950266 109516 109531 ACCCAACCTTGGGACA 75 N/A N/A 2353
950267 109576 109591 CCCAAAGGATCTGCCC 101 N/A N/A 2354
950268 109649 109664 TGCCTGGGTATGTTTG 76 N/A N/A 2355
950269 109910 109925 AGATAGGCCTGCTTGC 70 N/A N/A 2356
950270 109914 109929 CACCAGATAGGCCTGC 74 N/A N/A 2357
950271 110212 110227 ACTCACATTGTTGATC 92 N/A N/A 2358
950272 110607 110622 CTCTAGGCTTACCACA 53 N/A N/A 2359
950273 110885 110900 GCCTAGGGTGCCTGGC 105 N/A N/A 2360
950274 110899 110914 TACAAACAGGTATGGC 20 N/A N/A 2361
950275 110900 110915 CTACAAACAGGTATGG 46 N/A N/A 2362
950276 111043 111058 TCAAATTTGTTGTTGC 14 N/A N/A 2363
950277 111093 111108 CCAAAGAGGATGGCCG 66 N/A N/A 2364
950278 111150 111165 AGTTAGTGGACTTGAT 37 N/A N/A 2365
950279 111166 111181 CTGCAGTGTTCACTCC 64 N/A N/A 2366
950280 111195 111210 GCCTAAGTTAATTCAG 88 N/A N/A 2367
950281 111339 111354 GCAACCAGGGTAAACG 94 N/A N/A 2368
950282 111471 111486 ACTGAAGAGGAGCCCA 57 N/A N/A 2369
950283 111548 111563 GCCAAAGGCCTGATAC 96 N/A N/A 2370
950284 111581 111596 GGTTTATAAAGCTTCC 35 N/A N/A 2371
950285 111781 111796 TCTTACCTCGGTCTTC 66 N/A N/A 2372
950286 111872 111887 TGAAAGAGGTTCCTGC 36 N/A N/A 2373
950287 111910 111925 GTTGACATTCATATAC 68 N/A N/A 2374
950288 112131 112146 TGAGAATGGGAGCAAC 39 N/A N/A 2375
950289 112147 112162 GAACACTGATCACTAC 32 N/A N/A 2376
950290 112174 112189 AAACATACCAGGACAC 39 N/A N/A 2377
950291 112192 112207 TCCTATCGGTATATGA 139 N/A N/A 2378
950292 112222 112237 TCATAGCAGAAGAACC 28 N/A N/A 2379
950293 112260 112275 TAAACTTGCAGGGTCA 9 N/A N/A 2380
950294 112267 112282 CTAAAAGTAAACTTGC 98 N/A N/A 2381
950295 112360 112375 TCCCATCTTTGGCTGC 37 N/A N/A 2382
950296 112902 112917 TCCTACTGGATACAGA 58 N/A N/A 2383
950299 113293 113308 GCCAATCCTGTTATAT 97 N/A N/A 2384
950300 113614 113629 GCAGAATAATCCTGTT 77 N/A N/A 2385
950301 113616 113631 TGGCAGAATAATCCTG 69 N/A N/A 2386
950302 113780 113795 GTTGACACCATGCTTG 14 N/A N/A 2387
950303 113923 113938 CCCCAGACTTTTTTGA 101 N/A N/A 2388
950304 114269 114284 AACCAGGCTTCCGGAC 83 N/A N/A 2389
950305 114450 114465 AGCTGTAGGGCTGGCT 61 N/A N/A 2390
950306 114637 114652 TCTGGCCACGCCTTGC 93 N/A N/A 2391
950307 114737 114752 CCTTAAGGAACTCCAT 109 N/A N/A 2392
950308 114843 114858 CCTAATATCTCTAGGG 82 N/A N/A 2393
950309 115000 115015 GCGCAGTGGGATCCTC 178 N/A N/A 2394
950310 115042 115057 TGCCAGAACCTGAGGT 96 N/A N/A 2395
950311 115081 115096 ATACAGATGGAGTAGG 63 N/A N/A 2396
950312 115423 115438 ACAGGAGGAGAGACCC 58 N/A N/A 2397
950313 115497 115512 CCAAATAGGGATGAGG 87 N/A N/A 2398
950314 115504 115519 TCGCAAGCCAAATAGG 29 N/A N/A 2399
950315 115538 115553 GAACAAGCCTCTTGGC 142 N/A N/A 2400
950316 115640 115655 GCCCAGTGTGAGGGTT 102 N/A N/A 2401
950317 115795 115810 CATCAACTCGCCTGCT 101 N/A N/A 2402
950318 115915 115930 CCGGGAGCAAGAGGCA 160 N/A N/A 2403
951323 3692 3707 CCAGATGGCAGACTTC 19 N/A N/A 2404
951324 3772 3787 AGATATCTAGATGGCC 111 N/A N/A 2405
951325 3773 3788 TAGATATCTAGATGGC 63 N/A N/A 2406
951326 3774 3789 ATAGATATCTAGATGG 52 N/A N/A 2407
951327 3884 3899 CCAAATGGTGGTGGCA 84 N/A N/A 2408
951328 4373 4388 CCAATTTGTAGGCTGT 9 N/A N/A 2409
951329 4487 4502 ACAGATGGGCACACCG 91 N/A N/A 2410
951330 4647 4662 ACAAATGAGTAGTTCC 6 N/A N/A 2411
951331 4668 4683 TCATTTGGCAGCCACA 41 N/A N/A 2412
951332 4670 4685 TATCATTTGGCAGCCA 77 N/A N/A 2413
951333 4673 4688 TGTTATCATTTGGCAG 13 N/A N/A 2414
951334 4767 4782 CCTTACTTGGGATTCA 64 N/A N/A 2415
951335 4792 4807 ATGATAACACAGCCTC 47 N/A N/A 2416
951336 4793 4808 GATGATAACACAGCCT 46 N/A N/A 2417
951337 4795 4810 GGGATGATAACACAGC 104 N/A N/A 2418
951338 4917 4932 GAGATTTGTGCTGCTT 16 N/A N/A 2419
951339 5744 5759 GTAAGTAAGCACTTTT 45 N/A N/A 2420
951340 5899 5914 GGATTATAGCAATGCC 12 N/A N/A 2421
951341 5970 5985 TCACTTTACAGCCTCC 9 N/A N/A 2422
951342 6124 6139 GGATTCTAGGAGGTCG 36 N/A N/A 2423
951343 6458 6473 ATTAATACTCTTAACG 57 N/A N/A 2424
951344 6738 6753 ACTAACTGGGCTGTTC 53 N/A N/A 2425
951345 6740 6755 GAACTAACTGGGCTGT 40 N/A N/A 2426
951346 6857 6872 GGAAATCTAACACTGG 7 N/A N/A 2427
951347 6908 6923 AACTCTATAGATCTGA 101 N/A N/A 2428
951348 6959 6974 AGACATGGTGGAACCA 81 N/A N/A 2429
951349 7117 7132 GATTACAACAACAGCC 76 N/A N/A 2430
951350 7175 7190 TGAAATCGAAGCCATT 95 N/A N/A 2431
951351 7399 7414 TAAATGACAAGGGTCA 83 N/A N/A 2432
951352 7942 7957 GCTATTATAACTTGTA 8 N/A N/A 2433
951353 8568 8583 ATTTTAAAGAAGACGG 42 N/A N/A 2434
951354 8583 8598 GCTATTATAACTCCTA 11 N/A N/A 2435
951355 8616 8631 CACTTAATCCCTATTC 74 N/A N/A 2436
951356 9095 9110 ATACTTATCGCCTTTT 5 N/A N/A 2437
951357 9099 9114 CATCATACTTATCGCC 6 N/A N/A 2438
951358 9144 9159 TCCAACTGTGATCTCT 8 N/A N/A 2439
951359 10032 10047 CCAAGGAACACATCAC 25 N/A N/A 2440
951360 10064 10079 ACTAATAAGATCTGTT 97 N/A N/A 2441
951361 10131 10146 TGCAATTTGTCTTTGC 78 N/A N/A 2442
951362 10136 10151 CAAGATGCAATTTGTC 3 N/A N/A 2443
951363 10700 10715 CGAGATCACAAATGCT 41 N/A N/A 2444
951364 11386 11401 AGTAATGATGAGTTCC 3 N/A N/A 2445
951365 11416 11431 CACTGATAGGCACTCC 8 N/A N/A 2446
951366 11553 11568 ATTACTTGTTTGCAGC 8 N/A N/A 2447
951367 11556 11571 CCAATTACTTGTTTGC 8 N/A N/A 2448
951368 11572 11587 TAAATAACTCTCACGG 25 N/A N/A 2449
951369 11573 11588 GTAAATAACTCTCACG 86 N/A N/A 2450
951370 11575 11590 GTGTAAATAACTCTCA 10 N/A N/A 2451
951371 11922 11937 GTTGATAGTCGGTTGT 4 N/A N/A 2452
951372 11960 11975 GGTCATTAAAGATTCT 4 N/A N/A 2453
951373 11990 12005 GGTACCTAACAGGTCT 93 N/A N/A 2454
951374 12062 12077 GTCTTTCCGGTCTTTT 4 N/A N/A 2455
951375 12148 12163 GATTATAAACCTAATC 121 N/A N/A 2456
951376 12215 12230 TCAATAAGTAACTCTG 11 N/A N/A 2457
951377 12216 12231 GTCAATAAGTAACTCT 140 N/A N/A 2458
951378 12237 12252 ACCTATCAAGGGCTGT 27 N/A N/A 2459
951379 12244 12259 GTTATGAACCTATCAA 20 N/A N/A 2460
951380 12245 12260 TGTTATGAACCTATCA 47 N/A N/A 2461
951381 12850 12865 GTTTACATGATGTTCT 7 N/A N/A 2462
951382 12860 12875 GTAAATTACGGTTTAC 122 N/A N/A 2463
951383 12861 12876 AGTAAATTACGGTTTA 14 N/A N/A 2464
951384 12890 12905 CTTAATTACAGCTTGT 6 N/A N/A 2465
951385 12934 12949 TCATTATTGGCTTGGA 41 N/A N/A 2466
951386 12935 12950 CTCATTATTGGCTTGG 4 N/A N/A 2467
951387 12971 12986 CCTTTATTCAGATTGT 3 N/A N/A 2468
951388 13136 13151 AGTCATCCAGCTCCCG 54 N/A N/A 2469
951389 13167 13182 ATAAATGTCCAGCAGC 44 N/A N/A 2470
951390 13169 13184 TCATAAATGTCCAGCA 63 N/A N/A 2471
951391 13170 13185 ATCATAAATGTCCAGC 32 N/A N/A 2472
951392 13392 13407 GCCATATGTGTGGCTC 65 N/A N/A 2473
951393 13487 13502 TGTAATCTTGGCCCAG 83 N/A N/A 2474
951394 13521 13536 TGCATATCCAAAGCCA 83 N/A N/A 2475
951395 14442 14457 CCACATGTGAAGCAGC 21 N/A N/A 2476
951396 14476 14491 GGCTATTCCACTGCAG 99 N/A N/A 2477
951397 14694 14709 TCTGTAATGGTTTCCC 5 N/A N/A 2478
951398 14808 14823 TGTACCTAAGTACAGA 97 N/A N/A 2479
951399 14824 14839 TCTATAGGTACCAGCA 50 N/A N/A 2480
951400 15508 15523 AGTGAAATTCACTCCA 47 N/A N/A 2481
951401 15651 15666 CTCTTTATATAGATGG 58 N/A N/A 2482
951402 16748 16763 AGAGATACATCAACCC 35 N/A N/A 2483
951403 17836 17851 AAATATAGCAGGGACC 51 N/A N/A 2484
951404 17839 17854 ACTAAATATAGCAGGG 30 N/A N/A 2485
951405 17842 17857 GGCACTAAATATAGCA 71 N/A N/A 2486
951406 19042 19057 TAGTATACCAAGGTTA 11 N/A N/A 2487
951407 19043 19058 GTAGTATACCAAGGTT 6 N/A N/A 2488
951408 19760 19775 CAGTATGTATACTTCC 2 N/A N/A 2489
951409 19761 19776 TCAGTATGTATACTTC 86 N/A N/A 2490
951410 20345 20360 TCCTGATAAGATTCAC 17 N/A N/A 2491
951411 20392 20407 TCAGTTATCACTGTCA 31 N/A N/A 2492
951412 20458 20473 ACTAGTAACTTTCCAG 37 N/A N/A 2493
951413 20741 20756 GGATTATTACATGAGT 11 N/A N/A 2494
951414 20743 20758 GAGGATTATTACATGA 29 N/A N/A 2495
951415 20864 20879 GCCAACTAATTCCAGA 46 N/A N/A 2496
951416 21512 21527 ATATATGTGGAGGCAA 10 N/A N/A 2497
951417 21513 21528 TATATATGTGGAGGCA 104 N/A N/A 2498
951418 21515 21530 AATATATATGTGGAGG 4 N/A N/A 2499
951419 21654 21669 CACTATTGGCACACCA 115 N/A N/A 2500
951420 21655 21670 ACACTATTGGCACACC 122 N/A N/A 2501
951421 21656 21671 AACACTATTGGCACAC 111 N/A N/A 2502
951422 21840 21855 TTCTTAACAGGCTCCC 41 N/A N/A 2503
951423 22010 22025 TAAGTATGCGCTGCCA 31 N/A N/A 2504
951424 22134 22149 AGGATATAGGGTCTCC 97 N/A N/A 2505
951425 22135 22150 AAGGATATAGGGTCTC 37 N/A N/A 2506
951426 22212 22227 GAACATCATGGAGCCT 33 N/A N/A 2507
951427 23308 23323 TTTGATACTGATCTCA 18 N/A N/A 2508
951428 24284 24299 GGTATTATGGTATGTG 2 N/A N/A 2509
951429 24285 24300 AGGTATTATGGTATGT 2 N/A N/A 2510
951430 24396 24411 TCATATGTATGGGTTT 4 N/A N/A 2511
951431 24398 24413 CTTCATATGTATGGGT 10 N/A N/A 2512
951432 25701 25716 ATAGATGTAAGCAACT 51 N/A N/A 2513
951433 25709 25724 GGAAATTCATAGATGT 113 N/A N/A 2514
951434 25740 25755 ACTTATGGATGCAGCT 52 N/A N/A 2515
951435 25741 25756 AACTTATGGATGCAGC 39 N/A N/A 2516
951436 26160 26175 AGCATTGGTATCAGGC 35 N/A N/A 2517
951437 26168 26183 TGGATATCAGCATTGG 17 N/A N/A 2518
951438 26173 26188 ATGGATGGATATCAGC 41 N/A N/A 2519
951439 26180 26195 TTCAATCATGGATGGA 72 N/A N/A 2520
951440 27070 27085 GGAATACTTGCAGCTA 41 N/A N/A 2521
951441 27071 27086 AGGAATACTTGCAGCT 11 N/A N/A 2522
951442 27224 27239 CAACATGGCACTCCCT 64 N/A N/A 2523
951443 27231 27246 TCTGATGCAACATGGC 12 N/A N/A 2524
951444 27569 27584 ATCATTGGGTGAAGAC 43 N/A N/A 2525
951445 27762 27777 GGTCTATTGGCACACA 32 N/A N/A 2526
951446 27776 27791 AGATTAAGTCATCCGG 90 N/A N/A 2527
951447 27777 27792 GAGATTAAGTCATCCG 61 N/A N/A 2528
951448 27778 27793 AGAGATTAAGTCATCC 73 N/A N/A 2529
951449 28228 28243 GCAAATGCTAGCTGCA 142 N/A N/A 2530
951450 29274 29289 CGCTCTAATGTCCTGA 11 N/A N/A 2531
951451 29308 29323 TGGATATCCAGACCCA 97 N/A N/A 2532
951452 29321 29336 GCAGATCCTGCCTTGG 92 N/A N/A 2533
951453 29584 29599 TGAACTAGAGGCAGGC 29 N/A N/A 2534
951454 29585 29600 GTGAACTAGAGGCAGG 19 N/A N/A 2535
951455 29974 29989 TGTAACTTTCAGCAGT 25 N/A N/A 2536
951456 29999 30014 TGTGATTGCAGGCCAG 13 N/A N/A 2537
951457 30053 30068 TTTTATAGTCTCCAAC 140 N/A N/A 2538
951458 30107 30122 TGTATGGACAGCAGGC 13 N/A N/A 2539
951459 30108 30123 GTGTATGGACAGCAGG 10 N/A N/A 2540
951460 30242 30257 ATCAATCTTGGGAGCT 39 N/A N/A 2541
951461 30246 30261 CTAAATCAATCTTGGG 40 N/A N/A 2542
951462 30348 30363 ATATTAATGCAGTGGT 4 N/A N/A 2543
951463 30349 30364 CATATTAATGCAGTGG 14 N/A N/A 2544
951464 30350 30365 ACATATTAATGCAGTG 66 N/A N/A 2545
951465 30407 30422 AGAATATCAACACCTT 69 N/A N/A 2546
951466 30408 30423 TAGAATATCAACACCT 61 N/A N/A 2547
951467 30426 30441 TTATCTAACAGTCCCA 45 N/A N/A 2548
951468 30429 30444 CATTTATCTAACAGTC 104 N/A N/A 2549
951469 30509 30524 TAGTGATATGCTGCCT 22 N/A N/A 2550
951470 30852 30867 CACAATCCTGGCTATC 56 N/A N/A 2551
951471 30931 30946 CCAGACATTGCTGTCG 108 N/A N/A 2552
951472 31367 31382 ACATTTGACGGTTTGA 15 N/A N/A 2553
951473 32256 32271 GGGAATGATGCCACCT 110 N/A N/A 2554
951474 32270 32285 CCAATCTGTTATGTGG 23 N/A N/A 2555
951475 32336 32351 TGGAATCCAGTATTTC 103 N/A N/A 2556
951476 32498 32513 AGGAATCCTGCAGCTC 108 N/A N/A 2557
951477 32722 32737 TCCTATTAGAGTGGCA 49 N/A N/A 2558
951478 32905 32920 AGCATTAACAGAGCAG 92 N/A N/A 2559
951479 33017 33032 GGCTTTACTCCAGCCA 104 N/A N/A 2560
951480 33518 33533 AACAATAGCCATTGGT 107 N/A N/A 2561
951481 34302 34317 TGTTTATTTACCGTTT 3 N/A N/A 2562
951482 35180 35195 AGTACTATTGCATCAT 28 N/A N/A 2563
951483 36041 36056 TCACATACAGACCCCA 59 N/A N/A 2564
951484 36073 36088 CTAAATGTCACTTAGC 40 N/A N/A 2565
951485 36087 36102 GGAACTAACACATGCT 23 N/A N/A 2566
951486 36362 36377 GAAATCTACCTACTCC 105 N/A N/A 2567
951487 36363 36378 TGAAATCTACCTACTC 121 N/A N/A 2568
951488 36617 36632 GGCACCAACATTCACC 96 N/A N/A 2569
951489 36660 36675 TCCGATTTTGCTTCTA 10 N/A N/A 2570
951490 36665 36680 ACTTATCCGATTTTGC 23 N/A N/A 2571
951491 36809 36824 TGTTATTCCGAACAGT 43 N/A N/A 2572
951492 36911 36926 TCTCATGGCGACTGGC 77 N/A N/A 2573
951493 36948 36963 GGAATAAAGGCTCTCG 22 N/A N/A 2574
951494 37009 37024 TTAGATTGTATGACCC 9 N/A N/A 2575
951495 37194 37209 GGCTTTGTTAGATGCC 107 N/A N/A 2576
951496 37246 37261 ATTCATAGTACCCCAC 62 N/A N/A 2577
951497 37304 37319 GTATTTGTAGTGTGGA 110 N/A N/A 2578
951498 37305 37320 GGTATTTGTAGTGTGG 10 N/A N/A 2579
951499 37446 37461 GACAATGGTGATGCCC 62 N/A N/A 2580
951500 37566 37581 ATCTTAGGCAGACCCT 42 N/A N/A 2581
951501 37570 37585 ACACATCTTAGGCAGA 14 N/A N/A 2582
951502 37729 37744 ATTAAAATGGGTCTGC 77 N/A N/A 2583
951503 37750 37765 CATTTAACCATGACAG 31 N/A N/A 2584
951504 37751 37766 CCATTTAACCATGACA 32 N/A N/A 2585
951505 37971 37986 ACCTTAAGTTTTTTGG 118 N/A N/A 2586
951506 38196 38211 GCTAATAGCTATTCAA 39 N/A N/A 2587
951507 38225 38240 CGCATTACTGAGTTCA 12 N/A N/A 2588
951508 38335 38350 GTGACTAAGACAACCA 40 N/A N/A 2589
951509 38538 38553 AGACATGTAACTCCCT 39 N/A N/A 2590
951510 38540 38555 CTAGACATGTAACTCC 72 N/A N/A 2591
951511 38592 38607 GCCTATCCATGCTGCT 105 N/A N/A 2592
951512 39123 39138 CAGAATTGTTACAACC 47 N/A N/A 2593
951513 39140 39155 CCATTAAAATTTGCCC 30 N/A N/A 2594
951514 39141 39156 TCCATTAAAATTTGCC 44 N/A N/A 2595
951515 39233 39248 TTAACTATATCTAACT 73 N/A N/A 2596
951516 39236 39251 CGATTAACTATATCTA 87 N/A N/A 2597
951517 39547 39562 ATTTATGCGATTGGCC 88 N/A N/A 2598
951518 39548 39563 GATTTATGCGATTGGC 17 N/A N/A 2599
951519 39549 39564 AGATTTATGCGATTGG 11 N/A N/A 2600
951520 39555 39570 TGTTTAAGATTTATGC 41 N/A N/A 2601
951521 39748 39763 AAAGTAATTCACTGCG 81 N/A N/A 2602
951522 40198 40213 ATGGACTACAGTCTGT 110 N/A N/A 2603
951523 40275 40290 TGCAATCACAGACATC 93 N/A N/A 2604
951524 41080 41095 GTATTAACCTCATGAA 93 N/A N/A 2605
951525 41081 41096 GGTATTAACCTCATGA 68 N/A N/A 2606
951526 41125 41140 GTCTTTCCGTCACAGT 40 N/A N/A 2607
951527 41273 41288 GGATAATTGGAGAGGG 94 N/A N/A 2608
951528 41274 41289 GGGATAATTGGAGAGG 68 N/A N/A 2609
951529 42072 42087 GGGATTATGATGAGGA 3 N/A N/A 2610
951530 42327 42342 GATGATGGGTTCTAGC 85 N/A N/A 2611
951531 42355 42370 GGGAGATGTGCTCTTT 49 N/A N/A 2612
951532 42381 42396 GTATTACCCAGTGGCT 62 N/A N/A 2613
951533 42382 42397 TGTATTACCCAGTGGC 15 N/A N/A 2614
951534 42387 42402 GGGAATGTATTACCCA 131 N/A N/A 2615
951535 42501 42516 TACAATCATTCCCAGC 89 N/A N/A 2616
951536 42506 42521 AGCACTACAATCATTC 82 N/A N/A 2617
951537 42569 42584 TACTGTACAGCTGTGC 8 N/A N/A 2618
951538 42578 42593 GGCAATTGGTACTGTA 121 N/A N/A 2619
951539 42599 42614 GAAAATTTGTACAGGA 55 N/A N/A 2620
951540 43029 43044 TACATTAAAGGCTCGA 44 N/A N/A 2621
951541 43843 43858 GTACATATCCTGGCCG 32 N/A N/A 2622
951542 43871 43886 TACTATTCGACAGAGC 31 N/A N/A 2623
951543 43873 43888 ATTACTATTCGACAGA 36 N/A N/A 2624
951544 43876 43891 TAAATTACTATTCGAC 45 N/A N/A 2625
951545 43877 43892 GTAAATTACTATTCGA 63 N/A N/A 2626
951546 43878 43893 TGTAAATTACTATTCG 19 N/A N/A 2627
951547 44416 44431 GAGATCAACACATTTC 57 N/A N/A 2628
951548 44701 44716 AGAAATTACTCTTGCG 116 N/A N/A 2629
951549 44902 44917 TCCAATGACAGCCCAG 26 N/A N/A 2630
951550 44914 44929 GTGAATTCAATGTCCA 11 N/A N/A 2631
951551 44929 44944 ACACATGTGGAACACG 80 N/A N/A 2632
951552 45353 45368 TATCTATAACACATGA 44 N/A N/A 2633
951553 45356 45371 GGTTATCTATAACACA 23 N/A N/A 2634
951554 45446 45461 GTCTTTATTGCATGGG 8 N/A N/A 2635
951555 45569 45584 GCTATAAAACCAGCCA 101 N/A N/A 2636
951556 45590 45605 AGCATTGGATTGAGCA 89 N/A N/A 2637
951557 46280 46295 AGCAATGGTGGCCGGG 109 N/A N/A 2638
951558 46328 46343 CTATATTCAACAGGCT 24 N/A N/A 2639
951559 46329 46344 ACTATATTCAACAGGC 61 N/A N/A 2640
951560 46335 46350 GGCCATACTATATTCA 102 N/A N/A 2641
951561 46428 46443 GGGATATACGCCCACC 8 N/A N/A 2642
951562 46590 46605 TATTTAAAAGGGCCGC 23 N/A N/A 2643
951563 46591 46606 GTATTTAAAAGGGCCG 97 N/A N/A 2644
951564 46861 46876 CGAAATAGCAGAGCTC 75 N/A N/A 2645
951565 46961 46976 TCTATAGTGACTCTCA 9 N/A N/A 2646
951566 46962 46977 TTCTATAGTGACTCTC 6 N/A N/A 2647
951567 47624 47639 GTTCATCCGGGTCAGG 36 N/A N/A 2648
951568 47926 47941 GCAACTATGCATCCAC 141 N/A N/A 2649
951569 48813 48828 GAACATGGCAGCCAGT 82 N/A N/A 2650
951570 48973 48988 TGCTTAATGCCTTGCC 82 N/A N/A 2651
951571 49051 49066 CGCAATGTGTTCATTT 27 N/A N/A 2652
951572 49192 49207 ACTTTAACAAGTCCCG 36 N/A N/A 2653
951573 49193 49208 CACTTTAACAAGTCCC 23 N/A N/A 2654
951574 49227 49242 ACAGATGAAGCTACCA 27 N/A N/A 2655
951575 49443 49458 GGTTATGGTCTTAGGT 16 N/A N/A 2656
951576 49674 49689 TCGATTTGATTCTGAG 84 N/A N/A 2657
951577 50575 50590 GACAAATTGCCACTGG 54 N/A N/A 2658
951578 50595 50610 GCAAATATCTCCCAGT 19 N/A N/A 2659
951579 50845 50860 ACAATGACGAGGCTGG 25 N/A N/A 2660
951580 50979 50994 TCAAATCCCATCAGGA 90 N/A N/A 2661
951581 51714 51729 TGTACTTGCGGGTTTT 42 N/A N/A 2662
951582 51790 51805 AGCAATCACGCTGCCA 99 N/A N/A 2663
951583 51798 51813 AGTCATCCAGCAATCA 43 N/A N/A 2664
951584 51810 51825 ATTAATCTGGGCAGTC 38 N/A N/A 2665
951585 51811 51826 GATTAATCTGGGCAGT 67 N/A N/A 2666
951586 51816 51831 TAAAGGATTAATCTGG 48 N/A N/A 2667
951587 51977 51992 ATTTTGATAGCTCCAC 33 N/A N/A 2668
951588 51979 51994 GCATTTTGATAGCTCC 17 N/A N/A 2669
951589 52601 52616 GGTTTAAAAGCTTCCA 98 N/A N/A 2670
951590 52938 52953 GTAAATGCTGAATGCC 34 N/A N/A 2671
951591 53084 53099 GGATATGGACAGCAGG 17 N/A N/A 2672
951592 53085 53100 AGGATATGGACAGCAG 15 N/A N/A 2673
951593 53553 53568 TCACATGCCAGACTTT 100 N/A N/A 2674
951594 53781 53796 CACACTCACGCATGTT 102 N/A N/A 2675
951595 53852 53867 TTTACCTTGAATGTCC 46 N/A N/A 2676
951596 54009 54024 GCAAGCTACTCTCTCA 88 N/A N/A 2677
951597 54160 54175 TCAATACCTGCACAGG 42 N/A N/A 2678
951598 54161 54176 GTCAATACCTGCACAG 80 N/A N/A 2679
951599 54177 54192 TGTATGAGGACTCAGA 42 N/A N/A 2680
951600 54189 54204 ATCATAACAGGCTGTA 28 N/A N/A 2681
951601 54190 54205 CATCATAACAGGCTGT 94 N/A N/A 2682
951602 54199 54214 TAAAATGCGCATCATA 51 N/A N/A 2683
951603 54255 54270 GTAATGAGCTCAGTCT 45 N/A N/A 2684
951604 55117 55132 GAAACTACGGCACTCT 121 N/A N/A 2685
951605 55385 55400 GGTAATAAGTCACACT 103 N/A N/A 2686
951606 55528 55543 GATTAATATCGGCTGA 44 N/A N/A 2687
951607 55530 55545 TGGATTAATATCGGCT 24 N/A N/A 2688
951608 55531 55546 ATGGATTAATATCGGC 9 N/A N/A 2689
951609 56236 56251 GTTCATCACGGAAGGT 120 N/A N/A 2690
951610 56274 56289 CCGAATCACAGATTGA 71 N/A N/A 2691
951611 56324 56339 GTAATTGACAAGCAGT 16 N/A N/A 2692
951612 56327 56342 TAAGTAATTGACAAGC 29 N/A N/A 2693
951613 56387 56402 GTATATAAGACCCGGG 65 N/A N/A 2694
951614 56388 56403 TGTATATAAGACCCGG 86 N/A N/A 2695
951615 56389 56404 GTGTATATAAGACCCG 53 N/A N/A 2696
951616 56390 56405 AGTGTATATAAGACCC 41 N/A N/A 2697
951617 56459 56474 GACTATTCAAGAGGGC 70 N/A N/A 2698
951618 56567 56582 TCTCATGGCACTCACT 42 N/A N/A 2699
951619 56617 56632 ATTCATGGTCCACCAG 101 N/A N/A 2700
951620 56685 56700 GGTGATGCTGCAGAGC 36 N/A N/A 2701
951621 56725 56740 CAGGATACATCACCCA 128 N/A N/A 2702
951622 56858 56873 TATTATGAATCCCCCT 90 N/A N/A 2703
951623 56859 56874 ATATTATGAATCCCCC 100 N/A N/A 2704
951624 56861 56876 ACATATTATGAATCCC 52 N/A N/A 2705
951625 57375 57390 AGTAATGACCCAGGCT 74 N/A N/A 2706
951626 57642 57657 AGTGATGGGTCCCCAC 94 N/A N/A 2707
951627 57738 57753 GTGAATATCAACTGTT 41 N/A N/A 2708
951628 57916 57931 GCAGATCTGGCTGCCT 71 N/A N/A 2709
951629 58905 58920 AGGATATTTGGCTGGG 70 N/A N/A 2710
951630 59003 59018 ACTTATCGCAAGGAAC 71 N/A N/A 2711
951631 59075 59090 GCGATATACCTTTCTG 26 N/A N/A 2712
951632 59076 59091 TGCGATATACCTTTCT 19 N/A N/A 2713
951633 59174 59189 TGAATGACAGGTGTGT 124 N/A N/A 2714
951634 59346 59361 TACAATCACAATTGCT 47 N/A N/A 2715
951635 60402 60417 GCCAATACCAAAGAAC 96 N/A N/A 2716
951636 60469 60484 TCTAAATCAGGACAGT 86 N/A N/A 2717
951637 61124 61139 GCAACATGGGCACTGC 100 N/A N/A 2718
951638 61190 61205 TAAGATCGCATCTGGG 93 N/A N/A 2719
951639 61274 61289 AGCTATCTGGGTTAGG 105 N/A N/A 2720
951640 61338 61353 GGAAATAGACGATCTC 68 N/A N/A 2721
951641 61460 61475 CCAATTTGGGCATCAA 102 N/A N/A 2722
951642 61461 61476 GCCAATTTGGGCATCA 102 N/A N/A 2723
951643 61530 61545 GTTATATGTGTGGCAT 35 N/A N/A 2724
951644 61531 61546 TGTTATATGTGTGGCA 40 N/A N/A 2725
951645 61532 61547 GTGTTATATGTGTGGC 9 N/A N/A 2726
951646 61680 61695 GCTAAAATTCCACTCT 96 N/A N/A 2727
951647 61796 61811 CGTAAACATGATTCCT 20 N/A N/A 2728
951648 61841 61856 GTTATTAAGGACAACC 120 N/A N/A 2729
951649 61857 61872 CGTTATTGTCATTTGT 46 N/A N/A 2730
951650 61943 61958 TCGAATGAAGATGGTC 30 N/A N/A 2731
951651 62255 62270 AATGATAAGGACCCCA 63 N/A N/A 2732
951652 62257 62272 GTAATGATAAGGACCC 66 N/A N/A 2733
951653 62258 62273 AGTAATGATAAGGACC 80 N/A N/A 2734
951654 62398 62413 GTTAATTGTGCACTTG 15 N/A N/A 2735
951655 62399 62414 TGTTAATTGTGCACTT 80 N/A N/A 2736
951656 62400 62415 GTGTTAATTGTGCACT 109 N/A N/A 2737
951657 62526 62541 AGTTATAAACCCTGGG 11 N/A N/A 2738
951658 63805 63820 ACAATAATTGGCCAAA 86 N/A N/A 2739
951659 63829 63844 GATCTAATTACCAGCT 128 N/A N/A 2740
951660 63881 63896 TACTTAGGTTACTCCT 49 N/A N/A 2741
951661 64400 64415 GACAATGGGTCAACGC 67 N/A N/A 2742
951662 65042 65057 TGCTCTAAATGACTGC 96 N/A N/A 2743
951663 65090 65105 CCACATCTATCTCAGA 112 N/A N/A 2744
951664 65141 65156 AATATCTCAGCAGTGC 54 N/A N/A 2745
951665 65142 65157 CAATATCTCAGCAGTG 126 N/A N/A 2746
951666 65354 65369 GGCCTAACAGTGTCCA 105 N/A N/A 2747
951667 65601 65616 AGTCATTAGTACGCCA 46 N/A N/A 2748
951668 66403 66418 GTCTTGTGGGATGTGA 66 N/A N/A 2749
951669 66821 66836 TCAATACACACTGTTG 85 N/A N/A 2750
951670 66828 66843 GGATAATTCAATACAC 41 N/A N/A 2751
951671 67824 67839 ATAACATGTTACTCAG 71 N/A N/A 2752
951672 67825 67840 CATAACATGTTACTCA 87 N/A N/A 2753
951673 67827 67842 GTCATAACATGTTACT 76 N/A N/A 2754
951674 67828 67843 TGTCATAACATGTTAC 102 N/A N/A 2755
951675 67840 67855 GGCACTCACAGCTGTC 119 N/A N/A 2756
951676 68164 68179 AGCTGTTGTGCAGTGC 73 N/A N/A 2757
951677 68238 68253 GCTAAATGTGGACTGA 28 N/A N/A 2758
951678 68623 68638 GGCAATGCATACAGTC 44 N/A N/A 2759
951679 68650 68665 GTTATTAACCCCCTGT 44 N/A N/A 2760
951680 69011 69026 TCAATTACTTACAAGA 62 N/A N/A 2761
951681 69030 69045 TGTTTATGCACCATGT 57 N/A N/A 2762
951682 69227 69242 GAATTATGCCTTCTAC 25 N/A N/A 2763
951683 69652 69667 GTCTATGTGGGCTGCC 80 N/A N/A 2764
951684 69735 69750 ATCTATGGCATGGAGC 82 N/A N/A 2765
951685 69737 69752 ACATCTATGGCATGGA 75 N/A N/A 2766
951686 71409 71424 ACAGATAAATCAAGCC 50 N/A N/A 2767
951687 71450 71465 CACTATGCGGCCACCA 93 N/A N/A 2768
951688 71699 71714 GTACATACTGCAGCAG 113 N/A N/A 2769
951689 71700 71715 GGTACATACTGCAGCA 107 N/A N/A 2770
951690 71857 71872 GCGAATGCCATGCTTA 82 N/A N/A 2771
951691 71968 71983 GACATTTAACACACTA 7 N/A N/A 2772
951692 73303 73318 GGCTTAATCCCACACG 97 N/A N/A 2773
951693 73694 73709 GAATTTGGGATTGTGG 21 N/A N/A 2774
951694 73828 73843 TCATGCATGGCACTGT 102 N/A N/A 2775
951695 73956 73971 AGCATAAAAGCACTCT 74 N/A N/A 2776
951696 74038 74053 GCTATGAATTTCCTCC 10 N/A N/A 2777
951697 74039 74054 GGCTATGAATTTCCTC 115 N/A N/A 2778
951698 74365 74380 TGCTATGACCCTCACT 82 N/A N/A 2779
951699 75020 75035 ACAGATAACAGTGGCG 24 N/A N/A 2780
951700 75136 75151 GTAATTCCCGTTCTCT 16 N/A N/A 2781
951701 75145 75160 TCTATTACCGTAATTC 23 N/A N/A 2782
951702 75247 75262 TACATGAACAGTCTGT 50 N/A N/A 2783
951703 75327 75342 AACTTACAAGCATCGG 91 N/A N/A 2784
951704 75329 75344 TGAACTTACAAGCATC 94 N/A N/A 2785
951705 75417 75432 ATCAATTTTAAACACG 31 N/A N/A 2786
951706 75765 75780 ACAAATACATGAGGTC 32 N/A N/A 2787
951707 75894 75909 GTATTATTCCCAGCTA 77 N/A N/A 2788
951708 75895 75910 TGTATTATTCCCAGCT 102 N/A N/A 2789
951709 76435 76450 GAGAATATCACAGGGT 10 N/A N/A 2790
951710 76448 76463 TGTAATCAGTCAAGAG 18 N/A N/A 2791
951711 76550 76565 GACAATTGTGACCGGC 88 N/A N/A 2792
951712 76568 76583 CACAATCAGAGCATTC 34 N/A N/A 2793
951713 76593 76608 TGATTTACAGGCCCAA 37 N/A N/A 2794
951714 76594 76609 GTGATTTACAGGCCCA 50 N/A N/A 2795
951715 76725 76740 ACTAATGACAGACAAC 27 N/A N/A 2796
951716 76728 76743 TAAACTAATGACAGAC 92 N/A N/A 2797
951717 76775 76790 TTGAATTGTGGACCAA 60 N/A N/A 2798
951718 77126 77141 AGGTTAATGCTTCACC 54 N/A N/A 2799
951719 77303 77318 TCAAATGGTGACCACT 112 N/A N/A 2800
951720 77432 77447 CGTTTTAGTTTTCCTA 14 N/A N/A 2801
951721 77538 77553 GTAATAACATGTGTCG 45 N/A N/A 2802
951722 77539 77554 GGTAATAACATGTGTC 27 N/A N/A 2803
951723 77570 77585 TAAACAATTGCTCATC 59 N/A N/A 2804
951724 78076 78091 GGTAATTCTGCAAAGA 29 N/A N/A 2805
951725 78080 78095 TAATGGTAATTCTGCA 43 N/A N/A 2806
951726 78082 78097 ACTAATGGTAATTCTG 50 N/A N/A 2807
951727 78166 78181 TTAGATCTCATTACCT 71 N/A N/A 2808
951728 78206 78221 GTAACAACATCTACCT 88 N/A N/A 2809
951729 78207 78222 GGTAACAACATCTACC 3 N/A N/A 2810
951730 78387 78402 TGATTTACAGGATGCT 15 N/A N/A 2811
951731 78388 78403 TTGATTTACAGGATGC 8 N/A N/A 2812
951732 78539 78554 GCAAATGCTGGCTACG 85 N/A N/A 2813
951733 78546 78561 CCCAATGGCAAATGCT 66 N/A N/A 2814
951734 78848 78863 GGCACTACCTTCACCA 109 N/A N/A 2815
951735 79046 79061 TCATATTGTTCTGCCC 15 N/A N/A 2816
951736 79047 79062 TTCATATTGTTCTGCC 11 N/A N/A 2817
951737 79077 79092 GGCTTTTGTCAGAGGA 8 N/A N/A 2818
951738 79153 79168 TTCAATGACATGCTAG 19 N/A N/A 2819
951739 79209 79224 TATATCAGCTCAGTGC 75 N/A N/A 2820
951740 79211 79226 TATATATCAGCTCAGT 66 N/A N/A 2821
951741 79214 79229 TTGTATATATCAGCTC 37 N/A N/A 2822
951742 79229 79244 TCATACATAAGGATGT 91 N/A N/A 2823
951743 79398 79413 GCTCATTGTAAACAGT 20 N/A N/A 2824
951744 79462 79477 TGCATTTGGTCTTGCT 118 N/A N/A 2825
951745 79799 79814 GACTATCAGTATGCAC 118 N/A N/A 2826
951746 79845 79860 CATCATATTGGTGGGA 11 N/A N/A 2827
951747 80265 80280 GCTATATTCACAAGGC 70 N/A N/A 2828
951748 80266 80281 GGCTATATTCACAAGG 39 N/A N/A 2829
951749 80520 80535 AACGATTAGGGACTCA 4 N/A N/A 2830
951750 80663 80678 CCCTATTTGATCAGGA 117 N/A N/A 2831
951751 80845 80860 GCAACTACCTTTGTTA 17 N/A N/A 2832
951752 80986 81001 AGCAATTTCATTGGCC 105 N/A N/A 2833
951753 81192 81207 AGCAATACCTTACTGG 46 N/A N/A 2834
951754 81436 81451 TGGTATCAGGGTCCCA 130 N/A N/A 2835
951755 81663 81678 CATGATGTCGCTGGCA 41 N/A N/A 2836
951756 81741 81756 TCCAAAAATGGGCTGC 28 N/A N/A 2837
951757 82016 82031 TCTAATCGAAGAAGCT 99 N/A N/A 2838
951758 82262 82277 TCTGATTAGTCCATGC 40 N/A N/A 2839
951759 82535 82550 ACAAATGCGGAGATGA 41 N/A N/A 2840
951761 82653 82668 GCCAATGCAAGGTGGC 119 N/A N/A 2841
951762 82803 82818 TGTTTTGGTGCTGGCT 99 N/A N/A 2842
951763 82880 82895 TGGAATGGTTACTCTC 3 N/A N/A 2843
951764 82920 82935 ATCTTCTGCAGTGTGG 2 N/A N/A 2844
951765 83070 83085 GGTATCTGGGCCATCA 101 N/A N/A 2845
951766 83419 83434 AGCAACATGAACCACA 26 N/A N/A 2846
951767 84425 84440 GTAATCAAGGCAGCAA 7 N/A N/A 2847
951768 85210 85225 AGCTCTGGTTTCAACA 82 N/A N/A 2848
951769 85217 85232 TTAATTAAGCTCTGGT 12 N/A N/A 2849
951770 85218 85233 CTTAATTAAGCTCTGG 22 N/A N/A 2850
951771 85220 85235 GGCTTAATTAAGCTCT 67 N/A N/A 2851
951772 85238 85253 AGTGACATAGCAAGCA 7 N/A N/A 2852
951773 85417 85432 AAGAATCAGACTCTTC 110 N/A N/A 2853
951774 85726 85741 CATTTATAACAGGCCA 82 N/A N/A 2854
951775 85727 85742 CCATTTATAACAGGCC 94 N/A N/A 2855
951776 85844 85859 GGCTTATGAGTCCACT 91 N/A N/A 2856
951777 85973 85988 TGCATTAAAACTGCGA 87 N/A N/A 2857
951778 86550 86565 AACAATCATAGCCTCA 114 N/A N/A 2858
951779 86582 86597 AACTTACTGTCTCCCA 37 N/A N/A 2859
951780 86937 86952 GTTTAATAATGTGCAG 40 N/A N/A 2860
951781 86938 86953 GGTTTAATAATGTGCA 11 N/A N/A 2861
951782 86939 86954 GGGTTTAATAATGTGC 27 N/A N/A 2862
951783 87671 87686 TCGCTAAAGGCTCTGA 10 N/A N/A 2863
951784 87858 87873 TGAAATCAGGGCTCCC 31 N/A N/A 2864
951785 88030 88045 CTCTATCACAGGGCCC 92 N/A N/A 2865
951786 88032 88047 TGCTCTATCACAGGGC 30 N/A N/A 2866
951787 88258 88273 TGTATCTGGTGACTCC 5 N/A N/A 2867
951788 88270 88285 ACCGATAAATGTTGTA 65 N/A N/A 2868
951789 88634 88649 TATAGTAACAGCTGGG 73 N/A N/A 2869
951790 88637 88652 CAGTATAGTAACAGCT 94 N/A N/A 2870
951791 88638 88653 TCAGTATAGTAACAGC 41 N/A N/A 2871
951792 88880 88895 TGTTTAAGGACTCCAC 28 N/A N/A 2872
951793 88887 88902 GACAATTTGTTTAAGG 5 N/A N/A 2873
951794 89152 89167 GATCTAATCAGAAGCA 29 N/A N/A 2874
951795 89558 89573 TGAGATTACGCACCAC 5 N/A N/A 2875
951796 89718 89733 ATTATAGGGCTTCTTA 30 N/A N/A 2876
951797 89720 89735 TTATTATAGGGCTTCT 8 N/A N/A 2877
951798 89721 89736 TTTATTATAGGGCTTC 1 N/A N/A 2878
951799 89722 89737 GTTTATTATAGGGCTT 1 N/A N/A 2879
951800 89746 89761 AGTGATATTCCCAACA 19 N/A N/A 2880
951801 89977 89992 CATATATCTCCTGTTA 20 N/A N/A 2881
951802 89999 90014 TCATATCACCACTTGC 29 N/A N/A 2882
951803 90003 90018 ACAATCATATCACCAC 6 N/A N/A 2883
951804 90004 90019 GACAATCATATCACCA 3 N/A N/A 2884
951805 90058 90073 TTATATGTGGACACCT 34 N/A N/A 2885
951806 90059 90074 TTTATATGTGGACACC 10 N/A N/A 2886
951807 90139 90154 CACAATCCCAGATCTC 7 N/A N/A 2887
951808 90161 90176 TCTATAAGGTTCCTTA 14 N/A N/A 2888
951809 90165 90180 TGTTTCTATAAGGTTC 3 N/A N/A 2889
951810 90199 90214 CCAAATTTAGAGGACA 46 N/A N/A 2890
951811 90222 90237 ACATATCTTGCATGAC 4 N/A N/A 2891
951812 90264 90279 TTAGACATCAGACTGT 76 N/A N/A 2892
951813 90267 90282 GTCTTAGACATCAGAC 115 N/A N/A 2893
951814 90706 90721 TCAATTGAGGCTTCTA 7 N/A N/A 2894
951815 90716 90731 TGTATCTGGTTCAATT 11 N/A N/A 2895
951816 90721 90736 GTAAATGTATCTGGTT 2 N/A N/A 2896
951817 91071 91086 GGTACTGAGGCTGTGG 28 N/A N/A 2897
951818 91117 91132 CAGAATTATCAATTCC 145 N/A N/A 2898
951819 91174 91189 GGTGGGTAAAATGTGC 63 N/A N/A 2899
951820 91191 91206 GCACATAGGGCCTTCT 79 N/A N/A 2900
951821 91909 91924 GACAATGTAGTTTCCA 2 N/A N/A 2901
951822 91939 91954 AACTATCCCAAGCTCC 10 N/A N/A 2902
951823 91945 91960 GGCTTCAACTATCCCA 39 N/A N/A 2903
951824 92037 92052 ATTGATACAGCCGTTC 8 N/A N/A 2904
951825 92827 92842 ATGATAAAGGCTGGCA 21 N/A N/A 2905
951826 92828 92843 AATGATAAAGGCTGGC 127 N/A N/A 2906
951827 93169 93184 AAGATTATGGTTTCCT 4 N/A N/A 2907
951828 93170 93185 GAAGATTATGGTTTCC 6 N/A N/A 2908
951829 93241 93256 GTACATGGTGGAGTCC 83 N/A N/A 2909
951830 93321 93336 TGTATTACCTACGGCA 6 N/A N/A 2910
951831 93392 93407 GCTATTAATCATATTC 18 N/A N/A 2911
951832 93572 93587 TACTTACCAGGATCTC 24 N/A N/A 2912
951833 93746 93761 ACTTATACCCAGGGCA 7 N/A N/A 2913
951834 93747 93762 GACTTATACCCAGGGC 81 N/A N/A 2914
951835 93923 93938 ATGAATTCTGGTCTGG 2 N/A N/A 2915
951836 94043 94058 TCAACTAGCCATGTCT 25 N/A N/A 2916
951837 94169 94184 CACTTAGCCACATCTG 5 N/A N/A 2917
951838 94174 94189 TTAATCACTTAGCCAC 8 N/A N/A 2918
951839 94177 94192 ACCTTAATCACTTAGC 5 N/A N/A 2919
951840 94182 94197 ACAATACCTTAATCAC 7 N/A N/A 2920
951841 94284 94299 CAATTTATCTGGAGGA 8 N/A N/A 2921
951842 94350 94365 TCAATTAGTGTTGCCT 119 N/A N/A 2922
951843 94351 94366 ATCAATTAGTGTTGCC 5 N/A N/A 2923
951844 94423 94438 GTCAATCGACTGGTAC 41 N/A N/A 2924
951845 94446 94461 ATATGATTCATCTCGG 2 N/A N/A 2925
951846 94447 94462 AATATGATTCATCTCG 2 N/A N/A 2926
951847 94583 94598 AGCTATGAGTAGCAGG 18 N/A N/A 2927
951848 94885 94900 GCCAACTAATTCCTCC 31 N/A N/A 2928
951849 96000 96015 GCCATTCACGGGCTGC 104 N/A N/A 2929
951850 96084 96099 CAAGGGTACAGACTTA 152 N/A N/A 2930
951851 96224 96239 GGCTGGATGTGAGTGC 63 N/A N/A 2931
951852 96650 96665 ACAACTAACGGCAGGC 17 N/A N/A 2932
951853 96755 96770 ACACATCAGGGTTTCA 56 N/A N/A 2933
951854 97483 97498 TCCTAATGGTGACTCA 40 N/A N/A 2934
951855 97854 97869 TACAATGTAAGCCTTT 7 N/A N/A 2935
951856 98522 98537 GTATTTCAAAGTAGTC 4 N/A N/A 2936
951857 98652 98667 GGTTTTAATAGACACA 6 N/A N/A 2937
951858 98653 98668 GGGTTTTAATAGACAC 53 N/A N/A 2938
951859 99483 99498 GTTAACAACAATTGTC 60 N/A N/A 2939
951860 99712 99727 ACAGATCTTGCATGTT 84 N/A N/A 2940
951861 99888 99903 AGCTATCACACAGAAG 95 N/A N/A 2941
951862 100033 100048 GCAAATCCATTGCCCA 78 N/A N/A 2942
951863 100171 100186 GTGTTAAGGTGGCAAC 43 N/A N/A 2943
951864 100222 100237 CTACATGGTGATGGGT 20 N/A N/A 2944
951865 100285 100300 GTTAGCTGGACTCACA 89 N/A N/A 2945
951866 100375 100390 CAATATCCTGGTGACT 36 N/A N/A 2946
951867 100514 100529 ACACATGCAGTGAGCC 60 N/A N/A 2947
951868 101384 101399 TGTATGGTGGCTCAGC 26 N/A N/A 2948
951869 101385 101400 TTGTATGGTGGCTCAG 44 N/A N/A 2949
951870 101796 101811 TGCAATGCTGCCAGGC 72 N/A N/A 2950
951871 102161 102176 AGAGATATTGATGTCT 51 N/A N/A 2951
951872 102425 102440 GCACATTGGTTAGGCT 93 N/A N/A 2952
951873 102445 102460 CTCAATGTGTACAGTA 22 N/A N/A 2953
951874 102885 102900 TGGAACTGTTTACAGT 10 N/A N/A 2954
951875 102926 102941 CAAGTAACTGAGTCAC 7 N/A N/A 2955
951876 103421 103436 ATCTATCCAAGGAGGA 93 N/A N/A 2956
951877 103897 103912 TCAGTTCACGGATCCC 42 N/A N/A 2957
951878 104120 104135 TGCTTTCTAAGGTTGG 14 N/A N/A 2958
951879 104441 104456 TTTTATCTGGGCTCCA 39 N/A N/A 2959
951880 104447 104462 TGGAACTTTTATCTGG 17 N/A N/A 2960
951881 104452 104467 GTGAATGGAACTTTTA 5 N/A N/A 2961
951882 104843 104858 TGTATATGAGCCCATC 99 N/A N/A 2962
951883 105539 105554 TCATATCCATGCCCAC 31 N/A N/A 2963
951884 105559 105574 ACAATTGGTGCCTTTC 14 N/A N/A 2964
951885 105560 105575 CACAATTGGTGCCTTT 20 N/A N/A 2965
951886 105730 105745 GGACATCACACTCCTC 100 N/A N/A 2966
951887 105777 105792 CGCAATGGTGACTGCC 114 N/A N/A 2967
951888 105791 105806 TGAAATACCATCCACG 40 N/A N/A 2968
951889 105793 105808 CTTGAAATACCATCCA 19 N/A N/A 2969
951890 106015 106030 GCCTTTACTGACAGCT 71 N/A N/A 2970
951891 106173 106188 ACAAATGGGTCTCGAG 101 N/A N/A 2971
951892 106195 106210 GGTTTTCACGGCCAGC 44 N/A N/A 2972
951893 106203 106218 GCTATGAAGGTTTTCA 10 N/A N/A 2973
951894 106204 106219 AGCTATGAAGGTTTTC 20 N/A N/A 2974
951895 106233 106248 TGTCATATGGCCAGGG 17 N/A N/A 2975
951896 106295 106310 TAATATTGTCACCCTC 93 N/A N/A 2976
951897 106296 106311 ATAATATTGTCACCCT 29 N/A N/A 2977
951898 106351 106366 GTTTTTGCAGCTACTA 9 N/A N/A 2978
951899 106371 106386 ACTATCAACCATCTTA 20 N/A N/A 2979
951900 106391 106406 GGACTTAATTTACACA 12 N/A N/A 2980
951901 106392 106407 TGGACTTAATTTACAC 30 N/A N/A 2981
951902 106404 106419 GATACTAAAGTCTGGA 11 N/A N/A 2982
951903 107100 107115 GCAGATGGTGGTCTAC 69 N/A N/A 2983
951904 109198 109213 GCATTTTAATATTGGG 31 N/A N/A 2984
951905 109409 109424 GGTTTAAGCGATCTCC 46 N/A N/A 2985
951906 109955 109970 CCAATAACTGACCTCA 72 N/A N/A 2986
951907 109956 109971 ACCAATAACTGACCTC 54 N/A N/A 2987
951908 111211 111226 AGTTATTCTGATGCCA 3 N/A N/A 2988
951909 111349 111364 GGGTATGGTTGCAACC 92 N/A N/A 2989
951910 111384 111399 TCATTAGGACACAGCG 20 N/A N/A 2990
951911 111385 111400 ATCATTAGGACACAGC 6 N/A N/A 2991
951912 111494 111509 TACTATCAGTACAGCT 83 N/A N/A 2992
951913 111496 111511 GATACTATCAGTACAG 42 N/A N/A 2993
951914 111499 111514 GGAGATACTATCAGTA 115 N/A N/A 2994
951915 111500 111515 TGGAGATACTATCAGT 27 N/A N/A 2995
951916 112149 112164 GTGAACACTGATCACT 86 N/A N/A 2996
951917 112185 112200 GGTATATGAGGAAACA 18 N/A N/A 2997
951918 112208 112223 CCGTATATGTCTCCGA 8 N/A N/A 2998
951919 112209 112224 ACCGTATATGTCTCCG 7 N/A N/A 2999
951920 112293 112308 GGCAATTGTCTCTCTT 47 N/A N/A 3000
951921 112316 112331 TGTATAAGCTCACTTT 40 N/A N/A 3001
951922 112318 112333 CATGTATAAGCTCACT 105 N/A N/A 3002
951923 112320 112335 AGCATGTATAAGCTCA 36 N/A N/A 3003
951924 112369 112384 ATAATTATGTCCCATC 24 N/A N/A 3004
951925 112370 112385 GATAATTATGTCCCAT 5 N/A N/A 3005
951926 112371 112386 GGATAATTATGTCCCA 61 N/A N/A 3006
951927 112372 112387 TGGATAATTATGTCCC 102 N/A N/A 3007
951928 112373 112388 ATGGATAATTATGTCC 105 N/A N/A 3008
951929 112950 112965 ACTACTAGTTTCTGTT 91 N/A N/A 3009
951930 112951 112966 CACTACTAGTTTCTGT 37 N/A N/A 3010
951931 113712 113727 GGTTATGAGATTCTTA 4 N/A N/A 3011
951932 113713 113728 TGGTTATGAGATTCTT 5 N/A N/A 3012
951933 114474 114489 TTTATTCACAGGGTCC 29 N/A N/A 3013
951934 114476 114491 TATTTATTCACAGGGT 28 N/A N/A 3014
951935 114477 114492 GTATTTATTCACAGGG 18 N/A N/A 3015
951936 114510 114525 GCCAATGGAAGGCACC 129 N/A N/A 3016
951937 114524 114539 TCCATTTGGGCTGTGC 86 N/A N/A 3017
951938 114750 114765 TGCGATATCCTCCCCT 15 N/A N/A 3018
951939 115717 115732 GAGAATAAAGCCTGGC 80 N/A N/A 3019
908415 83669 83684 GATTGAGGTAAGGGTT 20 N/A N/A 3020
83757 83772 N/A N/A
83845 83860 N/A N/A
908426 83689 83704 ACGGAACCGCTCTGTA 88 N/A N/A 509
83777 83792 N/A N/A
83865 83880 N/A N/A
908428 83691 83706 TGACGGAACCGCTCTG 73 N/A N/A 511
83779 83794 N/A N/A
83867 83882 N/A N/A
908507 103213 103228 AGCAGAGCATAGGAGA 20 N/A N/A 590
103251 103266 N/A N/A
949039 7946 7961 AAGTGCTATTATAACT 100 N/A N/A 3021
8587 8602 N/A N/A
949040 7947 7962 GAAGTGCTATTATAAC 8 N/A N/A 3022
8588 8603 N/A N/A
949041 7948 7963 AGAAGTGCTATTATAA 6 N/A N/A 3023
8589 8604 N/A N/A
949042 7949 7964 AAGAAGTGCTATTATA 15 N/A N/A 3024
8590 8605 N/A N/A
949043 7950 7965 AAAGAAGTGCTATTAT 37 N/A N/A 3025
8591 8606 N/A N/A
949044 7951 7966 GAAAGAAGTGCTATTA 19 N/A N/A 3026
8592 8607 N/A N/A
949045 7952 7967 GGAAAGAAGTGCTATT 20 N/A N/A 3027
8593 8608 N/A N/A
949046 7953 7968 GGGAAAGAAGTGCTAT 36 N/A N/A 3028
8594 8609 N/A N/A
949047 7954 7969 AGGGAAAGAAGTGCTA 64 N/A N/A 3029
8595 8610 N/A N/A
949048 7955 7970 AAGGGAAAGAAGTGCT 22 N/A N/A 3030
8596 8611 N/A N/A
949049 7956 7971 AAAGGGAAAGAAGTGC 21 N/A N/A 3031
8597 8612 N/A N/A
949060 9158 9173 TAAAATGTACCCCCTC 42 N/A N/A 3032
9478 9493 N/A N/A
949133 16330 16345 GAAAAGAACAACCTGG 21 N/A N/A 3033
16655 16670 N/A N/A
949913 83642 83657 TGCAGCTGTCAGCATG 61 N/A N/A 3034
83730 83745 N/A N/A
83818 83833 N/A N/A
949914 83643 83658 ATGCAGCTGTCAGCAT 113 N/A N/A 3035
83731 83746 N/A N/A
83819 83834 N/A N/A
949915 83644 83659 TATGCAGCTGTCAGCA 59 N/A N/A 3036
83732 83747 N/A N/A
83820 83835 N/A N/A
949916 83645 83660 ATATGCAGCTGTCAGC 16 N/A N/A 3037
83733 83748 N/A N/A
83821 83836 N/A N/A
949917 83648 83663 GCCATATGCAGCTGTC 13 N/A N/A 3038
83736 83751 N/A N/A
83824 83839 N/A N/A
949918 83652 83667 CTTTGCCATATGCAGC 8 N/A N/A 3039
83740 83755 N/A N/A
83828 83843 N/A N/A
949919 83653 83668 ACTTTGCCATATGCAG 15 N/A N/A 3040
83741 83756 N/A N/A
83829 83844 N/A N/A
949920 83654 83669 TACTTTGCCATATGCA 4 N/A N/A 3041
83742 83757 N/A N/A
83830 83845 N/A N/A
949921 83655 83670 TTACTTTGCCATATGC 1 N/A N/A 3042
83743 83758 N/A N/A
83831 83846 N/A N/A
949922 83656 83671 GTTACTTTGCCATATG 4 N/A N/A 3043
83744 83759 N/A N/A
83832 83847 N/A N/A
949923 83657 83672 GGTTACTTTGCCATAT 8 N/A N/A 3044
83745 83760 N/A N/A
83833 83848 N/A N/A
949924 83668 83683 ATTGAGGTAAGGGTTA 4 N/A N/A 3045
83756 83771 N/A N/A
83844 83859 N/A N/A
949925 83675 83690 TATCTTGATTGAGGTA 6 N/A N/A 3046
83763 83778 N/A N/A
83851 83866 N/A N/A
949926 83676 83691 GTATCTTGATTGAGGT 2 N/A N/A 3047
83764 83779 N/A N/A
83852 83867 N/A N/A
949927 83677 83692 TGTATCTTGATTGAGG 1 N/A N/A 3048
83765 83780 N/A N/A
83853 83868 N/A N/A
949928 83678 83693 CTGTATCTTGATTGAG 4 N/A N/A 3049
83766 83781 N/A N/A
83854 83869 N/A N/A
949929 83682 83697 CGCTCTGTATCTTGAT 2 N/A N/A 3050
83770 83785 N/A N/A
83858 83873 N/A N/A
949930 83683 83698 CCGCTCTGTATCTTGA 9 N/A N/A 3051
83771 83786 N/A N/A
83859 83874 N/A N/A
949931 83700 83715 TTTAGGAGGTGACGGA 6 N/A N/A 3052
83788 83803 N/A N/A
83876 83891 N/A N/A
949932 83701 83716 TTTTAGGAGGTGACGG 7 N/A N/A 3053
83789 83804 N/A N/A
83877 83892 N/A N/A
949933 83702 83717 ATTTTAGGAGGTGACG 17 N/A N/A 3054
83878 83893 N/A N/A
949934 83703 83718 GATTTTAGGAGGTGAC 15 N/A N/A 3055
83879 83894 N/A N/A
949935 83704 83719 GGATTTTAGGAGGTGA 6 N/A N/A 3056
83880 83895 N/A N/A
949936 83705 83720 GGGATTTTAGGAGGTG 15 N/A N/A 3057
83881 83896 N/A N/A
949937 83706 83721 AGGGATTTTAGGAGGT 8 N/A N/A 3058
83882 83897 N/A N/A
949938 83707 83722 CAGGGATTTTAGGAGG 12 N/A N/A 3059
83883 83898 N/A N/A
949939 83708 83723 ACAGGGATTTTAGGAG 18 N/A N/A 3060
83884 83899 N/A N/A
949940 83728 83743 CAGCTGTCAGCATGAT 63 N/A N/A 3061
83816 83831 N/A N/A
949941 83729 83744 GCAGCTGTCAGCATGA 67 N/A N/A 3062
83817 83832 N/A N/A
950194 103191 103206 CGGTGGCCATGGAGGG 67 N/A N/A 3063
103229 103244 N/A N/A
103267 103282 N/A N/A
950195 103192 103207 CCGGTGGCCATGGAGG 98 N/A N/A 3064
103230 103245 N/A N/A
103268 103283 N/A N/A
950196 103193 103208 CCCGGTGGCCATGGAG 91 N/A N/A 3065
103231 103246 N/A N/A
103269 103284 N/A N/A
950197 103194 103209 GCCCGGTGGCCATGGA 122 N/A N/A 3066
103232 103247 N/A N/A
103270 103285 N/A N/A
950198 103195 103210 GGCCCGGTGGCCATGG 106 N/A N/A 3067
103233 103248 N/A N/A
103271 103286 N/A N/A
950199 103196 103211 GGGCCCGGTGGCCATG 125 N/A N/A 3068
103234 103249 N/A N/A
103272 103287 N/A N/A
950200 103210 103225 AGAGCATAGGAGAGGG 20 N/A N/A 3069
103248 103263 N/A N/A
950201 103212 103227 GCAGAGCATAGGAGAG 21 N/A N/A 3070
103250 103265 N/A N/A
950202 103214 103229 GAGCAGAGCATAGGAG 23 N/A N/A 3071
103252 103267 N/A N/A
950203 103215 103230 GGAGCAGAGCATAGGA 22 N/A N/A 3072
103253 103268 N/A N/A
950204 103217 103232 AGGGAGCAGAGCATAG 53 N/A N/A 3073
103255 103270 N/A N/A
950205 103219 103234 GGAGGGAGCAGAGCAT 50 N/A N/A 3074
103257 103272 N/A N/A
950206 103221 103236 ATGGAGGGAGCAGAGC 53 N/A N/A 3075
103259 103274 N/A N/A
950297 113289 113304 ATCCTGTTATATCTTT 3 N/A N/A 3076
113606 113621 N/A N/A
950298 113290 113305 AATCCTGTTATATCTT 2 N/A N/A 3077
113607 113622 N/A N/A

Each modified oligonucleotide listed in the table below is 100% complementary to human DNM2 nucleic acid sequence GENBANK Number NM_001005361.2. (SEQ ID No: 3). As shown below, modified oligonucleotides complementary to human DNM2 inhibited human DNM2 mRNA expression.

TABLE 4
DNM2 mRNA Expression
SEQ SEQ
ID: 3 ID: 3 Sequence Dynamin2 SEQ
Compound Start Stop (% ID
Number Site Site Control) NO
948482 1735 1750 CACCAGGATCTCCCCC 30 3078
948483 1738 1753 GATCACCAGGATCTCC 101 3079
948509 1511 1526 GCTTCTCGGCACACTT 27 3080
948510 1512 1527 AGCTTCTCGGCACACT 48 3081
948511 1514 1529 TGAGCTTCTCGGCACA 111 3082
948512 1520 1535 AGGAACTGAGCTTCTC 39 3083
948513 1521 1536 TAGGAACTGAGCTTCT 37 3084

Example 3: Effect of Modified Oligonucleotides Complementary to Dynamin 2 In Vitro

Modified oligonucleotides complementary to dynamin 2 (DNM2) nucleic acid were designed and tested for their effect on dynamin 2 mRNA in vitro. The modified oligonucleotides were tested in a series of experiments that had similar culture conditions.

A431 cells cultured at a density of 10,000 cells per well were treated with only 500 nM of modified oligonucleotide via free uptake or no modified oligonucleotide for untreated controls. After approximately 24 hours, RNA was isolated from the cells and DNM2 mRNA levels were measured by quantitative real-time PCR as described in Example 1.

The modified oligonucleotides described in the tables below each have a 3-10-3 cEt gapmer motif, wherein the central gap segment contains ten 2′-deoxynucleosides and is flanked by wing segments on the 3′ and 5′ ends, each containing three cEt nucleosides. Each modified oligonucleotide listed in the tables below is 100% complementary to human DNM2 nucleic acid sequence GENBANK Number NC_000019.10, truncated from 10715001 to 1083500 (SEQ ID NO:1) and/or GENBANK Number NM_004945.3 (SEQ ID NO: 2). As shown below, modified oligonucleotides complementary to human DNM2 inhibited human DNM2 mRNA expression.

TABLE 5
DNM2 mRNA Expression
SEQ SEQ
SEQ ID: SEQ ID: ID: 2 ID 2: SEQ
Compound 1 Start 1 Stop DNM2 Start Stop ID
Number Site Site Sequence (% Control) Site Site NO
694824 57496 57511 TTTTGGACTTGCAGTG 25 443 458 3085
695171 82451 82466 ACACACTTCAAACTCG 30 N/A N/A 13
695171 82451 82466 ACACACTTCAAACTCG 26 N/A N/A 13
695171 82451 82466 ACACACTTCAAACTCG 28 N/A N/A 13
695171 82451 82466 ACACACTTCAAACTCG 31 N/A N/A 13
695171 82451 82466 ACACACTTCAAACTCG 27 N/A N/A 13
695171 82451 82466 ACACACTTCAAACTCG 42 N/A N/A 13
695171 82451 82466 ACACACTTCAAACTCG 37 N/A N/A 13
695171 82451 82466 ACACACTTCAAACTCG 29 N/A N/A 13
951371 11922 11937 GTTGATAGTCGGTTGT 9 N/A N/A 2452
951371 11922 11937 GTTGATAGTCGGTTGT 8 N/A N/A 2452
951371 11922 11937 GTTGATAGTCGGTTGT 7 N/A N/A 2452
951371 11922 11937 GTTGATAGTCGGTTGT 7 N/A N/A 2452
951371 11922 11937 GTTGATAGTCGGTTGT 7 N/A N/A 2452
951371 11922 11937 GTTGATAGTCGGTTGT 10 N/A N/A 2452
951371 11922 11937 GTTGATAGTCGGTTGT 19 N/A N/A 2452
951371 11922 11937 GTTGATAGTCGGTTGT 9 N/A N/A 2452
988378 82447 82462 ACTTCAAACTCGGCTC 24 N/A N/A 3086
988379 81166 81181 AACTGTATTGATTAGC 20 1492 1507 3087
988380 116569 116584 GTGTGGTTAATATGGC 2 3313 3328 3088
988381 116853 116868 ATAGAATACAGAGTGC 19 3597 3612 3089
988382 11917 11932 TAGTCGGTTGTCTGGA 21 N/A N/A 3090
988383 11919 11934 GATAGTCGGTTGTCTG 37 N/A N/A 3091
988384 11920 11935 TGATAGTCGGTTGTCT 67 N/A N/A 3092
988385 11921 11936 TTGATAGTCGGTTGTC 26 N/A N/A 3093
988386 11923 11938 AGTTGATAGTCGGTTG 3 N/A N/A 3094
988387 11924 11939 GAGTTGATAGTCGGTT 5 N/A N/A 3095
988388 11925 11940 CGAGTTGATAGTCGGT 9 N/A N/A 3096
988389 11927 11942 AGCGAGTTGATAGTCG 42 N/A N/A 3097
988390 24283 24298 GTATTATGGTATGTGA 14 N/A N/A 3098
988391 24286 24301 TAGGTATTATGGTATG 20 N/A N/A 3099
988392 24287 24302 TTAGGTATTATGGTAT 31 N/A N/A 3100
988393 24288 24303 ATTAGGTATTATGGTA 29 N/A N/A 3101
988394 24290 24305 GGATTAGGTATTATGG 6 N/A N/A 3102
988395 82040 82055 TTGGACTGTTTTCCCC 39 N/A N/A 3103
988396 82042 82057 GTTTGGACTGTTTTCC 7 N/A N/A 3104
988397 82824 82839 GATGTGTTTCCTGTGT 2 N/A N/A 3105
988398 82825 82840 TGATGTGTTTCCTGTG 3 N/A N/A 3106
988399 82826 82841 ATGATGTGTTTCCTGT 5 N/A N/A 3107
988400 82828 82843 AGATGATGTGTTTCCT 4 N/A N/A 3108
988401 82829 82844 CAGATGATGTGTTTCC 4 N/A N/A 3109
988402 82830 82845 ACAGATGATGTGTTTC 7 N/A N/A 3110
988403 82832 82847 ATACAGATGATGTGTT 99 N/A N/A 3111
988404 83917 83932 TTTTTGAGAGGTTGAC 19 N/A N/A 3112
988405 89716 89731 TATAGGGCTTCTTATC 61 N/A N/A 3113
988406 89717 89732 TTATAGGGCTTCTTAT 64 N/A N/A 3114
988407 89723 89738 AGTTTATTATAGGGCT 8 N/A N/A 3115
988408 89724 89739 AAGTTTATTATAGGGC 13 N/A N/A 3116
988409 89725 89740 TAAGTTTATTATAGGG 25 N/A N/A 3117
988410 89726 89741 GTAAGTTTATTATAGG 24 N/A N/A 3118
988411 89727 89742 AGTAAGTTTATTATAG 96 N/A N/A 3119
988412 90717 90732 ATGTATCTGGTTCAAT 34 N/A N/A 3120
988413 90718 90733 AATGTATCTGGTTCAA 11 N/A N/A 3121
988414 90719 90734 AAATGTATCTGGTTCA 8 N/A N/A 3122
988415 90720 90735 TAAATGTATCTGGTTC 11 N/A N/A 3123
988416 90723 90738 AAGTAAATGTATCTGG 15 N/A N/A 3124
988417 90724 90739 CAAGTAAATGTATCTG 51 N/A N/A 3125
988418 90725 90740 ACAAGTAAATGTATCT 45 N/A N/A 3126
988419 90726 90741 AACAAGTAAATGTATC 109 N/A N/A 3127
988420 93918 93933 TTCTGGTCTGGCTTAA 16 N/A N/A 3128
988421 93920 93935 AATTCTGGTCTGGCTT 45 N/A N/A 3129
988422 93922 93937 TGAATTCTGGTCTGGC 7 N/A N/A 3130
988423 93924 93939 AATGAATTCTGGTCTG 30 N/A N/A 3131
988424 93925 93940 GAATGAATTCTGGTCT 80 N/A N/A 3132
988425 93926 93941 AGAATGAATTCTGGTC 20 N/A N/A 3133
988426 93928 93943 CAAGAATGAATTCTGG 74 N/A N/A 3134

Example 4: Dose Response of Modified Oligonucleotides Complementary to Dynamin 2 In Vitro

Selected oligonucleotides listed in the Examples above were tested at various doses via free uptake in A431 cells. Cells were cultured at a density of 10,000 cells per well and treated with 62.5, 250, 1,000, or 4,000 nM of modified oligonucleotide, as specified in the table below. After a treatment period of approximately 48 hours, total RNA was isolated and analyzed by RT-PCR with primer probe set RTS36027 (described in Example 1), normalized with ribogreen. As illustrated in the tables below, DNM2 mRNA expression was inhibited in a dose-dependent manner by modified oligonucleotides complementary to DNM2.

TABLE 6
DNM2 mRNA Expression
Compound DNM2 expression (% control)
Number 62.5 nM 250 nM 1,000 nM 4,000 nM IC50 (μM)
694838 31 12 5 3 <0.1
695171 74 28 11 4 0.1
695171 83 33 11 5 0.2
695171 57 25 7 3 0.1
695171 59 24 9 4 0.1
695171 51 17 9 4 <0.1
695171 57 28 10 4 0.1
907945 38 10 5 3 <0.1
907946 70 36 17 11 0.2
907947 48 28 9 6 <0.1
907948 51 22 9 5 <0.1
907949 77 43 16 6 0.2
907966 53 30 15 8 <0.1
907967 32 10 6 4 <0.1
907968 65 30 14 8 0.1
907969 19 6 3 2 <0.1
907970 20 5 3 2 <0.1
907971 59 30 17 12 0.1
907972 72 36 18 17 0.2
907975 35 15 7 4 <0.1
907979 55 26 14 10 <0.1
907983 39 16 9 8 <0.1
907998 40 13 6 4 <0.1
908000 71 42 19 11 0.2
908011 53 24 13 9 <0.1
908013 52 25 13 7 <0.1
908025 69 31 13 6 0.1
908027 38 13 5 2 <0.1
908028 80 51 22 9 0.3
908029 83 43 19 9 0.3
908031 44 13 4 2 <0.1
908033 52 18 8 5 <0.1
908034 63 29 13 8 0.1
908035 26 6 2 1 <0.1
908036 71 39 20 11 0.2
908037 26 9 3 1 <0.1
908041 49 19 6 3 <0.1
908043 28 15 10 8 <0.1
908044 43 17 7 3 <0.1
908047 54 28 15 9 <0.1
908049 49 15 6 3 <0.1
908052 53 21 7 4 <0.1
908055 69 36 19 12 0.2
908056 54 23 9 6 <0.1
908059 35 11 3 2 <0.1
908061 27 7 2 1 <0.1
908068 72 41 21 10 0.2
908070 64 35 15 9 0.1
908085 68 33 18 11 0.1
908098 61 28 12 10 0.1
908102 42 28 17 11 <0.1
908104 44 23 12 8 <0.1
908107 51 25 11 7 <0.1
908135 46 23 14 14 <0.1
908138 50 24 11 6 <0.1
908146 58 33 19 15 0.1
908147 37 18 10 6 <0.1
908148 42 15 7 5 <0.1
908154 28 9 3 2 <0.1
908164 65 31 16 10 0.1
908166 44 18 9 5 <0.1
908167 62 28 16 12 0.1
908177 69 37 15 7 0.2
908178 52 22 6 4 <0.1
908179 47 18 7 4 <0.1
908183 58 34 15 11 0.1
908184 56 24 11 8 <0.1
908201 26 13 5 4 <0.1
908213 37 13 5 3 <0.1
908214 57 37 17 12 0.1
908215 63 30 12 6 0.1
908217 32 10 3 2 <0.1
908232 58 26 6 3 0.1
908255 64 28 13 9 0.1
908267 48 28 12 8 <0.1
908355 83 62 42 26 0.6
908389 43 16 5 3 <0.1
908392 12 3 1 1 <0.1
908396 57 19 6 3 <0.1
908401 26 6 2 1 <0.1
908404 58 29 15 8 0.1
908405 49 26 9 4 <0.1
908407 70 30 12 5 0.1
908408 18 2 1 1 <0.1
908409 67 33 13 5 0.1
908410 71 36 15 7 0.2
908412 58 24 10 6 0.1
908413 33 8 2 1 <0.1
908414 25 6 3 2 <0.1
908415 40 11 4 3 <0.1
908416 42 13 4 1 <0.1
908417 26 5 2 1 <0.1
908418 63 33 11 4 0.1
908419 50 11 4 2 <0.1
908420 17 3 1 1 <0.1
908421 23 4 1 1 <0.1
908422 51 16 5 3 <0.1
908424 57 22 9 7 <0.1
908425 57 38 20 12 0.1
908434 54 20 8 3 <0.1
908436 71 40 17 8 0.2
908439 38 9 2 2 <0.1
908440 25 6 3 3 <0.1
908441 33 6 2 1 <0.1
908442 32 9 3 1 <0.1
908443 56 17 5 2 <0.1
908444 31 7 2 1 <0.1
908448 78 44 13 8 0.2
908449 47 20 7 4 <0.1
908451 45 14 6 5 <0.1
908475 66 29 12 5 0.1
908506 34 9 4 3 <0.1
908507 67 39 16 10 0.1
908508 52 30 14 10 <0.1

Example 5: Dose Response of Modified Oligonucleotides Complementary to Dynamin 2 In Vitro

Selected oligonucleotides listed in the Examples above were tested via free uptake at various doses in A431 cells. Cells were cultured at a density of 10,000 cells per well and treated with 31.25, 125, 500, or 2,000 nM of modified oligonucleotide, as specified in the tables below. After approximately 48 hours, total RNA was isolated and analyzed by RT-PCR with primer probe set RTS36027 (described in Example 1), normalized with ribogreen. As illustrated in the tables below, DNM2 mRNA expression was inhibited in a dose-dependent manner by modified oligonucleotides complementary to DNM2.

TABLE 7
DNM2 mRNA Expression
Compound DNM2 expression (% control)
Number 31.25 nM 125 nM 500 nM 2,000 nM IC50 (μM)
695015 105 94 89 94 >2.0
695170 62 30 13 5 0.05
695171 72 33 11 4 0.07
695171 70 33 10 3 0.1
695171 70 35 14 6 0.1
695171 58 22 9 2 <0.03
695171 71 36 12 4 0.08
695171 70 32 11 4 0.07
695171 74 36 12 4 0.08
695171 71 31 10 3 0.07
695171 73 36 14 4 0.08
695171 73 36 17 7 0.09
695171 54 27 10 3 <0.03
695171 69 33 10 5 0.06
695171 74 35 12 4 0.08
695171 81 40 14 4 0.11
695171 79 40 14 5 0.11
695171 77 38 14 5 0.10
695171 72 37 13 5 0.08
695171 71 34 11 4 0.07
695171 66 43 11 5 0.08
695171 68 33 11 4 0.06
695171 63 29 12 5 0.05
948488 79 33 12 4 0.09
948489 53 17 5 1 <0.03
948490 25 5 1 0 <0.03
948492 67 32 9 4 0.06
948496 72 43 15 6 0.09
948505 67 36 12 5 0.07
948506 58 16 5 2 <0.03
948507 80 30 9 3 0.1
948508 63 26 7 3 0.0
948521 79 35 19 13 0.11
948524 70 43 19 9 0.09
948525 75 47 19 7 0.12
948526 73 35 12 7 0.08
948527 62 31 14 9 0.05
948528 64 29 11 20 0.04
948538 104 95 96 91 >2.0
948549 71 38 16 11 0.08
948556 36 11 4 3 <0.03
948557 23 8 4 3 <0.03
948558 68 29 14 10 0.06
948559 48 16 7 5 <0.03
948560 24 7 3 2 <0.03
948562 69 26 10 5 0.06
948568 57 26 11 7 <0.03
948575 73 39 20 10 0.1
948587 43 14 7 4 <0.03
948589 66 21 11 9 0.04
948590 53 35 16 10 0.03
948602 39 15 7 5 <0.03
948604 42 17 7 4 <0.03
948608 54 18 6 4 <0.03
948622 79 47 22 10 0.13
948629 51 13 6 2 <0.03
948630 67 33 13 5 0.06
948631 46 14 5 3 <0.03
948632 42 12 5 2 <0.03
948633 57 21 8 6 <0.03
948646 63 58 23 10 0.11
948654 68 40 13 4 0.08
948656 69 40 22 13 0.09
948660 47 11 2 1 <0.03
948661 80 41 14 4 0.11
948662 63 38 16 8 0.06
948664 45 12 2 1 <0.03
948665 64 25 7 3 0.04
948666 82 37 12 4 0.11
948673 33 9 3 2 <0.03
948674 75 39 12 5 0.1
948675 43 8 2 0 <0.03
948676 40 10 2 0 <0.03
948677 53 11 2 1 <0.03
948678 69 27 9 4 0.06
948684 61 29 11 4 0.04
948685 52 15 5 2 <0.03
948686 24 8 2 1 <0.03
948687 58 19 5 2 <0.03
948689 73 26 17 8 0.07
948692 49 20 8 6 <0.03
948693 71 40 18 10 0.09
948695 75 38 20 7 0.1
948700 63 25 7 3 0.04
948701 64 24 9 4 0.04
948702 60 25 6 1 0.04
948703 66 29 7 2 0.05
948707 69 24 7 3 0.05
948729 47 12 2 1 <0.03
948731 67 33 11 4 0.06
948732 68 40 14 7 0.08
948735 22 9 2 2 <0.03
948741 49 55 24 15 0.06
948752 64 31 12 5 0.05
948765 61 20 7 3 0.03
948766 78 43 18 7 0.11
948767 76 40 19 12 0.1
948768 67 35 17 12 0.1
948769 60 24 10 5 0.0
948788 57 27 13 10 0.03
948794 51 26 5 2 <0.03
948804 42 18 8 5 <0.03
948805 34 13 5 3 <0.03
948806 16 18 7 5 <0.03
948807 56 35 18 11 0.04
948812 77 40 20 11 0.11
948835 66 28 7 3 0.05
948836 52 27 11 6 <0.03
948847 68 32 12 7 0.06
948849 43 13 6 5 <0.03
948850 43 15 7 5 <0.03
948851 45 16 5 3 <0.03
948852 51 16 4 2 <0.03
948853 84 32 9 5 0.10
948854 58 21 7 3 <0.03
948855 56 30 12 6 0.03
948856 70 38 14 8 0.08
948862 55 26 10 4 <0.03
948863 43 8 2 2 <0.03
948865 57 24 10 6 <0.03
948880 84 46 26 14 0.16
948882 66 36 19 8 0.07
948883 81 62 29 16 0.21
948884 59 25 9 4 0.03
948885 53 18 6 4 <0.03
948891 96 52 24 12 0.20
948892 54 24 7 4 <0.03
948893 93 84 59 44 1.24
948906 81 46 19 9 0.13
948907 65 25 8 4 0.05
948910 62 22 8 4 0.0
948911 48 16 10 4 <0.03
948917 81 57 30 19 0.20
948918 69 36 14 6 0.07
948922 64 32 12 6 0.05
948923 30 8 4 3 <0.03
948924 32 11 3 2 <0.03
948925 58 27 9 6 0.03
948926 109 94 105 111 >2.0
948935 38 17 6 3 <0.03
948936 47 12 4 2 <0.03
948937 48 21 7 3 <0.03
948938 49 19 8 5 <0.03
948950 54 27 8 3 <0.03
948951 32 13 5 3 <0.03
948952 46 13 4 2 <0.03
948953 69 41 14 7 0.08
948954 43 15 8 4 <0.03
948960 41 14 8 7 <0.03
948961 48 17 6 3 <0.03
948963 51 23 8 4 <0.03
948965 96 77 53 28 0.57
948966 63 32 11 4 0.05
948967 71 38 13 6 0.08
948968 60 29 9 3 0.04
948969 47 18 6 4 <0.03
948970 31 9 3 2 <0.03
948971 34 9 2 2 <0.03
948972 72 32 9 3 0.07
949006 79 53 19 8 0.1
949007 84 37 9 6 0.1
949012 81 38 17 10 0.11
949040 80 36 11 4 0.10
949041 101 50 14 5 0.18
949051 74 45 16 8 0.10
949053 89 54 18 5 0.2
949055 68 24 8 4 0.0
949059 73 40 15 5 0.09
949061 109 99 83 73 >2.0
949077 82 47 15 5 0.1
949080 48 20 7 5 <0.03
949088 73 24 8 3 0.06
949092 66 24 13 14 0.05
949094 79 48 17 6 0.13
949095 90 66 19 6 0.20
949109 95 55 26 13 0.22
949139 72 47 24 11 0.12
949158 54 20 10 8 <0.03
949159 75 40 15 25 0.10
949163 52 15 4 2 <0.03
949164 42 30 15 10 <0.03
949167 78 39 17 21 0.11
949168 67 36 19 12 0.07
949182 65 27 8 4 0.05
949190 57 15 3 2 <0.03
949216 74 42 14 5 0.10
949223 87 28 16 6 0.1
949229 125 101 92 78 >2.0
949279 85 41 15 5 0.12
949325 98 112 86 75 >2.0
949397 94 96 100 106 >2.0
949483 71 43 21 11 0.10
949500 78 56 24 10 0.16
949517 103 98 97 80 >2.0
949589 111 89 57 42 1.06
949685 101 82 58 40 0.99
949778 90 55 20 9 0.18
949805 106 88 66 48 1.73
949814 59 51 22 8 0.08
949841 87 46 11 4 0.13
949846 48 30 11 7 <0.03
949848 57 18 4 2 <0.03
949858 66 23 10 6 0.04
949865 61 11 3 1 <0.03
949871 70 26 7 3 0.1
949872 47 13 3 1 <0.03
949873 45 10 2 1 <0.03
949874 14 3 1 0 <0.03
949875 54 23 5 2 <0.03
949876 79 32 10 5 0.09
949880 52 20 6 3 <0.03
949884 87 41 16 7 0.13
949886 62 22 6 3 0.04
949887 87 64 21 8 0.19
949892 83 49 22 13 0.2
949896 13 1 1 0 <0.03
949897 67 32 15 7 0.06
949899 80 49 20 6 0.14
949917 80 48 22 10 0.1
949918 84 46 15 4 0.1
949920 59 20 3 2 <0.03
949921 67 19 2 1 0.04
949922 56 21 6 2 <0.03
949923 70 34 15 7 0.07
949924 112 106 5 2 0.31
949925 59 27 6 2 0.04
949926 44 7 1 1 <0.03
949927 37 4 1 1 <0.03
949928 68 20 4 2 0.04
949929 66 18 3 1 0.04
949930 61 30 10 4 0.04
949931 68 27 6 2 0.05
949932 72 31 6 2 0.07
949934 66 42 22 12 0.08
949935 52 20 8 6 <0.03
949937 69 27 7 5 0.06
949938 66 35 14 5 0.06
949942 69 30 8 3 0.06
949943 52 21 6 2 <0.03
949944 60 20 4 3 0.03
949945 54 16 5 3 <0.03
949948 34 5 1 1 <0.03
949949 46 10 2 1 <0.03
949950 46 12 3 2 <0.03
949962 70 34 16 9 0.1
949963 71 43 15 6 0.1
949978 65 35 9 2 0.06
949979 72 35 11 5 0.08
949983 89 66 25 12 0.23
949990 61 23 5 2 0.04
949991 55 21 5 1 <0.03
949992 56 29 11 6 0.03
950014 60 28 8 3 0.04
950017 68 38 11 5 0.07
950019 52 20 8 5 <0.03
950020 84 43 13 5 0.12
950021 80 46 15 6 0.12
950023 57 17 5 2 <0.03
950024 51 17 7 5 <0.03
950030 37 7 1 0 <0.03
950048 57 40 16 6 0.05
950057 65 38 21 9 0.07
950060 26 16 3 2 <0.03
950061 55 34 10 5 0.04
950064 74 32 11 4 0.08
950065 72 30 8 2 0.07
950069 68 31 8 4 0.06
950072 49 20 6 3 <0.03
950075 87 38 13 5 0.12
950080 69 40 15 7 0.08
950081 60 28 8 4 0.04
950083 65 29 12 4 0.1
950085 53 14 6 4 <0.03
950086 76 43 15 4 0.10
950089 46 10 2 1 <0.03
950091 45 12 2 1 <0.03
950092 80 42 14 8 0.11
950102 81 37 9 3 0.10
950124 69 31 14 8 0.06
950132 55 14 4 1 <0.03
950139 87 59 24 9 0.19
950183 44 23 5 2 <0.03
950219 84 37 18 11 0.12
950237 83 48 17 8 0.14
950246 76 33 15 7 0.09
951328 76 37 12 4 0.09
951330 76 40 13 5 0.10
951333 89 45 22 9 0.16
951340 74 42 15 6 0.10
951341 92 58 21 4 0.19
951346 49 22 4 3 <0.03
951352 67 19 7 3 0.04
951354 67 36 12 6 0.07
951356 57 23 6 2 <0.03
951357 62 35 10 4 0.05
951358 76 36 12 5 0.09
951362 53 15 3 1 <0.03
951364 58 18 4 2 <0.03
951365 78 47 16 6 0.12
951366 61 34 12 6 0.05
951367 69 28 8 4 0.06
951370 74 41 16 7 0.10
951371 30 7 2 2 <0.03
951372 61 21 6 4 0.03
951374 62 17 4 2 0.03
951376 67 47 15 5 0.09
951381 63 28 11 6 0.05
951384 63 27 6 2 0.05
951386 66 22 6 3 0.04
951387 68 20 3 1 0.04
951397 69 35 8 4 0.07
951406 73 52 19 9 0.12
951407 56 21 6 3 <0.03
951408 47 15 3 1 <0.03
951413 68 46 20 9 0.09
951416 63 42 17 7 0.07
951418 60 22 6 3 0.03
951428 28 4 1 1 <0.03
951429 32 6 2 2 <0.03
951430 59 25 6 2 0.03
951431 46 32 9 5 <0.03
951441 100 82 67 42 1.33
951450 71 36 12 6 0.08
951458 63 32 15 10 0.05
951459 77 44 17 9 0.11
951462 74 28 6 2 0.07
951463 74 35 15 6 0.09
951481 91 47 26 13 0.18
951489 59 17 8 3 <0.03
951494 64 32 10 5 0.05
951498 58 27 10 7 0.03
951519 60 32 8 3 0.05
951529 90 35 24 18 0.15
951537 103 101 105 168 >2.0
951550 66 42 15 6 0.08
951554 83 36 10 5 0.10
951561 88 59 74 100 >2.0
951565 65 38 13 4 0.07
951566 77 36 9 3 0.09
951608 73 25 8 4 0.06
951645 64 29 12 7 0.05
951657 107 91 64 62 >2.0
951691 58 28 9 3 0.04
951696 58 19 9 5 <0.03
951700 76 40 16 9 0.10
951709 52 25 9 6 <0.03
951729 73 74 88 89 >2.0
951731 70 34 10 4 0.07
951737 57 24 5 4 <0.03
951746 68 31 17 11 0.06
951749 71 27 4 2 0.06
951763 44 11 4 2 <0.03
951764 40 9 2 1 <0.03
951767 87 48 16 5 0.14
951772 62 30 10 7 0.05
951781 95 42 15 7 0.15
951783 56 31 12 5 0.04
951787 53 20 7 4 <0.03
951793 44 11 4 2 <0.03
951795 64 24 7 3 0.04
951797 40 15 6 4 <0.03
951798 31 5 1 1 <0.03
951799 27 5 1 1 <0.03
951803 67 29 9 4 0.06
951804 45 13 3 1 <0.03
951806 65 43 15 7 0.07
951807 59 30 10 4 0.04
951808 69 46 18 6 0.10
951809 47 13 3 1 <0.03
951811 57 22 7 3 <0.03
951814 60 25 10 7 0.04
951815 58 37 15 7 0.05
951816 46 10 2 1 <0.03
951821 41 14 4 2 <0.03
951822 86 44 15 7 0.13
951824 67 23 5 3 0.05
951827 51 17 5 2 <0.03
951828 63 23 9 4 0.04
951830 61 26 10 5 0.04
951833 59 39 9 4 0.05
951835 23 4 1 0 <0.03
951837 53 16 4 1 <0.03
951838 80 51 22 8 0.14
951839 56 25 8 2 <0.03
951840 76 37 12 4 0.09
951841 69 27 11 2 0.06
951843 63 29 8 4 0.05
951845 39 9 3 1 <0.03
951846 45 14 3 1 <0.03
951855 87 65 19 5 0.19
951856 61 18 4 2 <0.03
951857 57 27 7 2 0.03
951874 74 73 68 47 >2.0
951875 66 33 10 4 0.06
951881 49 22 3 2 <0.03
951893 53 26 10 5 <0.03
951898 46 18 5 2 <0.03
951902 61 34 13 7 0.05
951938 85 51 20 11 0.16

Example 6: Dose Response of Modified Oligonucleotides Complementary to Dynamin 2 In Vitro

Selected oligonucleotides listed in the Examples above were tested at various doses via free uptake in A431 cells. Cells were cultured at a density of 10,000 cells per well and treated with 8, 40, 200, or 1,000 nM of modified oligonucleotide, as specified in the table below. After approximately 48 hours, total RNA was isolated and analyzed by RT-PCR with primer probe set RTS36027 (described in Example 1), normalized with GADPH. As illustrated in the tables below, DNM2 mRNA expression was inhibited in a dose-dependent manner by modified oligonucleotides complementary to DNM2.

TABLE 8
DNM2 mRNA Expression
Compound DNM2 expression (% control)
Number 8 nM 40 nM 200 nM 1,000 nM IC50 (μM)
695171  90 84 54 26 0.24
951371 105 67 25  9 0.10
951371 101 70 27 11 0.10
951371 109 63 16  4 0.08
951371  91 61 23  8 0.07
951371  94 78 25  9 0.10
951371  91 63 23  8 0.07
951371  59 66 23  8 0.04
951371  94 56 20  7 0.07
951371  88 67 26 10 0.08
988380  77 33  5  1 0.02
988386  93 70 21  6 0.08
988387 101 46  5  1 0.05
988388  97 80 39 11 0.13
988394 120 81 23  5 0.12
988396 113 87 30  9 0.14
988397  77 29  7  2 0.02
988398  86 46 11  3 0.04
988399  81 47 13  3 0.04
988400  88 54 15  3 0.05
988401  98 65 16  6 0.07
988402  94 48 11  2 0.05
988407  99 77 30  8 0.11
988413  84 58 23  7 0.06
988414  95 73 23  6 0.09
988415  82 62 25  7 0.06
988422  91 60 17  7 0.06

Example 7: Dose Response of Modified Oligonucleotides Complementary to Dynamin 2 In Vitro

Selected oligonucleotides listed in the Examples above were tested at various doses via free uptake in A431 cells. Cells were cultured at a density of 10,000 cells per well treated with 7.8, 31.25, 125, 500, or 2,000 nM of modified oligonucleotide, as specified in the tables below. After approximately 48 hours, total RNA was isolated and analyzed by RT-PCR with primer probe set RTS36027 (described in Example 1), normalized with GADPH. As illustrated in the tables below, DNM2 expression was inhibited in a dose-dependent manner by modified oligonucleotides complementary to DNM2.

TABLE 9
DNM2 mRNA Expression
DNM2 expression (% control)
7.8 nM 31.25 125 500 2,000 IC50
Compound Number nM nM nM nM nM (μM)
908166 106 97 57 28 16 0.22
908213 139 85 56 30 16 0.21
908408 98 80 33 7 2 0.08
908420 91 86 45 13 4 0.11
948660 105 90 51 13 2 0.14
948677 101 101 61 23 8 0.21
948951 97 79 35 14 8 0.09
949190 107 101 54 22 8 0.18
949865 94 80 40 16 7 0.10
949935 88 84 58 31 19 0.20
950023 89 75 45 13 4 0.09
950060 81 79 48 29 11 0.13
950089 84 79 53 18 5 0.12
950132 87 83 44 19 9 0.11
950183 88 83 58 35 15 0.21

TABLE 10
DNM2 mRNA Expression
DNM2 expression (% control)
7.8 nM 31.25 125 500 2,000 IC50
Compound Number nM nM nM nM nM (μM)
908408 98 80 34 10 2 0.08
951356 190 79 60 28 10 0.23
951362 97 85 63 30 11 0.21
951372 87 80 55 23 10 0.14
951431 100 90 68 38 21 0.31
951797 89 77 42 19 10 0.10
951798 89 58 23 6 1 0.04
951799 90 68 23 6 2 0.05
951816 100 77 38 10 3 0.09
951821 87 57 45 16 6 0.07
951827 94 79 45 17 5 0.11
951839 95 90 69 38 14 0.29
951845 92 71 31 8 2 0.06
951846 91 85 50 19 5 0.13
951856 97 86 54 22 7 0.15

Example 8: Dose Response of Modified Oligonucleotides Complementary to Dynamin 2 In Vitro

Selected oligonucleotides listed in the Examples above were tested at various doses in HSMM cells (human myoblast, Lonza CC-2580). Cells were cultured at a density of 20,000 cells per well and transfected via electroporation with 7.8, 31.25, 125, 500, or 2,000 nM of modified oligonucleotide, as specified in the tables below. After approximately 16 hours, total RNA was isolated and analyzed by RT-PCR with primer probe set RTS36027 (described in Example 1), normalized with ribogreen. As illustrated in the tables below, DNM2 mRNA expression was inhibited in a dose-dependent manner by modified oligonucleotides complementary to DNM2.

TABLE 11
DNM2 mRNA Expression
DNM2 expression (% control)
7.8 nM 31.25 125 500 2,000 IC50
Compound Number nM nM nM nM nM (μM)
908166 104 95 98 66 42 1.29
908213 93 82 70 42 19 0.33
908408 111 100 74 38 17 0.36
908420 91 93 67 39 17 0.30
948660 88 86 83 42 15 0.40
948677 90 80 87 51 22 0.54
948951 88 74 57 31 12 0.16
949190 99 88 82 47 23 0.49
949865 132 106 92 39 19 0.50
949935 90 92 94 60 25 0.77
950023 113 97 86 40 15 0.43
950060 109 105 78 69 32 0.95
950089 111 102 80 54 21 0.58
950132 117 98 79 51 19 0.51
950183 95 110 84 59 23 0.70

TABLE 12
DNM2 mRNA Expression
DNM2 expression (% control)
7.8 nM 31.25 125 500 2,000 IC50
Compound Number nM nM nM nM nM (μM)
908408 98 102 81 55 20 0.58
951356 95 102 94 74 41 1.45
951362 95 67 85 56 29 0.62
951372 95 91 86 60 27 0.75
951431 87 90 89 55 35 0.77
951797 94 94 98 72 41 1.40
951798 103 95 79 40 21 0.40
951799 104 100 81 47 20 0.50
951816 106 91 89 53 30 0.70
951821 122 106 66 32 22 0.32
951827 100 87 51 38 20 0.21
951839 123 94 99 72 31 1.17
951845 104 94 75 51 20 0.48
951846 112 91 80 59 27 0.69
951856 113 101 77 50 22 0.52

Example 9: Dose Response of Modified Oligonucleotides Complementary to Dynamin 2 In Vitro

Selected oligonucleotides listed in the Examples above were tested at various doses in SkMC cells (human skeletal muscle, Lonza CC-2561). Cells were cultured at a density of 20,000 cells per well and transfected via electroporation with 7.8, 31.25, 125, 500, or 2,000 nM of modified oligonucleotide, as specified in the tables below. After approximately 16 hours, total RNA was isolated and analyzed by RT-PCR with primer probe set RTS36027 (described in Example 1), normalized with ribogreen. As illustrated in the tables below, DNM2 mRNA expression was inhibited in a dose-dependent manner by modified oligonucleotides complementary to DNM2.

TABLE 13
DNM2 mRNA Expression
DNM2 expression (% control)
7.8 nM 31.25 125 500 2,000 IC50
Compound Number nM nM nM nM nM (μM)
908166 90 84 87 43 13 0.41
908213 101 79 59 21 5 0.15
908408 94 72 57 21 3 0.13
908420 84 72 53 9 4 0.10
948660 95 90 64 12 2 0.16
948677 88 77 58 15 4 0.13
948951 83 67 41 12 5 0.07
949190 103 84 61 16 4 0.16
949865 130 106 55 10 4 0.17
949935 118 100 86 33 7 0.36
950023 129 98 57 11 3 0.17
950060 101 103 72 26 5 0.26
950089 112 78 65 20 4 0.17
950132 115 93 53 14 3 0.15
950183 114 92 70 24 5 0.23

TABLE 14
DNM2 mRNA Expression
DNM2 expression (% control)
7.8 nM 31.25 125 500 2,000 IC50
Compound Number nM nM nM nM nM (μM)
908408 91 80 46 10 3 0.10
951356 103 98 90 52 15 0.55
951362 90 88 65 22 4 0.19
951372 99 88 65 16 4 0.18
951431 103 97 70 25 6 0.24
951797 102 94 69 25 7 0.23
951798 99 90 46 8 3 0.12
951799 101 90 49 12 3 0.13
951816 96 78 63 13 4 0.14
951821 104 79 47 12 3 0.11
951827 94 71 44 8 3 0.08
951839 114 103 76 32 6 0.32
951845 97 88 55 12 4 0.14
951846 90 86 41 18 4 0.11
951856 102 91 62 15 4 0.17

Example 10: Administration of Modified Oligonucleotides Complementary to Human Dynamin 2 to CD1 Mice

CD1® mice (Charles River, Mass.) were treated with modified oligonucleotides selected from Examples above and evaluated for changes in the levels of various plasma chemistry markers. Groups of 6 week old male CD1 mice were injected subcutaneously once a week for 6 weeks with 50 mg/kg of a modified oligonucleotide listed in the tables below (50 mg/kg/week dose). Each group contained 4 mice. One control group of male CD1 mice was injected subcutaneously once a week for 6 weeks with PBS. Mice were sacrificed 48 hours after the last dose, and organs and plasma were harvested for further analysis.

Levels of transaminases, albumin, BUN, and billirubin were measured using an automated clinical chemistry analyzer (Hitachi Olympus AU400e, Melville, N.Y.). Kidney, liver, and spleen weights were also measured. The results, presented in the tables below, show that many of the modified oligonucleotides complementary to DNM2 were well tolerated in vivo.

TABLE 15
Levels of plasma markers
ALT AST Albumin BUN Creatine T. Bil.
(U/L) (U/L) (mg/dL) (mg/d) (mg/dL) (g/dL)
PBS 48 82 3.36 27.2 0.12 0.66
549144 72 68 3.23 23.6 0.12 0.47
908166 259 108 3.16 20.4 0.11 0.38
908213 93 85 2.95 23.9 0.10 0.34
908389 1073 636 3.17 22.7 0.09 0.55
908408 67 70 2.97 26.2 0.11 0.32
908415 286 209 2.60 26.2 0.10 0.28
908416 425 336 2.35 26.4 0.07 0.19
908420 105 144 2.50 26.5 0.06 0.38
948660 112 165 2.59 21.8 0.08 0.26
948673 225 263 2.15 27.2 0.04 0.82
948675 100 132 2.25 21.4 0.06 0.22
948677 65 91 2.32 17.7 0.05 0.21
948951 107 126 2.46 21.4 0.07 0.22
949158 713 608 2.99 18.6 0.01 0.27
949190 64 62 2.52 22.1 0.07 0.20
949865 45 58 2.62 23.2 0.06 0.22
949873 89 163 2.33 20.7 0.04 0.21
949874 1079 853 2.77 20.7 0.05 0.46
949935 98 81 2.63 22.9 0.07 0.20
950023 42 57 2.52 22.2 0.04 0.20
950030 59 77 2.44 20.6 0.05 0.21

TABLE 16
Levels of plasma markers
Compound ALT AST Albumin BUN Creatine T. Bil.
No. (U/L) (U/L) (mg/dL) (mg/d) (mg/dL) (g/dL)
PBS 37 62 2.78 22.0 0.08 0.46
549144 64 79 2.64 24.0 0.08 0.29
950060 47 63 2.47 22.0 0.09 0.33
950089 40 56 2.65 21.0 0.10 0.22
950132 58 58 2.58 20.0 0.07 0.24
950183 49 62 2.38 21.0 0.06 0.29
951356 64 80 2.39 23.0 0.10 0.25
951362 60 63 2.74 22.0 0.09 0.18
951371 312 209 2.32 20.0 0.09 0.18
951372 59 99 2.54 25.0 0.07 0.21
951407 172 200 2.72 24.0 0.07 0.24
951431 64 80 2.48 23.0 0.08 0.22
951793 319 238 2.5 19.0 0.10 0.20
951797 41 63 2.6 24.0 0.11 0.26
951798 53 97 2.57 26.0 0.10 0.19
951799 44 97 2.44 25.0 0.08 0.19
951816 121 113 2.63 19.0 0.10 0.20
951821 79 80 2.39 23.0 0.07 0.17
951827 56 88 2.46 25.0 0.10 0.21
951839 45 50 2.52 23.0 0.08 0.20
951845 117 132 2.51 21.0 0.08 0.25
951846 35 47 2.59 21.0 0.10 0.21
951856 112 412 2.25 20.0 0.09 0.17

TABLE 17
Organ weights
kidney liver spleen
(g) (g) (g)
PBS 0.55 1.9 0.09
549144 0.52 1.9 0.10
908166 0.48 2.0 0.08
908213 0.52 2.0 0.12
908389 0.54 2.6 0.14
908408 0.49 2.2 0.13
908415 0.51 2.2 0.12
908416 0.51 2.1 0.16
908420 0.52 2.0 0.13
948660 0.44 1.8 0.14
948673 0.51 3.9 0.62
948675 0.48 2.1 0.21
948677 0.54 2.0 0.15
948951 0.45 1.9 0.11
949158 0.59 2.3 0.18
949190 0.53 2.2 0.14
949865 0.53 2.1 0.14
949873 0.47 1.8 0.20
949874 0.52 2.3 0.16
949935 0.57 2.0 0.13
950023 0.53 1.9 0.16
950030 0.59 2.1 0.20

TABLE 18
Organ weights
Compound kidney liver spleen
No. (g) (g) (g)
PBS 0.57 2.1 0.11
549144 0.57 2.0 0.09
950060 0.57 2.3 0.12
950089 0.60 2.4 0.15
950132 0.59 2.3 0.16
950183 0.60 2.4 0.14
951356 0.57 2.4 0.19
951362 0.58 2.3 0.16
951371 0.51 2.7 0.16
951372 0.55 2.5 0.17
951407 0.53 2.2 0.17
951431 0.54 2.2 0.18
951793 0.55 2.6 0.17
951797 0.52 2.1 0.15
951798 0.57 2.4 0.18
951799 0.54 2.4 0.16
951816 0.50 2.4 0.16
951821 0.50 2.0 0.13
951827 0.47 1.8 0.13
951839 0.51 2.2 0.15
951845 0.55 2.0 0.17
951846 0.57 2.2 0.17
951856 0.60 2.5 0.19

Claims

1. A compound comprising a modified oligonucleotide 14 to 30 linked nucleosides in length having

i) a nucleobase sequence comprising at least 14 contiguous nucleobases of SEQ ID NO: 2879;

ii) a nucleobase sequence comprising a portion of at least 14 contiguous nucleobases 100% complementary to an equal length portion of nucleobases 87,359-90,915; 90,968-97,263; 83,573-87,287; 3,404-44,737; 97,378-104,979; 81,061-81,199; or 116,048-116,903 of SEQ ID NO: 1,

iii) a nucleobase sequence complementary to intron 12, intron 13, intron 11, intron 1, intron 14, exon 10, or the 3′-UTR of a human DNM2 pre-mRNA or human DNM2 mRNA, or

iv) a nucleobase sequence comprising at least 12, at least 13, at least 14, or at least 15 contiguous nucleobases of any one of the nucleobase sequences of SEQ ID NOs: 7-3134,

or a pharmaceutically acceptable salt thereof.

2. The compound according to claim 1, wherein the modified oligonucleotide has a nucleobase sequence consisting of any one of SEQ ID NOs: 2879, 2123, 2189, 2160, 3056, 2453, or 2232.

3. The compound according to claim 1, wherein the modified oligonucleotide comprises:

a gap segment consisting of 8-12 linked 2′-deoxynucleosides;

a 5′ wing segment consisting of 1-7 linked nucleosides; and

a 3′ wing segment consisting of 1-7 linked nucleosides;

wherein the gap segment is positioned between the 5′ wing segment and the 3′ wing segment and wherein each terminal wing nucleoside comprises a modified sugar.

4. The compound according to claim 1, wherein the modified oligonucleotide is at least 80%, 85%, 90%, 95% or 100% complementary to any of SEQ ID NOs: 1, 2, 3, or 3135.

5. The compound according to claim 1, wherein the modified oligonucleotide comprises at least one modified internucleoside linkage.

6. The compound according to claim 1, wherein the modified oligonucleotide comprises at least one bicyclic sugar.

7. The compound according to claim 1, wherein the modified oligonucleotide comprises at least one 5-methylcytosine.

8. The compound according to claim 1, wherein the compound is single-stranded.

9. The compound according to claim 1, wherein the compound is double-stranded.

10. The compound according to claim 1, wherein the modified oligonucleotide consists of 16 to 20 linked nucleosides.

11. A compound comprising a modified oligonucleotide according to the following formula: Gks Tks Tks Tds Ads Tds Tds Ads Tds Ads Gds Gds Gds mCks Tks Tk; wherein,

A=an adenine,

mC=a 5-methylcytosine

G=a guanine,

T=a thymine,

k=a cEt sugar moiety,

d=a 2′-deoxyribosyl sugar moiety, and

s=a phosphorothioate internucleoside linkage.

12. (canceled)

13. A compound according to the following formula:

or a salt thereof.

14. (canceled)

15. A chirally enriched population of the compound according to claim 1, wherein the population is enriched for modified oligonucleotides comprising at least one particular phosphorothioate internucleoside linkage having a particular stereochemical configuration.

16. A pharmaceutical composition comprising the compound according to claim 1 and at least one pharmaceutically acceptable diluent or carrier.

17. (canceled)

18. A method of treating, preventing, or ameliorating a disease associated with DNM2 in an individual, comprising administering to the individual the compound according to claim 1.

19. An in vitro method of inhibiting expression of DNM2 in a cell comprising contacting the cell with a single-stranded compound comprising a modified oligonucleotide 100% complementary to exon 10, an intron, or the 3′-UTR of a DNM2 nucleic acid transcript, thereby inhibiting expression of DNM2 in the cell.

20. The compound according to claim 5, wherein the at least one modified internucleoside is a phosphorothioate internucleoside linkage.

21. The compound according to claim 6, wherein the at least one bicyclic sugar is selected from the group consisting of LNA, ENA, and cEt.

22. The compound according to claim 1, comprising a conjugate group.

23. The compound according to claim 22, wherein the compound consists of the modified oligonucleotide and the conjugate group.

24. The compound according to claim 1, wherein the pharmaceutically acceptable salt is a sodium salt or a potassium salt.

25. The method according to claim 18, wherein the disease is centronuclear myopathy, Duchenne Muscular Dystrophy, Charcot-Marie Tooth disease, X-linked myotubular myopathy, autosomal recessive centronuclear myopathy, or autosomal dominant centronuclear myopathy.

26. The method according to claim 18, wherein the disease is associated with a mutation in at least one gene selected from among MTM1, BIN1, and DNM2.