US20210109076A1
2021-04-15
17/128,270
2020-12-21
The present invention provides systems, devices, signaling polynucleotides (SPNs), detection agents and methods for detecting the presence and/or absence of one or more allergens in a sample particularly a food sample. The detection system includes a separate sampler, at least one disposable detection vessel for receiving and processing a test sample and a detection device for measuring a fluorescent signal. SPNs derived from aptamer that bind allergens are provided as detection agents. SPNs have a single open structure, and are labeled with a fluorophore. Changes in fluorescence polarization of SPNs upon the binding of allergens are measured to calculate the allergen content in a sample.
Get notified when new applications in this technology area are published.
C12M1/3476 » CPC further
Apparatus for enzymology or microbiology; Measuring or testing with condition measuring or sensing means, e.g. colony counters; Photometry, spectroscopy, laser technology Fluorescence spectroscopy
G01N1/286 » CPC further
Sampling; Preparing specimens for investigation; Preparing specimens for investigation including physical details of (bio-)chemical methods covered elsewhere, e.g. , involving mechanical work, e.g. chopping, disintegrating, compacting, homogenising
G01N2001/2866 » CPC further
Sampling; Preparing specimens for investigation; Preparing specimens for investigation including physical details of (bio-)chemical methods covered elsewhere, e.g. , involving mechanical work, e.g. chopping, disintegrating, compacting, homogenising Grinding or homogeneising
G01N33/5308 » CPC further
Investigating or analysing materials by specific methods not covered by groups -; Biological material, e.g. blood, urine ; Haemocytometers; Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing; Immunoassay; Biospecific binding assay; Materials therefor for analytes not provided for elsewhere, e.g. nucleic acids, uric acid, worms, mites
C12N2310/16 » CPC further
Structure or type of the nucleic acid; Type of nucleic acid Aptamers
G01N2001/1427 » CPC further
Sampling; Preparing specimens for investigation; Devices for withdrawing samples in the liquid or fluent state; Suction devices, e.g. pumps; Ejector devices; Depression, aspiration Positive displacement, piston, peristaltic
C12N2320/11 » CPC further
Applications; Uses in screening processes for the determination of target sites, i.e. of active nucleic acids
G01N33/5304 » CPC further
Investigating or analysing materials by specific methods not covered by groups -; Biological material, e.g. blood, urine ; Haemocytometers; Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing; Immunoassay; Biospecific binding assay; Materials therefor; Apparatus specially adapted for immunological test procedures Reaction vessels, e.g. agglutination plates
G01N33/02 » CPC main
Investigating or analysing materials by specific methods not covered by groups - Food
C12M1/34 IPC
Apparatus for enzymology or microbiology Measuring or testing with condition measuring or sensing means, e.g. colony counters
G01N1/08 » CPC further
Sampling; Preparing specimens for investigation; Devices for withdrawing samples in the solid state, e.g. by cutting involving an extracting tool, e.g. core bit
C12N15/115 » CPC further
Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor; Recombinant DNA-technology; DNA or RNA fragments; Modified forms thereof Aptamers, i.e. nucleic acids binding a target molecule specifically and with high affinity without hybridising therewith ; Nucleic acids binding to non-nucleic acids, e.g. aptamers
G01N1/14 » CPC further
Sampling; Preparing specimens for investigation; Devices for withdrawing samples in the liquid or fluent state Suction devices, e.g. pumps; Ejector devices
G01N1/28 IPC
Sampling; Preparing specimens for investigation Preparing specimens for investigation including physical details of (bio-)chemical methods covered elsewhere, e.g. ,
G01N33/53 IPC
Investigating or analysing materials by specific methods not covered by groups -; Biological material, e.g. blood, urine ; Haemocytometers; Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing Immunoassay; Biospecific binding assay; Materials therefor
G01N33/58 » CPC further
Investigating or analysing materials by specific methods not covered by groups -; Biological material, e.g. blood, urine ; Haemocytometers; Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving labelled substances
This application is a continuing application of the U.S. patent application Ser. No. 16/084,996 filed Sep. 14, 2018 which is a 35 U.S.C. § 371 U.S. National Stage Entry of International Application No. PCT/US2017/021737, entitled Systems and Methods for Allergen Detection, filed Mar. 10, 2017, which claims priority to U.S. Provisional Application No. 62/308,376, entitled Portable Allergen Detection System, filed Mar. 15, 2016, and U.S. Provisional Application No. 62/308,377, entitled Allergen Detection Agents and Methods, filed Mar. 15, 2016; the contents of each of which are incorporated herein by reference in their entireties.
The present application is being filed along with a Sequence Listing in electronic format. The Sequence Listing is provided as a file entitled 20661004USCON_SEQLST.txt, created on Dec. 16, 2020, which is 77,260 bytes in size. The information in the electronic format of the sequence listing is incorporated herein by reference in its entirety.
The present invention relates to systems, devices, aptamers, signaling polynucleotides (SPNs), detection agents and methods for detecting the presence and/or absence of a target allergen in a test sample such as a food allergen in a food sample.
Allergy (e.g., food allergy) is a common medical condition affecting millions of people worldwide. It has been estimated that in the United States, up to 2 percent of adults and up to 8 percent of children, particularly those under three years of age, suffer from food allergies (about 15 million people), and this prevalence is believed to be increasing. During an allergic reaction, the immune system mistakenly targets an allergen as a threat and attacks it. The allergic reaction may affect the skin, the digestive system, the gastrointestinal tract, the respiratory system, the circulatory system and the cardiovascular system; in some allergic reactions, multiple organ systems are affected. Allergic reactions range from mild to severe or life-threatening. Severe symptoms may include difficulty in breathing, low blood pressure, chest pain, loss of consciousness, and anaphylaxis. People having allergies currently manage their allergies by avoiding any food that might contain that specific allergen. These restrictions have a major impact on the patients' quality of life and there remains no effective method for assessing the true allergen content of food. In the United States, food allergy symptoms send someone to the emergency room every three minutes. A rapid, sensitive and accurate method for determining the presence of an allergen would be of great benefit. A portable device that enables the patients to test their food and determine accurately and immediately the allergen content will be beneficial to provide for an informed decision on whether to consume or not.
Researchers have tried to develop suitable devices and methods to meet this need. There are many devices and systems disclosed in the field that detect the allergen content in a food sample, including U.S. Pat. No. 5,824,554 to McKay which teaches a dining mat formed of an absorbent material and small spots of chemical reagents applied to isolated zones on the mat, for detection of food allergens; US Patent Application Pub. No.: 2008/0182339 and U.S. Pat. No. 8,617,903 to Jung et al. which teach a method of detecting an allergen by processing samples with microfluidic chips configured for analysis of one or more allergen indicators, detecting the allergen indicators with one or more detection units, and displaying results with one or more display units; US Patent Application Pub. No.: 2010/0210033 to Scott et al. which teaches a portable device for detecting food allergens comprising a housing, a sample inlet port, a means for indicating the presence of the potential allergen in the sample, and an allergen detection chip using a tagged antibody to detect the potential allergen; U.S. Pat. No. 7,527,765 to Royds which teaches a food testing device for identifying the presence of harmful contaminants (including allergens) in a food sample, comprising a disposable sample container, a mechanical liquefier including a blade assembly, a test supply compartment with a reagent having an affinity for the harmful contaminant and capable of detecting the harmful contaminant in the liquefied food sample, and producing a visual cue upon recognition of the harmful contaminant; and U.S. Pat. No. 9,201,068 to Suni et al., which teaches bioelectronics tongues incorporated with antibodies for food allergy detection.
To implement sensitive and accurate allergen detection in a food sample, a specific detector that can rapidly recognize allergens is crucial to the testing result. Currently immunoassays are commonly used for food allergen detection in food industry and for customers who have food allergy. A specific allergen protein can be measured by an immunoassay such as ELISA, RIA (radioimmunoassay), latex agglutination assay, or western blotting. In these assays, antibodies with specificity to a target allergen are needed. Many immunoassays for detection of a specific food allergen have been disclosed in the prior art, for example, U.S. Pat. No. 8,377,696 which discloses immunoassays to detect crustacean tropomyosin; U.S. Pat. No. 8,361,460 which teaches ELISA using antibodies against soybean allergens to provide safety to patients with food allergy; U.S. Pat. No. 8,349,620 which relates to immunoassay system for detecting multiple allergens; and U.S. Pat. No. 6,441,142 which discloses an immunoassay for peanut allergen. However, most immunoassays are time consuming, require trained personnel to read the test results, are difficult to miniaturize, and are not fully standardized. Moreover, immunoassays suffer interferences, which are often attributed to matrix effects and cross-reactivities. As such immunoassay methods often cause false positive results.
In addition to antibodies specifically binding to an allergen, nucleic acid molecules such as aptamers, as well as devices and methods of using them in the detection of proteins in samples (e.g. food samples), are disclosed in several patents and patent applications, including U.S. Pat. No. 8,614,466 to Rasooly, et al., which teaches a method and system employing a physical principle called “electrical percolation,” (flow of electricity through a random resistive network) for electrically detecting biomolecular binding in a semiconductor using aptamer as capture molecules; U.S. Pat. No. 8,563,298 to Lowery, Jr., et al. which teaches NMR systems and methods for the collection and detection of analytes; U.S. Pat. No. 8,232,584 to Lieber, et al. which teaches a fluorescence based nanoscale wire biosensor devices and methods for detecting analytes, wherein an aptamer may be indirectly immobilized relative to the nanoscale wire; U.S. Pat. No. 7,977,462 to Hornbeck et al. which teaches lateral flow devices for detecting and quantitating novel tyrosine phosphorylation sites identified in carcinoma and/or leukemia using aptamers; U.S. Pat. No. 7,855,057 to Gordon, et al., which teaches methods, reagents and apparatus for detecting small quantities of protein isoforms (e.g., due to alternative splicing, or different disease protein isoforms or degradation products) in a sample, including using combinations of capture agents, wherein the capture agent may be an aptamer; U.S. Pat. No. 8,618,046 to Brunner, et al., teaches a method for treating atherosclerosis using aptamer-based anti-CETP-antibody-inducing antigens; U.S. Pat. No. 8,507,458 to Yokota, et al. teaches a system for delivering nucleic acids for suppressing target gene expression by utilizing endogenous chylomicron, wherein the nucleic acid may be an aptamer; and U.S. Pat. No. 7,850,964 to Vukicevic, et al., which teaches nucleic acid biosensors of bone morphogenetic proteins (BMPs) for diagnosis and treatment of bone and soft tissue defects and disorders (the contents of each of which are incorporated herein by reference). Other disclosures of use of aptamers in protein detection are also included in PCT Patent Publication NOs.: WO 2009/019007, WO 2009/040113, WO 2010/108657 and WO 2013/104540; which are incorporated by reference herein.
Aptamer derived molecular beacons (MBs) are mostly developed detection agents among nucleic acid agents, which are hairpin-shaped oligonucleotides that contain both fluorophore and quencher moieties and act like switches. When in a closed state, the fluorophore and quencher are brought together and the fluorescence is quenched (“turned off”) by resonance energy transfer. When a conformational change opens the hairpin structure and the fluorophore and quencher are separated, the quencher can no longer quench and fluorescence is restored (“turned on”). MBs are particularly useful in detection devices and diagnostic assays requiring a probe to have high sensitivity and excellent molecular recognition specificity; they are extraordinarily target-specific, ignoring nucleic acid target sequences that differ by as little as a single nucleotide. MBs as detectors could allow for real-time monitoring, and for “detection without separation”, where it is impossible or undesirable to isolate the probe-target hybrids from an excess of the unhybridized probes. The specificity provided by the MB loop-stem structure has been demonstrated to be applicable in a variety of biological environments.
Exemplary molecular beacons are reviewed in Leung, et al., 2011 (Nucleic Acids Research, 2012, 40(3): 941-955) and described in U.S. Pat. No. 8,188,255 to Litman et al., which teaches microRNA (miRNA) sequences associated with cancer, and their detection using aptamers and molecular beacons; U.S. Pat. No. 7,282,360 to Meyers et al., which generally discloses detection of novel protein kinase, serine/threonine phosphatase, prolyl oligopeptidase, trypsin, serine protease, and ubiquitin carboxy-terminal hydrolase family members, using aptamers or molecular beacons; and U.S. Pat. No. 6,730,491 to Kapeller-Libermann et al., which also generally discloses detection of three allegedly novel protein kinase family members, using aptamers or molecular beacons; which are incorporated by reference herein.
The inventors of the present invention have developed aptamer based signaling polynucleotides (SPNs) with high specificity to different allergen proteins. Such signaling polynucleotides (SPNs) are designed to have closed stem-loop structures similar to molecule beacons. SPNs are labeled with a fluorophore at one end of the polynucleotide and a fluorescent quencher at the other end. The closed loop structure brings the fluorophore and the quencher together and upon the binding of an allergen to the SPN, the closed loop structure is open and frees the fluorophore from the quencher. The fluorescent intensity changes before and after the allergen binding are measured and used to detect the allergen content in a sample. The commonly owned U.S. Patent Application Serial NOs.: 62/026,361, filed on Jul. 18, 2014, 62/009,958, filed on Jun. 10, 2014, 61/991,068, filed on May 9, 2014, 61/938,528, filed on Feb. 11, 2014, 61/896,399, filed on Oct. 28, 2013 and PCT Patent Application Serial NO.: PCT/US2014/062656, filed on Oct. 28, 2014, which are all entitled “allergen detection”; and U.S. Patent Application Ser. No. 62/154,200, filed Apr. 29, 2015, PCT Patent Application Serial No.: PCT/US 2016/029356 filed on Apr. 21, 2016, which are entitled “compositions and methods for allergen detection” (the contents of each of which are incorporated herein by reference in their entirety), discussed the sequences, structures and detection methods of these signaling polynucleotides.
The present inventors have designed detection systems, devices using such SPNs as detection agents to detect an allergen in a test sample. The detection systems are discussed in commonly owned U.S. Provisional Application Ser. No. 62/133,632, filed on Mar. 16, 2015 and U.S. Provisional Application Ser. No. 62/182,900, file on Jun. 22, 2015; the contents of each of which are incorporated herein by reference in their entirety.
In the present invention, the inventors further modify the nucleic acid sequences of aptamers that specifically bind a target allergen(s) to develop new SPNs and allergen detection agents. The identified aptamers that can specifically bind an allergen are modified at the 5′ and 3′ termini of the nucleic acid sequences and labeled with a fluorophore at one terminus of the polynucleotide. In some embodiments, fluorescence polarization (FP) changes may be measured upon the binding of a target allergen to the present signaling polynucleotide (SPN) and such FP signal will be used to indicate the presence and/or absence of an allergen in a food sample.
The inventors of the present invention further developed detection systems and devices which include a separate sampler, disposable vessels and a detector, for fast and accurate detection of an allergen(s) in a sample using aptamer-based signal polynucleotides (SPNs). Changes in fluorescence polarization of the SPNs can be measured by the present detection devices and used to indicate the allergen content in a sample. The detection device/apparatus may be miniaturized, portable and hand-held device for detecting food allergen in a sample.
The present invention provides systems, devices, detection vessels and methods for use in allergen detection in various types of samples, in particular, food samples. Detection agents such as nucleic acid aptamers, and signaling polynucleotides (SPNs) derived from aptamers, specific to allergen proteins, are provided as well.
One aspect of the present invention is an allergen detection system for detecting the presence and/or absence of one or more allergens in a sample, the system comprising: (a) at least one sampler for collecting a test sample; (b) at least one detection vessel for receiving and processing the test sample, and analyzing the interaction between an allergen(s) in the test sample and the detection agents; and (c) a detection device for detecting the allergen (s) in the test sample.
In some embodiments, the sampler may be provided with a means for weighing which ensures a certain amount of the test sample being picked up. In some aspects, the sampler is a food pickup corer which is configured for measuring a sized portion of a food sample and/or pre-processing the collected food sample. The food corer may have a distal portion provided with a corer top cap at the distal end and a proximal portion provided with a collecting tube, a grip for handling the corer which is connected to the collecting tube, and a plunger inside the collecting tube which has a distal end connected to the top cap and a proximal plunger tip which may protrude from the collecting tube for picking up a food sample. As a non-limiting example, the food pickup corer may further include a spring to indicate the amount of the food sample being picked up.
In some embodiments, the detection vessel is disposable, suitable for one particular allergen. The detection vessel comprises at least one reaction chamber where the detection reaction occurs. In some embodiments, the detection vessel is a disposable test cup or cup-like container. The disposable test cup or cup-like container may be designed as an analytical module in which a test sample is processed and an allergen of interest in the test sample is detected through the interaction with detection agents. In some aspects, the test cup or cup-like container comprises a cup body and a cup lid. The cup lid has several ports for holding a sampler (e.g., the food pickup corer), a homogenizer assembly and a means for the flow of the processed test sample solution. The cup body may comprise one container, or may be divided into two separate but connected parts.
Reaction chambers may be configured at various places within the test cup, including but not limited to the cup lid assembly, or the bottom and/or the side of the cup body, or one part of the divided cup body. In some embodiments, the cup lid assembly may comprise one or more reaction chambers. In some aspects, the reaction chambers may be configured to contain a volume of about 10 μL to about 200 μL.
The detection device of the present invention comprises (a) an external housing that provides support for the components of the detection device; (b) a first part that can be opened for inserting a detection vessel (e.g., a disposable test cup or cup-like container) when implementing an allergen detection testing; (c) means integrated for operating an allergen detection testing, and (d) an optional tether for carrying the detection device and an optional plug for power supply.
In accordance with the present invention, the first part of the detection device may be a drawer assembly which can be pulled out from and slide back into the housing. The drawer assembly may be configured to have a well/port for holding a disposable detection vessel (e.g., a test cup or cup-like container) when implementing an allergen detection testing. In other aspects, the first part may be a door that can be lifted and open the well/port for insertion of a detection vessel (e.g., a test cup or cup-like container).
In accordance with the present invention, the components of the detection device that are integrated for operating an allergen detection testing include (i) means for processing a test sample comprising a homogenizer; (ii) means for driving and controlling the homogenization; (iii) means for driving and controlling the flow of the processed sample during the process of an allergen detection testing; (iv) an optical subsystem for detecting a reaction signal; and (v) means for visualizing a detection result including means of converting and digitizing the detection signal and a display window; and (vi) a power supply.
In some embodiments, the homogenizer is optimized for low power and high speed homogenization of the test sample. In one aspect, the homogenizer comprises a rotor having blades at the proximal end thereof, inside a stator which has one or more slots on the axis of the proximal end thereof. The homogenizer rotor and stator are connected to a motor which can drive and control the movement of the rotor and stator for homogenizing the test sample.
In some embodiments, means for driving the liquid flow and controlling the flow rate may be a pump or an external pressure. The pump may be a gas or air pump, or an equivalent thereof. The processed sample solution is flowed into the reaction chambers configured in the detection vessel (e.g., the test cup or cup-like container).
In some embodiments, the optical subsystem may be an optical assemble that can detect a fluorescent signal generated during an allergen detection testing. In some embodiments, the fluorescent signal is fluorescence polarization (FP) changes. The optical subsystem may comprise a light source, filters and polarizers that control the plane polarization of light; and a photo detector.
In some embodiments, a printed circuit board (PCB) is connected directly or indirectly to the reaction chambers and the optical subsystem for displaying the testing readout. The result may be displayed as numbers, icons, colors and/or letters, or other equivalents.
In some embodiments, the power supply of the present detection device may be a rechargeable or replaceable battery. In other embodiments, the detection device may include a docking station and/or USB charger. In further embodiments, the detection device may be configured to be directly connected to a power supply such as AC/DC converter.
In some embodiments, the detection system may comprise a user interface that may be accessed and controlled by a software application. The software may be run by a software application on a personal device such as a smartphone, a tablet computer, a personal computer, a laptop computer, a smartwatch and/or other devices. In some cases, the software may be run by an internet browser. In some embodiments, the software may be connected to a remote and localized server referred to as the cloud.
Another aspect of the present invention provides aptamers, SPNs which can be used as detection agents to determine the presence and/or absence of an allergen in a sample. In some embodiments, the detection agents may be SPNs derived from aptamers. The SPNs of the present invention may include aptamers that have nucleic acid sequences specifically binding a target allergen, a modified nucleic acid sequence at either 5′ terminus or 3′ terminus of the polynucleotide, which is designed to maintain a single open structure, and a fluorophore label probed at one terminus of the polynucleotide.
In some embodiments, SPNs of the present invention may comprise nucleic acid sequences as shown in Table 1 and Table 2.
In some embodiments, the SPN of the present invention comprises a core nucleic acid sequence selected from polynucleotide sequences of SEQ ID NOs.: 2, 6, 13, 27, 35, 44, 57, 61, 65, 71, 78, 84, 98, 110, 119, 126, 132, 137, 150, 158, 168, 178, 190, 194, 204, 215, 220, 228, 237, 247, 251, 255, 259, 263, 267, 271, 279, 296, 308, 316, 332, 334, 336, 338, 340, and 341-353.
In other embodiments, the SPN of the present invention comprises a nucleic acid sequence selected from polynucleotide sequences of SEQ ID NOs.: 3, 4, 7-11, 14-25, 28-33, 36-42, 45-55, 58, 59, 62, 63, 66-69, 72-76, 79-82, 85-96, 99-108, 111-117, 120-124, 127-130, 133-135, 138-148, 151-156, 159-166, 169-176, 179-188, 191-192, 195-202, 205-213, 216-218, 221-226, 229-235, 238-245, 248, 249, 252, 253, 256, 257, 260, 261, 264, 265, 268, 269, 272-277, 280-294, 297-306, 309-314, and 317-330.
In some embodiments, SPNs of the present invention are labeled with a fluorescent molecule at either the 5′ terminus or the 3′ terminus, in which changes in fluorescence polarization (FP) upon a target allergen binding may be detected. In one aspect, the fluorescent molecule is Texas red.
Another aspect of the present invention relates to an allergen detection testing assay for detection of the allergen content in a sample comprising the steps of (a) obtaining a sample suspected of containing an allergen of interest, (b) processing the sample of (a) with an extraction buffer, (c) contacting the processed sample with a detection agent, (d) treating the contacted sample with an excitation means and measuring the fluorescence polarization, and (e) visualizing the interaction of the detection agent and the allergen.
In some embodiments, the present detection method may comprise the steps of (a) obtaining a test sample suspected of containing an allergen(s) of interest using a sampler, (b) processing and digesting the obtained sample in an extraction buffer, using a homogenization assembly, (c) mixing the processed sample with detection agents specific to the allergen(s) of interest, (d) treating the mixture from step (c) with a fluorescent excitation means and detecting a fluorescent signal emitted from the detection agents, and (e) digitizing the detected signals and visualizing the interaction between the detection agents and the allergen(s). The detection agents may be aptamer based SPNs that can specifically bind to specific allergens. The SPNs are probed with a fluorescent molecule. The extraction buffer may be optimized for extracting allergen proteins efficiently. The fluorescent signal, in some aspects, may be fluorescence polarization changes.
Other features and embodiments of the present invention will be apparent from the description that follows.
The foregoing and other objects, features and advantages will be apparent from the following description of particular embodiments of the invention, as illustrated with the reference to the accompanying drawings. The accompany figures are merely for purpose of illustrating exemplary embodiments of the present invention and are not intended to limit the scope of the invention to the exemplary embodiments. Similar reference numerals among the drawings are employed to denote the identical or similar elements presented in different drawings.
FIG. 1a illustrates an embodiment of a detection system of the present invention comprising a detection device 100, a separate food corer 200 as an example of the sampler, a disposable test cup 300 as an example of the detection vessel, and an optional tether 50. FIG. 1b illustrates an assembly of the detection system shown in FIG. 1a during the process of implementing an allergen detection testing.
FIG. 2a and FIG. 2b illustrate the parts of the food corer 200. FIG. 2c is an assembled food corer 200 as an example of the sampler.
FIG. 3a is an assembled disposable test cup 300 having a cup lid assembly 210 and a cup body 220; the disposable test cup 300 is an example of the detection vessel. FIG. 3b through FIG. 3g show an exploded view of the disposable test cup 300. FIG. 3b illustrates the label/final fluid seal 211. FIG. 3c illustrates the optical window/fluid seal 216. FIG. 3d illustrates the homogenizer rotor 240. FIG. 3e illustrates the cup lid assembly 210. FIG. 3f illustrates the flow tube 221, and the flow tube cap and filter assembly 224. FIG. 3g illustrates the cup body 220.
FIG. 4a illustrates an alternative configuration of the homogenizer rotor 240 on the lid assembly 210, which is connected to the rotor port 212 through a membrane seal 250, without the homogenizer stator 230. FIG. 4b illustrates an alternative configuration of reaction chambers on the top of the lid assembly 210.
FIG. 5a is a side view of an alternative embodiment of reaction chambers 223 which are located at the bottom of the cup body 220. FIG. 5b is a view from the bottom of the test cup 300, demonstrating a valve 228 which is provided to control the fluid flow to the reaction chambers 223 and/or the additional control chamber 225 (not shown).
FIG. 6a and FIG. 6b depict two different shapes of the cup body 220′ (FIG. 6a, the side view on the left panel and the top view on the right panel) and 220″ (FIG. 6b, the side view on the left panel and the top view on the right panel) which is divided into two separate but connected parts. FIG. 6c and FIG. 6d illustrate an assembled test cup 300 with a divided cup body 220 and the exploded view of the cup lid assembly 210 in this alternative design, respectively.
FIG. 7a to FIG. 7d depict other examples of the shapes and layouts of reaction chambers 223. FIG. 7a is a top view of the cup body 220 and FIGS. 7b-7d show the side view of the cup body 220.
FIG. 8a and FIG. 8b illustrate other embodiments of the filter assembly. FIG. 8a illustrates that an alternative filter membrane 226 may be provided at the bottom of the cup body 220 with certain distance from the cup base 222. FIG. 8b illustrates another alternative in which the filter membrane 226 is aligned in parallel with the cup wall and a small chamber 227 may be connected to the cup body 220 for receiving the filtered sample solution.
FIG. 9a and FIG. 9b depict alternative designs of the filter membrane 226 inside the cup body 220. FIG. 9a illustrates a single filter membrane 226 provided; FIG. 9b illustrates double filter membranes 226 provided.
FIG. 10a and FIG. 10b illustrate the external parts of the detection device 100. FIG. 10a illustrates the housing 10. FIG. 10b illustrates the drawer assembly 20.
FIG. 11 illustrates an alternative assembly of the detection system of the present invention having a claw-like rotating door 410 or a swinging housing configuration.
FIG. 12a and FIG. 12b illustrate an assembly of the detection device 100. FIG. 12a illustrates the individual components of the detection device 100. FIG. 12b illustrates the components of the detection device 100 configured inside the external housing 10 (not shown).
FIG. 13a illustrates an assembled breadboard homogenizer assembly 570 and its components. FIGS. 13b-13e illustrate a gearhead 610, a coupling 630, a homogenizer stator 230 and a homogenizer rotor 240.
FIG. 14 illustrates a motor shuttle 710 and a motor 510 assembly.
FIG. 15a and FIG. 15b illustrate a gear train/drive platen 530 connected to a pump 540. FIG. 15a is a bottom view of the gear train/drive platen 530 and FIG. 15b is a top view of the gear train/drive platen 530.
FIG. 16 illustrates an embodiment of the optical subsystem 520.
FIG. 17 illustrates an alternative of the optical subsystem 520.
FIG. 18 illustrates a printed circuit board (PCB) 550 which is connected to the optical subsystem 520. The main control PCB contains motor and pump/actuator control electronics.
The details of one or more embodiments of the invention are set forth in the accompanying description below. Although any materials and methods similar or equivalent to those described herein can be used in the practice or testing of the present invention, the preferred materials and methods are now described. Other features, objects and advantages of the invention will be apparent from the description. In the description, the singular forms also include the plural unless the context clearly dictates otherwise. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. In the case of conflict, the present description will control.
The use of analytical devices to ensure food safety has not yet advanced to the point of fulfilling its promise. In particular, portable devices based on simple, yet accurate, sensitive and rapid detection schemes have not yet been developed for detection of the wide variety of known allergens. One of the more recent reviews of aptamer-based analysis in context of food safety control indicated that while a great variety of commercial analytical tools have been developed for allergen detection, most of them rely on immunoassays. It was further indicated that the selection of aptamers for this group of ingredients is emerging (Amaya-Gonzalez et al., Sensors 2013, 13, 16292-16311, the contents of which are incorporated herein by reference in its entirety).
The present invention provides detection systems, devices and agents that can specifically detect low concentrations of allergens in a variety of food samples. The present detection systems, devices and methods use aptamer based signal polynucleotides (SPNs) as detection agents. As used herein, the term “allergen” means a compound, substance or composition that causes, elicits or triggers an immune reaction in a subject. Allergens may also be referred to as antigens. A fluorescent signal such as fluorescence polarization (FP) is measured to indicate the allergen content in the sample.
In one embodiment, the detection system and/or device of the present invention is a miniaturized, portable and hand-held product, which is intended to have a compact size which enhances its portability and discreet operation. A user can carry the detection system and device of the present invention and implement a rapid and real-time testing of the presence and/or absence of one or more allergens in a food sample, prior to consuming the food. The detection system and device, in accordance with the present invention, can be used by a user at any location, such as at home or in a restaurant.
In one embodiment of the present invention, the detection system and/or device displays the testing result as a standard readout and the detection can be implemented by any user following the simple instructions on how to operate the detection system and device.
In some embodiments, the detection system and device is designed for simple, fast, and sensitive one-step execution. An allergen detection testing may be completed in less than 5 minutes.
In accordance with the present invention, the detection system and device may involve a mechatronic design process integrating electrical engineering, mechanical engineering and computing engineering to implement and control the process of an allergen detection testing, including rechargeable or replaceable batteries, motor drivers for processing the test sample, pumps or actuators for controlling the flow of the processed sample solution to different components of the detection device, and connectors that couple and integrate different components for a fast allergen testing. The detection system and device of the present invention also includes an optical system which is configured for detection of the presence and concentration of an allergen of interest in a test sample and convert detection signals into readable signals; and a mechanical part which provides support for other parts of the detection device and integrates different parts together as a functional product.
In some embodiments, the detection system and/or device is designed such that the disposable vessels (e.g., a disposable test cup or cup-like container), unique to one or more specific allergens, are designed for receiving and processing a test sample, and assaying the detection test, in which all the solutions are packed. Therefore, all the solutions may be confined in the disposable cup or cup-like container. As a non-limiting example, a disposable gluten test cup may be used to detect gluten in any food sample by a user and discarded after the testing. Accordingly, the detection device may be a dry device and the solutions are packed as disposables. Such a design will avoid cross-contaminations from different allergen tests.
In some embodiments, a separate sampler that can measure and size a test sample is provided. In one aspect, the sampler can further pre-process the test sample, such as cutting the sample into small pieces, blending, abrading and/or grinding, to make the sample suitable for allergen protein extraction.
In some embodiments, detection agents of the present invention comprise SPNs that specifically recognize a target allergen and generate changes in fluorescence polarization as detection signals. The SPNs may comprise aptamer sequences that are identified through a selection process with high specificity and affinity to a target allergen.
In general, an allergen detection system of the present invention comprises at least one sampler for collecting a test sample, at least one disposable detection vessel for implementing an allergen detection testing, and a detection device for detecting and visualizing the result of the detection testing.
As shown in FIG. 1a and FIG. 1b, an embodiment of the detection system of the present invention comprises a detection device 100 configured for processing a test sample, implementing an allergen detection testing, and detecting the result of the detection testing, a separate food corer 200 as an example of the sampler, and a disposable test cup 300 as an example of the detection vessel. Optionally, a tether 50 may be included for carrying the detection device 100. As used herein, the disposable test cup 300 may be a cup or a cup-like container. The detection device 100 includes an external housing 10 that provides support to the components (as shown in FIGS. 12a-12b, 13a, 14, 15a-15b, and 16-18) of the detection device 100, and a drawer assembly 20 which includes a drawer frame 22 and a drawer well/port 23 for holding a disposable test cup 300. On the front of the drawer frame 22, a drawer grip 21 may be added for a user to operate the drawer assembly in and out of the housing 10. The external housing 10 also provides surface space for buttons that a user can operate the device. An execution/action button 40 that allows a user to execute an allergen detection testing and an on/off slider 30 that allows a user to turn on and/or off the detection device 100 may be included. A display window 60 (shown in FIG. 1b) and an optional plug (not shown) for external power charge may also be included. Optionally, a lanyard 51 for the attachment of the optional tether 50 may be included on the outer surface of the external housing 10.
During the process of implementing an allergen detection testing, the food corer 200 with a sample being picked up is inserted into the disposable test cup 300 and the disposable test cup 300 is inserted into the drawer well/port 23 of the detection device 100 for detection, as shown in FIG. 1b.
The assembly of the detection system shown in FIG. 1a and FIG. 1b is not intended to be limiting. Other ways to assemble the disposable test cup 300, the food corer 200 and the detection device 100 are within the scope of the present invention. One example includes that the detection device 100 may be configured to grab the disposable test cup 300 from the side or the top of the test cup 300, such as an alternative assembly shown in FIG. 11. In another aspect, the detection device 100 may be configured to have a door that can be lifted for connecting the detection device 100 with the disposable test cup 300 and the food corer 200.
Collecting a right-sized sample is an important step for implementing allergen detection testing. In some embodiments of the present invention, a separate sampler for picking up and collecting test samples (e.g. food samples) is provided. In one aspect, a coring-packer-plunger concept for picking up and collecting a food sample is disclosed herein. Such mechanism may measure and collect one or several sized portions of the test sample and provide pre-processing steps such as cutting, grinding, abrading and/or blending, for facilitating the homogenization and extraction or release of allergen proteins from the test sample. According to the present invention, a separate food corer 200 is designed for picking up different types of food samples and collecting a sized portion of a test sample.
As shown in FIG. 2a to FIG. 2c, the food corer 200 has a distal portion provided with a corer top cap 110 (FIG. 2a) at the distal end, a proximal portion provided with a sample collecting tube 140 (FIG. 2b), a grip 120 (FIG. 2b) for handling the food corer 200 which is connected to the collecting tube 140, and a plunger 130 (FIG. 2a) inside the sample collecting tube 140 which has a distal end connected to the corer top cap 110 and a proximal plunger tip 150 which may protrude from the sample collecting tube 140 for directly contacting a test sample and picking up a sized portion of the test sample (FIGS. 2a-2c). The shape of the proximal plunger tip 150 may be configured for pre-processing the collected sample. The proximal end of the food corer 200 may be further featured with a snap or the like, which can reduce the incidence of spillage of the collected test sample when being transferred from the food corer 200 to the test cup 300.
The parts of the food corer 200 may be designed as any shape for easy handling such as triangular, square, octagonal, circular, oval, and the like.
In some embodiments, the size of the food corer 200 is designed to fit in the corer port 213 on the top of the cup lid assembly 210 (FIG. 3a). In other embodiments, the food corer 200 may be further provided with a means for weighing a test sample being picked up, such as a spring, a scale or the equivalent thereof. As a non-limiting example, the food corer 200 may be provided with a weigh tension module.
Alternatively, other sample pickups may be designed for picking up and collecting different types of test samples. Other designs for sample pickups may include bisecting corer, syringe corer with a blade (e.g., X-Acto blade) across the diameter of the syringe; or alternatively, a syringe corer which is placed directly on top of X-acto blade. The blade may help to divide the cored sample into two or more small pieces, making them easier to be processed and homogenized.
The food corer 200 and the plunger 130 may be made of plastic materials, including but not limited to, polycarbonate (PC), polystyrene (PS), polymethylmethacrylate (PMMA), polyester (PET), polypropylene (PP), high density polyethylene (HDPE), polyvinylchloride (PVC), thermoplastic elastomer (TPE), thermoplastic urethane (TPU), acetal (POM), polytetrafluoroethylene (PTFE), or any polymer, and combinations thereof. The plunger 130 may be sealed to the corer using any materials that can provide resistance to heat, liquids and UV light, etc., for example, Buna-n, Fluoroelastomer, Silicone, Ethylene propylene diene monomer (EPDM) elastomers, Neoprene, Polyurethane (PU), and PTFE.
In accordance with the present invention, at least one separate detection vessel is provided as part of the detection system. The detection vessel is disposable and used for a particular allergen(s). A disposable detection vessel is designed for processing a test sample, extracting allergen proteins from the test sample, storing reaction solutions and detection agents, contacting/mixing the test samples with the detection agents; and/or providing an optical window for fluorescent signal measurement. A disposable detection vessel of the present invention comprises one or more reaction chambers wherein the analytical detection assays occur. That is, a disposable detection vessel is intended to be used only once for an allergen testing in a sample and therefore may be made of low cost plastic materials, for example, transparent high density polyethylene (HDPE), polycarbonate (PC), polymethylmethacrylate (PMMA), polypropylene (PP), polyvinylchloride (PVC), polystyrene (PS), polyester (PET), or other thermoplastics. Accordingly, a disposable detection vessel may be designed for any particular allergen of interest. In some embodiments, these disposable vessels may be designed for one particular allergen only, which may avoid cross contamination with other allergen reactions. In other embodiments, these disposable vessels may be designed for detecting two or more different allergens in a test sample in parallel. In some aspects, the disposable vessels may be designed for detecting two, three, four, five, six, seven, or eight different allergens in parallel.
As shown in FIG. 3a, the disposable detection vessel may be a disposable test cup 300 or a cup-like container. According to one embodiment of the test cup, as shown in FIG. 3a, the assembled disposable test cup 300 includes a cup lid assembly 210 and a cup body 220 for receiving a test sample, processing the test sample and contacting/mixing the processed sample with the detection agents (e.g., signal polynucleotides (SPNs)). FIG. 3b through FIG. 3g show an exploded view of the disposable test cup 300. FIG. 3b illustrates the label/final fluid seal 211, which can inform a user which allergen(s) the test cup is intended to detect. FIG. 3c illustrates the optical window/fluid seal 216 with the test cup port 214. The optical window/fluid seal 216 can be aligned with the optical subsystem 520 (FIG. 16 and FIG. 17) of the detection device 100 to allow light through during signal detection. FIG. 3d illustrates the homogenizer rotor 240. The homogenizer rotor 240 can be inserted into the test cup 300 through the port 212. FIG. 3e illustrates the cup lid assembly 210. FIG. 3f illustrates the flow tube cap and filter assembly 224. FIG. 3g illustrates the cup body 220. The cup lid assembly 210 has multiple functions in addition to the closure of the disposable test cup 300 (FIG. 3a). As shown in FIG. 3a, FIG. 3e and FIG. 6d, the cup lid assembly 210 has three ports: a rotor port 212 for housing a homogenizer rotor 240 and a homogenizer stator 230; a food corer port 213 for receiving a food corer 200 and receiving a test sample, and a test cup port 214 for connecting the disposable test cup 300 to a flow controlling component (e.g., vacuum or pressure ducts); and a means 218 (as shown in FIG. 6d) for aligning and stabilizing the cup lid assembly 210 when the cup lid assembly 210 is assembled with the cup body 220 to form a test cup 300.
The test cup 300 includes one or more reaction chambers 223. All the analytical reactions occur in the reaction chambers 223. The reaction chambers 223 are places where a processed sample is mixed with the detection agents pre-stored within the test cup 300 and a detectable signal (e.g., a fluorescent signal) is generated. In some aspects, a reaction chamber 223 may be designed as a control chamber for measuring the total protein content in a test sample depending on the detection assay implemented. In other aspects, a reaction chamber 223 may be designed suitable for measuring other background signals depending on the types of assays and detection signals measured. Alternatively, an additional control chamber 225 may be added to any part of the test cup, for example to the cup lid assembly 210 as shown in FIG. 4b. The multiple reaction chambers 223 may be configured at various places inside the test cup 300, including but not limited to the cup lid assembly 210 (FIG. 3a, FIG. 3e and FIGS. 4a-4b), the side or the bottom of the cup body 220 (FIG. 5a and FIG. 5b), a separate part of the divided cup body 220 (FIGS. 7a-7d). The multiple reaction chambers 223 can be in different shapes and are orientated with each other differently (FIGS. 3a, 4b, 5a and 7a-7d).
In one embodiment of the detection system, the reaction chambers 223 are included in the cup lid assembly 210 (FIGS. 3a-3g, and FIGS. 4a-4b). In this embodiment, the cup lid assembly 210 further comprises a fluid channel 215 for bringing the extracted sample solution to the two reaction chambers 223 (FIGS. 3a-3g). Through the food corer port 213, the test sample collected by a food corer 200 can be plunged into the cup body 220 for homogenization and extraction of allergen proteins. Through the test cup port 214, which is used to link the disposable test cup 300 to the flow control component of the detection device 100, the extracted allergen proteins from the test sample may be pumped or pressed out of the cup body 220 and flow through the flow tube 221 into the fluid channel 215 and then to the two reaction chambers 223. An optical window/fluid seal 216 provides liquid sealing and optical access to the two reaction chambers 223. A label/final fluid seal 211 provides final liquid seal and identification for the cup assembly (e.g. a designation of gluten that indicates the disposable test cup 300 is used for detecting the gluten allergen). In one aspect, a flow tube cap and filter assembly 224 is provided to prevent humidification of the solid reagents stored in the two reaction chambers 223 and filtration of the large particles from the homogenized protein and/or buffer solution.
In one preferable embodiment as shown in FIG. 3a and FIG. 4b, two independent reaction chambers 223 are provided in the cup lid assembly 210, including one analytical chamber for the allergen detection reaction in which the detection agents specific to an allergen of interest are provided and wherein the allergen detection reaction occurs, and one control chamber for measurement of background signals in which a chemical solution, if needed, for measuring the background signals in the test sample are provided. The two reaction chambers 223 on the top of the cup lid assembly 210 are connected to the fluid channel 215 through which the flow of the extracted protein solution is pumped or pressed into the two reaction chambers 223. The detection agents specific to an allergen and the chemical solution for measurement of background signals in the reaction chambers 223 may be dry powder and can be mixed with the processed sample solution that flows from the flow tube 221 and the fluid channel 215 to the reaction chambers 223. Alternatively, the detection agents and the chemical solution may be resuspended in an appropriate buffer. The two reaction chambers 223 may be configured to receive the processed sample solution in parallel or sequentially, but preferably in parallel. The fluorescent signals (e.g., fluorescent intensity and fluorescent polarization) from the allergen analytical chamber and the background signals from the control chamber will be detected by an optical subsystem (e.g., the optical subsystem 520 shown in FIG. 16 and FIG. 17) of the detection device 100. In some embodiments, more than one allergen analytical chambers may be configured on the top of the cup lid assembly 210, such as two, or three, or four, or five, or six, or seven, or eight, or more allergen analytical chambers, in each of which the detection agents specific to a different allergen may be provided. Such multiplex design will allow a user to detect several allergens in a test sample at the same time, in condition that the user is allergic to multiple allergens. In some aspects, these reaction chambers are designed for parallel detection reactions. That is to say, all reactions may occur in parallel.
As noted above and shown in FIG. 4b, it is within the scope of the present invention that more than two reaction chambers 223 may be designed on the top of the cup lid assembly 210. In certain embodiments, three or more chambers may be designed on the top of the cup lid assembly 210. In one particular embodiment, three chambers are provided including two reaction chambers 223 and one additional control chamber 225 which may be used to measure non-specific background signals from the allergen detection assay. FIG. 4b illustrates an exemplary configuration of the three chambers, two reaction chambers 223 and one control chamber 225, on the top of the cup lid assembly 210. It is understandable to one of skill in the art that this particular configuration is illustrated to present the concept thus is not limiting. The position of each chamber may vary dependent on the design of the cup lid assembly 210 and the number indications are not limiting either. Each chamber may be designated as an analytic chamber for detecting signals from the interaction between an detection agent and the allergen of interested in the test sample, or a chamber for measuring total proteins isolated from the test sample, or a control chamber for measuring non-specific background signals from the detection assay. The three chambers may be connected to the fluid channel 215, receiving a portion of the processed test sample solution through the flow tube 221. To avoid the interference among different chambers which may cause misleading detection results, one or more air vent 217 (FIG. 4b) may be added within the fluid channel 215 to prevent the liquid flow between reaction chambers 223.
It is within the scope of the present invention that one or more reaction chambers 223 and the optional control chamber 225 are not necessarily being designed on the top of the cup lid assembly 210. The one or more reaction chambers 223 and the optional control chamber 225 may be located at any parts of the test cup or the cup like container 300. In addition to the configurations illustrated in FIG. 3a and FIG. 4b, alternative embodiments may also be provided. As illustrated in FIGS. 5a and 5b, the one or more reaction chambers 223, and/or the optional control chamber 225 (not shown in FIG. 5a and FIG. 5b) may be located at the bottom of the cup body 220, directly receiving the test sample solution after being filtered by the filter membrane 226 (FIG. 5a). FIG. 5b further illustrates a view from the bottom of the test cup 300. According to this particular embodiment, the optical window/fluid seal 216 is used to seal the reaction chambers 223 and/or the optional control chamber 225 to provide a window to read the detection signals. Additionally a valve 228 may be provided, allowing control of the flow of the processed sample solution. The valve 228 may be an umbrella valve, a duckbill valve, other one way valves, a frangible seal or the like. For example, internal frangible seals may be used to enable the controlled release of the sample solution.
Alternatively, the cup body 220 of a disposable test cup 300 may be divided into two separate parts (FIGS. 6a-6d and FIGS. 7a-7d), one part configured for receiving and processing the test sample collected by the food corer 200 or other types of samplers and extracting allergen proteins from the test sample, and the other configured for including one or more reaction chambers 223 and/or the optional control chamber 225. The shapes of each part of the divided cup body 220 may vary. As non-limiting examples, FIG. 6a illustrates an alternative cup body design 220′ with a triangle shaped part for processing the test sample and a rectangle part for holding the reaction chambers. FIG. 6b illustrates another alternative cup body design 220″ with a circular part for processing the test sample and a rectangle part for holding the reaction chambers.
As noted above and shown in FIGS. 7a to 7d, the reaction chambers 223 and the optional control chamber 225 may be configured at one of the two separate parts of the cup body 220. FIGS. 7a to 7d illustrate some examples of arrangements of the reaction chambers 223 and/or the optional control chamber 225 inside the separate part of the cup body 220. The reaction chambers 223 (and the optional control chamber 225) can be configured into any layout arrangement, for example, side-by-side (FIG. 7a, viewed from the top of the cup), stacked orientation as shown in FIG. 7b, front-and-back (FIG. 7c), or in a diagonal orientation (FIG. 7d).
In this aspect, the cup lid assembly 210 of the test cup 300 may be shaped to match the shape of the cup body 220. As shown in FIGS. 6c and 6d, the cup lid assembly 210 of an assembled test cup 300 with two separate parts of the cup body 220 comprises three ports 212, 213 and 214. A means 218 for aligning and stabilizing the assembly may be included too. In the embodiment that the reaction chambers are included in one part of the divided cup body, a vacuum gasket 840 comprising air vent 217 and vacuum port seal 219 may be inserted underneath of the cup lid assembly 210 as shown in an exploded view in FIG. 6d.
In some embodiments, the reaction chambers 223 and the optional control chamber 225 can be in any shapes, including but not limited to circle, triangle, rectangle and wedge.
To form an operable detection vessel, i.e. a test cup 300, the cup lid assembly 210 and the cup body 220 are assembled together. Means for aligning and stabilizing the assembly (e.g., features 218 as illustrated in FIG. 6d) may be included. A label/final fluid seal 211 is attached to the assembled test cup, for example on the top of the cup lid assembly 210. The label indicates the target allergen to be tested using the test cup 300. In one example, when the reaction chambers 223 included in the cup lid assembly 210, the label/final fluid seal 211 is attached to the top of the optical window/fluid seal 216 as shown in FIG. 3c. In another example, when the reaction chambers 223 are positioned at the bottom of the cup body 220 (FIG. 5a) or one of the two separate parts of the cup body 220 (FIGS. 7a-7d), the label/final fluid seal 211 is attached directly to the cup lid assembly 210 and also functions as final seal of the test cup 300.
In some embodiments, the homogenizer rotor 240 may be connected to the rotor port 212 on the cup lid assembly 210 as shown in FIG. 4a. In this particular embodiment, the homogenizer stator 230 which is as shown in FIG. 3a and FIG. 3e, welded to the rotor port 212 is not necessarily required. The homogenizer rotor 240 may be directly linked to the rotor port 212 at the inner side of the cup lid assembly 210, through a membrane seal 250. The seal materials may include, but are not limited to thermoplastic polyurethane (TPU), thermoplastic elastomer (TPE), thermoset materials such as Silicone, Rubber (e.g., Buna-N, Neoprene, and Santoprene). The connected two parts which may be composed of materials with different thermo-plasticity and hardness may be fabricated using two-shot plastic injection molding. The connection between the homogenizer rotor 240 and the rotor port 212 may also be produced using over-molding injection molding, thermally welding, ultrasonically welding and/or gluing process, or any other appropriate molding technologies.
A test cup 300 may further comprise a filter that filters a processed sample solution before it is flowed into the reaction chambers 223 and the optional control chamber 225 for allergen detection testing. In some embodiments, as described in FIG. 3a and FIG. 3f, a flow tube cap and filter assembly 224 may be attached to the flow tube 221 for filtering the processed test sample before being delivered to the reaction chambers 223 and the optional control chamber 225. Alternatively, the flow tube cap and filter assembly 224 may be replaced by a simple filter membrane 226 as shown in FIGS. 5a-5b, 8a-8b and 9a-9b. In some aspects, the filter membrane 226 may be aligned in parallel with the cup base 222 of the cup body 220 with a certain distance to the cup base 222 (FIG. 8a). The room between the filter membrane 226 and the cup base 222 allows holding a filtered sample solution. In other aspects, the filter membrane 226 may be inserted into the cup body 220 in parallel with the wall of the cup body 220 with a certain distance to the wall, allowing enough room for holding the filtered sample solution before being delivered (e.g., by pumping or vacuuming) to the reaction chambers 223 and the optional control chamber 225. Alternatively, a small chamber 227 protruding out from the side wall of the cup body 220 where the filter membrane 226 is attached, may be provided; the small chamber 227 will hold the filtered sample solution before being delivered to the reaction chambers 223 and the optional control chamber 225 (FIG. 8b).
In the embodiments that the reaction chambers 223 and the optional control chamber 225 are included in the separate part of the divided cup body 220, a single filter membrane 226 may be inserted at the bottom of the cup body 220 underneath of the valve 228, as shown in FIG. 9a. The processed sample solution then is filtered before it is flowed into the reaction chambers 223 and the optional control chamber 225 included in the separate part of the cup body 220.
In some aspects, two or more filter membranes 226 may be inserted into the cup body 220. The filter membranes 226 are assembled to form a filter stage. In one example illustrated in FIG. 9b, one filter membrane 226 may be positioned in the middle of the cup body 220 to filter the processed sample solution before it is driven through the valve 228; and another filter membrane 226 is configured at the bottom of the cup body, to re-filter the processed sample solution before it is flowed into the reaction chambers 223 and the optional control chamber 225. In some aspects, the top filter membrane 226 may have a larger pore size than the filter membrane 226 at the bottom.
The filter membrane 226 may be a nylon, PES (poly-ethersulfone), Porex™, or the membrane polymers such as mixed cellulose esters (MCE), cellulose acetate, PTFE, polycarbonate, or the like. It may be a thin membrane (e.g., 150 μm thick) with high porosity. In some aspects, the pore size of the filter membrane 226 may range from 20 μm to 300 μm, or any size in between. For example, the pore size may be 20 μm, 25 μm, 30 μm, 35 μm, 40 μm, 45 μm, 50 μm, 55 μm, 60 μm, 65 μm, 70 μm, 75 μm, 80 μm, 85 μm, 90 μm 100 μm, 150 μm, 200 μm, 250 μm, or 300 μm.
The cup lid assembly 210 may be composed of a thermoplastic including, but not limited to polymethylmethacrylate (PMMA), polystyrene (PS), polycarbonate (PC), polyester (PET), polypropylene (PP), high density polyethylene (HDPE) and polyvinylchloride (PVC), or combinations thereof.
The cup body 220 is intended to receive a test sample from the food corer 200 to be homogenized for extraction of allergen proteins and may have a wider distal end which is connected to the cup lid assembly 210, and a cup base 222 (FIG. 3g). In certain embodiments, the cup body 220 contains a volume of extraction buffer for extraction and digestion of the test sample. The volume of extraction buffer may range from about 100 μL to about 500 or from about 500 μL to about 2.5 mL. In the cup the digestion volume should be 500 mL. In the detection chambers it should range from 10 μl to 300 μl. In some embodiments, the volume of buffer may be 100 μL, or 200 μL, or 300 μL, or 400 μL, or 500 μL, or 1 mL, or 1.2 mL, or 1.4 mL, or 1.6 mL, or 1.8 mL, or 2.0 mL, or 2.5 mL.
In other embodiments of the present invention, the allergen detection reaction may occur in the cup body 220 and the fluorescent signals will be detected by an optical subsystem (e.g., the optical subsystem 520) of the detection device 100. Accordingly, the cup body 220 may include detection molecules (e.g., SPNs) which specifically bind to one or more allergens to be tested. The detection agents may be confined in any local regions of the cup body 220, such as at the bottom of the cup base 222 and released into the cup body and mixed with the extracted protein solution for the detection assay. The allergen and detection agent mixture may be pumped or pressed into the reaction chambers 223 and the optional control chamber 225 for signal analysis.
Typically, a disposable test cup 300 has a capacity suitable for a sample of about 0.25-5 g. The cup body 220, which is intended for dissociating/homogenizing the test sample in an extraction buffer, may have a capacity of about 0.5 mL-10 mL.
In other embodiments, the cup body 220 may be made of soft materials. In such case, after insertion of a test sample, the cup body 220 including the solution inside may be pressed into one of the reaction chambers 223 on the top of the cup lid assembly 210 by an external pressure, such as a pressure from the detection device 100. Such pressure, compression, or agitation may also serve to process the test sample.
As one skilled in the field would expect that the present disposable detection vessel, for example, the test cup 300 as disclosed herein, is not limited to its usage in the present detection system. The detection vessel may be further modified to be operable in other similar analyte detection systems (e.g., protein, nucleic acids and other molecules.
In some embodiments, the detection device 100 may be configured to have two parts: an external housing that provides support surfaces for the components of the detection device 100; and a part that can open the detection device 100 for inserting a disposable test cup 300 and a food corer 200. One embodiment of the allergen detection device 100 according to the present invention is depicted in FIGS. 1a-1b, 10a-10b, 11 and 12a-12b. As illustrated in FIG. 1a and FIG. 1b, the detection device 100 comprising an external housing 10 that provides support for holding the components of the detection device 100 together and integrates them as a functional integrity for implementing an allergen detection testing; and a drawer assembly 20 that may be pulled out from and slide back into the external housing 10. The external housing 10 may be formed of plastic or other suitable support material.
As shown in FIG. 10a, the external housing 10 may include a housing cover 310 and a housing base 320, on which a button port 40a for the execution/action button 40, and an on/off slider port 30a for the on/off slider 30 are provided. Additionally, an alignment 340 may be incorporated into the alignment site 340a on the top front of the external housing 10 for aligning the disposable test cup 300 with the detection device 100 when implementing an allergen detection testing. A groove 330 at each side of the bottom of the housing base 320 is used to sled the drawer assembly 20. The drawer assembly 20 (FIG. 10b) may include a drawer frame 22 on the front of which there is a drawer grip 21 which is configured for a user to handle the drawer assembly 20 during a detection testing, and a drawer well/port 23 for insertion of a disposable test cup 300. A sled (or chimb) 350 at each side of the drawer frame 22 is provided for sliding the drawer assembly 20 along the groove 330 of the housing base 320.
When the detection device 100 is not in use, the drawer assembly 20 is pushed back into the housing 10, so the detection device 100 is closed and may be easily carried with or stored in a bag (e.g., a handbag).
Alternatively, other configurations that allow the drawer well/port 23 for holding a disposable test cup 300 being reachable may be designed in accordance with the present invention. As a non-limiting example, a claw-like rotating door 410 may be connected to the external housing 10 (as illustrated in FIG. 11). The detection device 100 may be placed over the disposable test cup 300 with the claw-like rotating door 410 to close over the cup during operation. As another non-limiting example, a hinged door that can be lifted may be designed to open the external housing 10 during an allergen detection testing.
To execute an allergen detection test, the detection device 100 is provided with a homogenizer which is configured for homogenizing a test sample and extracting allergen proteins from the test sample in an extraction buffer; means (e.g., a motor) for operating the homogenizer and necessary connectors that connect the motor to the homogenizer; means for driving and controlling the flow of the processed sample solution during the process of the allergen detection testing; an optical subsystem for providing fluorescence excitation and for filtering of fluorescence emission; means for detecting fluorescence emissions from the detection reaction between the allergen in the test sample and the detection agents, and background signals from the control chamber; means for visualizing the detection signals including converting and digitizing the detected signals; a user interface that displays the test results; and a power supply. In some embodiments, a molecule probed with a fluorophore dye (e.g., a random aptamer) that cannot bind the target allergen may be stored in the control chamber. The non-binding molecule provides a means to correct for viscosity and temperature effects. By measuring the difference between the read value and the expected value and using that to scale the measurement from the active reaction chambers.
In one embodiment of the present invention, as shown in FIGS. 12a and 12b, the components of the detection device 100 that are integrated to operate a detection testing, include a motor 510 which may be connected to the homogenizer assembly 570 that is assembled inside the cup body 220 (not shown), an optical subsystem 520 that is connected to the reaction chambers 223 (not shown) within the disposable test cup 300, a gear train/drive platen 530 for driving the rotor during homogenization in an allergen detection testing, a pump 540 for controlling and regulating the flow rate, a PCB 550, and a power supply 560. The components are held inside the drawer assembly 20 which may have a drawer grip 21. The detection device is enclosed by a housing cover 310 and a housing base 320. FIG. 12a illustrates different components of the detection device 100 while FIG. 12b illustrates a view of the detection device 100 when different components are assembled and integrated as a functional device with the food corer 200 and the test cup 300.
In accordance with the present invention, a homogenizer is designed small enough to fit into a disposable test cup 300. Additionally, the homogenizer of the detection device 100 may be optimized for increasing the efficacy of sample homogenization and allergen protein extraction.
FIG. 13a illustrates an assembled breadboard homogenizer assembly 570 which is held inside a cup body 220 and its components. FIGS. 13b-13e illustrate a gearhead 610, a coupling 630, a homogenizer stator 230 and a homogenizer rotor 240. The homogenizer rotor 240 and the homogenizer stator 230 are assembled through the rotor port 212 on the top of the cup lid assembly 210 (not shown, see FIG. 3a). The homogenizer rotor 240 has a distal end provided with a top rotor cap 660 and a proximal end comprising one or more rotor blades 670 or the equivalent thereof (FIG. 13e). The rotor cap 660 may be connected to the rotor port 212 (not shown) and the homogenizer rotor 240 is inserted into the cup lid assembly 210 (not shown) through the rotor port 212 (not shown). The homogenizer rotor 240 is configured to rotate inside the homogenizer stator 230 and pull the test sample from the food corer 200 (not shown) into the bottom of the processing chamber 690. The homogenizer stator 230 has a distal end provided with a stator cap 640 and a proximal end comprising one or more small stator slots 650 (FIG. 13d), which extend into the cup body 220. Through the stator cap 640, the homogenizer stator 230 is seated within the rotor port 212 of the cup lid assembly 210 (not shown). During processing, the test sample is forced radially out through the stator slots 650 at the proximal end of the homogenizer stator 230. The homogenizer stator 230 acts as a flow breaker to largely prevent rotation of the sample, and to introduce large mechanical energies in very small space. A coupling 630 (FIG. 13c) at the distal portion of the homogenizer links the homogenizer rotor 240 to a gearhead 610 (FIG. 13b), which is a part of a gear train or a drive for connection to a motor 510 (not shown, see FIG. 12b and FIG. 14). The gearhead 610 reduces the speed of the motor 510 and increases torque in the liquid and the coupling 630 connects the actuator shaft 620 to the homogenizer rotor 240. The proximal portion of the homogenizer (i.e., the rotor blades 670 and the stator slots 650) spins within the cup body 220 to create shear in the liquid between the stationary teeth of the homogenizer stator 230 and the rotating tines of the homogenizer rotor 240 (FIG. 13a). The vortex is greatly reduced and more energy is introduced in the shearing gap between the rotor and stator. Particles are reduced in size by hitting sharp edges, shearing between the edges of the rotor blades and stator slots.
In some aspects, a heating system (e.g. resistance heating, or peltier heaters) may be provided to increase the temperature of homogenization, therefore to increase the effectiveness of sample dissociation and shorten the processing time. The temperature may be increased to between 60° C. to 95° C., but below 95° C. Increased temperature may also facilitate the binding between detection molecules and the allergen being detected. Optionally a fan or peltier cooler may be provided to bring the temperature down quickly after implementing the test.
Turning to FIG. 14, in some embodiments of the present invention, a motor 510 may be connected to the homogenizer assembly 570 (not shown) through a motor shuttle 710 for engaging the homogenizer rotor 240 (not shown) and homogenizer stator 230 (not shown). A shuttle vertical guide pin 680 through a pin port 680a on the motor shuttle 710 guides the gearhead 610 and the actuator shaft 620 of the homogenizer assembly 570 to the motor 510. A motor shuttle lift pin 720 can further align and raise/lower the motor shuttle 710 and the motor 510 through a lift pin port 720a.
In the sample processing cup body 220, an extraction buffer preloaded in the cup and a test sample plunged from the food corer 200 are mixed. Driven by the motor 510, the homogenizer assembly 570 will homogenize the test sample in the extraction buffer and dissociate/extract allergen proteins. The processed sample solution may be pumped or pressed through the flow tube 221 to the fluid channel 215 on the cup lid assembly 210, then to the analytical chamber which is one of the reaction chambers 223, in which the processed sample solution is mixed with the pre-loaded detection molecules (e.g., SPNs) for the detection testing. In parallel, a portion of the processed sample solution is pumped or pressed to the other control chamber which is one of the reaction chambers 223 on the top of the cup lid assembly 210, in which the extraction solution is measured for background signals.
In some embodiments, the processed test sample may be further filtered through means that can push the processed sample solution through a filter membrane (e.g., a filtering means connected to the homogenizer assembly 570) prior to the flow of the extraction solution to a reaction chamber 223. One example is a flow tube cap and filter assembly 224 illustrated in FIG. 3f The filter pores can be between 0.2 u to 300 u. The filter can be made from any low binding material including, but not limited to, PES (Polyethersulfone), PCTE (Polycarbonate) or PVDF (polyvinylidene difluoride).
In some embodiments, the coupling 630 may have different sizes at each end of the coupling 630, or the same sizes at each end of the coupling 630.
As compared to other homogenizers with similar structural design (e.g., U.S. Pat. No. 6,398,402), the custom blade core of the present invention spins and draws and forces food into the toothed surfaces of the custom cap. The custom o-ring seals between the custom cap and the custom cup which may be clear for visualization of homogenization progress and results. The homogenizer rotor may be made of any thermoplastics, including, but not limited to, polyamide (PA), Acrylanitrilebutadienestyrene (ABS), Polycarbonate (PC), High Impact Polystyrene (HIPS), and Acetal (POM).
In some embodiments, the homogenizer assembly 570 may be designed and modified for different homogenization mechanisms for different types of test samples, to meet specific requirements such as adding mechanical help to break up food, including grinding, cutting, blending, abrading or mixed movements. In some aspects, the homogenizer may include means (e.g., a stator and a corer) for increasing the agitation of the homogenizer. The homogenizer may have a “star knob” style handle which can be twisted to help for coring. The handle of stator/corer may be designed as herb grinder (textured band around edge); or pill crusher (with 3 flowerette knob); or pill crusher (with two winged knob). In other aspects, the stator/corer may by an object stator (e.g., 1 mm thick), PPE syringe corer, fine microplane, coarse microplane, and pulverizor, bead beating (marble agitator or steel ball agitator). In other embodiments, a homogenizer may be a hybrid with mixed processes to dissociate the test sample, for example by grinding and blending.
In some embodiments, the motor 510 can be a commercially available motor, for example, Maxon motor systems: Maxon RE-max and/or Maxon A-max (Maxon Motor ag, San Mateo, Calif., USA).
In some embodiments, a gear train or a drive may be used to connect the motor 510 to the homogenizer assembly 570. A gear train and/or a drive allows the motor 510 to be packaged so it does not interfere with the ability of the food corer 200 to introduce food sample to the homogenizer assembly 570 while allowing the homogenizer stator 230 to be driven from above, and does not require a liquid tight seal during operation. A label/final fluid seal 211 is provided by the applied label or other removable seal proximal to the area surrounding the stator cap 640. The gear train or the drive may also allow the power from the motor 510 to take two right angle turns and is therefore critical to a particular combination of user experience of the detection device 100 and functional requirement for the disposable test cup 300.
The test sample will be processed in an extraction buffer for protein extraction and allergen retrieval. In some embodiments, the extraction buffer may be optimized for increasing protein extraction. The extraction buffer may contain different agents for different test samples, such as those disclosed in Applicants' PCT Application Serial No. PCT/US2014/062656, the contents of which are incorporated herein by reference in its entirety.
In accordance with the present invention, a means for driving and controlling the flow of the processed sample solution and mixing said extraction solution with one or more detection signal molecules is provided. In some embodiments, the means may be a vacuum system or an external pressure. As a non-limiting example, the means may be a platen (e.g., a welded plastic clamshell) configured to being multifunctional in that it could support the axis of the gear train and it could provide the pumping (sealed air channel) for the vacuum to be applied from the pump to the test cup port 214 on the cup lid assembly 210 of the disposable test cup 300.
Referring to FIG. 15a and FIG. 15b, a gear train/drive platen 530 may have a underside to which a pump (e.g., Piezo micropump) 540 is connected; and a topside which is provided with a vacuum duct 850 that is connected to the test cup port 214 (as shown in FIG. 3c) on the top of the cup lid assembly 210 (not shown) of the disposable test cup 300; and air channels 860. A gear train/motor port 810 which is configured for connection to the gear train or the drive that is connected to the motor 510 (not shown) and the homogenizer assembly 570 (not shown). A gear train/cup port 830 at the edge of the gear train/drive platen 530 is surrounded by a vacuum gasket 840 which seals the connection between the test cup port 214 (shown in FIG. 3c) on the top of the cup lid assembly 210 and the gear train/cup port 830. The flow control port 820 provides a flow control of the extraction protein solution from the cup body 220 (not shown) to the reaction chambers 223 (not shown) with active feedback from the optical subsystem 520 (not shown, illustrated in FIG. 16 and FIG. 17), or by fluid mechanical means such as a small orifice or hydrophobic membrane.
The pump 540, such as piezoelectric micro pump (Takasago Electric, Inc., Nagoya, Japan) may be used to control and automatically adjust the flow to a target flow rate. The flow rate of a pump is adjustable by changing either the driver voltage or drive frequency. The pump 540 shown in FIG. 15a is a representation of piezo pumps currently on the market that have specifications that indicate they could be suitable for the aliquot function required to bring filtered sample solution into the two reaction chambers 223 and the optional control chamber 225. The pump 540 may be a vacuum pump or other small pumps designed for laboratory use such as KBF pumps (KNF Neuberger, Trenton, N.J., USA).
The vacuum gasket 840 provides a seal between the gear train/drive platen 530 and the test cup port 214 on the top of the cup lid assembly 210. In some embodiments, the vacuum gasket 840 could also be incorporated into the disposable test cup 300 to increase reliability of the detection device 100. The air channel 860 could also be executed with discrete tubing and fittings. The sample flow tube 221 will be isolated from the fluid channel 215 and reaction chambers 223 such that evaporation of the buffer solution will not prematurely dissolve the reactants by means such as a cap, a duckbill valve, an umbrella valve, a cone valve, X-Fragm (Minivalve) or similar arrangement. Opening pressures of any such valve must be controlled to open during operation but not during storage/shipment due to expansion of the air in the cup. In some aspects, the vacuum gasket 840 is positioned directly underneath of the cup lid assembly 210 as shown in FIG. 6d. The vacuum gasket 840 includes a food corer port 213 and a rotor port 212 which are aligned with the corresponding ports of the lid; one or more air vents 217 and a vacuum port seal 219 to seal the test cup port 214 of the lid.
The detection device 100 of the present invention comprises an optical subsystem that detects signals (e.g., a fluorescent signal) generated from the interaction between an allergen(s) in the sample and detection agents (e.g., SPNs). The optical subsystem may comprise different components and variable configurations depending on the types of the fluorescent signal to be detected. The optical subsystem is close and aligned with the detection vessel, for instance, the reaction chambers 223 and the optional control chamber 225 of the test cup 300 as discussed above. As such, the optical subsystem may be close and aligned with the optical window/fluid seal 216 of the reaction chambers 223 (as shown in FIG. 3c).
In accordance with the present invention, a detectable signal generated from the interaction between detection agents and an allergen(s) in a test sample may be a fluorescent signal, including but not limited to absorbance, fluorescence intensity, luminescence, time-resolved fluorescence (TRF), and fluorescence polarization (FP). In one aspect, a detectable signal from the binding interaction between an allergen(s) in the test sample and detection agents may be changes in fluorescence polarization (FP) of a fluorescent probe, e.g., a fluorophore labeled signaling polynucleotide (SPN), upon the binding of an allergen protein to the fluorophore probed SPN. Accordingly, the optical subsystem is assembled to measure fluorescence polarization (FP).
As used herein, the term “fluorescence polarization (FP)” refers to a phenomenon related to an observation that if a fluorescent molecule is excited by polarized light, the subsequently emitted light will also be polarized in a fixed plane if the molecule remains stationary between excitation and emission. The binding of a large compound (e.g., a protein) to a fluorescently labeled agent changes the rotation of the fluorescent molecule, causing a change in the fluorescence polarization during their fluorescent lifetime which is the period of time between absorption of an excitation photon and the emission of a photon through fluorescence. (Checovich et al., Fluorescence polarization—a new tool for cell and molecular biology, Nature, 1995, 375: 254-256; the contents of which are incorporated by reference herein in their entirety.) Measurement of fluorescent polarization of a fluorescent molecule has been intensively employed in biomedical area where a number of various assays for determination of specific biological compounds are developed based on the FP technology. The method is fast, sensitive and accurate.
In accordance with the present invention, as shown in FIG. 16 and FIG. 17, an optical subsystem 520 that is configured to measure fluorescence polarization may be included as the detector of the detection device 100. More than one polarizing filters (i.e. polarizers) are included in the optical paths.
FIG. 16 illustrates a configuration of the optical subsystem for measuring FP signal. The optical subsystem 520 of the detection device 100 is connected with the reaction chambers 223 and the optional control chamber 225. The optical subsystem 520 includes an excitation optical path which comprises a light emitting diodes (LEDs) or a diode laser 910 (e.g. Avago LED of Luxeon Rebel LED) held by a LED housing (not shown), an excitation filter 920, a excitation polarization filter 930; and an emission optical path which comprises an emission filter 940, an optional beam splitter 970, a pair of emission polarizing filters or membranes 960 and a pair of photodiodes or a photomultiplier tubes (PMT) (photo detectors) 950. The excitation optical path and emission optical path are aligned with the reaction chamber 223 and the optional control chamber 225 within the cup lid assembly 210 or the cup body 220. Both the excitation and emission optical paths contain beam-shaping and collimation optics.
The LEDs or the diode laser 910 provide light of an excitation wavelength appropriate to excite the fluorophore of signaling polynucleotides, through the excitation filter 920. LEDs may have different shapes, e.g. a bulb or a plate. This light is then plane polarized by passing it through the excitation polarizing filter 930. The resulting plane polarized excitation light is directed into the reaction chambers 223 and the optional control chamber 225. The light LED or diode laser light is polarized in either vertical or horizontal direction. The fluorophore probed detection agent is excited and a fluorescent light is reemitted and passes sequentially through the emission filter 940, an optional beam splitter 970 and the emission polarizing filter or membrane 960, and is detected by a photo detector 950. The emission filter 940 allows only the wavelength of interest to pass through from the fluorescence emitted from the reaction chamber 223 for detection by the photo detector 950, and blocks light scatter and non-specific fluorescence before being detected. The pair of emission polarizing filters or membranes 960 and photodiodes or a photomultiplier tubes (PMT) (photo detectors) 950 are arranged at a 90° angle with each other. The pair of emission polarizing filters or membranes 960 polarizes the light re-emitted from the reaction chamber 223 in opposite orientations for each of the photo detectors 950. Alternatively, a beam splitter 970 may be inserted into the emission optical path before the emission light being detected. Signals from the detector (e.g., a spectrometer and a camera) may be converted to digital signals or processed as analog signals, and the amount of allergen corresponding to the signal is indicated in a corresponding display window 60 (not shown, see FIG. 1b), which functions as a user interface screen.
In an alternative configuration as shown in FIG. 17, the optical subsystem for FP measurement comprises the same optical components: a light emitting diodes (LEDs) or a diode laser 910 (e.g. Avago LED of Luxeon Rebel LED) held by a LED housing (not shown), an excitation filter 920, a excitation polarization filter 930, a baffle 1120, an emission filter 940, a pair of emission polarizing filters or membranes 960 and a pair of photodiodes or a photomultiplier tubes (PMT) (photo detectors) 950. The pair of emission polarizing filters or membranes 960 and the photo detectors 950 is arranged in parallel.
As used herein, the term “polarizer or polarizing filter” refers to an optical filter (e.g., a prism) that passes light of a specific polarization and blocks waves of other polarizations. It can convert a beam of light of undefined or mixed polarization into a beam with well-defined polarization, polarized light. Commonly used polarizers include linear polarizers and circular polarizers. Linear polarizers can be divided into two general categories: absorptive polarizers, where the unwanted polarization states are absorbed by the device, and beam-splitting polarizers, where the un-polarized beam is split into two beams with opposite polarization state.
In some embodiments, the two polarizers in the emission optical path may be crossed polarizers, as shown in FIG. 17. Crossed polarizers are two linear polarizers of which the transmission directions are placed at right angles to eliminate all light.
The LEDs integrated into the optical subsystem 520 may be an Avago LED (Avago Technologies, San Jose, Calif., USA), or a Luxeon Rebel LED (Luxeon LEDs, Ontario Canada).
The above described optical subsystem 520 is illustrative examples of certain embodiments. In some embodiments they might have different configurations and/or different components. In some embodiments, the optical assembly or the alternative optical assembly may be configured together with an absorbance measurement assembly. In such configurations, some of the components, such as reaction chambers, excitation sources (LEDs or a diode laser); detectors (e.g. photodiode or PMT), filters and/or other components might be shared by the assemblies.
As shown in FIG. 18, a printed circuit board (PCB) 550 is connected to the optical subsystem 520 and the analytical chamber (i.e. of the reaction chamber 223). The PCB 550 may be configured to be compact with the size of the detection device 100 and at the same time, may provide enough space to display the testing result.
In accordance, the test result may be displayed with back lit icons, LEDs or an LCD screen, OLED, segmented display or on an attached mobile phone application. The user may see an indicator that the sample is being processed, that the sample was processed completely (total protein indictor) and the results of the test. The user may also be able to view the status of the battery and what kind of cartridge he/she placed in the device (bar code on the cartridge or LED assembly). The results of the test will be displayed, for example, as 1) actual number ppm or mg; or 2) binary result yes/no; or 3) risk analysis—high/medium/low or high/low, risk of presence; or 4) range of ppm less than 1/1-10 ppm/more than 10 ppm; or 5) range of mg less than 1 mg/between 1-10 mg/more than 10 mg. The result might also be displayed as number, colors, icons and/or letters. In accordance with the present invention, the detection device 100 may also include other features such as means for providing power supply and means for providing a control of the process. In some embodiments, one or more switches are provided to connect the motor, the micropump and/or the gear train or the drive to the power supply. The switches may be simple microswitches that can turn the detection device on and off by connecting and disconnecting the battery.
The power supply 560 may be a Li-ion AA format battery or any commercially available batteries that are suitable for supporting small medical devices such as Rhino 610 battery, Turntigy Nanotech High dischargeable Li Po battery, or a Pentax D-L163 battery.
A molecule that specifically recognizes an allergen protein may be used in the present invention, such as antibodies, nucleic acid molecules (e.g., aptamers) and SPNs developed by the present inventors. In some embodiments, the present invention further provides signaling polynucleotides (SPNs) that are derived from aptamers specifically bind to an allergen. The SPNs may be labeled with a fluorophore marker at one end of the nucleic acid sequence, i.e. the 5′ terminus or 3′ terminus.
While a great variety of commercial analytical methods have been developed for allergen detection, most of them rely on antibody based immunoassays. Antibodies as detection agents for allergen detection have generated great specificity. However, immunoassays are time consuming, require trained personnel to read the test results, are difficult to miniaturize, and are not fully standardized. Moreover, immunoassay methods often cause false positive results which are often attributed to matrix and cross-reactivities. One of the more recent reviews of aptamer-based analysis in context of food safety control indicated that the selection of aptamers for this group of ingredients is emerging (Amaya-Gonzalez et al., Sensors 2013, 13: 16292-16311, the contents of which are incorporated herein by reference in its entirety).
As used herein, the term “aptamer” refers to a class of small single-stranded nucleic acid species that has been engineered through repeated rounds of in vitro selection or equivalently, SELEX (systematic evolution of ligands by exponential enrichment) that fold into a well-defined three-dimensional structure, to bind to various molecular targets such as small molecules, proteins, nucleic acids, and even cells, tissues and organisms. The binding specify and high affinity to target molecules, the sensitivity and reproductively at ambient temperature, the relatively low production cost, and the possibility to develop an aptamer core sequence that can recognize any protein, ensure an effective but yet simple detection assays for the sensors of the detection device as described herein.
Aptamers are particularly well suited to provide core/binding sequences for detection agents because the iterative approach of the SELEX (systematic evolution of ligands by exponential enrichment) process (described herein below) can be used to produce aptamers against essentially any molecular target (or portion thereof). Such aptamers have high affinity and binding specificity for their targets. The present inventors have recognized that production of signaling polynucleotides (SPNs) (described in detail herein below) using an aptamer as the core/binding sequence allows convenient linkage to various reporter molecules. The relatively low production cost of signaling polynucleotides based on aptamer core/binding sequences is also advantageous with respect to the objective of development of simple, yet effective detection assays for biomolecule sensors. The present inventors have recognized that allergen detection in various matrices of food products can be conveniently performed using aptamer-based detector sequences such as signaling polynucleotides, which are particularly well suited for use in a simple and portable sensor that can be used repetitively with high sensitivity and reproducibility at ambient temperature to ensure food safety.
A recent review describes analytical strategies developed using aptamers for the control of pathogens, allergens, adulterants, toxins and other forbidden contaminants to ensure food safety (Amaya-Gonzalez, et al., Aptamer-Based Analysis: A Promising Alternative for Food Safety Control, Sensors, 2013, 13:16292-16311; Amaya-Gonzalez, et al., Aptamer binding to coelic disease-triggering hydrophobic proteins: a sensitive gluten detection system. Anal. Chem. 2014, 86(5): 2733-2739; the contents of each of which are incorporated herein by reference in their entirety). A method of detection of gluten is also described in PCT Publication PCT/ES2013/000133, 28 Jun. 2013, to Amaya-Gonzalez, et al; the contents of which are incorporated herein by reference in their entirety.
By way of non-limiting example, a process for in vitro selection of a single stranded DNA aptamer specific for the anaphylactic toxic allergen, β-conglutin, Lup an 1 has been reported (Nadal, et al., DNA Aptamers against the Lup an 1 Food Allergen. PLoS ONE, 2012, 7(4): e35253; the contents of which are incorporated herein by reference in its entirety). Briefly, the β-conglutin subunit from lupin was purified and chemically crosslinked to magnetic beads. Peptide mass fingerprinting was used to ensure the presence of the β-conglutin on the surface of the beads. A DNA library pool having a population variability of 1014 was amplified using a phosphorothioated forward primer and the T7 Gene 6 Exonuclease to generate single stranded 93-mer DNA sequences. The library pool was incubated with the protein-conjugated magnetic beads. Each round of SELEX was monitored using PCR, comparing the amount of DNA liberated from the protein-conjugated beads to that obtained from unconjugated beads. Evolution was monitored using enzyme linked oligonucleotide assay (ELONA) and surface plasmon resonance (SPR). After 15 rounds of SELEX, the enriched DNA was cloned, sequenced and consensus motifs identified, the affinity and specificity of these motifs were evaluated, and their secondary structures predicted. The resulting aptamers were evaluated using competitive ELONA for the detection and quantification of the β-conglutin lupin allergen. Thus, the original 93-mer with KD 3.6×10−7 was selected and truncated to an 11-mer with KD of 1.7×10−9 (Nadal, et al., Probing high-affinity 11-mer DNA aptamer against Lup an 1 (β-conglutin). Anal. Bioanal. Chem. 2013, 405: 9343-9349; the contents of which are incorporated herein by reference in its entirety). This truncated 11-mer is guanine-rich and predicted to fold into G-quadruplex structures, composed of stacked guanine tetrads, which are stabilized by Hoogsteen-type hydrogen bonds between the guanines and by interactions with cations located between the tetrads. A sensitive method exploiting fluorescence resonance energy transfer (FRET) was recently reported for rapid and sensitive detection of Lup an 1, using a high affinity dimeric form of the truncated 11-mer anti-β-conglutin aptamer, with each monomeric aptamer being flanked by donor/acceptor moieties. The dimeric form in the absence of target yields fluorescence emission due to the FRET from the excited fluorophore to the proximal second fluorophore. However, upon addition of β-conglutin, the specific interaction induces a change in the bi-aptameric structure resulting in an increase in fluorescence emission. The method is highly specific and sensitive, with a detection limit of 150 pM, providing an effective tool for the direct detection of the toxic β-conglutin subunit in foodstuffs in just 1 min. at room temperature (Mairal, et al., FRET-based dimeric aptamer probe for selective and sensitive Lup an 1 allergen detection. Biosensors and Bioelectronics, 2014, 54: 207-210; the contents of which are incorporated by reference herein in their entirety).
Nucleic acid aptamers (DNA or RNA) are usually engineered through repeated rounds of in vitro selection or equivalently, SELEX (systematic evolution of ligands by exponential enrichment) to bind to various molecular targets such as small molecules, proteins, nucleic acids, and even cells, tissues and organisms. Nucleic acid aptamers have specific binding affinity to molecules through interactions other than classic Watson-Crick base pairing. Nucleic acid aptamers, like peptides generated by phage display or monoclonal antibodies (mAbs), are capable of specifically binding to selected targets and, through binding, block their targets' ability to function.
Aptamers, often called “chemical antibodies,” have characteristics which are similar to those of antibodies. A typical nucleic acid aptamer is approximately 10-15 kDa in size (20-45 nucleotides), binds its target with at least nanomolar affinity, and discriminates against closely related targets.
Aptamers may be either monovalent or multivalent. Aptamers may be monomeric, dimeric, trimeric, tetrameric or higher multimeric. Individual aptamer monomers may be linked to form multimeric aptamer fusion molecules. As a non-limiting example, a linking oligonucleotide (i.e., linker) may be designed to contain sequences complementary to both 5′-arm and 3′-arm regions of random aptamers to form dimeric aptamers. For trimeric or tetrameric aptamers, a small trimeric or tetrameric (i.e., a Holiday junction-like) DNA nanostructure will be engineered to include sequences complementary to the 3′-arm region of the random aptamers, therefore creating multimeric aptamer fusion through hybridization. In addition, 3 to 5 or 5 to 10 dT rich nucleotides can be engineered into the linker polynucleotides as a single stranded region between the aptamer-binding motifs, which offers flexibility and freedom of multiple aptamers to coordinate and synergize multivalent interactions with cellular ligands or receptors.
Alternatively, multimeric aptamers can also be formed by mixing biotinylated aptamers with streptavidin.
As used herein, the term “multimeric aptamer” or “multivalent aptamer” refers to an aptamer that comprises multiple monomeric units, wherein each of the monomeric units can be an aptamer on its own. Multivalent aptamers have multivalent binding characteristics. A multimeric aptamer can be a homomultimer or a heteromultimer. The term “homomultimer” refers to a multimeric aptamer that comprises multiple binding units of the same kind, i.e., each unit binds to the same binding site of the same target molecule. The term “heteromultimer” refers to a multimeric aptamer that comprises multiple binding units of different kinds, i.e., each binding unit binds to a different binding site of the same target molecule, or each binding unit binds to a binding site on different target molecule. Thus, a heteromultimer can refer to a multimeric aptamer that binds to one target molecule at different binding sties or a multimeric aptamer that binds to different target molecules. A heteromultimer that binds to different target molecules can also be referred to as a multi-specific multimer.
Nucleic acid aptamers comprise a series of linked nucleosides or nucleotides. The term “nucleic acid,” in its broadest sense, includes any compound and/or substance that comprise a polymer of nucleotides. These polymers are often referred to as polynucleotides. Exemplary nucleic acid molecules or polynucleotides of the invention include, but are not limited to, either D- or L-nucleic acids, ribonucleic acids (RNAs), deoxyribonucleic acids (DNAs), threose nucleic acids (TNAs), glycol nucleic acids (GNAs), peptide nucleic acids (PNAs), locked nucleic acids (LNAs, including LNA having a β-D-ribo configuration, α-LNA having an α-L-ribo configuration (a diastereomer of LNA), 2′-amino-LNA having a 2′-amino functionalization, and 2′-amino-α-LNA having a 2′-amino functionalization) or hybrids thereof.
The skilled artisan will recognize that the term “RNA molecule” or “ribonucleic acid molecule” encompasses not only RNA molecules as expressed or found in nature, but also analogs and derivatives of RNA comprising one or more ribonucleotide/ribonucleoside analogs or derivatives as described herein or as known in the art. Strictly speaking, a “ribonucleoside” includes a nucleoside base and a ribose sugar, and a “ribonucleotide” is a ribonucleoside with one, two or three phosphate moieties. However, the terms “ribonucleoside” and “ribonucleotide” can be considered to be equivalent as used herein. The RNA can be modified in the nucleobase structure, the ribofuranosyl ring or in the ribose-phosphate backbone.
Nucleic acid aptamers may be ribonucleic acid, deoxyribonucleic acid, or mixed ribonucleic acid and deoxyribonucleic acid. Aptamers may be single stranded ribonucleic acid, deoxyribonucleic acid or mixed ribonucleic acid and deoxyribonucleic acid.
In some embodiments, the aptamer comprises at least one chemical modification. In some embodiments, the chemical modification is selected from a chemical substitution of the nucleic acid at a sugar position, a chemical substitution at a phosphate position and a chemical substitution at a base position. In other embodiments, the chemical modification is selected from incorporation of a modified nucleotide; 3′ capping; conjugation to a high molecular weight, non-immunogenic compound; conjugation to a lipophilic compound; and incorporation of phosphorothioate into the phosphate backbone. In a preferred embodiment, the high molecular weight, non-immunogenic compound is polyalkylene glycol, and more preferably is polyethylene glycol (PEG). The process of covalent conjugation of PEG to another molecule, normally a drug or therapeutic protein is known as PEGylation. PEGylation is routinely achieved by incubation of a reactive derivative of PEG with the target molecule. The covalent attachment of PEG to a drug or therapeutic protein can mask the agent from the host's immune system, thereby providing reduced immunogenicity and antigenicity, and increase the hydrodynamic size (size in solution) of the agent which prolongs its circulatory time by reducing renal clearance. PEGylation can also provide water solubility to hydrophobic drugs and proteins.
In another preferred embodiment, the 3′ cap is an inverted deoxythymidine cap.
In some embodiments, nucleic acid aptamers are provided in which the P(O)O group is replaced by P(O)S (“thioate”), P(S)S (“dithioate”), P(O)NR2 (“amidate”), P(O)R, P(O)OR′, CO or CH2 (“formacetal”) or 3′-amine (—NH—CH2-CH2-), wherein each R or R′ is independently H or substituted or unsubstituted alkyl. Linkage groups can be attached to adjacent nucleotide through a —O—, —N—, or —S— linkage. Not all linkages in the nucleic acid aptamers are required to be identical.
As non-limiting examples, a nucleic acid aptamer can include D-ribose or L-ribose nucleic acid residues and can also include at least one modified ribonucleoside including but not limited to a 2′-O-methyl modified nucleoside, a nucleoside comprising a 5′ phosphorothioate group, a terminal nucleoside linked to a cholesteryl derivative or dodecanoic acid bisdecylamide group, a locked nucleoside, an abasic nucleoside, an inverted deoxynucleoside or inverted ribonucleoside, a 2′-deoxy-2′-fluoro-modified nucleoside, a 2′-amino-modified nucleoside, a 2′-alkyl-modified nucleoside, a morpholino nucleoside, a phosphoramidate or a non-natural base comprising nucleoside, or any combination thereof. Alternatively, a nucleic acid aptamer can comprise at least two modified ribonucleosides, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 15, at least 20 or more modified ribonucleosides, up to the entire length of the molecule. The modifications need not be the same for each of such a plurality of modified deoxy- or ribonucleosides in a nucleic acid molecule.
Detection agents which are nucleic acid based may include nucleobase (often referred to in the art simply as “base”) modifications or substitutions. As used herein, “unmodified” or “natural” nucleobases include the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C) and uracil (U). Modified nucleobases include other synthetic and natural nucleobases such as 5-methylcytosine (5-me-C), 5-hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-halouracil and cytosine, 5-propynyl uracil and cytosine, 6-azo uracil, cytosine and thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl anal other 8-substituted adenines and guanines, 5-halo, particularly 5-bromo, 5-trifluoromethyl and other 5-substituted uracils and cytosines, 7-methylguanine and 7-methyladenine, 8-azaguanine and 8-azaadenine, 7-deazaguanine and 7-daazaadenine and 3-deazaguanine and 3-deazaadenine. Further nucleobases include those disclosed in U.S. Pat. No. 3,687,808, those disclosed in Modified Nucleosides in Biochemistry, Biotechnology and Medicine, Herdewijn, P. ed. Wiley-VCH, 2008; those disclosed in The Concise Encyclopedia Of Polymer Science And Engineering, pages 858-859, Kroschwitz, J. L, ed. John Wiley & Sons, 1990, those disclosed by Englisch et al., Angewandte Chemie, International Edition, 1991, 30, 613, and those disclosed by Sanghvi, Y S., Chapter 15, dsRNA Research and Applications, pages 289-302, Crooke, S. T. and Lebleu, B., Ed., CRC Press, 1993.
A suitable nucleotide length for an aptamer may range from about 15 to about 120 nucleotides (nt), and in various other preferred embodiments, 15-30 nt, 20-25 nt, 50-120 nt, 30-100 nt, 30-60 nt, 25-70 nt, 25-60 nt, 40-60 nt, 25-40 nt, 30-40 nt, any of 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39 or 40 nt or 40-70 nt in length. However, the sequence can be designed with sufficient flexibility such that it can accommodate interactions of aptamers with two targets at the distances described herein.
In some embodiments, the nucleic acid aptamer comprises one or more regions of double-stranded character. Such double stranded regions may arise from internal self-complementarity or complementarity with a second or further aptamers or oligonucleotide molecule. In some embodiments the double stranded region may be from 4-12, 4-10, 4-8 base pairs in length. In some embodiments the double stranded region may be 5, 6, 7, 8, 9, 10, 11 or 12 base pairs. In some embodiments the double stranded region may form a stem region. Such extended stem regions having double stranded character can serve to stabilize the nucleic acid aptamer. As used herein, the term “double stranded character” means that over any length of two nucleic acid molecules, their sequences form base pairings (standard or nonstandard) of more than 50 percent of the length.
Aptamers may be further modified to provide protection from nuclease and other enzymatic activities. The aptamer sequence can be modified by any suitable methods known in the art. For example, phosphorothioate can be incorporated into the backbone, and 5′-modified pyrimidine can be included in 5′ end of ssDNA for DNA aptamers. For RNA aptamers, modified nucleotides such as substitutions of the 2′-OH groups of the ribose backbone, e.g., with 2′-deoxy-NTP or 2′-fluoro-NTP, can be incorporated into the RNA molecule using T7 RNA polymerase mutants. The resistance of these modified aptamers to nuclease can be tested by incubating them with either purified nucleases or nuclease from mouse serum, and the integrity of aptamers can be analyzed by gel electrophoresis.
In some embodiments, such modified nucleic acid aptamers may be synthesized entirely of modified nucleotides, or with a subset of modified nucleotides. The modifications can be the same or different. All nucleotides may be modified, and all may contain the same modification. All nucleotides may be modified, but contain different modifications, e.g., all nucleotides containing the same base may have one type of modification, while nucleotides containing other bases may have different types of modifications. For example, all purine nucleotides may have one type of modification (or are unmodified), while all pyrimidine nucleotides have another, different type of modification (or are unmodified). In this way, oligonucleotides, or libraries of oligonucleotides are generated using any combination of modifications as disclosed herein.
In accordance with the present invention, a SELEX approach was used to select core binding aptamers that bind 8 major food allergens (i.e. cashew, egg, milk, peanuts, gluten, fish, crustacean and soy). Several aptamers with sequences that can specifically recognize a target allergen were selected and the nucleic acid sequences of selected aptamers were further modified to generate signaling polynucleotides (SPNs). The aptamers with high selectivity, specificity and stability are selected and further labeled as detection agents. The sequences of the selected aptamers for the 8 major allergens are listed in Table 1. For example, 1501 RiboSPN (SEQ ID NO.: 1) is the full sequence of one of the aptamers that bind cashew. The full sequence includes the primers used for the screen and the core binding sequence of the aptamer (SEQ ID NO.: 2). The core binding sequence will be further modified to generate signaling polynucleotides specific to cashew, as discussed herein below.
In accordance with the present invention, a signaling polynucleotide may be developed from the selected aptamers which specifically bind a target allergen molecule. The polynucleotide sequences are detectable when bound at high affinity and specificity to molecular targets.
In some embodiments, SPNs of the present invention comprise the core binding sequences which determine the specificity and affinity of SPNs to a target allergen molecule. The full sequence of a selected aptamer can be shortened by deleting the primers used for aptamer selection without impacting the binding sequence to a target allergen. Additional nucleotides may also be added at the 5′ terminus and/or the 3′ terminus, without impacting the binding (core) sequence of each aptamer. 3D structures of such SPNs are predicted using standard structure prediction software. The resulting polynucleotide may form an open single structure. In some aspects, the 5′ terminus and 3′ terminus are not necessary to form a close loop structure to bring both ends together. In other aspects, nucleotides added at the termini may increase the stability of the polynucleotide and facilitate the binding of a fluorescent dye. The length and sequence of additional nucleotides may vary in the context of the core binding sequence of a signaling polynucleotide. SPNs generated from aptamers against common allergens are listed in Table 1. For example, 1501-SPN_A (SEQ ID NO.: 3) and 1501 SPN_B (SEQ ID NO.: 4) are two polynucleotides derived from the aptamer 1501 RiboSPN (SEQ ID NO.: 1).
| TABLE 1 |
| Aptamers and SPNs that bind common allergens |
| SEQ | |||
| ID | |||
| Allergen | SPN ID | NO. | Sequence (5′-3′) |
| Cashew | 1501RiboSPN_ | 1 | TAATACGACTCACTATAGGCGTAGCCTGATGAGGCACAC |
| full sequence | CACGTCAAAAATCATTGTCACCACGAAGCCGAAACGTGG | ||
| TGAAAGCCACGT AGCTGCGCC | |||
| 1501 SPN_core | 2 | GCACACCACGTCAAAAATCATTGTCACCACGAAGC | |
| sequence | |||
| 1501 SPN_A | 3 | GCA | |
| GCACACCACGTCAAAAATCATTGTCACCACGAAGC | |||
| TGC | |||
| 1501 SPN_B | 4 | ATGCC | |
| GCACACCACGUCAAAAAUCAUUGUCACCACGAAGC | |||
| GGCAT | |||
| 1494 | 5 | TAATACGACTCACTATAGGCGTAGCCTGATGAGTGCGCA | |
| RiboSPN_full | ACATAAGTCTCTTGAAAGACCACGTTCAACGAAACGTGG | ||
| sequence | TGAAAGCCACGTAGCTGCGCC | ||
| 1494 SPN_core | 6 | TGCGCAACATAAGTCTCTTGAAAGACCACGTTCAA | |
| sequence | |||
| 1494 SPN_A | 7 | CCTGATGAG | |
| TGCGCAACATAAGTCTCTTGAAAGACCACGTTCAA | |||
| CGAAA | |||
| 1494 SPN_B | 8 | UUCCTGATGAG | |
| TGCGCAACATAAGTCTCTTGAAAGACCACGTTCAA | |||
| CGAAA | |||
| 1494 SPN_C | 9 | UAACTGATGAG | |
| TGCGCAACATAAGTCTCTTGAAAGACCACGTTCAA | |||
| CGUA | |||
| 1494 SPN_D | 10 | UACGTGATGAG | |
| TGCGCAACATAAGTCTCTTGAAAGACCACGTTCAA | |||
| CGUA | |||
| 1494 SPN_E | 11 | ACATGATGAG | |
| TGCGCAACATAAGTCTCTTGAAAGACCACGTTCAA | |||
| AUGU | |||
| 1065 | 12 | TAATACGACTCACTATAGGCGTAGCCTGATGAGCACCCA | |
| RiboSPN_full | CCATACCAGAAATGTTGACACCACGTGGACGAAACGTGG | ||
| sequence | TGAAAGCCACGTAGCTGCGCC | ||
| 1065 SPN_core | 13 | CACCCACCATACCAGAAATGTTGACACCACGTGGA | |
| sequence | |||
| 1065 SPN_A | 14 | CCTGATGAG | |
| CACCCACCATACCAGAAATGTTGACACCACGTGGA | |||
| CGAAACGTGG | |||
| 1065 SPN_B | 15 | UGU | |
| CACCCACCATACCAGAAATGTTGACACCACGTGGA | |||
| CGACA | |||
| 1065 SPN_C | 16 | UAU | |
| CACCCACCATACCAGAAATGTTGACACCACGTGGA | |||
| GAUA | |||
| 1065 SPN_D | 17 | UCG | |
| CACCCACCATACCAGAAATGTTGACACCACGTGGA | |||
| AAACGA | |||
| 1065 SPN_E | 18 | UCA | |
| CACCCACCATACCAGAAATGTTGACACCACGTGGA | |||
| AAAUGA | |||
| 1065 SPN_F | 19 | UCGUCC | |
| CACCCACCATACCAGAAATGTTGACACCACGTGGA | |||
| AAAACGA | |||
| 1065 SPN_G | 20 | CACCCACCATACCAGAAATGTTGACACCACGTGGA | |
| CGAAACGTGGTGAAAG | |||
| 1065 SPN_H | 21 | CUU | |
| CACCCACCATACCAGAAATGTTGACACCACGTGGA | |||
| CGAAACGTGGTGAAAGAAG | |||
| 1065 SPN_I | 22 | UU CACCCACCATACCAGAAATGTTGACACCACGTGGA | |
| CGAAACGTGGTGAAAGAA | |||
| 1065 SPN_J | 23 | UA CACCCACCATACCAGAAATGTTGACACCACGTGGA | |
| CGAAACGTGGTGUGUA | |||
| 1065 SPN_K | 24 | UA CACCCACCATACCAGAAATGTTGACACCACGTGGA | |
| CGAAACGTGGTGAUGUA | |||
| 1065 SPN_L | 25 | UA CACCCACCATACCAGAAATGTTGACACCACGTGGA | |
| CGAAACGTGCAGUA | |||
| 1904 | 26 | TAATACGACTCACTATAGGCGTAGCCTGATGAGTGCACA | |
| RiboSPN_full | ATGTAATTATCAAAATACACCACGTTGGCCGAAACGTGG | ||
| sequence | TGAAAGCCACGTAGCTGCGCC | ||
| 1904 SPN_core | 27 | TGCACAATGTAATTATCAAAATACACCACGTTGGC | |
| sequence | |||
| 1904 SPN_A | 28 | CCTGATGAG | |
| TGCACAATGTAATTATCAAAATACACCACGTTGGC | |||
| CGAAACGTGGTGAAAGG | |||
| 1904 SPN_B | 29 | CCAAACCTGATGAG | |
| TGCACAATGTAATTATCAAAATACACCACGTTGGC | |||
| CGAAACGTGGTGACCAAGG | |||
| 1904 SPN_C | 30 | CCAAAUUTGATGAG | |
| TGCACAATGTAATTATCAAAATACACCACGTTGGC | |||
| CGAAACGTGGTGAAACCAUGG | |||
| 1904 SPN_D | 31 | UAUAAUUTGATGAG | |
| TGCACAATGTAATTATCAAAATACACCACGTTGGC | |||
| CGAAACGTGGTGAAAUCUCUA | |||
| 1904 SPN_E | 32 | UAUGGUUTGATGAG | |
| TGCACAATGTAATTATCAAAATACACCACGTTGGC | |||
| CGAAACGTGGTGAAAUCAAUA | |||
| 1904 SPN_F | 33 | UGUUTGATGAG | |
| TGCACAATGTAATTATCAAAATACACCACGTTGGC | |||
| CGAAACGTGGTGAAAUCAAACA | |||
| 1 RiboSPN_full | 34 | TAATACGACTCACTATAGGCGTAGCCTGATGAGCCACAT | |
| sequence | CGTGCAATGCCCGAAACATACCACGTAGACGAAACGTGG | ||
| TGAAAGCCACGTAGCTGCGCC | |||
| 1 SPN_core | 35 | CCACATCGTGCAATGCCCGAAACATACCACGTAGA | |
| sequence | |||
| 1 SPN_A | 36 | CTGAG | |
| CCACATCGTGCAATGCCCGAAACATACCACGTAGAC | |||
| UCAG | |||
| 1 SPN_B | 37 | G CCACATCGTGCAATGCCCGAAACATACCACGTAGA | |
| GGC | |||
| 1 SPN_C | 38 | CCACATCGTGCAATGCCCGAAACATACCACGTAGA | |
| 1 SPN_D | 39 | GUCCAAA | |
| CCACATCGTGCAATGCCCGAAACATACCACGTAGA | |||
| UGGAAAC | |||
| 1 SPN_E | 40 | CGCAAA | |
| CCACATCGTGCAATGCCCGAAACATACCACGTAGA | |||
| AAGCG | |||
| 1 SPN_F | 41 | CCACATCGTGCAATGCCCGAAACATACCACGTAGA | |
| UGUGG | |||
| 1 SPN_G | 42 | CCACATCGTGCAATGCCCGAAACATACCACGTAGA | |
| CAAGG | |||
| 28 | 43 | TAATACGACTCACTATAGGCGTAGCCTGATGAGCTATGC | |
| RiboSPN_full | AGTGATGATTAAAGATACCACCACGTGAGCGAAACGTGG | ||
| sequence | TGAAAGCCACGTAGCTGCGCC | ||
| 28 SPN_core | 44 | CTATGCAGTGATGATTAAAGATACCACCACGTGAG | |
| sequence | |||
| 28 SPN_A | 45 | GATGAG | |
| CTATGCAGTGATGATTAAAGATACCACCACGTGAG | |||
| CGAAACGTGGTGA | |||
| 28 SPN_B | 46 | G CTATGCAGTGATGATTAAAGATACCACCACGTGAG | |
| CGAAACGTGGTGAAAGC | |||
| 28 SPN_C | 47 | A CTATGCAGTGATGATTAAAGATACCACCACGTGAG | |
| CGAAACGTGGTGAAAGU | |||
| 28 SPN_D | 48 | UA CTATGCAGTGATGATTAAAGATACCACCACGTGAG | |
| CGAAACGTGGTGAGUA | |||
| 28 SPN_E | 49 | G CTATGCAGTGATGATTAAAGATACCACCACGTGAG | |
| CGAAACGTGGTCCGC | |||
| 28 SPN_F | 50 | GGUUGATGAG | |
| CTATGCAGTGATGATTAAAGATACCACCACGTGAG | |||
| CGAAACGTGGTGAAACC | |||
| 28 SPN_G | 51 | UUGGATGAG | |
| CTATGCAGTGATGATTAAAGATACCACCACGTGAG | |||
| CGAAACGTGGTGACAA | |||
| 28 SPN_H | 52 | UCGGATGAG | |
| CTATGCAGTGATGATTAAAGATACCACCACGTGAG | |||
| CGAAACGTGGTGAAACGA | |||
| 28 SPN_I | 53 | AUGATGAG | |
| CTATGCAGTGATGATTAAAGATACCACCACGTGAG | |||
| CGAAACGTGGTGAAACCAU | |||
| 28 SPN_J | 54 | AUGGAG | |
| CTATGCAGTGATGATTAAAGATACCACCACGTGAG | |||
| CGAAACGTGGTGAAACAU | |||
| 28 SPN_K | 55 | GUAAA | |
| CTATGCAGTGATGATTAAAGATACCACCACGTGAG | |||
| CGAAACGTGGTGAAUGC | |||
| Peanut | 2047 | 56 | TAATACGACTCACTATAGGCGTAGCCTGATGAGCAAATA |
| RiboSPN_full | GTTACAAACACCACGTAGCGAAACGTGGTGAAAGCCACG | ||
| sequence | TAGCTGCGCC | ||
| 2047 SPN_core | 57 | CAAATAGTTACAAACACCACGTAG | |
| sequence | |||
| 2047 SPN_A | 58 | UUCG CAAATAGTTACAAACACCACGTAG CGAA | |
| 2047 SPN_B | 59 | AUCG CAAATAGTTACAAACACCACGTAG CGAU | |
| 1981 | 60 | TAATACGACTCACTATAGGCGTAGCCTGATGAGCCCAAC | |
| RiboSPN_full | TGTACAGTACACCACGTAGCGAAACGTGGTGAAAGCCAC | ||
| sequence | GTAGCTGCGCC | ||
| 1981 SPN_core | 61 | CCCAACTGTACAGTACACCACGTAG | |
| sequence | |||
| 1981 SPN_A | 62 | GAG CCCAACTGTACAGTACACCACGTAG | |
| CGAAACGTGGTGAAACUC | |||
| 1981 SPN_B | 63 | UAU CCCAACTGTACAGTACACCACGTAG | |
| CGAAACGTGGTGAAAGGAAGAUA | |||
| 2108 | 64 | TAATACGACTCACTATAGGCGTAGCCTGATGAGCACACA | |
| RiboSPN_full | CACATTCCACCACGTCACGCGAAACGTGGTGAAAGCCAC | ||
| sequence | GTAGCTGCGCC | ||
| 2108-SPN_core | 65 | CACACACACATTCCACCACGTCACG | |
| sequence | |||
| 2108-SPN_A | 66 | CTGATGAG CACACACACATTCCACCACGTCACG | |
| 2108 SPN_B | 67 | GAUGATGAG CACACACACATTCCACCACGTCACG | |
| 2108 SPN_C | 68 | UGAUGATGAG CACACACACATTCCACCACGTCACG A | |
| 2108 SPN_D | 69 | UUAUUGATGAG CACACACACATTCCACCACGTCACG | |
| UAA | |||
| 1785 | 70 | TAATACGACTCACTATAGGCGTAGCCTGATGAGCACACG | |
| RiboSPN_full | TTACCACACCACGTTGACGCGAAACGTGGTGAAAGCCAC | ||
| sequence | GTAGCTGCGCC | ||
| 1785 SPN_core | 71 | CACACGTTACCACACCACGTTGACG | |
| sequence | |||
| 1785 SPN_A | 72 | AUCTGATGAG CACACGTTACCACACCACGTTGACG | |
| CGAAACGAGAU | |||
| 1785 SPN_B | 73 | TAUUGAG CACACGTTACCACACCACGTTGACG | |
| CGAAUA | |||
| 1785 SPN_C | 74 | TGAUUGAG CACACGTTACCACACCACGTTGACG | |
| CGAAUCA | |||
| 1785 SPN_D | 75 | GUUGAG CACACGTTACCACACCACGTTGACG CGAA | |
| 1785 SPN_E | 76 | AUUGAG CACACGTTACCACACCACGTTGACG CGAU | |
| 1 RiboSPN_full | 77 | TAATACGACTCACTATAGGCGTAGCCTGATGAGCGTGCC | |
| sequence | CGAAACACACACCACGATGCGAAACGTGGTGAAAGCCAC | ||
| GTAGCTGCGCC | |||
| 1 SPN_core | 78 | CGTGCCCGAAACACACACCACGATG | |
| sequence | |||
| 1 SPN_A | 79 | UUGAG CGTGCCCGAAACACACACCACGATG | |
| CGAAACGUCAA | |||
| 1 SPN_B | 80 | UUAG CGTGCCCGAAACACACACCACGATG | |
| CGAAACGCUAA | |||
| 1 SPN_C | 81 | GAUAGA CGTGCCCGAAACACACACCACGATG | |
| CGAAAUGUC | |||
| 1 SPN_D | 82 | UGAUAGA CGTGCCCGAAACACACACCACGATG | |
| CGAAAUGUCA | |||
| 7 RiboSPN_full | 83 | TAATACGACTCACTATAGGCGTAGCCTGATGAGCTCACC | |
| sequence | ACATACCATGTACCACGTGCGAAACGTGGTGAAAGCCAC | ||
| GTAGCTGCGCC | |||
| 7 SPN_core | 84 | CTCACCACATACCATGTACCACGTG | |
| Sequence | |||
| 7 SPN_A | 85 | CCTGATGAG CTCACCACATACCATGTACCACGTG | |
| CGAAACGTGGTGAAGC | |||
| 7 SPN_B | 86 | GAG CTCACCACATACCATGTACCACGTG CGAAUGA | |
| 7 SPN_C | 87 | CTCACCACATACCATGTACCACG TGCGAAUGA | |
| 7 SPN_D | 88 | GCUCCTGATGAG CTCACCACATACCATGTACCACGTG | |
| CGAAACGTGGTGAAGC | |||
| 7 SPN_E | 89 | CAUGATGAG CTCACCACATACCATGTACCACGTG | |
| CGAACAUG | |||
| 7 SPN_F | 90 | UCAUACGAG CTCACCACATACCATGTACCACGTG | |
| CGAAUGA | |||
| 7 SPN_G | 91 | UCAUACGAG CTCACCACATACCATGTACCACGTG | |
| CGAAUGA | |||
| 7 SPN_H | 92 | GCUCCTGATGAG CTCACCACATACCATGTACCACGTG | |
| CGAAACGTGGTGAAGC | |||
| 7 SPN_I | 93 | CCTGATGAG CTCACCACATACCATGTACCACGTG | |
| CGAAACGTGGTGAAGC | |||
| 7 SPN_J | 94 | CAUGATGAG CTCACCACATACCATGTACCACGTG | |
| CGAACAUG | |||
| 7 SPN_K | 95 | UCAUACGAG CTCACCACATACCATGTACCACGTG | |
| CGAAUGA | |||
| 7 SPN_L | 96 | UCAUACGAG CTCACCACATACCATGTACCACG | |
| TGCGAAUGA | |||
| Milk | 35 | 97 | TAATACGACTCACTATAGGCGTAGCCTGATGAGTTCACTG |
| RiboSPN_full | GCTGCACCCACCACCGCGTTCCACGAAACGTGGTGAAAG | ||
| sequence | CCACGTAGCTGCGCC | ||
| 35 SPN_core | 98 | TTCACTGGCTGCACCCACCACCGCGTTCCA | |
| sequence | |||
| 35 SPN_A | 99 | GATGAG TTCACTGGCTGCACCCACCACCGCGTTCCA | |
| CGAAACGTGGTGAAAGCCA | |||
| 35 SPN_B | 100 | CGUCCTGATGAG | |
| TTCACTGGCTGCACCCACCACCGCGTTCCA | |||
| CGAAACGTGGTGAAAGCCAACG | |||
| 35 SPN_C | 101 | AGCUCCTGATGAG | |
| TTCACTGGCTGCACCCACCACCGCGTTCCA | |||
| CGAAACGTGGTGAAAGCCAAGCU | |||
| 35 SPN_D | 102 | AUCUCCTGATGAG | |
| TTCACTGGCTGCACCCACCACCGCGTTCCA | |||
| CGAAACGTGGTGAAAG | |||
| 35 SPN_E | 103 | GCUACCTGATGAG | |
| TTCACTGGCTGCACCCACCACCGCGTTCCA | |||
| CGAAACGTGGTGAAAGCCAUAGC | |||
| 35 SPN_F | 104 | CCACCTGATGAG | |
| TTCACTGGCTGCACCCACCACCGCGTTCCA | |||
| CGAAACGTGGTGAAAGCCAAAGG | |||
| 35 SPN_G | 105 | UACCTGATGAG | |
| TTCACTGGCTGCACCCACCACCGCGTTCCA | |||
| CGAAACGTGGTGAAAGCCAGGUA | |||
| 35 SPN_H | 106 | AUACCTGATGAG | |
| TTCACTGGCTGCACCCACCACCGCGTTCCA | |||
| CGAAACGTGGTGAAAGCCAGGUAU | |||
| 35 SPN_I | 107 | CUACCTGATGAG | |
| TTCACTGGCTGCACCCACCACCGCGTTCCA | |||
| CGAAACGTGGTGAAAGCCAAAUAG | |||
| 35 SPN_J | 108 | UACCTGATGAG | |
| TTCACTGGCTGCACCCACCACCGCGTTCCA | |||
| CGAAACGTGGTGAAAGCCAAAGUA | |||
| 45 | 109 | TAATACGACTCACTATAGGCGTAGCCTGATGAGCATCCA | |
| RiboSPN_full | CGGTGACGCTAATCCCACGTTCGACGAAACGTGGTGAAA | ||
| sequence | GCCACGTAGCTGCGCC | ||
| 45 SPN_core | 110 | CATCCACGGTGACGCTAATCCCACGTTCGA | |
| sequence | |||
| 45 SPN_A | 111 | CCTGATGAG | |
| CATCCACGGTGACGCTAATCCCACGTTCGA CGAAAGG | |||
| 45 SPN_B | 112 | AGACCTGATGAG | |
| CATCCACGGTGACGCTAATCCCACGTTCGA CGAAUCU | |||
| 45 SPN_C | 113 | AGCCTGATGAG | |
| CATCCACGGTGACGCTAATCCCACGTTCGA CGAAGCU | |||
| 45 SPN_D | 114 | UAUCCTGATGAG | |
| CATCCACGGTGACGCTAATCCCACGTTCGA CGGAAUA | |||
| 45 SPN_E | 115 | GUCGATGAG | |
| CATCCACGGTGACGCTAATCCCACGTTCGA GAC | |||
| 45 SPN_F | 116 | UCGATGAG | |
| CATCCACGGTGACGCTAATCCCACGTTCGA GA | |||
| 45 SPN_G | 117 | UCGATGAG | |
| CATCCACGGTGACGCTAATCCCACGTTCGA G | |||
| 74 | 118 | TAATACGACTCACTATAGGCGTAGCCTGATGAGACAATG | |
| RiboSPN_full | CAGATGCGCCCACCACGGATCACTCGAAACGTGGTGAAA | ||
| sequence | GCCACGTAGCTGCGCC | ||
| 74 SPN_core | 119 | ACAATGCAGATGCGCCCACCACGGATCACT | |
| sequence | |||
| 74 SPN_A | 120 | CCTGATGAG | |
| ACAATGCAGATGCGCCCACCACGGATCACT | |||
| CGAAACGTGGTGAAAGCCA | |||
| 74 SPN_B | 121 | GAG ACAATGCAGATGCGCCCACCACGGATCACT | |
| 74 SPN_C | 122 | GAG ACAATGCAGATGCGCCCACCACGGATCACT C | |
| 74 SPN_D | 123 | GAC ACAATGCAGATGCGCCCACCACGGATCACT CGUC | |
| 74 SPN_E | 124 | CCTGATGAG | |
| ACAATGCAGATGCGCCCACCACGGATCACT | |||
| CGAAACGTGGTGAAAGCCAAGG | |||
| 16 | 125 | TAATACGACTCACTATAGGCGTAGCCTGATGAGCAACCA | |
| RiboSPN_full | AGCACGCTGCATCACGTTTCATCGCGAAACGTGGTGAAA | ||
| sequence | GCCACGTAGCTGCGCC | ||
| 16 SPN_core | 126 | CAACCAAGCACGCTGCATCACGTTTCATCG | |
| sequence | |||
| 16 SPN_A | 127 | GAG CAACCAAGCACGCTGCATCACGTTTCATCG | |
| CGAAACGTGGCUC | |||
| 16 SPN_B | 128 | GUU CAACCAAGCACGCTGCATCACGTTTCATCG | |
| CGAAACGTGGAAC | |||
| 16 SPN_C | 129 | UU CAACCAAGCACGCTGCATCACGTTTCATCG | |
| CGAAACGTUGAA | |||
| 16 SPN_D | 130 | CGATGAG CAACCAAGCACGCTGCATCACGTTTCATCG | |
| 1 RiboSPN_full | 131 | TAATACGACTCACTATAGGCGTAGCCTGATGAGCTCACA | |
| sequence | GCCCGAAACACATCGCCACGTTCACGAAACGTGGTGAAA | ||
| GCCACGTAGCTGCGCC | |||
| 1 SPN_core | 132 | CTCACAGCCCGAAACACATCGCCACGTTCA | |
| sequence | |||
| 1 SPN_A | 133 | TGAG CTCACAGCCCGAAACACATCGCCACGTTCA | |
| 1 SPN_B | 134 | CGAAATGAG | |
| CTCACAGCCCGAAACACATCGCCACGTTCA AAACG | |||
| 1 SPN_C | 135 | UAUCG CTCACAGCCCGAAACACATCGCCACGTTCA | |
| CGAAACGTGGTGAAAGAUA | |||
| Fish | 301 | 136 | TAATACGACTCACTATAGGCGTAGCCTGATGAGCTCAAT |
| RiboSPN_full | ACTACGTCAATTCACAGATGATAGACACCACGGACGAAA | ||
| sequence | CGTGGTGAAAGCCACGTAGCTGCGCC | ||
| 301 SPN_core | 137 | CTCAATACTACGTCAATTCACAGATGATAGACACCACGG | |
| sequence | A | ||
| 301 SPN_A | 138 | GAG | |
| CTCAATACTACGTCAATTCACAGATGATAGACACCAC | |||
| GGA CGAAACGTGGTGAAAG | |||
| 301 SPN_B | 139 | GAG | |
| CTCAATACTACGTCAATTCACAGATGATAGACACCAC | |||
| GGA CGAAACGTGGTGACUC | |||
| 301 SPN_C | 140 | GUAAG | |
| CTCAATACTACGTCAATTCACAGATGATAGACACCAC | |||
| GGA CGAAACGTGGTGACUAC | |||
| 301 SPN_D | 141 | CUAAG | |
| CTCAATACTACGTCAATTCACAGATGATAGACACCAC | |||
| GGA CGAAACGTGGTGACUAG | |||
| 301 SPN_E | 142 | CUGU | |
| CTCAATACTACGTCAATTCACAGATGATAGACACCAC | |||
| GGA CGAAACGTGGTGACAG | |||
| 301 SPN_F | 143 | CUGA | |
| CTCAATACTACGTCAATTCACAGATGATAGACACCAC | |||
| GGA CGAAACGTGGTGACAG | |||
| 301 SPN_G | 144 | CGA | |
| CTCAATACTACGTCAATTCACAGATGATAGACACCAC | |||
| GGA CGAAACGTGGTGUUUG | |||
| 301 SPN_H | 145 | UCUGA | |
| CTCAATACTACGTCAATTCACAGATGATAGACACCAC | |||
| GGA CGAAACGTGGTGAUAGA | |||
| 301 SPN_I | 146 | AAAAG | |
| CTCAATACTACGTCAATTCACAGATGATAGACACCAC | |||
| GGA CGAAACGTGGTGACUUAU | |||
| 301 SPN_J | 147 | GAAAG | |
| CTCAATACTACGTCAATTCACAGATGATAGACACCAC | |||
| GGA CGAAACGTGGTGACUUAC | |||
| 301 SPN_K | 148 | CUCAG | |
| CTCAATACTACGTCAATTCACAGATGATAGACACCAC | |||
| GGA CGAAACGTGGTGACGAG | |||
| 333 | 149 | TAATACGACTCACTATAGGCGTAGCCTGATGAGTCCAAC | |
| RiboSPN_full | ACCACGTAACGTACACTGCATGTGATTGGTGCAACGAAA | ||
| sequence | CGTGGTGAAAGCCACGTAGCTGCGCC | ||
| 333 SPN_core | 150 | TCCAACACCACGTAACGTACACTGCATGTGATTGGTGCA | |
| sequence | A | ||
| 333 SPN_A | 151 | CCTGATGAG | |
| TCCAACACCACGTAACGTACACTGCATGTGATTGGTG | |||
| CAA CGAAACGTGG | |||
| 333 SPN_B | 152 | TAGCCTGATGAG | |
| TCCAACACCACGTAACGTACACTGCATGTGATTGGTG | |||
| CAA CGAAACGTGGTGA | |||
| 333 SPN_C | 153 | GATGAG | |
| TCCAACACCACGTAACGTACACTGCATGTGATTGGTG | |||
| CAA CGAA | |||
| 333 SPN_D | 154 | UUAAGATGAG | |
| TCCAACACCACGTAACGTACACTGCATGTGATTGGTG | |||
| CAA CGAAUUAA | |||
| 333 SPN_E | 155 | UGAAGATGAG | |
| TCCAACACCACGTAACGTACACTGCATGTGATTGGTG | |||
| CAA CGAAUUCA | |||
| 333 SPN_F | 156 | UCACGATGAG | |
| TCCAACACCACGTAACGTACACTGCATGTGATTGGTG | |||
| CAA CGAA GUGA | |||
| 365 | 157 | TAATACGACTCACTATAGGCGTAGCCTGATGAGTGGCGC | |
| RiboSPN_full | CGACTGATCAACTAGACATCACGTTAGCATTCCGCGAAA | ||
| sequence | CGTGGTGAAAGCCACGTAGCTGCGCC | ||
| 365 SPN_core | 158 | TGGCGCCGACTGATCAACTAGACATCACGTTAGCATTCCG | |
| sequence | |||
| 365 SPN_A | 159 | CCTGATGAG | |
| TGGCGCCGACTGATCAACTAGACATCACGTTAGCATT | |||
| CCG CGAAACGTGG | |||
| 365 SPN_B | 160 | GATGAG | |
| TGGCGCCGACTGATCAACTAGACATCACGTTAGCATT | |||
| CCG CGAAACG | |||
| 365 SPN_C | 161 | UGTGAG | |
| TGGCGCCGACTGATCAACTAGACATCACGTTAGCATT | |||
| CCG CGAAACG | |||
| 365 SPN_D | 162 | CCTGATGAG | |
| TGGCGCCGACTGATCAACTAGACATCACGTTAGCATT | |||
| CCG CGAAACGAGG | |||
| 365 SPN_E | 163 | GATGAG | |
| TGGCGCCGACTGATCAACTAGACATCACGTTAGCATT | |||
| CCG CGAAACGTGGTGAAAGCCA | |||
| 365 SPN_F | 164 | CATGAG | |
| TGGCGCCGACTGATCAACTAGACATCACGTTAGCATT | |||
| CCG CGAAACGTGGTGAAAGCAUG | |||
| 365 SPN_G | 165 | TAGAG | |
| TGGCGCCGACTGATCAACTAGACATCACGTTAGCATT | |||
| CCG CGAAACGTGGTGAAAGCUCUA | |||
| 365 SPN_H | 166 | AGAG | |
| TGGCGCCGACTGATCAACTAGACATCACGTTAGCATT | |||
| CCG CGAAACGTGGTGAAAGCUUU | |||
| 38 | 167 | TAATACGACTCACTATAGGCGTAGCCTGATGAGCCAGCA | |
| RiboSPN_full | ACCAGGTTACCTCCCATCACGCTTCGTCTCAGGACGAAAC | ||
| sequence | GTGGTGAAAGCCACGTAGCTGCGCC | ||
| 38 SPN_core | 168 | CCAGCAACCAGGTTACCTCCCATCACGCTTCGTCTCAGGA | |
| sequence | |||
| 38 SPN_A | 169 | CCTGATGAG | |
| CCAGCAACCAGGTTACCTCCCATCACGCTTCGTCTCA | |||
| GGA CGAAACG | |||
| 38 SPN_B | 170 | GATGAG | |
| CCAGCAACCAGGTTACCTCCCATCACGCTTCGTCTCA | |||
| GGA CGAAACG | |||
| 38 SPN_C | 171 | GATGAG | |
| CCAGCAACCAGGTTACCTCCCATCACGCTTCGTCTCA | |||
| GGA CGAA | |||
| 38 SPN_D | 172 | CAAGATGAG | |
| CCAGCAACCAGGTTACCTCCCATCACGCTTCGTCTCA | |||
| GGA CGAAUUG | |||
| 38 SPN_E | 173 | CAAGATGAG | |
| CCAGCAACCAGGTTACCTCCCATCACGCTTCGTCTCA | |||
| GGA CGAUUUG | |||
| 38 SPN_F | 174 | CCAAGATGAG | |
| CCAGCAACCAGGTTACCTCCCATCACGCTTCGTCTCA | |||
| GGA CGACUUUGG | |||
| 38 SPN_G | 175 | ACAAGATGAG | |
| CCAGCAACCAGGTTACCTCCCATCACGCTTCGTCTCA | |||
| GGA CGACUUUGU | |||
| 38 SPN_H | 176 | ACAGATGAG | |
| CCAGCAACCAGGTTACCTCCCATCACGCTTCGTCTCA | |||
| GGA CGACUUUGU | |||
| 1 RiboSPN_full | 177 | TAATACGACTCACTATAGGCGTAGCCTGATGAGCTGACA | |
| sequence | CCACAAACGATTATGACCACGTTATCGTACATAGCGAAA | ||
| CGTGGTGAAAGCCACGTAGCTGCGCC | |||
| 1 SPN_core | 178 | CTGACACCACAAACGATTATGACCACGTTATCGTACATA | |
| sequence | G | ||
| 1 SPN_A | 179 | TAGGCGTAGCCTGATGAG | |
| CTGACACCACAAACGATTATGACCACGTTATCGTACAT | |||
| AG CGAA | |||
| 1 SPN_B | 180 | GAG | |
| CTGACACCACAAACGATTATGACCACGTTATCGTACAT | |||
| AG CGAAACGTGGTGAAAGCCA | |||
| 1 SPN_C | 181 | AGAG | |
| CTGACACCACAAACGATTATGACCACGTTATCGTACAT | |||
| AG CGAAACGTGGTGAAAGCCAU | |||
| 1 SPN_D | 182 | UGAG | |
| CTGACACCACAAACGATTATGACCACGTTATCGTACAT | |||
| AG CGAAACGTGGTGAAAGCCUCA | |||
| 1 SPN_E | 183 | UGAAG | |
| CTGACACCACAAACGATTATGACCACGTTATCGTACAT | |||
| AG CGAAACGTGGTGAAAGCCGUCA | |||
| 1 SPN_F | 184 | UGAAG | |
| CTGACACCACAAACGATTATGACCACGTTATCGTACAT | |||
| AG CGAAACGTGGCGUCA | |||
| 1 SPN_G | 185 | AUGAAG | |
| CTGACACCACAAACGATTATGACCACGTTATCGTACAT | |||
| AG CGAAACGTGGCGUCAU | |||
| 1 SPN_H | 186 | GUAA | |
| CTGACACCACAAACGATTATGACCACGTTATCGTACAT | |||
| AG CGAAACGTGGTGAAAGCCUAC | |||
| 1 SPN_I | 187 | UGUAAG | |
| CTGACACCACAAACGATTATGACCACGTTATCGTACAT | |||
| AG CGAAACGTGGTGAAAGAGGCA | |||
| 1 SPN_J | 188 | UGUAAAG | |
| CTGACACCACAAACGATTATGACCACGTTATCGTACAT | |||
| AG CGAAACGTGGTGAAAGAGGCA | |||
| 27 | 189 | TAATACGACTCACTATAGGCGTAGCCTGATGAGTAGGTC | |
| RiboSPN_full | AAGTGCGCTAAAACACACCGCGTTAGTTCACCAACGAAA | ||
| sequence | CGTGGTGAAAGCCACGTAGCTGCGCC | ||
| 27 SPN_core | 190 | TAGGTCAAGTGCGCTAAAACACACCGCGTTAGTTCACCA | |
| sequence | A | ||
| 27 SPN_A | 191 | A | |
| TAGGTCAAGTGCGCTAAAACACACCGCGTTAGTTCAC | |||
| CAA CGAAACGTGGTGAAAGAUAAU | |||
| 27 SPN_B | 192 | GA | |
| TAGGTCAAGTGCGCTAAAACACACCGCGTTAGTTCAC | |||
| CAA CGAAACGTGGTGAAAGAUAAUC | |||
| Egg | 1013 | 193 | TAATACGACTCACTATAGGCGTAGCCTGATGAGGCCACC |
| RiboSPN_full | TCACTGTGTTTTGTTGCACAACATAATATGATGACGTGCC | ||
| sequence | GAAACGTGGTGAAAGCCACGTAGCTGCGCC | ||
| 1013 SPN_core | 194 | GGCCACCTCACTGTGTTTTGTTGCACAACATAATATGATG | |
| sequence | ACGTGC | ||
| 1013 SPN_A | 195 | GCACGA | |
| GGCCACCUCACUGUGUUUUGUUGCACAACAUAAUAUG | |||
| AUGACGUGC | |||
| 1013 SPN_B | 196 | GCACGUA | |
| GGCCACCUCACUGUGUUUUGUUGCACAACAUAAUAUG | |||
| AUGACGUGC | |||
| 1013 SPN_C | 197 | GCACGUAU | |
| GGCCACCUCACUGUGUUUUGUUGCACAACAUAAUAUG | |||
| AUGACGUGC | |||
| 1013 SPN_D | 198 | GCACCUG | |
| GGCCACCUCACUGUGUUUUGUUGCACAACAUAAUAUG | |||
| AUGACGUGC | |||
| 1013 SPN_E | 199 | GCAC | |
| GGCCACCUCACUGUGUUUUGUUGCACAACAUAAUAUG | |||
| AUGACGUGC | |||
| 1013 SPN_F | 200 | TT | |
| GGCCACCUCACUGUGUUUUGUUGCACAACAUAAUAUG | |||
| AUGACGUGCC GAA | |||
| 1013 SPN_G | 201 | GCCACCUCACUGUGUUUUGUUGCACAACAUAAUAUGAU | |
| GACGUGCGGUGGC | |||
| 1013 SPN_H | 202 | GCACGCCACCUCACUGUGUUUUGUUGCACAACAUAAUA | |
| UGAUGACGUGC | |||
| 851 | 203 | TAATACGACTCACTATAGGCGTAGCCTGATGAGGCGTTCC | |
| RiboSPN_full | CCACCGTTGCCCACGCTTAACTGGACAAAGATGGGCCCC | ||
| sequence | GAAACGTGGTGAAAGCCACGTAGCTGCGCC | ||
| 851 SPN_core | 204 | GCGTTCCCCACCGTTGCCCACGCTTAACTGGACAAAGATG | |
| sequence | GGCCC | ||
| 851 SPN_A | 205 | GCGTTCCCCACCGTTGCCCACGCTTAACTGGACAAAG | |
| ATGGGCCC AACGC | |||
| 851 SPN_B | 206 | GGGCCCA | |
| GCGTTCCCCACCGTTGCCCACGCTTAACTGGACAAAG | |||
| ATGGGCCC | |||
| 851 SPN_C | 207 | ACC | |
| GCGTTCCCCACCGTTGCCCACGCTTAACTGGACAAAG | |||
| ATGGGCCC AGGA | |||
| 851 SPN_D | 208 | TTGG | |
| GCGTTCCCCACCGTTGCCCACGCTTAACTGGACAAAG | |||
| ATGGGCCC GA | |||
| 851 SPN_E | 209 | TAGG | |
| GCGTTCCCCACCGTTGCCCACGCTTAACTGGACAAAG | |||
| ATGGGCCC GAA | |||
| 851 SPN_F | 210 | TG | |
| GCGTTCCCCACCGTTGCCCACGCTTAACTGGACAAAG | |||
| ATGGGCCC A | |||
| 851 SPN_G | 211 | U | |
| GCGTTCCCCACCGTTGCCCACGCTTAACTGGACAAAG | |||
| ATGGGCCC UGUG | |||
| 851 SPN_H | 212 | TTGG | |
| GCGTTCCCCACCGTTGCCCACGCTTAACTGGACAAAG | |||
| ATGGGCCC GGAA | |||
| 851 SPN_I | 213 | TTC | |
| GCGTTCCCCACCGTTGCCCACGCTTAACTGGACAAAG | |||
| ATGGGCCU GAG | |||
| 505 | 214 | TAATACGACTCACTATAGGCGTAGCCTGATGAGTCTGTGC | |
| RiboSPN_full | ACATCACTCGACCTCTACGGCTGTATTGATCCTGCATACG | ||
| sequence | AAACGTGGTGAAAGCCACGTAGCTGCGCC | ||
| 505 SPN_core | 215 | TCTGTGCACATCACTCGACCTCTACGGCTGTATTGATCCT | |
| sequence | GCATA | ||
| 505 SPN_A | 216 | TCTGTGCACATCACTCGACCTCTACGGCTGTATTGATC | |
| CTGCATA GUGCACAGA | |||
| 505 SPN_B | 217 | CCUAUGC | |
| TCTGTGCACATCACTCGACCTCTACGGCTGTATTGATC | |||
| CTGCATA GG | |||
| 505 SPN_C | 218 | GCUAGAGTGCACATCACTCGACCTCTACGGCTGTATT | |
| GATCCTGCATA AGAGC | |||
| 780 | 219 | TAATACGACTCACTATAGGCGTAGCCTGATGAGCGTCCA | |
| RiboSPN_full | ACGTTCGATCAGAACCGCGTTCAGGCTGATGATTGTACGC | ||
| sequence | GAAACGTGGTGAAAGCCACGTAGCTGCGCC | ||
| 780 SPN_core | 220 | CGTCCAACGTTCGATCAGAACCGCGTTCAGGCTGATGATT | |
| sequence | GTACG | ||
| 780 SPN_A | 221 | CGTCCAACGTTCGATCAGAACCGCGTTCAGGCTGATG | |
| ATTGTACG UUCCACG | |||
| 780 SPN_B | 222 | GCUUA | |
| CGTCCAACGTTCGATCAGAACCGCGTTCAGGCTGATG | |||
| ATTGTACG UAAGC | |||
| 780 SPN_C | 223 | TGATGAG | |
| CGTCCAACGTTCGATCAGAACCGCGTTCAGGCTGATG | |||
| ATTGTACG CGAAACG | |||
| 780 SPN_D | 224 | CGTGATGAG | |
| CGTCCAACGTTCGATCAGAACCGCGTTCAGGCTGATG | |||
| ATTGTACG CGACG | |||
| 780 SPN_E | 225 | CAAGTGATGAG | |
| CGTCCAACGTTCGATCAGAACCGCGTTCAGGCTGATG | |||
| ATTGTACG CGACTTG | |||
| 780 SPN_F | 226 | AUAGTGATGAG | |
| CGTCCAACGTTCGATCAGAACCGCGTTCAGGCTGATG | |||
| ATTGTACG CGACTAT | |||
| 1 RiboSPN_full | 227 | TAATACGACTCACTATAGGCGTAGCCTGATGAGCATCAG | |
| sequence | TGCGTTCTGCCTTTGCAACCACACAACACACCGTATGAGC | ||
| GAAACGTGGTGAAAGCCACGTAGCTGCGCC | |||
| 1 SPN_core | 228 | CATCAGTGCGTTCTGCCTTTGCAACCACACAACACACCGT | |
| sequence | ATGAG | ||
| 1 SPN_A | 229 | CUCAUA | |
| CATCAGTGCGTTCTGCCTTTGCAACCACACAACACAC | |||
| CGTATGAG | |||
| 1 SPN_B | 230 | GCUUA | |
| CATCAGTGCGTTCTGCCTTTGCAACCACACAACACAC | |||
| CGTATGAG UAAGC | |||
| 1 SPN_C | 231 | CCTGATGAG | |
| CATCAGTGCGTTCTGCCTTTGCAACCACACAACACAC | |||
| CGTATGAG CGAAACG | |||
| 1 SPN_D | 232 | GCAG | |
| CATCAGTGCGTTCTGCCTTTGCAACCACACAACACAC | |||
| CGTATGAG CGC | |||
| 1 SPN_E | 233 | TTGAG | |
| CATCAGTGCGTTCTGCCTTTGCAACCACACAACACAC | |||
| CGTATGAG CGAA | |||
| 1 SPN_F | 234 | TGCAG | |
| CATCAGTGCGTTCTGCCTTTGCAACCACACAACACAC | |||
| CGTATGAG CGCG | |||
| 1 SPN_G | 235 | CGCAG | |
| CATCAGTGCGTTCTGCCTTTGCAACCACACAACACAC | |||
| CGTATGAG CGCG | |||
| 17 | 236 | TAATACGACTCACTATAGGCGTAGCCTGATGAGCCAACT | |
| RiboSPN_full | GTGCACACTGTTCGCTTATCGAGCTGTGTACCTCCATAGC | ||
| sequence | GAAACGTGGTGAAAGCCACGTAGCTGCGCC | ||
| 17 SPN_core | 237 | CCAACTGTGCACACTGTTCGCTTATCGAGCTGTGTACCTC | |
| sequence | CATAG | ||
| 17 SPN_A | 238 | CCTGATGAG | |
| CCAACTGTGCACACTGTTCGCTTATCGAGCTGTGTAC | |||
| CTCCATAG CGAAACGTGG | |||
| 17 SPN_B | 239 | ACUCCTGATGAG | |
| CCAACTGTGCACACTGTTCGCTTATCGAGCTGTGTAC | |||
| CTCCATAG CGAAACGAGGCAT | |||
| 17 SPN_C | 240 | ATGCCTGATGAG | |
| CCAACTGTGCACACTGTTCGCTTATCGAGCTGTGTAC | |||
| CTCCATAG CGAAACGTGGTGAA | |||
| 17 SPN_D | 241 | AACCTGATGAG | |
| CCAACTGTGCACACTGTTCGCTTATCGAGCTGTGTAC | |||
| CTCCATAG CGAAACGTGGCA | |||
| 17 SPN_E | 242 | AACTGATGAG | |
| CCAACTGTGCACACTGTTCGCTTATCGAGCTGTGTAC | |||
| CTCCATAG CGAAACAGUU | |||
| 17 SPN_F | 243 | CATGCCTGATGAG | |
| CCAACTGTGCACACTGTTCGCTTATCGAGCTGTGTAC | |||
| CTCCATAG CGAAACGTGGTGAAGUG | |||
| 17 SPN_G | 244 | CCAACTGTGCACACTGTTCGCTTATCGAGCTGTGTAC | |
| CTCCATAG GUUGG | |||
| 17 SPN_H | 245 | CUAUGG | |
| CCAACTGTGCACACTGTTCGCTTATCGAGCTGTGTAC | |||
| CTCCATAG | |||
| Gluten | 457 | 246 | TAATACGACTCACTATAGGCGTAGCCTGATGAGCTTGGTC |
| RiboSPN_full | ACCTTTCCTGACATTAACACAGGCGAAACGTGGTGAAAG | ||
| sequence | CCACGTAGCTGCGCC | ||
| 457 SPN_core | 247 | CTTGGTCACCTTTCCTGACATTAACACAGG | |
| sequence | |||
| 457 SPN_A | 248 | CTTGGTCACCTTTCCTGACATTAACACAGG CCAAG | |
| 457 SPN_B | 249 | CCUGU CTTGGTCACCTTTCCTGACATTAACACAGG | |
| 491 | 250 | TAATACGACTCACTATAGGCGTAGCCTGATGAGTTTTCCC | |
| RiboSPN_full | GATACGGCTACGAATTGCGACAACGAAACGTGGTGAAAG | ||
| sequence | CCACGTAGCTGCGCC | ||
| 491 SPN_core | 251 | TTTTCCCGATACGGCTACGAATTGCGACAA | |
| sequence | |||
| 491 SPN_A | 252 | CC TTTTCCCGATACGGCTACGAATTGCGACAA AAGG | |
| 491 SPN_B | 253 | GCUUA TTTTCCCGATACGGCTACGAATTGCGACAA | |
| UAAGC | |||
| 578 | 254 | TAATACGACTCACTATAGGCGTAGCCTGATGAGGCACCA | |
| RiboSPN_full | ATTTTACCGATTTTGGTGGACAGCCGAAACGTGGTGAAA | ||
| sequence | GCCACGTAGCTGCGCC | ||
| 578 SPN_core | 255 | GCACCAATTTTACCGATTTTGGTGGACAGC | |
| sequence | |||
| 578 SPN_A | 256 | GCUGUCC GCACCAATTTTACCGATTTTGGTGGACAGC | |
| 578 SPN_B | 257 | GCACCAATTTTACCGATTTTGGTGGACAGC UUGGUGC | |
| 1514 | 258 | TAATACGACTCACTATAGGCGTAGCCTGATGAGCGTACA | |
| RiboSPN_full | ACCCACCACCGTTGTCCACAAATGCGAAACGTGGTGAAA | ||
| sequence | GCCACGTAGCTGCGCC | ||
| 1514 SPN_core | 259 | CGTACAACCCACCACCGTTGTCCACAAATG | |
| sequence | |||
| 1514 SPN_A | 260 | CAUUUG CGTACAACCCACCACCGTTGTCCACAAATG | |
| 1514 SPN_B | 261 | CGTACAACCCACCACCGTTGTCCACAAATG UUGUACG | |
| 1 RiboSPN_full | 262 | TAATACGACTCACTATAGGCGTAGCCTGATGAGTGCGTC | |
| sequence | AACGGCCGTCCCGAAACGTGAATACGAAACGTGGTGAAA | ||
| GCCACGTAGCTGCGCC | |||
| 1 SPN_core | 263 | TGCGTCAACGGCCGTCCCGAAACGTGAATA | |
| sequence | |||
| 1 SPN_A | 264 | UAUUCA TGCGTCAACGGCCGTCCCGAAACGTGAATA | |
| 1 SPN_B | 265 | GCUUA TGCGTCAACGGCCGTCCCGAAACGTGAATA | |
| UAAGC | |||
| 35 | 266 | TAATACGACTCACTATAGGCGTAGCCTGATGAGGTTACCC | |
| RiboSPN_full | CGAAACGGCCCTAACTGCATCAGCGAAACGTGGTGAAAG | ||
| sequence | CCACGTAGCTGCGCC | ||
| 35 SPN_core | 267 | GTTACCCCGAAACGGCCCTAACTGCATCAG | |
| sequence | |||
| 35 SPN_A | 268 | CUGAUGC GTTACCCCGAAACGGCCCTAACTGCATCAG | |
| 35 SPN_B | 269 | GTTACCCCGAAACGGCCCTAACTGCATCAG GGGUAAC | |
| Soy | 1 RiboSPN_full | 270 | TAATACGACTCACTATAGGCGTAGCCTGATGAGCCGCAT |
| sequence | CACCACCCAAACCACCGTTCGAAACGTGGTGAAAGCCAC | ||
| GTAGCTGCGCC | |||
| 1 SPN_core | 271 | CCGCATCACCACCCAAACCACCGTT | |
| sequence | |||
| 1 SPN_A | 272 | GCCTGATGAG CCGCATCACCACCCAAACCACCG | |
| TTCGAAACGAGGC | |||
| 1 SPN_B | 273 | TTCCAATGATGAG CCGCATCACCACCCAAACCACCG | |
| TTCGAAACGAGGAA | |||
| 1 SPN_C | 274 | TATACAATGATGAG CCGCATCACCACCCAAACCACCG | |
| TTCGAAACGAGTAAG | |||
| 1 SPN_D | 275 | UUCCTGATGAG CCGCATCACCACCCAAACCACCGTT | |
| CGAAAUAGGAA | |||
| 1 SPN_E | 276 | TGGACAATGATGAG CCGCATCACCACCCAAACCACCG | |
| TTCGAAACGAGTCACA | |||
| 1 SPN_F | 277 | TCCACAATGATGAG CCGCATCACCACCCAAACCACCG | |
| TTCGAAACGAGTGAGA | |||
| 2 RiboSPN_full | 278 | TAATACGACTCACTATAGGCGTAGCCTGATGAGCCTGCTC | |
| sequence | CATCCGCGCCAGCCTCACCGAAACGTGGTGAAAGCCACG | ||
| TAGCTGCGCC | |||
| 2 SPN_core | 279 | CCTGCTCCATCCGCGCCAGCCTCAC | |
| sequence | |||
| 2 SPN_A | 280 | CCTGATGAG CCTGCTCCATCCGCGCCAGCCTCAC | |
| CGAAACG | |||
| 2 SPN_B | 281 | TAGCCTGATGAG CCTGCTCCATCCGCGCCAGCCTCAC | |
| CGAAACGTGGCTA | |||
| 2 SPN_C | 282 | CTTAGCCTGATGAG | |
| CCTGCTCCATCCGCGCCAGCCTCAC CGTAAG | |||
| 2 SPN_D | 283 | CTTAGGGTAGAG CCTGCTCCATCCGCGCCAGCCTCAC | |
| CUTAAG | |||
| 2 SPN_E | 284 | TTAGGGTAGAG CCTGCTCCATCCGCGCCAGCCTCAC | |
| CUTAA | |||
| 2 SPN_F | 285 | GTTAGGGTAGAG CCTGCTCCATCCGCGCCAGCCTCAC | |
| CUAAU | |||
| 2 SPN_G | 286 | TTAGGTAGAG CCTGCTCCATCCGCGCCAGCCTCAC | |
| CUAA | |||
| 2 SPN_H | 287 | GCGTAGCCTGATGAG | |
| CCTGCTCCATCCGCGCCAGCCTCAC | |||
| CGAAACGTGGTGAAAG | |||
| 2 SPN_I | 288 | TAATACGAC CCTGCTCCATCCGCGCCAGCCTCAC | |
| CGAAACGTGGTGAAAG | |||
| 2 SPN_J | 289 | TCACTATAG CCTGCTCCATCCGCGCCAGCCTCAC | |
| CGAAACGTGGTGAAAG | |||
| 2 SPN_K | 290 | CCACGTAGCTGCGCC | |
| CCTGCTCCATCCGCGCCAGCCTCAC | |||
| CGAAACGTGGTGAAAG | |||
| 2 SPN_L | 291 | CUUTCACCTGATGAG | |
| CCTGCTCCATCCGCGCCAGCCTCAC | |||
| CGAAACGTGGTGAAAG | |||
| 2 SPN_M | 292 | UAUTCACCTGATGAG | |
| CCTGCTCCATCCGCGCCAGCCTCAC | |||
| CGAAACGTGGTGAAAG | |||
| 2 SPN_N | 293 | UTCGATGAG CCTGCTCCATCCGCGCCAGCCTCAC | |
| CGAACAG | |||
| 2 SPN_O | 294 | CAUTCGATGAG CCTGCTCCATCCGCGCCAGCCTCAC | |
| CGAACUG | |||
| 3 RiboSPN_full | 295 | TAATACGACTCACTATAGGCGTAGCCTGATGAGCCAATCT | |
| sequence | CCTGCCCACGCCGTTCCACGAAACGTGGTGAAAGCCACG | ||
| TAGCTGCGCC | |||
| 3 SPN_core | 296 | CCAATCTCCTGCCCACGCCGTTCCA | |
| sequence | |||
| 3 SPN_A | 297 | TAGGCGTAGCCTGATGAG | |
| CCAATCTCCTGCCCACGCCGTTCCA | |||
| CGAAACGTGGTGAAAG | |||
| 3 SPN_B | 298 | TAGGCGTAGCCTGATGAG | |
| CCAATCTCCTGCCCACGCCGTTCCA CGAA | |||
| 3 SPN_C | 299 | TAGGCGTAGCCTGATGAG | |
| CCAATCTCCTGCCCACGCCGTTCCA CCUACGCCUA | |||
| 3 SPN_D | 300 | GCGTAGCCTGATGAG | |
| CCAATCTCCTGCCCACGCCGTTCCA CCUACGC | |||
| 3 SPN_E | 301 | UCGTAGCCTGATGAG | |
| CCAATCTCCTGCCCACGCCGTTCCA CCUACCA | |||
| 3 SPN_F | 302 | UGCTAGCCTGATGAG | |
| CCAATCTCCTGCCCACGCCGTTCCA CCUAGAA | |||
| 3 SPN_G | 303 | CGATAGCCTGATGAG | |
| CCAATCTCCTGCCCACGCCGTTCCA CCUATAG | |||
| 3 SPN_H | 304 | GUCCTAGCCTGATGAG | |
| CCAATCTCCTGCCCACGCCGTTCCA | |||
| CAUCUUGCUAGAAC | |||
| 3 SPN_I | 305 | GATGAG CCAATCTCCTGCCCACGCCGTTCCAC | |
| AAGCUCAUC | |||
| 3 SPN_J | 306 | CCTGATGAG CCAATCTCCTGCCCACGCCGTTCCA | |
| CAUCGAAAGG | |||
| 4 RiboSPN_full | 307 | TAATACGACTCACTATAGGCGTAGCCTGATGAGCCAATC | |
| sequence | AAGGACCGCCTTCACCGCTCGAAACGTGGTGAAAGCCAC | ||
| GTAGCTGCGCC | |||
| 4 SPN_core | 308 | CCAATCAAGGACCGCCTTCACCGCT | |
| sequence | |||
| 4 SPN_A | 309 | CCTGATGAG CCAATCAAGGACCGCCTTCACCGCT | |
| CGAAACG | |||
| 4 SPN_B | 310 | GATGAG CCAATCAAGGACCGCCTTCACCGCT CGAU | |
| 4 SPN_C | 311 | TGAG CCAATCAAGGACCGCCTTCACCGCT CG | |
| 4 SPN_D | 312 | GCACAG CCAATCAAGGACCGCCTTCACCGCT UCU | |
| 4 SPN_E | 313 | GCAACAG CCAATCAAGGACCGCCTTCACCGCT UUU | |
| 4 SPN_F | 314 | GACAG CCAATCAAGGACCGCCTTCACCGCT UUU | |
| 5 RiboSPN_full | 315 | TAATACGACTCACTATAGGCGTAGCCTGATGAGACTCTCG | |
| sequence | CATCACCAGCCAACTCACCGAAACGTGGTGAAAGCCACG | ||
| TAGCTGCGCC | |||
| 5 SPN_core | 316 | ACTCTCGCATCACCAGCCAACTCAC | |
| sequence | |||
| 5 SPN_A | 317 | TAGCCTGATGAG ACTCTCGCATCACCAGCCAACTCAC | |
| CGAAACGTGGTGAAAG | |||
| 5 SPN_B | 318 | TAGCCTGATGAG ACTCTCGCATCACCAGCCAACTCAC | |
| CGAAACGTGGTGGCUA | |||
| 5 SPN_C | 319 | TAGCCAGATGAG ACTCTCGCATCACCAGCCAACTCAC | |
| CGAAACGTGGTGGCUA | |||
| 5 SPN_D | 320 | TAGCCAGATGAG ACTCTCGCATCACCAGCCAACTCAC | |
| CGAACACAUCTGGCUA | |||
| 5 SPN_E | 321 | TCGCCAGATGAG ACTCTCGCATCACCAGCCAACTCAC | |
| CGAAACGTGGTGGCGA | |||
| 5 SPN_F | 322 | TCGCCAGATGAG ACTCTCGCATCACCAGCCAACTCAC | |
| CGAAACGTGGAGGCGA | |||
| 5 SPN_G | 323 | TUGCCAGATGAG ACTCTCGCATCACCAGCCAACTCAC | |
| CGAAACGTGGAGGCGA | |||
| 5 SPN_H | 324 | TUGCCAGATGAG ACTCTCGCATCACCAGCCAACTCAC | |
| CGAAACGTGGAGUUGCGA | |||
| 5 SPN_I | 325 | TUGCCUUGATGAG ACTCTCGCATCACCAGCCAACTCAC | |
| CGAAACGTGGAGGCGA | |||
| 5 SPN_J | 326 | TUGCCUAUGATGAG | |
| ACTCTCGCATCACCAGCCAACTCAC | |||
| CGAAACGTGGAGGCGA | |||
| 5 SPN_K | 327 | TUGCCUGATGAG ACTCTCGCATCACCAGCCAACTCAC | |
| CGAAACGAATGGAGGCGA | |||
| 5 SPN_L | 328 | TUGCCUGATGAG ACTCTCGCATCACCAGCCAACTCAC | |
| CGAAACGGTGGAGGCGA | |||
| 5 SPN_M | 329 | TUGCCUGATGAG ACTCTCGCATCACCAGCCAACTCAC | |
| CGAAACGTGGAGGCAT | |||
| 5 SPN_N | 330 | TUGCCUGATGAG ACTCTCGCATCACCAGCCAACTCAC | |
| CGAAACGTGGAGGCAA | |||
| Crustacean | 1 RiboSPN_full | 331 | TAATACGACTCACTATAGGCGTAGCCTGATGAGCGGTAC |
| sequence | TCAGATTACAGAGTGACATCGAAACGTGGTGAAAGCCAC | ||
| GTAGCTGCGCC | |||
| 1 SPN_core | 332 | CGGTACTCAGATTACAGAGTGACAT | |
| sequence | |||
| 2 RiboSPN_full | 333 | TAATACGACTCACTATAGGCGTAGCCTGATGAGAGACAC | |
| sequence | CACGGATCCGAACTGGAGCGAAACGTGGTGAAAGCCACG | ||
| TAGCTGCGCC | |||
| 2 SPN_core | 334 | AGACACCACGGATCCGAACTGGAG | |
| sequence | |||
| 3 RiboSPN_full | 335 | TAATACGACTCACTATAGGCGTAGCCTGATGAGCCTCGC | |
| sequence | AAGATTGCATACGTTAGAACGAAACGTGGTGAAAGCCAC | ||
| GTAGCTGCGCC | |||
| 3 SPN_core | 336 | CCTCGCAAGATTGCATACGTTAGAA | |
| sequence | |||
| 4 RiboSPN_full | 337 | TAATACGACTCACTATAGGCGTAGCCTGATGAGCACGTA | |
| sequence | GGAAACGACCTCTACGGAGCGAAACGTGGTGAAAGCCAC | ||
| GTAGCTGCGCC | |||
| 4 SPN_core | 338 | CACGTAGGAAACGACCTCTACGGAG | |
| sequence | |||
| 5 RiboSPN_full | 339 | TAATACGACTCACTATAGGCGTAGCCTGATGAGCCCGAA | |
| sequence | ACCACCACCGTTGTCCAATACGAAACGTGGTGAAAGCCA | ||
| CGTAGCTGCGCC | |||
| 5 SPN_core | 340 | CCCGAAACCACCACCGTTGTCCAATA | |
| sequence | |||
In some embodiments, SPNs of the present invention may be generated by modifying the original allergen binding aptamers disclosed in the literature. The parent aptamer sequence against a specific allergen is modified to comprise the shortest sequence without changing the binding specificity and affinity of the aptamer. Some exemplary SPNs modified from known parent sequences are listed in Table 2.
| TABLE 2 |
| SPNs originated from literature sequences |
| SEQ | |||
| ID | |||
| Allergen | SPN ID | NO. | Sequence (5′-3′) |
| Gluten | GLI4-parent | 341 | CCAGTCTCCCGTTTACCGCGCCTACACATGTCTGAATGCC |
| sequence | |||
| GLI4 SPN-1 | 342 | TAGTCTCCCGTTTACCGCGCCTACACATGTCTGAATG | |
| GLI4 SPN-2 | 343 | TAGTCTCCCGTTTACCGCGCCTACACATGTCTGAA | |
| GLI1-parent | 344 | CTAGGCGAAATATAGCTACAACTGTCTGAAGGCACCCAA | |
| sequence | T | ||
| Egg | 2007-parent | 345 | ATCTACGAATTCATCAGGGCTAAAGAGTGCAGAGTTACT |
| sequence | TAG | ||
| 2007 SPN-1 | 346 | TACGAATTCATCAGGGCTAAAGAGTGCAGAGTTACT | |
| 2007 SPN-2 | 347 | AAT | |
| ATCTACGAATTCATCAGGGCTAAAGAGTGCAGAGTTACT | |||
| TAG CTC | |||
| 2007 SPN-3 | 348 | ATCTACGAATTCATCAGGGCTAAAGAGTGCAGAGTTACT | |
| TAG | |||
| 2012-parent | 349 | GCAGCTAAGCAGGCGGCTCACAAAACCATTCGCATGCGG | |
| sequence | C | ||
| 2012 SPN-1 | 350 | GCTAAGCAGGCGGCTCACAAAACCATTCGCATGC | |
| 2012 SPN-2 | 351 | GCTAAGCAGGCGGCTCACAAAACCATTCGCATGC AA | |
| Ellington | Parent | 352 | GGUUGUGAAGAUUGGGAGCGUCGUGGCUAC |
| and Cox | sequence | ||
| Peanut | ARAH1- | 353 | TCGCACATTCCGCTTCTACCGGGGGGGTCGAGCTGAGTG |
| parent | GATGCGAATCTGTGGGTGGGCCGTAAGTCCGTGTGTGCG | ||
| sequence | AA | ||
In one embodiment, a signaling polynucleotide of the present invention may be probed with a fluorescent marker, for instance, a fluorescent dye. The fluorescent dye may be added at either the 5′ terminus or the 3′ terminus of the polynucleotide. In some aspects, the fluorescent dyes may include, but are not limited to, Fluorescein, Rhodamine, Oregon green (e.g., Oregon Green 488 dye, Oregon Green 514 dye), Eosin, Texas red, ROX, TAMRA, JOE, HEX, TET, Cyanine, Indocarbocyanine, Oxacarbocyanine, Thiacarbocyanine, Merocyanine, Squaraines and derivatives such as Seta (e.g., Seta-APC-780, Seta-PerCP-680, Seta-555-NHS, Seta-555-Azide, Seta-555-DBCO, Seta-580-NHS and Seta-R-PE-670), SeTau (e.g., SeTau-380-NHS, SeTau-425-NHS, SeTau-647-NHS and SeTau-405-NHS), and Square dyes, Naphthalene derivatives, Coumarin derivatives, Pyridyloxazole, Nitrobenzoxadiazole and Benzoxadiazole, Anthraquinones (e.g., DRAQ5, DRAQ7 and CyTRAK Orange), Pyrene and derivatives (e.g., cascade blue), Oxazine derivatives (e.g., Nile red, Nile blue, cresyl violet, oxazine 170), Proflavin, Acridine orange, Acridine yellow, Auramine, Crystal violet, Malachite green, Porphin, Phthalocyanine, Bilirubin, BODIPY TMR dye, BODIPY FL dye, Tetramethylrhodamine, Hydroxycoumarin, Aminocoumarin, Methoxycoumarin, Cascade Blue, Pacific Blue, Pacific Orange, NBD, R-Phycoerythrin (PE), Red 613, PerCP, TruRed, FluorX, Cy2, Cy3, Cy5, Cy7, TRITC, X-Rhodamine, Lissamine Rhodamine B, Allophycocyanin (APC), and Alexa Fluor dyes (e.g., Alexa Fluor 488 dye, and Alexa Fluor 594 dye).
In another embodiment, more than one fluorophore molecules may be added to the same terminus of the signaling polynucleotide. As a non-limiting example, two FAM (fluorescein) molecules may be added one after another on either the 5′ terminus or the 3′ terminus of the signaling polynucleotide. In further another embodiment, fluorophore molecules may be added to both the 5′ and 3′ termini of the signaling polynucleotide.
Detection agents of the present invention comprise SPNs as discussed herein. According to the present invention, and while not wishing to be bound by theory, the detection agents may completely or partially bind an allergen. In some embodiments, detection agents of the invention comprise one or more aptamers as core sequences which will bind specifically to an allergen molecule.
In some embodiments, detection agents of the present invention may comprise a detectable probe, such as various organic small molecules, inorganic compounds, nanoparticles, quantum dot, enzymes or enzyme substrates, fluorescent materials, luminescent materials (e.g., luminol), bioluminescent materials (e.g., luciferase, luciferin, and aequorin), chemiluminescent materials, radioactive materials (e.g., 18F, 67Ga, 81mKr, 82Rb, 111In, 123I, 133Xe, 201Tl, 125I, 35S, 14C, 3H, or 99mTc (e.g., as pertechnetate (technetate(VII), TcO4)), contrast agents (e.g., gold (e.g., gold nanoparticles) and butyrate quantum dot.
In some embodiments, detection agents of the present invention may further comprise conjugates. In some aspects, detection agents may be conjugated to other polynucleotides, dyes, intercalating agents (e.g. acridines), cross-linkers (e.g. psoralene, mitomycin C), porphyrins (TPPC4, texaphyrin, Sapphyrin), polycyclic aromatic hydrocarbons (e.g., phenazine, dihydrophenazine), artificial endonucleases (e.g. EDTA), alkylating agents, phosphate, amino, mercapto, PEG (e.g., PEG-40K), MPEG, [MPEG]2, polyamino, alkyl, substituted alkyl, radiolabeled markers, enzymes, haptens (e.g. biotin), transport/absorption facilitators (e.g., aspirin, vitamin E, folic acid), synthetic ribonucleases, proteins, e.g., glycoproteins, or peptides, e.g., molecules having a specific affinity for a co-ligand, or antibodies e.g., an antibody, that binds to a specified cell type such as a cancer cell, endothelial cell, or bone cell, hormones and hormone receptors, non-peptidic species, such as lipids, lectins, carbohydrates, vitamins, cofactors, or a drug.
According to certain embodiments of the present invention, variants of detection agents are provided. In some aspects, the variants are polynucleotide variants. As used herein, the term “polynucleotide variants” refers to molecules which differ in their nucleotide sequence from a native or reference sequence. The nucleic acid sequence variants may possess substitutions, deletions, and/or insertions at certain positions within the nucleotide sequence, as compared to a native or reference sequence. Ordinarily, variants will possess at least about 50% identity (homology) to a native or reference sequence, and preferably, they will be at least about 80%, more preferably at least about 90% identical (homologous) to a native or reference sequence. “Native” or “reference” sequence should not be confused with a wild type sequence. As used herein, a native or reference sequence is a relative term referring to an original molecule against which a comparison may be made. “Native” or “reference” sequences or molecules may represent the wild-type (that sequence found in nature) but do not have to be the wild-type sequence. In some examples, the native or reference sequence may be the sequence of a signaling polynucleotide as disclosed herein, such as a SPN specific to peanut listed in Table 1 and Table 2.
In some embodiments, derivatives of detection agents are also provided. As used herein, the term “derivative” is used synonymously with the term “variant” and refers to a molecule that has been modified or changed in any way relative to a reference molecule. The term “derivatives,” as referred to herein, includes modifications of a reference polynucleotide with an organic proteinaceous or non-proteinaceous derivatizing agent.
In some embodiments, detection agents of the present invention may be used in combination with other detection molecules such as antibodies against an allergen.
SPNs and detection agents of the present invention may be formulated in a solution which favors the interaction between the detection molecules and the allergen. Such formulations can be packaged for use in a variety of pharmaceutically or diagnostically acceptable containers using any acceptable container closure, Examples of acceptable containers include, but are not limited to, ampules and pre-filled syringes, cartridges and the like. Alternatively, the formulation may contain lyophilized aptamer in one compartment of an admix bag and an acceptable solvent in a separate compartment of the admix bag such that the two compartments may be mixed together prior to its application. The formulations in liquid form may be stored in a refrigerated environment. Alternatively, the lyophililized formulations may be stored at room temperature, or refrigerated or frozen. Preferably, the formulations may be sterile. A “sterile” formulation, as used herein, means a formulation that has been brought to a state of sterility and has not been subsequently exposed to microbiological contamination, i.e., the container holding the sterile composition has not been compromised. Sterile compositions are generally prepared by pharmaceutical manufacturers in accordance with current Good Manufacturing Practice (“cGMP”) regulations of the U.S. Food and Drug Administration. In some embodiments, detection agents and compositions of the present invention may be combined with other ingredients or reagents or prepared as components of kits or other retail products for commercial sale or distribution. The kit will contain the compound or composition, along with instructions regarding administration and/or use of the kit. The kit may also contain one or more of the following: a syringe, a bag or bottle.
In some embodiments, detection systems and devices, aptamers, SPNs and detection agents of the present invention may be used to detect the presence and/or absence of an allergen protein or variants thereof. In some embodiments, aptamers, SPNs and detection agents may be designed to bind or associate with proteins or other biomolecules which themselves associated with the allergen. Allergens may include those from foods, the environment or from non-human proteins such as domestic pet dander. In some embodiments, detection systems and devices of the present invention may be used to implement an allergen detection test, for example using SPNs of the invention as detection agents to detect the presence and/or absence of an allergen protein in a test sample.
Food allergens include, but are not limited to proteins in legumes such as peanuts, peas, lentils and beans, as well as the legume-related plant lupin, tree nuts such as almond, cashew, walnut, Brazil nut, filbert/hazelnut, pecan, pistachio, beechnut, butternut, chestnut, chinquapin nut, coconut, ginkgo nut, lychee nut, macadamia nut, nangai nut and pine nut, egg, fish, shellfish such as crab, crawfish, lobster, shrimp and prawns, mollusks such as clams, oysters, mussels and scallops, milk, soy, wheat, gluten, corn, meat such as beef, pork, mutton and chicken, gelatin, sulphite, seeds such as sesame, sunflower and poppy seeds, and spices such as coriander, garlic and mustard, fruits, vegetables such as celery, and rice. For example, the seeds from plants, such as lupin, sunflower or poppy can be used in foods such as seeded bread or can be ground to make flour to be used in making bread or pastries.
Seafood allergens typically belong to a group of muscle proteins, including the parvalbumins in codfish and tropomyosin in crustaceans; other allergens such as arginine kinase and myosin light chain may also play an important part in allergenicity. Tropomyosin is the major allergen responsible for molecular and clinical cross-reactivity between crustaceans and molluscs, and is believed to be the allergen responsible in other inhaled invertebrates such as house dust mites and insects.
In some embodiments, allergens are food allergens. Examples of allergenic proteins associated with food include, but are not limited to, Brine shrimp (Art fr 5), Crab (Cha f 1), North Sea Shrimp (Cra c 1, Cra c 2, Cra c 4, Cra c 5, Cra c 6, Cra c 8), American lobster (Hom a 1, Hom a 3, Hom a 6), white shrimp (Lit v 1, Lit v 2, Lit v 3, Lit v4), giant freshwater prawn (Mac r 1), shrimp (Met e 1, Pen a 1, Pen i 1), northern shrimp (Pan b 1), spiny lobster (Pan s 1), black tiger shrimp (Pen m 1, Pen m 2, Pen m 3, Pen m 4, Pen m 6), narrow-clawed crayfish (Pon i 4, Pon i 7), blue swimmer crab (Por p 1), domestic cattle (Bos d 4, Bos d 5, Bos d 6, Bos d 7, Bos d 8, Bos d 9, Bos d 10, Bos d 11, Bos d 12), Atlantic herring (Clu h 1), common carp (Cyp c 1), Baltic cod (Gad c 1), Atlantic cod (Gad m 1, Gad m 2, Gad m 3), cod (Gad c 1), chicken (Gal d 1, Gal d 2, Gal d 3, Gal d 4, Gal d 5), Barramunda (Lat c 1), Lepidorhombus whiffiagonis (Lep w 1), chum salmon (Onc k 5), Atlantic salmon (Sal s 1, Sal s 2, Sal s 3) rainbow trout (Onc m 1), Mozambique tilapia (Ore m 4), edible frog (Ran e 1, Ran e 2), pacific pilchard (Sar sa 1), ocean perch (Seb m 1), yellowfin tuna (Thu a 1, Thu a 2, Thu a 3), swordfish (Xip g 1), abalone (Hal m 1), brown garden snail (Hel as 1), Squid (Tod p 1), pineapple (Ana c 1, Ana c 2), asparagus (Aspa o 1), barley (Hor v 12, Hor v 15, Hor v 16, Hor v 17, Hor v 20, Hor v 21), banana (Mus a 1, Mus a 2, Mus a 3, Mus a 4, Mus a 5), banana (Musxp1), rice (Ory s 12), rye (Sec c 20), wheat (Tri a 12, Tri a 14, Tri a 18, Tri a 19, Tri a 25, Tri a 26, Tri a 36, Tri a 37), maize (corn) (Zea m 14, Zea m 25), kiwi fruit (Act c1, Act c 2, Act c 5, Act c 8, Act c 10, Act d 1, Act d 2, Act d 3, Act d 4, Act d 5, Act d 6, Act d 7, Act d 8, Act d 9, Act d 10, Act d 11), cashew (Ana o 1, Ana o 2, Ana o 3), celery (Api g 1, Api g 2, Api g 3, Api g 4, Api g 5, Api g 6), peanut (Ara h 1, Ara h 2, Ara h 3, Ara h 4, Ara h 5, Ara h 6, Ara h 7, Ara h 8, Ara h 9, Ara h 10, Ara h 11, Ara h 12, Ara h 13), brazil nut (Ber e 1, Ber e 2), oriental mustard (Bra j 1), rapeseed (Bra n 1), cabbage (Bra o 3), turnip (Bra r 1, Bra r 2), bell pepper (Cap a 1w, Cap a 2), pecan (Car i 1, Car i 4), chestnut (Cas s 1, Cas s 5, Cas s 8, Cas s 9), lemon (Cit I 3), tangerine (Cit r 3), sweet orange (Cit s 1, Cit s 2, Cit s 3), Hazel (Cor a 1, Cor a 2, Cor a 8, Cor a 9, Cor a 11, Cor a 12, Cor a 13, Cor a 14), muskmelon (Cuc m 1, Cuc m 2, Cuc m 3), carrot (Dau c 1, Dau c 4, Dau c 5), common buckwheat (Fag e 2, Fag e 3), tartarian buckwheat (Fag t 2), strawberry (Fra a 1, Fra a 3, Fra a 4), soybean (Gly m 1, Gly m 2, Gly m 3, Gly m 4, Gly m 5, Gly m 6, Gly m 7, Gly m 8), sunflower (Hel a1, Hel a 2, Hel a 3), black walnut (Jug n 1, Jug n 2), English walnut (Jug r 1, Jug r 2, Jug r 3, Jug r 4), Cultivated lettuce (Lac s 1), Lentil (Len c 1, Len c 2, Len c 3), litchi (Lit c 1), narrow-leaved blue lupin (Lup an 1), apple (Mal d 1, Mal d 2, Mal d 3, Mal d 4), Cassava (Man e 5), mulberry (Mor n 3), avocado (Pers a 1), green bean (Pha v 3), pistachio (Pis v 1, Pis v 2, Pis v 3, Pis v 4, Pis v 5), pea (Pis s 1, Pis s 2), apricot (Pru ar 1, Pru ar 3), sweet cherry (Pru av 1, Pru av 2, Pru av 3, Pru av 4), European plum (Pru d 3), almond (Pru du 3, Pru du 4, Pru du 5, Pru du 6), peach (Pru p 1, Pru p 2, Pru p 3, Pru p 4, Pru p 7), pomegranate (Pun g 1), pear (Pyr c 1, Pyr c 3, Pyr c 4, Pyr c 5), castor bean (Ric c 1), red raspberry (Rub i 1, Rub i 3), Sesame (Ses i 1, Ses i 2, Ses i 3, Ses i 4, Ses i 5, Ses i 6, Ses i 7), yellow mustard (Sin a 1, Sin a 2, Sin a 3, Sin a 4), tomato (Sola I 1, Sola I 2, Sola I 3, Sola I 4), potato (Sola t 1, Sola t 2, Sola t 3, Sola t 4), Mung bean (Vig r 1, Vig r 2, Vig r 3, Vig r 4, Vig r 5, Vig r 6), grape (Vit v 1), Chinese date (Ziz m 1), Anacardium occidentale (Ana o 1.0101, Ana o 1.0102), Apium graveolens (Api g 1.0101, Api g 1.0201), Daucus carota (Dau c1.0101, Dau c1.0102, Dau c1.0103, Dau c1.0104, Dau c1.0105, Dau c1.0201), Citrus sinensis (Cit s3.0101, Cit s3.0102), Glycine max (Gly m1.0101, Gly m1.0102, Gly m3.0101, Gly m3.0102), Lens culinaris (Len c1.0101, Len c1.0102, Len c1.0103), Pisum sativum (Pis s1.0101, Pis s1.0102), Lycopersicon sativum (Lyc e2.0101, Lyc e2.0102), Fragaria ananassa (Fra a3.0101, Fra a3.0102, Fra a3.0201, Fra a3.0202, Fra a3.0203, Fra a3.0204, Fra a3.0301), Malus domestica (Mal d1.0101, Mal d1.0102, Mal d1.0103, Mal d1.0104, Mal d1.0105, Mal d1.0106, Mal d1.0107, Mal d1.0108, Mal d1.0109, Mal d1.0201, Mal d1.0202, Mal d1.0203, Mal d1.0204, Mal d1.0205, Mal d1.0206, Mal d1.0207, Mal d1.0208, Mal d1.0301, Mal d1.0302, Mal d1.0303, Mal d1.0304, Mal d1.0401, Mal d1.0402, Mal d1.0403, Mal d3.0101w, Mal d3.0102w, Mal d3.0201w, Mal d3.0202w, Mal d3.0203w, Mal d4.0101, Mal d4.0102, Mal d4.0201, Mal d4.0202, Mal d4.0301, Mal d4.0302), Prunus avium (Pru av1.0101, Pru av1.0201, Pru av1.0202, Pru av1.0203), and Prunus persica (Pru p4.0101, Pru p4.0201); and any variants thereof. The names of allergens associated with food are systematically named and listed according to IDIS Allergen Nomenclature Sub-Committee (see, International Union of Immunological Societies Allergen Nomenclature Sub-Committee, List of isoallergens and variants).
In addition to food allergens, aptamers, signaling polynucleotides and detection agents of the present invention may detect airborne particulates/allergens and other environmental allergens. Samples that contain allergens may be obtained from plants (e.g. weeds, grasses, trees, pollens), animals (e.g., allergens found in the dander, urine, saliva, blood or other bodily fluid of mammals such as cat, dog, cow, pig, sheep, horse, rabbit, rat, guinea pig, mouse and gerbil), fungi/mold, insects (e.g., stinging insects such as bee, wasp, and hornet and chirnomidae (non-biting midges), as well as other insects such as the housefly, fruit fly, sheep blow fly, screw worm fly, grain weevil, silkworm, honeybee, non-biting midge larvae, bee moth larvae, mealworm, cockroach and larvae of Tenibrio molitor beetle; spiders and mites such as the house dust mite), rubbers (e.g. latex), metals, chemicals (e.g. drugs, protein detergent additives) and autoallergens and human autoallergens (e.g. Hom s 1, Hom s 2, Hom s 3, Hom s 4, Hom s 5) (see, Allergen Nomenclature: International Union of Immunological Societies Allergen Nomenclature Sub-Committee, List of allergens and Allergen Nomenclature: International Union of Immunological Societies Allergen Nomenclature Sub-Committee, List of isoallergens and variants).
Examples of allergenic proteins from plants that can be detected using the aptamers, signaling polynucleotides and detection agents of the present invention include, but are not limited to, ash (Fra e 1), Japanese cypress (Cha o1, Cha o 2), sugi (Cry j1, Cry j 2), cypress (Cup a 1), common cypress (Cup s 1, Cup s 3), mountain cedar (Jun a 1, Jun a 2, Jun a 3, Jun s 1), prickly juniper (Jun o 4), eastern red cedar (Jun v 1, Jun v 3), sweet vernal grass (Ant o 1), saffron crocus (Cro s 1, Cro s 2), Bermuda grass (Cyn d 1, Cyn d 7, Cyn d 12, Cyn d 15, Cyn d 22w, Cyn d 23, Cyn d 24), orchard grass (Dac g 1, Dac g 2, Dac g 3, Dac g 4, Dac g 5), meadow fescue (Fes p 4), velvet grass (Hol I 1, Hol I 5), barley (Hor v 1, Hor v 5), rye grass (Lol p 1, Lol p 2, Lol p 3, Lol p 4, Lol p 11), bahia grass (Pas n 1), canary grass (Pha a 1, Pha a 5), timothy (Phl p 1, Phl p 2, Phl p 4, Phl p 5, Phl p 6, Phl p 7, Phl p 11, Phl p 12, Phl p 13), date palm (Pho d 2), Kentucky blue grass (Poa p 1, Poa p 5), rye (Sec c 1, Sec c 5, Sec c 38), Johnson grass (Sor h 1), wheat (Tri a 15, Tri a 21, Tri a 27, Tri a 28, Tri a 29, Tri a 30, Tri a 31, Tri a 32, Tri a 33, Tri a 34, Tri a 35, Tri a 39), maize (Zea m 1, Zea m 12), alder (Aln g 1, Aln g 4), redroot pigweed (Ama r 2), short ragweed (Amb a 1, Amb a 2, Amb a 3, Amb a 4, Amb a 5, Amb a 6, Amb a 7, Amb a 8, Amb a 9, Amb a 10, Amb a 11), western ragweed (Amb p 5), giant ragweed (Amb t 5), mugwort (Art v 1, Art v 2, Art v 3, Art v 4, Art v 5, Art v 6), sugar beet (Beta v 1, beta v 2), European white birch (Bet v 1, Bet v 2, Bet v 3, Bet v 4, Bet v 6, Bet v 7), turnip (Bra r 5), hornbeam (Car b 1), chestnut (Cas s 1), rosy periwinkle (Cat r 1), lamb's-quarters, pigweed (Che a 1, Che a 2, Che a 3), Arabian coffee (Cof a 1, Cof a 2, Cof a 3), Hazel (Cor a 6, Cor a 10), Hazel nut (Cor a1.04, Cor a2, Cor a8), European beech (Fag s 1), ash (Fra e 1), sunflower (Hel a 1, Hel a 2), para rubber tree (Hey b 1, Hey b 2, Hey b 3, Hey b 4, Hey b 5, Hey b 6, Hey b 7, Hey b 8, Hey b 9, Hey b 10, Hey b 11, Hey b 12, Hey b 13, Hey b 14), Japanese hop (Hum j 1), privet (Lig v 1), Mercurialis annua (Mer a 1), olive (Ole e 1, Ole e 2, Ole e 3, Ole e 4, Ole e 5, Ole e 6, Ole e 7, Ole e 8, Ole e 9, Ole e 10, Ole e 11), European hophornbeam (Ost c 1), Parietaria judaica (Par j 1, Par j 2, Par j 3, Par j 4), Parietaria officinalis (Par o 1), Plantago lanceolata (Pal I 1), London plane tree (Pla a 1, Pla a 2, Pla a 3), Platanus orientalis (Pla or 1, Pla or 2, Pla or 3), white oak (Que a 1), Russian thistle (Sal k 1, Sal k 2, Sal k 3, Sal k 4, Sal k 5), tomato (Sola I 5), Lilac (Syr v 1, Syr v 5), Russian-thistle (Sal k 1), English plantain (Pla 11), Ambrosia artemisiifolia (Amb a8.0101, Amb a8.0102, Amb a9.0101, Amb a9.0102), Plantago lanceolata (Pla 11.0101, Pla 11.0102, Pla 11.0103), Parietaria judaica (Par j 3.0102), Cynodon dactylon (Cyn d1.0101, Cyn d1.0102, Cyn d1.0103, Cyn d1.0104, Cyn d1.0105, Cyn d1.0106, Cyn d1.0107, Cyn d1.0201, Cyn d1.0202, Cyn d1.0203, Cyn d1.0204), Holcus lanatus (Hol 11.0101, Hol 11.0102), Lolium perenne (Ph1 p1.0101, Ph1 p1.0102, Ph1 p4.0101, Ph1 p4.0201, Ph1 p5.0101, Ph1 p5.0102, Ph1 p5.0103, Ph1 p5.0104, Ph1 p5.0105, Ph1 p5.0106, Ph1 p5.0107, Ph1 p5.0108, Ph1 p5.0201, Ph1 p5.0202), Secale cereale (Sec c20.0101, Sec c20.0201), Betula Verrucosa (Bet v1.0101, Bet v1.0102, Bet v 1.0103, Bet v 1.0201, Bet v 1.0301, Bet v1.0401, Bet v 1.0402, Bet v 1.0501, Bet v 1.0601, Bet v 1.0602, Bet v1.0701, Bet v1.0801, Bet v1.0901, Bet v1.1001, Bet v1.1101, Bet v1.1201, Bet v 1.1301, Bet v1.1401, Bet v1.1402, Bet v1.1501, Bet v1.1502, Bet v1.1601, Bet v1.1701, Bet v 1.1801, Bet v1.1901, Bet v1.2001, Bet v1.2101, Bet v1.2201, Bet v1.2301, Bet v1.2401, Bet v 1.2501, Bet v1.2601, Bet v1.2701, Bet v1.2801, Bet v1.2901, Bet v1.3001, Bet v1.3101, Bet v 6.0101, Bet v6.0102), Carpinus betulus (Car b1.0101, Car b1.0102, Car b1.0103, Car b1.0104, Car b1.0105, Car b1.0106, Car b1.0106, Car b1.0106, Car b1.0106, Car b1.0107, Car b1.0107, Car b1.0108, Car b1.0201, Car b1.0301, Car b1.0302), Corylus avellana (Cor a1.0101, Cor a1.0102, Cor a1.0103, Cor a1.0104, Cor a1.0201, Cor a1.0301, Cor a1.0401, Cor a1.0402, Cor a1.0403, Cor a1.0404), Ligustrum vulgare (Syr v1.0101, Syr v1.0102, Syr v1.0103), Cryptomeria japonica (Cry j2.0101, Cry j2.0102), and Cupressus sempervirens (Cup s1.0101, Cup s1.0102, Cup s1.0103, Cup s1.0104, Cup s1.0105); and any variants thereof.
Lupin is an herbaceous plant of the leguminous family belonging to the genus Lupinus. In Europe, lupin flour and seeds are widely used in bread, cookies, pastry, pasta, sauces, as well as in beverages as a substitute for milk or soy, and in gluten-free foods. The International Union of Immunological Societies (LUIS) allergen nomenclature subcommittee recently designated β-conglutin as the Lup an 1 allergen. (Nadal, et al., DNA Aptamers against the Lup an 1 Food Allergen. PLoS ONE, 2012, 7(4): e35253), and more recently, a high-affinity 11-mer DNA aptamer against Lup an 1 (β-conglutin) was reported (Nadal, et al., Probing high-affinity 11-mer DNA aptamer against Lup an 1 (β-conglutin). Anal. Bioanal. Chem. 2013, 405: 9343-9349).
Examples of allergenic proteins from mites that can be detected using the aptamers, signaling polynucleotides and detection agents of the present invention include, but are not limited to, mite (Blo t 1, Blo t 3, Blo t 4, Blo t 5, Blo t 6, Blo t 10, Blo t 11, Blo t 12, Blo t 13, Blo t 19, Blot t 21); American house dust mite (Der f 1, Der f 2, Der f 3, Der f 7, Der f 10, Der f 11, Der f 13, Der f 14, Der f 15, Der f 16, Der f 17, Der f 18, Der f 22, Der f 24); Dermatophagoides microceras (house dust mite) (Der m 1); European house dust mite (Der p 1, Der p 2, Der p 3, Der p 4, Der p 5, Der p 6, Der p 7, Der p 8, Der p 9, Der p 10, Der p 11, Der p 14, Der p 15, Der p 20, Der p 21, Der p 23); Euroglyphus maynei (House dust mite) (Eur m 2, Eur m 2, Eur m 3, Eur m 4, Eur m 14); storage mite (Aca s 13, Gly d 2, Lep d 2, Lep d 5, Lep d 7, Lep d 10, Lep d 13, Tyr p 2, Tyr p 3, Tyr p 10, Tyr p 13, Tyr p 24), Dermatophagoides farinae (Der f1.0101, Der f1.0102, Der f1.0103, Der f1.0104, Der f1.0105, Der f2.0101, Der f2.0102, Der f2.0103, Der f2.0104, Der f2.0105, Der f2.0106, Der f2.0107, Der f2.0108, Der f2.0109, Der f2.0110, Der f2.0111, Der f2.0112, Der f2.0113, Der f2.0114, Der f2.0115, Der f2.0116, Der f2.0117), Dermatophagoides pteronyssinus (Der p1.0101, Der p1.0102, Der p1.0103, Der p1.0104, Der p1.0105, Der p1.0106, Der p1.0107, Der p1.0108, Der p1.0109, Der p1.0110, Der p1.0111, Der p1.0112, Der p1.0113, Der p1.0114, Der p1.0115, Der p1.0116, Der p1.0117, Der p1.0118, Der p1.0119, Der p1.0120, Der p1.0121, Der p1.0122, Der p1.0123, Der p2.0101, Der p2.0102, Der p2.0103, Der p2.0104, Der p2.0105, Der p2.0106, Der p2.0107, Der p2.0108, Der p2.0109, Der p2.0110, Der p2.0111, Der p2.0112, Der p2.0113), Euroglyphus maynei (Eur m2.0101, Eur m2.0102), Lepidoglyphus destructor (Lep d2.0101, Lep d2.0101, Lep d2.0101, Lep d2.0102, Lep d2.0201, Lep d2.020) and Glycyphagus domesticus (Gly d2.0101, Gly d2.0201); and any variants thereof.
Examples of allergenic proteins from animals that can be detected using the aptamers, signaling polynucleotides and detection agents of the present invention include, but are not limited to, domestic cattle (Bos d 2, Bos d 3, Bos d 4, Bos d 5, Bos d 6, Bos d 7, Bos d 8), dog (Can f 1, Can f 2, Can f 3, Can f 4, Can f 5, Can f 6), domestic horse (Equ c 1, Equ c 2, Equ c 3, Equ c 4, Equ c 5), cat (Fel d 1, Fel d 2, Fel d 3, Fel d 4, Fel d 5w, Fel d 6w, Fel d 7, Fel d 8), mouse (Mus m 1), guinea pig (Cav p 1, Cav p 2, Cav p 3, Cav p 4, Cav p 6), rabbit (Ory c 1, Ory c 3, Ory c 4) rat (Rat n 1), Bos domesticus (Bos d 2.0101, Bos d 2.0102, Bos d 2.0103) and Equus caballus (Equ c2.0101, Equ c 2.0102); and any variants thereof.
Examples of allergenic proteins from insects that can be detected using the aptamers, signaling polynucleotides and detection agents of the present invention include, but are not limited to, yellow fever mosquito (Aed a 1, Aed a 2, Aed a 3), Eastern hive bee (Api c 1), giant honeybee (Api d 1), honey bee (Api m 1, Api m 2, Api m 3, Api m 4, Api m 5, Api m 6, Api m 7, Api m 8, Api m 9, Api m 10, Api m 11, Api m 12), pigeon tick (Arg r 1), German cockroach (Bla g 1, Bla g 2, Bla g 3, Bla g 4, Bla g 5, Bla g 6, Bla g 7, Bla g 8, Bla g 11), bumble bee (Born p 1, Born p 4, Born t 1, Born t 4), silk moth (Bomb m 1), midge (Chi k 10, Chi t 1, Chi t 1.01, Chi t 2, Chi t 2.0101, Chi t 2.0102, Chi t 3, Chi t 4, Chi t 5, Chi t 6, Chi t 6.01, Chi t 7, Chi t 8, Chi t 9), cat flea (Cte f 1, Cte f 2, Cte f 3), yellow hornet (Dol a 5), white face hornet (Dol m 1, Dol m 2, Dol m 5), biting midge (Fort 1, Fort 2), Savannah Tsetse fly (Glo m 5), Asian ladybeetle (Har a 1, Har a 2), silverfish (Lep s 1), booklouse (Lip b 1), Australian jumper ant (Myr p 1, Myr p 2, Myr p 3), American cockroach (Per a 1, Per a 3, Per a 6, Per a 7, Per a 9, Per a 10), Indian meal moth (Plo i 1, Plo i 2), wasp (Pol a 1, Pol a 2, Pol a 5, Pol e 1, Pol e 4, Pol e 5, Pol f 5, Pol g 1, Pol g 5, Pol m 5, Poly p 1, Poly s 5, Ves vi 5), Mediterranean paper wasp (Pol d 1, Pol d 4, Pol d 5), tropical fire ant (Sol g 2, Sol g 3, Sol g 4), Solenopsis invicta (red imported fire ant) (Sol I 1, Sol I 2, Sol I 3, Sol I 4), black fire ant (Sol r 2, Sol r 3), Brazilian fire ant (Sol s 2, Sol s 3), horsefly (Tab y 1, Tab y 2, Tab y 5), pine processionary moth (Tha p 1, Tha p 2), California kissing bug (Tria p 1), European hornet (Vesp c 1, Vesp c 5), Vespa magnifica (hornet) (Vesp ma 2, Vesp ma 5), Vespa mandarinia (Giant asian hornet) (Vesp m1, Vesp m 5), yellow jacket (Ves f 5, Ves g 5, Ves m 1, Ves m 2, Ves m 5), Vespula germanica (yellow jacket) (Ves p 5), Vespula squamosa (Yellow jacket) (Ves s 1, Ve s s5), Vespula vulgaris (Yellow jacket) (Ves v 1, Ves v 2, Ves v 3, Ves v 4, Ves v 5, Ves v 6), Blattella germanica (Bla g 1.0101, Bla g 1.0102, Bla g 1.0103, Bla g 1.02, Bla g 6.0101, Bla g 6.0201, Bla g 6.0301), Periplaneta Americana (Per a1.0101, Per a1.0102, Per a1.0103, Per a1.0104, Per a1.02, Per a3.01, Per a3.0201, Per a3.0202, Per a3.0203, Per a7.0101, Per a7.0102), Vespa crabo (Ves pc 5.0101, Ves pc 5.0101), Vespa mandarina (Vesp m 1.01, Vesp m 1.02); and any variants thereof.
Examples of allergenic proteins from fungi/mold that can be detected using the aptamers, signaling polynucleotides and detection agents of the present invention include, but are not limited to, Alternaria alternata (Alternaria rot fungus) (Alt a 1, Alt a 3, Alt a 4, Alt a 5, Alt a 6, Alt a 7, Alt a 8, Alt a 10, Alt a 12, Alt a 13), Aspergillus flavus (fungus) (Asp fl 13), Aspergillus fumigatus (fungus) (Asp f 1, Asp f 2, Asp f 3, Asp f 4, Asp f 5, Asp f 6, Asp f 7, Asp f 8, Asp f 9, Asp f 10, Asp f 11, Asp f 12, Asp f 13, Asp f 15, Asp f 16, Asp f 17, Asp f 18, Asp f 22, Asp f 23, Asp f 27, Asp f 28, Asp f 29, Asp f 34), Aspergillus niger (Asp n 14, Asp n 18, Asp n 25), Aspergillus oryzae (Asp o 13, Asp o 21), Aspergillus versicolor (Asp v 13), Candida albicans (Yeast) (Cand a 1, Cand a 3), Candida boidinii (Yeast) (Cand b 2), Cladosporium cladosporioides (Cla c 9, Cla c 14), Cladosporium herbarum (Cla h 2, Cla h 5, Cla h 6, Cla h 7, Cla h 8, Cla h 9, Cla h 10, Cla h 12), Curvularia lunata (Synonym: Cochliobolus lunatus) (Cur 1 1, Cur I 2, Cur I 3, Cur I 4), Epicoccum purpurascens (Soil fungus) (Epi p 1), Fusarium culmorum (N.A.) (Fus c 1, Fus c 2), Fusarium proliferatum (Fus p 4), Penicillium brevicompactum (Pen b 13, Pen b 26), Penicillium chrysogenum (Pen ch 13, Pen ch 18, Pen ch 20, Pen ch 31, Pen ch 33, Pen ch 35), Penicillium citrinum (Pen c 3, Pen c 13, Pen c 19, Pen c 22, Pen c 24, Pen c 30, Pen c 32), Penicillium crustosum (Pen cr 26), Penicillium oxalicum (Pen o 18), Stachybotrys chartarum (Sta c 3), Trichophyton rubrum (Tri r 2, Tri r 4), Trichophyton tonsurans (Tri t 1, Tri t 4), Psilocybe cubensis (Psi c 1, Psi c 2), Shaggy cap (Cop c 1, Cop c 2, Cop c 3, Cop c 5, Cop c 7), Rhodotorula mucilaginosa (Rho m 1, Rho m 2), Malassezia furfur (Malaf2, Malaf3, Malaf4), Malassezia sympodialis (Malas1, Malas5, Malas6, Malas7, Malas8, Malas9, Malas10, Malas11, Malas12, Malas13) and Alternaria alternate (Alt a1.0101, Alt a1.0102); and any variants thereof.
Examples of additional allergens include, but are not limited to, Nematode (Ani s 1, Ani s 2, Ani s 3, Ani s 4), worm (Asc s 1), soft coral (Den n 1), rubber (Latex) (Hey b 1, Hey b 2, Hey b 3, Hey b 5, Hey b 6, Hey b 7, Hey b 8, Hey b 9, Hey b 10, Hey b 11, Hey b 12, Hey b 13), obeche (Trip s 1) and Heveabrasiliensis (Hey b6.01, Hey b6.0201, Hey b6.0202, Hey b6.03, Hey b8.0101, Hey b8.0102, Hey b8.0201, Hey b8.0202, Hey b8.0203, Hey b8.0204, Hey b10.0101, Hey b10.0102, Hey b10.0103, Hey b11.0101, Hey b11.0102); and any variants thereof.
Some new allergens may include allergen secretoglobin from horse dander (U.S. Pat. No. 9,164,101) and prostate kallikrein allergen from dog (U.S. Pat. No. 9,182,400).
In addition to allergens, detection systems, devices, aptamers, SPNs and detection agents of the present invention may be used to detect any target content in a sample.
In some embodiments, detection systems, devices, aptamers, SPNs and detection agents of the present invention may detect one or more target proteins specific to a pathogenic microorganism. The target protein may be a molecule secreted by a pathogen, a surface protein, a protein induced in a host which a pathogen attacks, or a portion of a target protein. The present invention allows for the detection and identification of many different types of pathogenic microorganisms, such as bacteria, yeasts, fungi, spores, viruses or prions. As used herein, the term “pathogen” means any disease-producing agent (especially a virus or bacterium or other microorganism).
In some embodiments, detection systems, devices, aptamers, SPNs and detection agents of the present invention may detect other target molecules such as diseases associated proteins to diagnose, stage diseases, disorders and other clinical conditions. Disease associated proteins may be secreted polypeptides and peptides (e.g. circulating molecules); cell surface proteins (e.g. receptors); biomarkers that are expressed or overexpressed in a particular disease condition; isoforms, derivatives and/or variants of a particular protein that are only present in a disease condition; mutated proteins that cause a disorder; and proteins derived from another organism which causes a clinical condition in the host such as viral infection.
In other embodiments, detection systems, devices, aptamers, SPNs and detection agents of the present invention may detect non-protein target molecules, for example, a ganglioside, a lipid, a phospholipid, a carbohydrate, a small molecule (e.g. a mycotoxin and an antibiotic), a hapten, and a nucleic acid (DNA or RNA), a pesticide, a fertilizer and other chloroaromatic pollutants.
The present invention further provides methods for detecting the presence and/or absence of an allergen of interest in a food sample. Various methods and assays may be used in combination with detection systems, devices, aptamers, SPNs, detection agents and compositions of the present invention; the choice may depend on the application field. In some embodiments, an allergen detection testing assay is provided using aptamer-based signal polynucleotides as detection agents. In some embodiments, the signal polynucleotide is labeled with a fluorophore at one terminus of the polynucleotide. In other embodiments, changes in fluorescence polarization upon allergen protein binding may be detected to measure the presence of an allergen. In some embodiments, the SPNs and detection agents may comprise nucleic acid sequences included in Table 1 and Table 2.
In general, assays and methods for detecting a target allergen protein in a sample using systems, device, aptamers, SPNs and detection agents of the present invention comprise steps of (a) obtaining a test sample suspected of containing an allergen of interest; (b) processing the sample of (a) with an extraction buffer; (c) contacting the processed sample with a detection agent specific to the allergen on interest; (d) treating the mixed processed sample and detection agent with an excitation means; and (e) visualizing the interaction between the allergen of interest contained in the processed sample and the detection agent. Assays and methods provided can detect the presence and/or absence of an allergen of interest in a sample, and/or determine the amount of the allergen in a sample.
Assays and methods for detecting the allergen content in a sample are applicable to foods containing the allergens without any restriction. Examples of foods include eggs, milk, meat, fishes, crustacea and mollusks, cereals, legumes and nuts, fruits, vegetables, beer yeast, and gelatin; more particularly, egg white and egg yolk of the eggs, milk and cheese of the milk, pork, beef, chicken and mutton of the meat, mackerel, horse mackerel, sardine, tuna, salmon, codfish, flatfish and salmon caviar of the fishes, crab, shrimp, blue mussel, squid, octopus, lobster and abalone of the crustacea and mollusks, wheat, rice, buckwheat, rye, barley, oat, corn, millet, foxtail millet and barnyardgrass of the cereals, soybean, peanut, cacao, pea, kidney bean, hazelnut, Brazil nut, almond, coconut and walnut of the legumes and nuts, apple, banana, orange, peach, kiwi, strawberry, melon, avocado, grapefruit, mango, pear, sesame and mustard of the fruits, tomato, carrot, potato, spinach, onion, garlic, bamboo shoot, pumpkin, sweet potato, celery, parsley, yam and Matsutake mushroom of the vegetables, the foods containing them, and the ingredients thereof (e.g., ovoalbumin, ovomucoid, lysozyme, casein, beta-lactoglobulin, alpha-lactoalbumin, gluten, and alpha-amylase inhibitor).
The foods could be fresh foods, frozen foods, cooled foods or processed foods containing animal derived meat and/or vegetables. These foods may be processed by heating, freezing, drying, salting, fermentation, enzymatic processing, etc.
In some embodiments, food sample processing may involve use of a universal formulation. This universal formulation will be clinically relevant as to try to minimally affect the food tested and only sample approximately 0.5 g of food, allowing detection of traces of allergens when their concentration will be minimal in the sample. This optimized protein extraction process will provide a fast, accurate and universal protocol that allows detection of an allergen in any food matrix. In some aspects, the universal buffer may be a Tris based buffer (T buffer), a HEPES based buffer, TGK based buffer, or PBS based buffer. A detailed discussion is provided below.
In some embodiments, one or more detection agents (e.g. SPNs) may be used, depending on the nature of the food matrixes. Some food contains several allergenic proteins, e.g., at least eight peanut proteins, such as Ara h1 and Ara h2, can potentially cause an immunological response. In such case, more than one SPN against more than one allergenic protein may be used in a mixed cocktail for detecting the absence or presence of peanut. In other aspects, some food matrixes such as fish, shellfish and mollusks, contain only one major allergenic protein. One or more SPNs that specifically bind to this major allergen protein may be used for allergen detection. In some aspects, detection agents may be pre-stored in the detection system, and be released during the process of a detection assay, for example, in the disposable test cup of the present invention.
In some embodiments, allergen detection assays and methods of the present invention can detect a lower concentration of allergen in a food sample. The sensitivity of nucleic acid aptamers and SPNs and optical design makes it possible to detect the presence of an allergen as low as 0.0001 ppm. In some aspects, the concentration or mass of allergen that can be detected may range from 0.001 ppm to 5 ppm, or from 0.001 ppm to 0.1 ppm, or from 0.1 ppm to 3 ppm, or from 1 ppm to 5 ppm, or from 5 ppm to 10 ppm, or from 10 ppm to 30 ppm. In some aspects, the concentration or mass of allergen in a food sample that can be detected may be 0.001 ppm, 0.002 ppm, 0.003 ppm, 0.004 ppm, 0.005 ppm, 0.006 ppm, 0.007 ppm, 0.008 ppm, 0.009 ppm, 0.01 ppm, 0.02 ppm, 0.03 ppm, 0.04 ppm, 0.05 ppm, 0.06 ppm, 0.07 ppm, 0.08 ppm, 0.09 ppm, 0.1 ppm, 0.2 ppm, 0.3 ppm, 0.4 ppm, 0.5 ppm, 0.6 ppm, 0.7 ppm, 0.8 ppm, 0.9 ppm, 1.0 ppm, 1.5 ppm, 2 ppm, 2.5 ppm, 3 ppm, 3.5 ppm, 4 ppm, 4.5 ppm, 5 ppm, 10 ppm, 15 ppm, 20 ppm, or 30 ppm.
In some embodiments, allergen detection assays and methods of the present invention may complete the implementation in less than 5 minutes. In some aspects, the assay time may be from about 1 minute to about 5 minutes, about 1 minute to about 3 minute, about 2 minutes to about 10 minutes, about 5 minutes to about 10 minutes. In other aspects, the assay time may last less than 1 min, 2 min 3 min, 4 min, 5 min, 6 min, 7 min, 8 min, 9 min, or 10 min. In further other aspects, the assay time may last less than about 10 seconds, about 15 seconds, about 20 seconds, about 25 seconds, about 30 seconds, about 35 seconds, about 40 seconds, about 45 seconds, about 50 seconds, about 55 seconds or about 60 seconds.
Any methods and systems used to detect and display nucleic acid molecule (e.g., SPN) and protein interaction may be used to display the detection results. In some embodiments, fluorescence polarization (FP) changes from a fluorophore probed detection molecule (e.g. SPN) upon the binding of a target allergen are measured to indicate the presence and absence of the target allergen in a sample. To measure fluorescence polarization, the sample is excited with linearly polarized light. When the emission polarizer is oriented parallel to the direction of the polarized excitation, the fluorescence intensity in parallel is measured and when the emission polarizer is oriented perpendicularly to the polarization plane of the excitation light, the perpendicular fluorescence intensity is measured. Fluorescence emission may be depolarized by a number of phenomena, including rotational diffusion of the fluorophore during the lifetime of the excited state, energy transfer, reabsorption, etc. Following the principle of FP technology, the binding of a target allergen to the relatively small signaling polynucleotide can significantly change the rotational diffusion; such change cause FP and can be used to quantify the bound target.
In some embodiments, the FP change may be measured using an optical system and the detected signal may be visualized to report to the consumer. In one aspect, the device of the present invention may be used. Accordingly, the polarized light emitter in the system emits lights having an excitation wavelength appropriate to excite the fluorophore of the SPNs and the light detector in the system can filter fluorescence emitted from the fluorophores of the SPNs and transmit the wavelength(s) of interest. A means then may be used to process and convert the fluorescence signals to useful readouts (i.e. digital signals). In another aspect, changes in FP may be measured in any commercial FP equipment.
In some embodiments, the wavelength of the polarized light is in a range of 200 nm and 800 nm.
In some embodiments, signals from the interaction between a SPN and a target allergen may be detected and visualized by a detection system. Some non-limiting examples include lateral flow devices (LFD), microfluidic chips (U.S. Pat. No. 8,617,903), portable detection devices/systems described in the commonly owned US patent application NOs. 62/133,632 filed on Mar. 16, 2015 and 62/182,900 filed Jun. 22, 2015, and the cartridge as described in the commonly owned PCT patent application NO.: PCT/US14/62656 filed on Oct. 28, 2014, the contents of each of which are incorporated herein by reference in their entirety.
The detection result from the present assay may be displayed in a platform that a user can easily read such as a display window. In one embodiment, it may be a platform application in a computer, a pad and/or a smartphone (Coskun et al., A personalized food allergen testing platform on a cellphone, Lab Chip., 2013, 13(4), 636-640; the contents of which are incorporated herein by reference in its entirety).
In one embodiment, a method for detecting the presence and/or absence of an allergen protein of interest may be implemented with the present detection systems and compositions. A detailed description of the method is set forth in the following sections.
To provide a reliable and sensitive result from an allergen detection testing, a right size of a testing sample is important. The inventors of the present invention developed a sampling mechanism that can collect a test sample effectively and non-destructively for fast and efficient extraction of allergen proteins for detection.
A sized portion of the test sample can be collected using, for example, a food corer 200 illustrated in FIG. 2c. The sample pickup (e.g., food corer 200) can measure the size and collect a rightly sized sample which can provide enough protein extraction for the detection testing. The sized portion may be ranged from 0.1 g to 1 g food sample. Furthermore, the food corer 200 may pre-process the collected test sample by cutting, grinding, blending, abrading and/or filtering. Pre-processed test sample will be introduced into the sample processing cup body 220 for homogenization and allergen protein extraction. As illustrated in FIG. 1a and FIG. 3a, the food corer 200 may be inserted into the food corer port 213 on the top of the cup lid assembly 210 and releases the test sample into the disposable test cup 300.
The collected test sample is processed in an extraction buffer. In some aspects, an extraction buffer is present in the cup body 220 and may be mixed with the test sample by the homogenizer assembly 570. In other aspects, the extraction buffer may be released into the cup body 220 from a local region (e.g., at the bottom of the cup body 220) by manual plunging or automatically release from the storage place to the cup chamber. The test sample and the extraction buffer will be mixed together by the homogenizer assembly 570 and the sample being homogenized.
The extraction buffer may be universal target extraction buffer that can retrieve enough target protein (e.g., minimum 1 mg/ml total protein) from any test sample and be optimized for maximizing protein extraction and allergen retrieval. In some embodiments, the formulation of the universal protein extraction buffer can extract protein at room temperature and in minimal time, e.g., less than about 2 minutes, or less than about 1 minute, or less than about 30 seconds. The same buffer may be used during food sampling, homogenization and filtering. The universal extraction buffer will be applicable to any allergen and to all foods (e.g. pre-processed or post-processed). Additionally, the universal extraction buffer can improve signaling polynucleotides (SPNs) binding affinity, minimize non-specific binding and increase signal to noise ratio. In certain aspects, the extraction buffer may be PBS based buffer containing 10%, 20% or 40% ethanol, or Tris based buffer containing Tris base Ph8.0, 5 mM MEDTA and 20% Ethanol, or a modified PBS or Tris buffer. In some examples, the buffer may be a HEPES based buffer. Some examples of modified PBS buffers may include: P+ buffer and K buffer. Some examples of Tris based buffers may include Buffer A+, Buffer A, B, C, D, E, and Buffer T. A detailed description of each modified buffer is disclosed in the PCT patent application No.: PCT/US2014/062656; the content of which is incorporated herein by reference in its entirety.
The volume of the extraction buffer may be from 0.5 mL to 3 mL, which has been determined to be efficient and repeatable over time and in different food matrices.
In accordance with the present invention, the test sample is homogenized and processed using a homogenizer (e.g. the homogenizer assembly 570) that has been optimized with high speed homogenization for maximally processing the test sample. In some aspects, a filtering mechanism may be linked to the homogenizer. The homogenized sample solution is then driven to flow through a filter processing to further extract allergen proteins, lowering the amount of other molecules extracted from the test sample. A filter membrane such as cell strainer from CORNING (CORNING, NY, USA) or similar custom embodiment may be connected to the homogenizer. The filter pores can be between 0.2 μm to 600 μm. The filter can be made from any low binding material, including, but not limited to, PES (Polyethersulfone), PCTE (Polycarbonate) or PVDF (polyvinylidene difluoride). The filtering process may be a multi-stage arrangement with changing pore sizes from first filter to second. Filters may be in any configuration relative to the FLOW VALVE (get the right name of this from above), above, below or in between any of the stages of the filtration.
In some aspects, the sampling procedure may reach effective protein extraction in less than 1 minute. In one aspect, speed of digestion may be less than 2 minutes including food pickup, digestion and readout. Approximately, the procedure may be 15 seconds, 30 seconds, 45 seconds, 50 seconds, 55 seconds or 1 minute.
Extracted allergen proteins may be mixed with one or more detection agents that are specific to one or more allergens of interest. The interaction between allergen protein extraction and detection agents will generate a detectable signal which indicates the presence, or absence or the amount of one or more allergens in the test sample. As used herein, the term “detection agent” or “allergen detection agent” refers to any molecule which is capable of, or does, interact with and/or bind to one or more allergens in a way that allows detection of such allergen in a sample.
In one aspect of the present invention, the detection agents are nucleic acid molecules based SPNs.
In other embodiments, aptamer molecules that can be used as detection agents in reaction chambers 223 may be aptamers described in applicants' relevant patent applications including U.S. Provisional Application Ser. No. 62/026,361, filed on Jul. 18, 2014; U.S. Provisional Application Ser. No. 62/009,958, filed on Jun. 10, 2014; U.S. Provisional Application Ser. No. 61/991,068, filed on May 9, 2014; U.S. Provisional Application Ser. No. 61/938,528, filed on Feb. 11, 2014; U.S. Provisional Application Ser. No. 61/896,399, filed on Oct. 28, 2013; and PCT Application Serial No.: PCT/US2014/062656, filed on Oct. 28, 2014; and U.S. Provisional Application Ser. No. 62/154,200 filed on Apr. 29, 2015; the contents of each of which are herein incorporated by reference in their entirety.
In addition to aptamers based SPNs, detection agents used in the detection device 100 may be any molecules or agents which are capable of association or binding to one or more allergens such as small molecules, antibodies and variants thereof. The antibodies detectors may be polyclonal antibodies, monoclonal antibodies, single chain antibodies, antibody fragments and other functional variants.
In some embodiments, aptamers and SPNs of the present invention which are labeled with a fluorescent marker may be used as the detection agents. The SPNs may comprise nucleic acid sequences as included in Table 1 and Table 2. In some aspects, the SPNs may be labeled at one end of the polynucleotide with a fluorescent marker. In this aspect, a change in fluorescence polarization of the fluorescent probed detection agent upon the binding of an allergen presented in a test sample is measured and used to calculate the allergen content in the test sample. Fluorescence polarization changes may be measured by the optical subsystems 520 as shown in FIG. 16 and FIG. 17 of the present detection system.
The fluorescent marker, fluorophore may suitably have an excitation maximum in the range of 200 to 800 nm, while the emission maximum may be in the range of 300 to 700 nm. The fluorophore may further have a fluorescence relaxation time in the range of 1-7 nanoseconds, preferably 3-5 nanoseconds. As non-limiting examples, a fluorophore that can be probed at one terminus of a SPN may include derivatives of BODIPY (e.g., BODIPY TMR dye; BODIPY FL dye), Fluorescein including derivatives thereof, Rhodamine including derivatives thereof, Dansyls including derivatives thereof (e.g. dansyl cadaverine), Texas red, Eosin, Cyanine dyes, Indocarbocyanine, Oxacarbocyanine, Thiacarbocyanine, Merocyanine, Squaraines and derivatives Seta, SeTau, and Square dyes, Naphthalene and derivatives thereof, Coumarin and derivatives thereof, Pyridyloxazole, Nitrobenzoxadiazole, Benzoxadiazole, Anthraquinones, Pyrene and derivatives thereof, Oxazine and derivatives, Nile red, Nile blue, Cresyl violet, Oxazine 170, Proflavin, Acridine orange, Acridine yellow, Auramine, Crystal violet, Malachite green, Porphin, Phthalocyanine, Bilirubin, Tetramethylrhodamine, Hydroxycoumarin, Aminocoumarin; Methoxycoumarin, Cascade Blue, Pacific Blue, Pacific Orange, NBD, R-Phycoerythrin (PE), Red 613; PerCP, TruRed; FluorX, Cy2, Cy3, Cy5 and Cy7, TRITC, X-Rhodamine, Lissamine Rhodamine B, Allophycocyanin (APC) and Alexa Fluor dyes.
In addition to fluorescence polarization changes, the specific interaction between the detection agent labeled with a fluorophore and an allergen may also be detected by measuring other optical properties including but not limited to absorbance, fluorescence intensity, fluorescent spectrum and fluorescence lifetime. The measurement of fluorescence signals provides a sensitive method of monitoring the biochemical changes in an environment such as the sample mixture of the present detection assay.
In some embodiments, detection agents for 8 major food allergens (i.e. wheat, egg, milk, peanuts, tree-nuts, fish, shell-fish and soy) may be provided as disposables. In one aspect, constructs of the detection agents may be stored with MgCl, or buffer doped with KCl. MgCl keeps constructs closed tightly, while KCl opens them slightly for bonding.
The mixture of allergen protein extraction and detection agents is analyzed in the reaction chamber 223. As described above, a detection agent (e.g., SPN) probed with a fluorophore (e.g., Texas red) is a small molecule and rotates fast. In general, the plane polarized excitation light absorbed by a fluorophore is rotated to the same degree of molecular rotation the fluorophore undergoes before emission of fluorescence. Fluorescence emission may be depolarized by a number of phenomena, including rotational diffusion of the fluorophore during the lifetime of the excited state, energy transfer, reabsorption, etc. The binding of a target allergen to the relatively smaller signaling polynucleotide can significantly slow down the rotation and change the rotational diffusion; such changes can be used to quantify the bound allergen protein. According to the present invention, an optical subsystem 520 as shown in FIG. 16 and FIG. 17 measures such signals and converts the detected signals to digital signals, or compare analog signals to thresholds which are used to indicate the user the presence, or absence, or the amount of allergen in the test sample.
Fluorophores being excited by lights at this range would allow for inexpensive laser or LED illumination. A printed circuit board (PCB) 550 may be used to convert the fluorescent signals into digital signals or comparing analog signals to thresholds for displaying the readouts of the detection testing to the user. In some embodiments, a polystyrene window can be designed for reading, as fluorescent readings are very precise and repeatable in polystyrene well plate.
In addition to above described detection methods comprising fluorescence polarization measurement, the detection mechanism may be based on a chemiluminescence measurement, a colorimetric measurement, a pH measurement, a measurement of dissolved oxygen, a redox measurement and/or other suitable measurement.
In accordance with the present invention, detection systems, devices and methods described herein contemplate the use of nucleic acid-based detector molecules such as aptamers, or aptamer derived SPNs for detection of allergens in samples such as food samples. The portable devices allow a user to test the presence or absence of one or more allergens in food samples that the user is allergic to. Allergen families that can be detected using the systems and compositions described herein include allergens from foods, the environment or from non-human proteins such as domestic pet dander. Food allergen, may include, but are not limited to, legumes such as peanuts, peas, lentils and beans, as well as the legume-related plant lupin, tree nuts such as almond, cashew, walnut, Brazil nut, filbert/hazelnut, pecan, pistachio, beechnut, butternut, chestnut, chinquapin nut, coconut, ginkgo nut, lychee nut, macadamia nut, nangai nut and pine nut, egg, fish, shellfish such as crab, crawfish, lobster, shrimp and prawns, mollusks such as clams, oysters, mussels and scallops, milk, soy, wheat, gluten, corn, meat such as beef, pork, mutton and chicken, gelatin, sulphite, seeds such as sesame, sunflower and poppy seeds, and spices such as coriander, garlic and mustard, fruits, vegetables such as celery, and rice. The allergen may be present in a flour or meal, or in any format of products. For example, the seeds from plants, such as lupin, sunflower or poppy can be used in foods such as seeded bread or can be ground to make flour to be used in making bread or pastries. The device is capable of confirming the presence or absence of these allergens as well as quantifying the amounts of these allergens.
In some embodiments, detection systems, devices, aptamers, SPNs, detection agents and assays of the present invention may be used in a hospital for clinical food allergy or allergy test and to identify food/allergen(s) to which a patient is allergic. Such assays and methods may also be used to monitor allergen contamination in food industry. Additionally, they may also be used at home or in a restaurant by a person who has allergy to test the allergen content before he/she consumes the food.
In a broad concept, the detection systems, devices, aptamers, SPNs, detection agents and methods described herein may be used for detection of any protein content in a sample in a large variety of applications in addition to food safety, such as, for example, medical diagnosis and prognosis of diseases in civilian and battlefield settings, environmental monitoring/control and military use for the detection of biological weapons. In even broad applications, the detection systems, devices, SPNs, compositions and methods of the present invention may be used to detect any biomolecules which nucleic acid-based detector molecules bind. As some non-limiting examples, the detection systems, devices, SPNs, agents and methods may be used on the spot detection of cancer markers, in-field diagnostics (exposure the chemical agents, traumatic head injuries etc.), third-world applications (TB, HIV tests etc.), emergency care (stroke markers, head injury etc.) and many others.
As a non-limiting example of applications, the detection systems, devices, aptamers, SPNs, detection agents and methods of the present invention can detect and identify pathogenic microorganisms in a sample. Pathogens that can be detected include bacteria, yeasts, fungi, viruses and virus-like organisms. Pathogens could cause diseases in animals and plants; contaminate food, water, soil or other sources; or is used as biological agents in military fields. The device is capable of detecting and identifying these pathogens.
Another important application includes the use of the detection systems, devices, SPNs, detection agents and methods of the present invention for medical care, for example, to diagnose a disease, to stage a disease progression and to monitor a response to a certain treatment. As a non-limiting example, detection devices and SPNs of the present invention may be used to test the presence or absence, or the amount of a biomarker associated with a disease (e.g. cancer) to predict a disease or disease progression. The detection systems, devices and methods of the present invention are designed to analyze a small amount of test sample and can be implemented by a user without extensive laboratory training.
Other expanded applications outside of the field of food safety include in-field use by military organizations, testing of antibiotics and biological drugs, environmental testing of products such as pesticides and fertilizers, testing of dietary supplements and various food components and additives prepared in bulk such as caffeine and nicotine, as well as testing of clinical samples such as saliva, skin and blood to determine if an individual has been exposed to significant levels of an individual allergen.
At various places in the present specification, substituents of compounds of the present disclosure are disclosed in groups or in ranges. It is specifically intended that the present disclosure include each and every individual sub-combination of the members of such groups and ranges. The following is a non-limiting list of term definitions.
About: As used herein, the term “about” when referring to a measurable value such as an amount of weight, time, dose, etc. is meant to encompass variations of ±20% or ±10%, more preferably ±5%, even more preferably ±1%, and still more preferably ±0.1% from the specified amount, as such variations are appropriate to perform the disclosed method.
Activity: As used herein, the term “activity” refers to the condition in which things are happening or being done. Compositions of the invention may have activity and this activity may involve the binding to a target molecule.
Allergen: as used herein, the term “allergen” means a compound, substance or composition that causes, elicits or triggers and immune reaction in a subject. As such, allergens are typically referred to as antigens. An allergen is typically a protein or a polypeptide.
Allergen detection agent: As used herein, the term “an allergen detection agent” refers to Any agent which is capable of, or does, interact with and/or bind to one or more allergens in a way that allows detection of such allergen in a sample is referred to herein as an “allergen detection agent” or “detection agent”.
Binding affinity: As used herein, the term “binding affinity” refers to the tendency of a detection molecule (e.g., aptamer) to bind or not bind a target (e.g., allergen) and describes the measure of the strength of the binding or affinity of the detection molecule to bind the target.
Local conformational shape: As used herein the term “local conformational shape” means a structural manifestation which is located within a definable space of the polynucleotide.
Detection: As used herein, the term “detection” means an extraction of a particular target protein from a mixture of many non-target proteins, indicating the absence, presence, and/or amount of a target protein from a mixture of many non-target proteins.
Detectable label: As used herein, “detectable label” refers to one or more markers, signals, or moieties which are attached, incorporated or associated with another entity, which markers, signals or moieties are readily detected by methods known in the art including radiography, fluorescence, chemiluminescence, enzymatic activity, absorbance, immunological detection and the like. Detectable labels may include radioisotopes, fluorophores, chromophores, enzymes, dyes, metal ions, ligands, biotin, avidin, streptavidin and haptens, quantum dots, polyhistidine tags, myc tags, flag tags, human influenza hemagglutinin (HA) tags and the like. Detectable labels may be located at any position in the entity with which they are attached, incorporated or associated. For example, when attached, incorporated in or associated with a peptide or protein, they may be within the amino acids, the peptides, or proteins, or located at the N- or C-termini.
Domain: as used herein the term “domain” refers to a motif of a polynucleotide having one or more identifiable structural or functional characteristics or properties (e.g., binding capacity, serving as a site for molecular interactions.
Fluorescence polarization (FP): as used herein, the term “fluorescence polarization (FP)” refers to changes in the orientation of plane polarized light brought by fluorophores that undergo significant molecular motion during their fluorescent lifetime. This lifetime is defined as the period of time between absorption of an excitation photon and the emission of a photon through fluorescence. In general, the plane polarized excitation light absorbed by a fluorophore is rotated to the same degree of molecular rotation the fluorophore undergoes before emission of fluorescence. Most fluorophore are small molecules and rotate fast. Measurable changes in polarization or depolarization of plane polarized light, can occur during its fluorescence lifetime. Significant depolarization can still occur if the fluorophore is attached to a small ligand. The extent of depolarization provides a basis for quantifying specific binding of fluorescent ligands (detection agents) to targets (such as allergen proteins). If the small detection agent binds a target of significantly greater size (e.g. an allergen protein), the ability of the detection agent to depolarize plane polarized light is severely reduced, the added molecular volume of the target protein will greatly reduce molecular rotation over the fluorescence lifetime. In fact, the extent of specific binding can be quantified by measuring the extent of depolarization. The greater the specific binding, the less depolarization of the original plane polarized light. The FP signal is expressed as a ratio of fluorescence intensities. Thus, the signal is not influenced by changes in intensity brought about by detection agent concentration changes. This is because the ability of a fluorophore to depolarize light is not a function of its concentration; rather, it is a function of its ability to rotate freely during the fluorescence lifetime.
Including: As used herein, the term “including” refers to” including but not limited to”. “Including” and “including but not limited to” are used interchangeably.
Interaction: As used herein, the term “interaction” refers to a kind of action that occurs as two or more molecules have effect upon one another. In the context of the present invention, an interaction between a detection molecule and a target affects the structure of the detection molecule and such effect will generate energetic changes that can be visualized.
Loop: as used herein the term “loop” refers to a structural feature of a polynucleotide which reverses the direction of the backbone of the sequence and comprises four or more nucleoside (or nucleotide) residues.
Polynucleotide: As used herein, the term “polynucleotide” refers to nucleobase polymers or oligomers in which the nucleobases are connected by sugar phosphate linkages (sugar-phosphate backbone). Exemplary poly- and oligonucleotides include polymers of 2′ deoxyribonucleotides (DNA) and polymers of ribonucleotides (RNA). A polynucleotide may be composed entirely of ribonucleotides, entirely of 2′ deoxyribonucleotides or combinations thereof.
Polynucleotide variants: As used herein, the term “polynucleotide variants” refers to molecules with some differences in their nucleic acid sequences as compared to a native or starting sequence.
Sample: As used herein, the term “sample” refers to any composition that might contain a target of interest to be analyzed including, but not limited to, biological samples obtained from subjects (including humans and animals as detailed below), samples obtained from the environment for example soil samples, water samples, agriculture samples (including plant and crop samples), or food samples. Food samples may be obtained from fresh food, processed/cooked food or frozen food.
Sensitivity: As used herein, the term “sensitivity” means the ability of a detection molecule to bind to a target molecule.
Specifically bind(s): As used herein, the term: specifically bind(s)” means that a detection molecule (e.g., aptamer) reacts or associates more frequently, more rapidly, with greater duration and/or with greater affinity with a particular target such as an allergen protein than it does with alternative targets. For example, an aptamer that specifically binds to an allergen protein binds that protein or a fragment thereof with greater affinity, avidity, more readily, and/or with greater duration than it binds to unrelated protein and/or the fragments thereof. It is also understood by an artisan by this definition, for example, a detection molecule (e.g., aptamer) that specifically binds to a first target may or may not specifically bind to a second target. As such, “specific binding” does not necessarily require exclusive binding or non-detectable binding of another molecule, this is encompassed by the term “selective binding”. Generally, but not necessarily, reference to binding means specific binding. The specificity of binding is defined in terms of the comparative dissociation constants (Kd) of the aptamer for target as compared to the dissociation constant with respect to the aptamer and other materials in the environment or unrelated molecules in general. Typically, the Kd for the aptamer with respect to the target will be 2-fold, 5-fold, or 10-fold less than the Kd with respect to the target and the unrelated material or accompanying material in the environment. Even more preferably, the Kd will be 25-fold, 50-fold, 75-fold, 100-fold, 150 fold or 200-fold less.
Target: as used herein, the term “target” and “target molecule” refers to a molecule which may be found in a tested sample and which is capable of binding to a detection molecule such as an aptamer or an antibody.
Termini or terminus: as used herein the terms “termini” or “terminus” refers to an extremity of a polynucleotide. Such extremity is not limited only to the first or final site of the polynucleotide but may include additional nucleosides (or nucleotides) in the terminal regions. The polynucleotides of the present invention may be characterized as having both a 5′ terminus and a 3′ terminus.
Universal buffer: As used herein, the term “universal buffer” refers to a buffer that may be used for a variety of samples.
It is to be understood that the words which have been used are words of description rather than limitation, and that changes may be made within the purview of the appended claims without departing from the true scope and spirit of the invention in its broader aspects.
While the present invention has been described at some length and with some particularity with respect to the several described embodiments, it is not intended that it should be limited to any such particulars or embodiments or any particular embodiment, but it is to be construed with references to the appended claims so as to provide the broadest possible interpretation of such claims in view of the prior art and, therefore, to effectively encompass the intended scope of the invention.
All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, the present specification, including definitions, will control. In addition, section headings, the materials, methods, and examples are illustrative only and not intended to be limiting.
An in vitro screening experiment based on SELEX method was carried out and aptamers were selected against the allergen targets including egg, gluten, milk, soy, fish, peanut, cashew and crustacean, over the counter-target (combinations of the non-target proteins) and were further engineered for their capability in detecting targeted food allergens.
Various RNA libraries were used to select for binding ability in selection buffer consisting of 100 mM Tris (pH 8), 5 mM EDTA, 150 mM NaCl, 10 mM MgCl2, 0.1% SDS, 0.1% Gelatin, 1% NP-40 (Tergitol), 0.5% Deoxycholate Sodium at 23° C. A given round of selection began with incubating RNA library members in either the buffer alone (negative selection), then collecting the portion of the library that did not respond (i.e. cleave). The second part of each round (when called for) consisted of incubating the non-responsive molecules from the prior negative selection step with the full combination of non-positive targets (as the counter), or with just the selection buffer again for a second negative selection. Once again, the non-responsive (non-cleaving) molecules would be collected. The final step of each round consists of incubating the material from the previous step with the positive target (each of the allergens as appropriate) in buffer, then collecting the responsive material (i.e. cleaved RNA). Each selection round was followed by reverse transcription to generate cDNA, library amplification through PCR, and regeneration of the RNA library by transcription. After subjecting the initial library of diverse random sequences to varying consecutive rounds of selection (i.e. negative, counter and positive selections), again project-dependent, and the enriched libraries were divided into three fractions to perform the parallel assessments.
The parallel assessment of libraries enriched after rounds of negative, counter and positive selections, involves simultaneously exposing one third of the enriched library to selection buffer alone, another one-third to the counter-target complex in selection buffer, and the final one-third of the enriched library to the target allergen in buffer. Any residual RNA molecules that react indiscriminately to both target allergen and counter-targets, or that still generate a response in the absence of the target allergen were identified and discarded during further bioinformatics analysis.
The enriched RNA libraries after the parallel assessment were subjected to PAGE gel assessment. 40 pmoles of enriched library was exposed separately to either the negative (buffer only), counter target, or target allergen (e.g., milk, wheat, egg white and peanut) in selection buffer. After 5 minutes incubation at 23° C., libraries exhibiting a positive response (i.e. cleavage) material were collected, ethanol precipitated, reverse transcribed, and PCR-amplified for sequencing and bioinformatics analysis.
Targets (complexes of proteins from cashew, peanut, fish, milk, soy, gluten, egg and crustacean) were dried down, if necessary, before being combined with RNase-free water for preliminary analysis and aptamer screening. When needed, targets were pooled to produce counter-target mixture by combining appropriate amounts of the targets which were not designated as positive target for the selection. The initial aptamer library template and primers were synthesized by IDT (Coralville, Iowa) as single-stranded DNA. The library was then primer extended to provide double-stranded DNA (dsDNA) using Titanium Taq DNA polymerase from Clontech (Mountain View, Calif.).
Following the experimental plan, for a given generation of the library, RNA was transcribed from the previous dsDNA with AmpliScribe T7 Transcription kits from Epicentre (Madison, Wis.) and purified using a 10% denaturing polyacrylamide gel electrophoresis (PAGE). The purified RNA was combined with Selection Buffer, which was then diluted to 1× concentration (100 mM Tris (pH 8), 5 mM EDTA, 150 mM NaCl, 10 mM MgCl2, 0.1% SDS, 0.1% Gelatin, 1% NP-40 (Tergitol), 0.5% Deoxycholate Sodium) for negative selection. Negative selection began with a refolding cycle, which involved heating the sample to 65° C. to denature the RNA before bringing the sample to 23° C. for the remainder of the incubation. After incubation, non-cleaved RNA was separated from cleaved RNA using 10% denaturing PAGE. Recovered non-cleaved material was combined with counter-target and buffer, target and buffer, or buffer alone depending on the selection step, incubated at 23° C., and partitioned on 10% denaturing PAGE. Recovery and another selection step was implemented if called for. cDNA was then generated from eluted post-selection library using SuperScript II Reverse Transcriptase (Life Technologies; Carlsbad, Calif.), then PCR-amplified with Titanium Taq DNA polymerase (Clontech; Mountain View, Calif.) to complete the round of selection. After several rounds of selection steps, libraries were enriched and showed that the negative cleavage amount was less than 30%, and that there was at least 5% more cleavage in the positive treatment when compared to the counter.
The initial libraries consisting of approximately 1014 random sequences was subjected to varying rounds of ribozyme-based SELEX to enrich for sequences that bind to the target allergens and to eliminated sequences that bind to the counter-targets over multiple rounds of selection. As a result, the population to be sequenced is expected to contain multiple copies of potential aptamer candidates (Van Simaeys et al., Study of the Molecular Recognition of Aptamers Selected through Ovarian Cancer Cell-SELEX, 2010, PLOS One, 5(11): e13770).
The Illumina (San Diego, Calif.) MiSeq system was implemented to sequence the aptamers after the selections using a paired-end read technique. Bioinformatics analysis of the sequencing data identified candidate aptamer molecules. The deep sequencing and subsequent data analysis reduced the traditional approach of performing a large number of selections, which may introduce error and bias due to the screening process (Schütze et al., Probing the SELEX Process with Next-Generation Sequencing, PLos One, 2011, 6(12): e29604).
Sequence family construction focused on motif presence which means that a sequence's frequency in the positive target population was factored in, but places greater emphasis on the prevalence of sub-sequences in the overall population (100% match over the entire sequence not necessary to join a family). Two other factors were used to adjust the importance of motif-family size to determine candidate sequences. One factor is the presence of the sequence in the negative and counter-target population. Three libraries were collected from the parallel assessment: the positive target-exposed library, the buffer-only negative library, and the counter-target-exposed library. All libraries were analyzed to discover any sequences that have yet to be removed during a negative- or counter-selection step, but still have affinity for both the target and counter-target. A given sequence appears more frequently in the positive population than in the counter-target-exposed population, making it an attractive candidate for further testing.
The secondary structure of a given candidate sequence was also predicted using the Mfold secondary structure modeling software (Zucker, Mfold web server for nucleic acid folding and hybridization prediction, Nucleic Acids Res., 2003, 31 (13): 3406-3415).
A set of aptamer sequences were selected and further designed as signaling polynucleotides for detecting different food allergens, including cashew, peanut, egg white, wheat, fish, soy, milk and crustacean. The full sequences and core sequences which define the binding specificity to each allergen of selected aptamers are listed in Table 1. The selected aptamers for each food allergen are then further modified at either one or both of the 5′ terminus and the 3′ terminus to optimize the binding affinity to its targeted allergen. Modified sequences that are intended to have a fluorophore probe (e.g., Texas Red) at the 5′ terminus are the signaling polynucleotides that will be tested for allergen detection as described herein.
As a proof-of-concept example, two aptamers selected from the screen as indicated in Example 1 were used to design different signaling polynucleotides. The strategy was to delete as much of the primers used for the screen as possible but maintain the core binding sequence to ensure the specificity to a target allergen.
An aptamer selected from the screen (Example 1) that is specific to peanut was used. The full Sequence of the aptamer is shown below.
| (7 RiboSPN_full sequence; SEQ ID NO.: 83) |
| 5′TAATACGACTCACTATAGGCGTAGCCTGATGAGCTCACCACATAC |
| CATGTACCACGTGCGAAACGTGGTGAAAGCCACGTAGCTGCGCC3′ |
The core sequence to bind to peanut is shown below.
| (7 SPN-core sequence; SEQ ID NO.: 84) | |
| 5′CTCACCACATACCATGTACCACGTG3′ |
The original full sequence of SEQ ID NO.:83 was modified to delete as much of the primers as possible at both 5′ terminus and 3′ terminus without changing the binding sequence of SEQ ID NO.: 84. Additional nucleotides were also added at either 5′ terminus or 3′ terminus or both termini. The shortest sequences without impacting the binding sequence and forming an open single structure were tested for allergen detection. The resulted signaling polynucleotides include 7 SPN-A (SEQ ID NO.: 85), 7 SPN-B (SEQ ID NO.: 86), 7 SPN-C(SEQ ID NO.: 87), 7 SPN-D (SEQ ID NO.: 88), 7 SPN-E (SEQ ID NO.: 89), 7 SPN-F (SEQ ID NO.: 90), 7 SPN-G (SEQ ID NO.: 91), 7 SPN-H (SEQ ID NO.: 92), 7 SPN-I (SEQ ID NO.: 93), 7 SPN-J (SEQ ID NO.: 94), 7 SPN-K (SEQ ID NO.: 95), and 7 SPN-L (SEQ ID NO.: 96).
An aptamer selected from the screen (Example 1) that is specific to egg was used. The full Sequence of the aptamer is shown below.
| (17 RiboSPN_full sequence; SEQ ID NO.: 228) |
| 5′TAATACGACTCACTATAGGCGTAGCCTGATGAGCCAACTGTGCAC |
| ACTGTTCGCTTATCGAGCTGTGTACCTCCATAGCGAAACGTGGTGAA |
| AGCCACGTAGCTGCGCC3′. |
The core sequence to bind to peanut is shown below.
| (17 SPN-core sequence; SEQ ID NO.: 229) | |
| 5′CCAACTGTGCACACTGTTCGCTTATCGAGCTGTGTACCTCCAT | |
| AG3′ |
The original full sequence of SEQ ID NO.:228 was modified to delete as much of the primers as possible at both 5′ terminus and 3′ terminus without changing the binding sequence of SEQ ID NO.: 229. Additional nucleotides were also added at either 5′ terminus or 3′ terminus or both termini. The shortest sequences without impacting the binding sequence and forming an open single structure were tested for allergen detection. The resulted signaling polynucleotides include 17 SPN-A (SEQ ID NO.: 230), 17 SPN-B (SEQ ID NO.: 231), 17 SPN-C(SEQ ID NO.: 232), 17 SPN-D (SEQ ID NO.: 233), 17 SPN-E (SEQ ID NO.: 234), 17 SPN-F (SEQ ID NO.: 235), 17 SPN-G (SEQ ID NO.: 236), and 17 SPN-H (SEQ ID NO.: 237).
In a similar manner, signaling polynucleotides were designed based upon the sequences of aptamers selected from the screen (Table1) and disclosed literature sequences (Table 2). The signaling polynucleotides are used for allergen detection by measuring fluorescence polarization changes.
The signaling polynucleotides 7 SPN-A (SEQ ID NO.: 85), 7 SPN-B (SEQ ID NO.: 86), 7 SPN-C(SEQ ID NO.: 87) which bind peanut allergens are labeled with a fluorophore Texas Red at the 5′ terminus (marked as SPN-P). Several different food samples containing peanut are processed using T buffer. 20 μl sample for each test is used. The fluorescence polarization with SPN-P (20 μl SPN-P at the concentration of 100 μM) or without SPN-P are measured. Table 3 lists the study design. Changes in FP are measured in a commercial FP equipment.
| TABLE 3 |
| SPN binding test on samples containing peanut butter (PB) |
| 1 | 2 | 3 | 4 | 5 | 6 | 7 | 8 |
| +SPN-P | −SPN-P | |
| A | PB Pretzel | PB ice | PB cookie | Granola | PB Pretzel | PB ice | PB | Granola |
| cream | Bar | cream | cookie | Bar | ||||
| B | PB Pretzel | PB ice | PB cookie | Granola | PB Pretzel | PB ice | PB | Granola |
| cream | Bar | cream | cookie | Bar | ||||
| C | PB Pretzel | PB ice | PB cookie | Granola | PB Pretzel | PB ice | PB | Granola |
| cream | Bar | cream | cookie | Bar | ||||
| D | PB Pretzel | PB ice | PB cookie | Granola | PB Pretzel | PB ice | PB | Granola |
| 1:10 | cream | 1:10 | Bar | 1:10 | cream | cookie | Bar | |
| 1:10 | 1:10 | 1:10 | 1:10 | 1:10 | ||||
| E | PB Pretzel | PB ice | PB cookie | Granola | PB Pretzel | PB ice | PB | Granola |
| 1:10 | cream | 1:10 | Bar | 1:10 | cream | cookie | Bar | |
| 1:10 | 1:10 | 1:10 | 1:10 | 1:10 | ||||
| F | PB Pretzel | PB ice | PB cookie | Granola | PB Pretzel | PB ice | PB | Granola |
| 1:10 | cream | 1:10 | Bar | 1:10 | cream | cookie | Bar | |
| 1:10 | 1:10 | 1:10 | 1:10 | 1:10 | ||||
| G | SPN-P + T | SPN-P + T | SPN-P + T | T buffer | T buffer | T | ||
| buffer | buffer | buffer | buffer | |||||
Similarly the signaling polynucleotides 17 SPN-A (SEQ ID NO.: 230), 17 SPN-B (SEQ ID NO.: 231), 17 SPN-C(SEQ ID NO.: 232), 17 SPN-D (SEQ ID NO.: 233) which bind egg allergens, are labeled with a fluorophore Texas Red at the 5′ terminus. The Texas Red labeled signaling polynucleotides are used to test fluorescent polarization changes upon allergen binding.
1. An allergen detection system comprising:
(a) at least one sampler for collecting a test sample suspected of containing one or more allergens of interest;
(b) at least one detection vessel for receiving and processing the test sample, and contacting detection agents with said one or more allergens presented in the test sample; and
(c) a detection device for detecting the allergen content in the test sample by measuring and visualizing a signal from the binding interaction between the detection agents and the one or more allergens presented in the test sample.
2. The detection system of claim 1, wherein the sampler is a food pickup corer.
3. The detection system of claim 2, wherein the food pickup corer has a distal portion provided with a top cap at the distal end, a proximal portion provided with a sample collecting tube, a grip for handling the corer which is connected to the sample collecting tube, and a plunger inside the sample collecting tube which has a distal end connected to the top cap and a plunger tip at the proximal end,
wherein the proximal plunger tip can protrude out from the sample collecting tube for picking up the test sample.
4. The detection system of claim 3, wherein the food pickup corer is further provided with a means for weighing the test sample being picked up.
5. The detection system of claim 3, wherein the food pickup corer further comprises a snap at the proximal end.
6. The detection system of claim 1, wherein the detection vessel is disposable.
7. The detection system of claim 6, wherein the disposable detection vessel is a disposable test cup or cup-like container,
Wherein the disposable test cup or cup-like container comprises a cup lid assembly and a cup body having a wider distal end connected to the cup lid assembly and a proximal base, and wherein the cup lid assembly comprises three ports on the top cap of the cup lid assembly: a port (a) for holding a food pickup corer, a port (b) through which a homogenizer is assembled, and a port (c) for connection to a flow controlling means for driving and controlling the flow rate of the processed sample solution during the allergen detection testing; and an optional means for aligning and stabilizing the cup lid assembly and the cup body when both are assembled together to form a test cup or cup-like container.
8. The detection system of claim 7, wherein the cup lid assembly further comprises two or more reaction chambers on the top cap of the cup lid assembly for detection of said one or more allergens in the test sample; and a fluid channel for conveying the processed sample solution from the cup body to said two or more reaction chambers,
wherein said two or more reaction chambers consist of one or more allergen analytical chambers where detection agents specific to the one or more allergens are present.
9. The detection system of claim 8, wherein the cup lid assembly further comprises,
(a) a flow tube through which the processed sample solution is flowed from the cup body to said two or more reaction chambers; and
(b) a flow tube cap and filter assembly in the cup lid assembly for further filtering large particles in the processed sample solution and preventing humidification of the molecules in said two or more reaction chambers.
10. The detection system of claim 7, wherein the cup body further comprises two or more reaction chambers and a filter membrane, wherein said two or more reaction chambers are positioned at the bottom of the cup body and the filter membrane is located above the one or more reaction chambers at the bottom of the cup body which is used to filter the processed test sample before it flows to the one or more reaction chambers at the bottom of the cup body.
11. The detection system of claim 7, wherein the cup body is divided into two separate but connected parts, the first part of which is configured for receiving and processing the test sample, and the second part of which includes two or more reaction chambers,
wherein the two parts are connected by a fluid tube and a valve through which the processed sample solution is flowed from the first part of the cup body to the two or more reaction chambers within the second part of the cup body.
12. The detection system of claim 11, wherein the two or more reaction chambers within the second part of the cup body are configured in a side-to-side orientation, or a stack orientation, or a front-to-back orientation, or in a diagonal orientation.
13. The allergen detection system of claim 7, wherein the cup body is configured for receiving the test sample collected by the corer and for processing the test sample using the homogenizer assembled through the port (b) on the top of the cup lid assembly,
wherein the homogenizer rotor and stator are inserted into the cup body through the port (b) on the top of the cup lid assembly, wherein the distal caps of the homogenizer rotor and stator are connected to the port (b) and the proximal portions of the homogenizer rotor and stator extend to the cup body.
14. The allergen detection system of claim 13, wherein the cup body contains a volume of an extraction buffer which is used for dissociating the test sample and extracting allergen proteins.
15. The allergen detection system of claim 1, wherein the detection device comprises,
(a) an external housing configured for providing support for the components of the detection device consisting of a housing cover and a housing base;
(b) a first part that can be opened for insertion of the disposable test cup or cup-like container and the food pickup corer;
(c) components integrated for operating an allergen detection testing; and
(d) a power supply;
wherein the components integrated for operating the detection testing (c) comprise,
(i) a homogenizer configured for homogenizing the test sample and extracting allergen proteins from the test sample in an extraction buffer in the cup body;
(ii) means for driving and controlling the homogenization;
(iii) means for driving and controlling the flow of the processed sample solution during the process of the allergen detection testing;
(iv) an optical assembly for detecting a fluorescent signal;
(v) means for converting and digitizing the fluorescent signals; and
(vi) a display window for receiving the detected signals and indicating the presence and/or absence of the allergen in the test sample.
16. The detection system of claim 15, wherein the external housing (a) comprises an alignment on the top front of the housing for aligning the disposable test cup or cup-like container during the process of the allergen detection testing.
17. The detection system of claim 15, wherein the first part (b) is a drawer assembly which comprises an open well for inserting the disposable test cup or cup-like container and a drawer frame, the drawer frame comprising one chimb on each side of the drawer frame, respectively.
18. The detection system of claim 15, wherein the homogenizer (i) comprises a homogenizer stator, a homogenizer rotor inside the stator which are inserted to the cup body through the port (b) on the top cap of the cup lid assembly, a coupling that couples the homogenizer stator and the rotor to a gearhead, and a gearhead for connecting the homogenizer to a gear train, through which the homogenizer is connected to the means (ii) for driving and controlling the homogenization.
20. The detection system of claim 15, wherein the homogenizer (i) comprises a homogenizer rotor which is welded to the port (b) on the top cap of the cup lid assembly, through a membrane seal.
21. The detection system of claim 18, wherein the means (ii) for driving and controlling the homogenization is a motor.
24. The detection system of claim 23, wherein the port of the platen for connection to the port (c) on the top cap of the cup lid assembly of claim 7 is sealed with a vacuum gasket.
25. The detection system of claim 15, wherein the optical assembly (iv) is connected to the reaction chambers within the test cup for providing plane polarization excitation light, detecting light remitted from the detection agents, and measuring a detectable signal upon the binding of said one or more allergens in the test sample to the detection agents, wherein the optical assembly comprises an excitation optical path including a light source, an excitation filter and an excitation polarizing filter; and an emission optical path including an emission filter, a pair of emission polarizing filters and a pair of photo detectors.
26. The detection system of claim 25, wherein the detection agents are aptamer based signaling polynucleotides probed with a fluorophore and the detectable signals are changes in fluorescence polarization.
27. The detection system of claim 26, wherein the pair of emission polarizing filters and the pair of photo detectors are arranged at a 90 degree to each other.
28. The detection system of claim 26, wherein the pair of emission polarizing filters and the pair of photo detectors are arranged in parallel to each other.
29. The detection system of claim 15, wherein the power supply (d) is a rechargeable or replaceable battery.
30. The detection system of claim 15, wherein the display is a printed circuits board (PCB).
31. A signaling polynucleotide (SPN) comprising:
(a) a core nucleic acid sequence which specifically binds an allergen;
(b) a short nucleic acid sequence at the 5′ terminus and/or 3′ terminus of the core sequence of (a); and
(c) a fluorophore dye at the 5′ terminus, or the 3′ terminus, or both the 5′ and 3′ termini of the signaling polynucleotide.
32. The SPN of claim 31 comprising a core nucleic acid sequence selected from the group consisting of nucleic acid sequences of SEQ ID NOs.: 2, 6, 13, 27, 35, 44, 57, 61, 65, 71, 78, 84, 98, 110, 119, 126, 132, 137, 150, 158, 168, 178, 190, 194, 204, 215, 220, 228, 237, 247, 251, 255, 259, 263, 267, 271, 279, 296, 308, 316, 332, 334, 336, 338, 340, and 341-353.
33. The SPN of claim 31 comprising a nucleic acid sequence selected from the group consisting of nucleic acid sequences of SEQ ID NOs.: 3, 4, 7-11, 14-25, 28-33, 36-42, 45-55, 58, 59, 62, 63, 66-69, 72-76, 79-82, 85-96, 99-108, 111-117, 120-124, 127-130, 133-135, 138-148, 151-156, 159-166, 169-176, 179-188, 191-192, 195-202, 205-213, 216-218, 221-226, 229-235, 238-245, 248, 249, 252, 253, 256, 257, 260, 261, 264, 265, 268, 269, 272-277, 280-294, 297-306, 309-314, and 317-330.
34. The SPN of claim 31, wherein the fluorophore dye is selected from the group consisting of Fluorescein; Rhodamine; eosin; Texas red; Cyanine; Indocarbocyanine; Oxacarbocyanine; Thiacarbocyanine; Merocyanine; Squaraines and derivatives Seta, SeTau, and Square dyes; Naphthalene derivatives; Coumarin derivatives; Pyridyloxazole; Nitrobenzoxadiazole; Benzoxadiazole; Anthraquinones; Pyrene and derivatives; Oxazine derivatives Nile red, Nile blue, Cresyl violet, and Oxazine 170; Proflavin; Acridine orange; Acridine yellow; Auramine; Crystal violet; Malachite green; Porphin; Phthalocyanine; Bilirubin; BODIPY TMR dye; BODIPY FL dye; Tetramethylrhodamine; Hydroxycoumarin; Aminocoumarin; Methoxycoumarin; Cascade Blue; Pacific Blue; Pacific Orange; NBD; R-Phycoerythrin (PE); Red 613; PerCP; TruRed; FluorX; Cy2, Cy3, Cy5 and Cy7; TRITC; X-Rhodamine; Lissamine Rhodamine B; Allophycocyanin (APC); and Alexa Fluor dyes.
35. The SPN of claim 34, wherein the fluorophore dye is Texas red.
36. A method of detecting the presence and/or absence of an allergen of interest in a sample comprising:
(a) obtaining a sample suspected of containing the allergen of interest;
(b) processing the sample of (a) with an extraction buffer;
(c) contacting the processed sample with a detection agent;
(d) treating the contacted processed sample and detection agent with an excitation means; and
(e) visualizing the interaction between the allergen of interest contained in the processed sample and the detection agent.
37. The method of claim 36, wherein the detection agent comprises a signaling polynucleotide of any one of claims 31-35.
38. The method of claim 37, wherein the extraction buffer is a universal buffer.
39. The method of claim 38, wherein the extraction buffer is T buffer.
40. The method of claim 37, wherein the excitation means is a polarized light.
41. The method of claim 40, wherein in the step (e) changes in fluorescence polarization of the fluorophore dye in the signaling polynucleotide upon the interaction with the allergen in the test sample are measured.
42. The method of claim 37, wherein the sample is a food sample.
43. A method of detecting the presence and/or absence of an allergen of interest in a sample comprising,
(a) obtaining a test sample suspected of containing an allergen of interest using a sampler;
(b) processing and digesting the obtained sample in an extraction buffer in a disposable vessel;
(c) mixing the processed sample with detection agents specific to the allergen of interest, (d) treating the mixture from step (c) with a fluorescent excitation means and detecting a fluorescent signal emitted from the detection agents using an optic system; and
(e) digitizing the detected signals and visualizing the interaction between the detection agents and the allergen of interest.