US20220220221A1
2022-07-14
17/494,765
2021-10-05
The present invention relates to a composition for producing an extracellular matrix from a eukaryotic cell, the composition comprising a polypeptide or compound capable of specifically binding to a microtubule associated serine/threonine kinase family member 4 (MAST4) protein or a fragment thereof or a polynucleotide, polypeptide or compound capable of specifically binding to a nucleic acid coding for the MAST4 protein or a fragment thereof, and a composition for promoting chondrogenesis, comprising the same composition.
Get notified when new applications in this technology area are published.
A61K38/1841 » CPC further
Medicinal preparations containing peptides; Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans; Growth factors; Growth regulators Transforming growth factor [TGF]
C12N2800/80 » CPC further
Nucleic acids vectors Vectors containing sites for inducing double-stranded breaks, e.g. meganuclease restriction sites
C12N15/1137 » CPC further
Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor; Recombinant DNA-technology; DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides against enzymes
C12N2310/20 » CPC further
Structure or type of the nucleic acid; Type of nucleic acid involving clustered regularly interspaced short palindromic repeats [CRISPRs]
C07K16/40 » CPC main
Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against enzymes
A61K38/18 IPC
Medicinal preparations containing peptides; Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans Growth factors; Growth regulators
C12N9/22 » CPC further
Enzymes; Proenzymes; Compositions thereof ; Processes for preparing, activating, inhibiting, separating or purifying enzymes; Hydrolases (3) acting on ester bonds (3.1) Ribonucleases RNAses, DNAses
C12N15/113 IPC
Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor; Recombinant DNA-technology; DNA or RNA fragments; Modified forms thereof Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides
The present application is a continuation of U.S. patent application Ser. No. 16/492,477, filed Sep. 9, 2019, which is a National Stage Entry of PCT Patent Application No. PCT/US2020/025689, filed Mar. 8, 2018, each of which is hereby incorporated by reference in their entirety.
The present disclosure relates to a composition for producing an extracellular matrix from eukaryotic cells using Microtubule Associated Serine/Threonine Kinase Family Member 4 (MAST4) gene, a method of producing the extracellular matrix from the eukaryotic cells, and a composition for promoting chondrogenesis, the composition including the above composition.
Since most bone formation begins from a cartilaginous template, successful skeletal development requires a perfect cooperation in both structural and molecular aspects. Articular cartilage is a highly organized tissue, and the mechanism of in-vivo chondrogenesis involved therein is still unknown. Interactions between collagen microfibers and other extracellular matrix component proteins are known to maintain the structural integrity of the cartilage, but the signaling mechanisms regulating their complex processes have not yet been clearly revealed. Therefore, identification of the existence and function of a master regulator that leads chondrogenesis is not only academically meaningful, but also contributes to the public health as well as to development of innovative therapeutics.
Microtubule associated serine/threonine kinase (MAST) 4 is known to be expressed in cartilage (BMC Genomics 2007, 8: 165), but its role has not been clearly elucidated. CN 105636614 discloses that MAST4 may be used for the treatment of cartilage, but this is based only on the stochastic results of MAST4 expression in the cartilage, and does not elucidate specific roles thereof.
The present inventors have found MAST4 as a novel central regulator that is involved in chondrogenesis, and provide a source technology for the development of substances that modulate the activity of MAST4.
An aspect provides a composition for promoting production of an extracellular matrix from eukaryotic cells, the composition including a compound capable of specifically binding to Microtubule Associated Serine/Threonine Kinase Family Member 4 (MAST4) protein or a fragment thereof, or a compound capable of specifically binding to a nucleic acid encoding the MAST4 protein or the fragment thereof.
Another aspect provides a composition for promoting chondrogenesis of chondrocytes, the composition including a compound capable of specifically binding to MAST4 protein or a fragment thereof, or a compound capable of specifically binding to a nucleic acid encoding the MAST4 protein or the fragment thereof.
Still another aspect provides a method of producing an extracellular matrix from eukaryotic cells, the method including contacting the eukaryotic cells with the composition for promoting production of the extracellular matrix from eukaryotic cells.
According to an aspect, provided is a composition for promoting production of an extracellular matrix from eukaryotic cells, the composition including a compound capable of specifically binding to Microtubule Associated Serine/Threonine Kinase Family Member 4 (MAST4) protein or a fragment thereof, or a compound capable of specifically binding to a nucleic acid encoding the MAST4 protein or the fragment thereof.
According to another aspect, provided is a composition for promoting chondrogenesis of chondrocytes, the composition including a compound capable of specifically binding to MAST4 protein or a fragment thereof, or a compound capable of specifically binding to a nucleic acid encoding the MAST4 protein or the fragment thereof.
In a specific embodiment, the compound capable of specifically binding to the MAST4 protein or the fragment thereof, or the compound capable of specifically binding to the nucleic acid encoding the MAST4 protein or the fragment thereof includes those capable of at least partially binding to the protein or the fragment thereof, or the nucleic acid. Here, the compound may be a chemically synthesized compound, polypeptide, or polynucleotide, or a combination thereof. These compounds may inhibit activity or expression of MAST4 protein.
In a specific embodiment, the composition for promoting production of extracellular matrix from eukaryotic cells may be a composition for promoting chondrogenesis from eukaryotic cells.
In the composition, the activity inhibitor of MAST4 protein or the expression inhibitor of MAST4 protein includes any one, as long as it is able to inhibit expression of MAST4 gene or activity of MAST4 protein. The activity inhibitor or the expression inhibitor may be a polynucleotide complementary to the entire or a part of the MAST4 gene. The polynucleotide sequence may be RNA, DNA, or a hybrid thereof.
In a specific embodiment, the activity inhibition of the MAST4 protein may be kinase activity inhibition of the MAST4 protein.
MAST4 is a kinase capable of phosphorylating Ser or Thr of a target substrate, and the kinase activity inhibition of the MAST4 protein means blocking of phosphorylation of a target substrate of MAST4, specifically, blocking of phosphorylation of Ser or Thr.
In a specific embodiment, the polypeptide specifically binding to MAST4 protein or the fragment thereof, or the polypeptide specifically binding to the nucleic acid encoding the MAST4 protein or the fragment thereof may be an antibody or an antigen-binding fragment thereof.
The term âantibodyâ means a specific immunoglobulin directed against an antigenic site. MAST4 gene is cloned into an expression vector to obtain the MAST4 protein encoded by the gene, and the antibody may be prepared from the protein according to a common method in the art. A type of the antibody includes a polyclonal antibody or a monoclonal antibody, and includes all immunoglobulin antibodies. The antibody includes not only complete forms having two full-length light chains and two full-length heavy chains but also functional fragments of antibody molecules which have a specific antigen binding site (binding domain) directed against an antigenic site to retain an antigen-binding function, although they do not have the intact complete antibody structure having two light chains and two heavy chains.
The term âpolynucleotideâ may be used in the same meaning as a nucleotide or a nucleic acid, unless otherwise mentioned, and refers to a deoxyribonucleotide or a ribonucleotide. The polynucleotide may include an analog of a natural nucleotide and an analog having a modified sugar or base moiety, unless otherwise mentioned. The polynucleotide may be modified by various methods known in the art, as needed. Examples of the modification may include methylation, capping, substitution of a natural nucleotide with one or more homologues, and modification between nucleotides, for example, modification to uncharged linkages (e.g., methylphosphonate, phosphotriester, phosphoroamidate, carbamate, etc.) or charged linkages (e.g., phosphorothioate, phosphorodithioate, etc.).
In a specific embodiment, as the compound capable of specifically binding to the nucleic acid encoding the MAST4 protein or the fragment thereof, the polynucleotide capable of specifically binding to the nucleic acid encoding the MAST4 protein or the fragment thereof may be microRNA (miRNA), small interfering RNA (siRNA), short hairpin RNA (shRNA), Piwi-interacting RNA (piRNA), small nuclear RNA (snRNA), or antisense oligonucleotide, each specific to the nucleic acid encoding the MAST4 protein or the fragment thereof, or a combination thereof.
In another specific embodiment, the compound capable of specifically binding to the nucleic acid encoding the MAST4 protein or the fragment thereof may include the polynucleotide capable of specifically binding to the nucleic acid encoding the MAST4 protein or the fragment thereof, and may be CRISPR-Cas including guide RNA specific to the nucleic acid encoding the MAST4 protein or the fragment thereof.
In a specific embodiment, the Cas may be Cas9.
Clustered Regularly Interspaced Short Palindromic Repeats (CRISPRs) mean loci including many short direct repeats found in the genome of bacteria or archaea, of which genetic sequences are revealed. The CRISPR-Cas system includes Cas9 as an essential protein element which forms a complex with guide RNA (specifically, two RNAs, called CRISPR RNA (crRNA) and trans-activating crRNA (tracrRNA), included in guide RNA), and it serves as an active endonuclease.
In a specific embodiment, for the CRISPR-Cas system to specifically act on the target gene MAST4, the guide RNA may have a form of a dual RNA including CRISPR RNA (crRNA) and transactivating crRNA (tracrRNA) specific to the nucleic acid encoding the MAST4 protein, or a single strand guide RNA including parts of the crRNA and the tracrRNA and hybridizing with the nucleic acid encoding the MAST4 protein. The dual RNA and the single strand guide RNA may at least partially hybridize with the polynucleotide encoding the MAST4 protein, and specifically, may hybridize with a region corresponding to â5â˛-TACCCTGCCGCTGCCGCACC-3Ⲡ(SEQ ID NO: 17)â in the polynucleotide sequence encoding the amino acid sequence of MAST4 protein.
Specifically, the guide RNA may be a dual RNA including crRNA and tracrRNA that hybridize with a target sequence selected from the nucleotide sequence encoding the MAST4 protein, or a single strand guide RNA including parts of the crRNA and the tracrRNA and hybridizing with the nucleotide encoding the MAST4 protein. The MAST4 gene which is the target sequence includes a polynucleotide sequence at least partially complementary to the crRNA or sgRNA, and a sequence including a protospacer-adjacent motif (PAM). The PAM may be a sequence well-known in the art, which may have a sequence suitable to be recognized by a nuclease protein. The MAST4 gene targeted by the CRISPR-Cas system may be endogenous DNA or artificial DNA. The nucleotide encoding the MAST4 protein may be specifically endogenous DNA of a eukaryotic cell, and more specifically, endogenous DNA of a chondrocyte.
In a specific embodiment, the crRNA or sgRNA may include twenty consecutive polynucleotides complementary to the target DNA. The target DNA of the complementary twenty consecutive polynucleotides may be 5â˛-TACCCTGCCGCTGCCGCACC-3Ⲡ(SEQ ID NO: 17), and may be selected from the sequences marked in bold in SEQ ID NOS: 74, 76, and 77 of Table 6. A nucleic acid encoding the Cas9 protein or the Cas9 protein may be derived from a microorganism of the genus Streptococcus. The microorganism of the genus Streptococcus may be Streptococcus pyogenes. The PAM may mean 5â˛-NGG-3Ⲡtrinucledotide, and the Cas9 protein may further include a nuclear localization signal (NLS) at the C-terminus or N-terminus to enhance the efficiency.
In the composition for promoting production of an extracellular matrix from eukaryotic cells of the present disclosure, the eukaryotic cells may be yeast cells, fungal cells, protozoa cells, plant cells, higher plant cells, insect cells, amphibian cells, or mammalian cells. The mammal may vary such as humans, monkeys, cows, horses, pigs, etc. The eukaryotic cells may include cultured cells (in vitro) isolated from an individual, graft cells, in vivo cells, or recombinant cells, but are not limited thereto. The eukaryotic cells isolated from an individual may be eukaryotic cells isolated from an individual the same as an individual into which the product including extracellular matrix produced from the eukaryotic cells is injected. In this case, it is advantageous in that side effects such as unnecessary hyperimmune reactions or rejection reactions including graft-versus-host reaction generated by injecting a product produced from a different individual may be prevented.
In a specific embodiment, the eukaryotic cells may be fibroblasts or chondrocytes.
In a specific embodiment, the composition for promoting the production of extracellular matrix from the eukaryotic cells and/or the composition for promoting chondrogenesis of chondrocytes may further include TGF-β1. The present inventors confirmed that MAST4 expression in human chondrocytes is reduced by TGF-β1, and as a result, production of extracellular matrix is promoted. Therefore, to more effectively and easily promote extracellular matrix in MAST4 knockout cells of eukaryotic cells (or chondrocytes), combination treatment with TGF-β1 may be advantageous.
The MAST4 is a protein derived from a human (Homo sapiens) or a mouse (Musmusculus), but the same protein may also be expressed in other mammals such as monkeys, cows, horses, etc.
The human-derived MAST4 may include all of seven isoforms present in human cells. The seven isoforms may include amino acid sequences of NP_055998.1 (SEQ ID NO: 1), NP_942123.1 (SEQ ID NO: 2), NP_001158136.1 (SEQ ID NO: 3), NP_001277155.1 (SEQ ID NO: 4), NP_001277156.1 (SEQ ID NO: 5), NP_001277157.1 (SEQ ID NO: 6), or NP_001284580.1 (SEQ ID NO: 7), based on NCBI reference sequence, and a protein or a polypeptide having each of the amino acid sequences may be translated from mRNA including polynucleotide sequences of SEQ ID NOS: 8 to 14 each encoding the amino acid sequences of SEQ ID NOS: 1 to in the sequence of NM_015183.2, NM_198828.2, NM_001164664.1, NM_001290226.1, NM_001290227.1, NM_001290228.1, or NM_001297651.1.
The mouse-derived MAST4 may include an amino acid sequence of NP_780380.2 (SEQ ID NO: 15), based on NCBI reference sequence, and a protein or a polypeptide having the amino acid sequence may be translated from mRNA including a polynucleotide sequence of SEQ ID NO: 16 encoding the amino acid sequence of SEQ ID NO: 15 in the sequence of NM_175171.3.
An amino acid sequence or a polynucleotide sequence having biologically equivalent activity, even though it is not identical to the amino acid sequences of SEQ ID NOS: 1 to 7 and 15 and the polynucleotide sequences of SEQ ID NOs: 8 to 14 and 16, may also be regarded as the MAST4 protein or mRNA thereof.
Therefore, in a specific embodiment, the MAST4 protein may include any one sequence of SEQ ID NOS: 1 to 7 and 15, and the nucleotide sequence encoding the MAST4 protein may include any one sequence of SEQ ID NOS: 8 to 14 and 16.
The MAST4 protein or polypeptide may include an amino acid sequence having 60% or more, for example, 70% or more, 80% or more, 90% or more, 95% or more, 99% or more, or 100% sequence identity to SEQ ID NOS: 1 to 7 and 15. Further, the MAST4 protein may have an amino acid sequence having modification of 1 or more amino acids, 2 or more amino acids, 3 or more amino acids, 4 or more amino acids, 5 or more amino acids, 6 or more amino acids, or 7 or more amino acids in the amino acid sequences of SEQ ID NOS: 1 to 7 and 15.
Each polynucleotide encoding MAST4 may have a sequence having 60% or more, for example, 70% or more, 80% or more, 90% or more, 95% or more, 99% or more, or 100% sequence identity to SEQ ID NOS: 8 to 14 and 16. Further, the polynucleotide encoding MAST4 may be a polynucleotide having a different sequence of 1 or more nucleotides, 2 or more nucleotides, 3 or more nucleotides, 4 or more nucleotides, 5 or more nucleotides, 6 or more nucleotides, or 7 or more nucleotides in the sequences of SEQ ID NOS: 8 to 14 and 16.
The present inventors first demonstrated that production of extracellular matrix is increased and chondrogenesis is promoted by inhibiting MAST4 gene expression in chondrocytes.
Therefore, in a specific embodiment, the composition for promoting production of an extracellular matrix from eukaryotic cells or the composition for promoting chondrogenesis of chondrocytes of the present disclosure may prevent or treat a joint disease, or improve symptoms thereof.
Further, in a specific embodiment, the composition for promoting the production of extracellular matrix from the eukaryotic cells and/or the composition for promoting chondrogenesis of chondrocytes of the present disclosure may be to induce chondrogenesis.
Further, in a specific embodiment, the composition for promoting the production of extracellular matrix from the eukaryotic cells may be used for tissue regeneration or anti-aging.
The tissue regeneration refers to regeneration of the skin damaged or deformed by wounds, burns, injury, aging, chronic inflammation, diseases, genetic factors, etc., and includes all those used for medical or skin cosmetic purposes. The damage or deformation is caused by the loss or reduced production of extracellular matrix in a tissue, or impossibility of recovery of the extracellular matrix in the tissue by the above factors, and the damage or deformation means symptoms improved, alleviated, recovered, or cured by promoting the production of extracellular matrix by the composition of the present disclosure.
As a tissue including the skin ages, the production of extracellular matrix decreases, resulting in reduced elasticity of the tissue, and the tissue is easily deformed or damaged by external stimuli, and its recovery becomes slow. Accordingly, the composition of the present disclosure may promote the production of extracellular matrix, thereby preventing or recovering reduced elasticity, deformation, or damage of tissues caused by aging.
In another specific embodiment, the composition for tissue regeneration or anti-aging may be used as a component of fillers or collagen supplement cosmetics. In still another specific embodiment, the composition for tissue regeneration or anti-aging may be used as a component of functional cosmetics to block the adsorption of fine dust or minerals.
The composition for promoting the production of extracellular matrix from the eukaryotic cells or the composition for promoting chondrogenesis of chondrocytes of the present disclosure may further include a pharmaceutically acceptable salt or carrier.
The term âpharmaceutically acceptable saltâ means any organic or inorganic addition salt of the compound in the composition of the present disclosure, whose concentration has effective action because it is relatively non-toxic and harmless to patients and whose side effects do not degrade the beneficial efficacy of the composition of the present disclosure. These salt may be selected from any one known to those skilled in the art.
The composition of the present disclosure may further include a pharmaceutically acceptable carrier. The composition including the pharmaceutically acceptable carrier may have various formulations for oral or parenteral administration. When formulated, the composition may be prepared using commonly used diluents or excipients such as fillers, extenders, binders, wetting agents, disintegrating agents, surfactants, etc. Solid formulations for oral administration may include tablets, pills, powders, granules, capsules, troches, etc., and these solid formulations may be prepared by mixing one or more compounds of the present disclosure with at least one excipient such as starch, calcium carbonate, sucrose, lactose, or gelatin. Moreover, in addition to simple excipients, lubricants such as magnesium stearate, talc, etc. may be used. Liquid formulations for oral administration may include suspensions, liquids for internal use, emulsions, syrups, etc. Various excipients such as wetting agents, sweeteners, flavoring agents, preservatives, etc. may be included, in addition to commonly used simple diluents such as water, liquid paraffin, etc.
Formulations for parenteral administration may include sterilized aqueous solutions, non-aqueous solvents, suspensions, emulsions, freeze-dried preparations, suppositories, etc. The non-aqueous solvents and suspensions may include propylene glycol, polyethylene glycol, vegetable oils such as olive oil, injectable esters such as ethyl oleate, etc. As a base of a suppository, witepsol, macrogol, Tween 61, cocoa butter, laurin butter, glycerol, gelatin, etc. may be used.
An aspect provides a method of preventing, treating, or improving a joint disease, the method including administering the composition to a subject.
Another aspect provides a method of producing an extracellular matrix, the method including contacting eukaryotic cells with the composition for producing the extracellular matrix from eukaryotic cells of the present disclosure.
In a specific embodiment, the eukaryotic cells may be isolated from a subject. In a specific embodiment, the eukaryotic cells may be chondrocytes.
In a specific embodiment, the contacting with the eukaryotic cells may include co-transfecting or serial-transfecting the composition into the eukaryotic cells. To effectively deliver the composition of the present disclosure to the eukaryotic cells, various methods known in the art, such as microinjection, electroporation, DEAE-dextran treatment, lipofection, nanoparticle-mediated transfection, protein transduction domain-mediated transduction, virus-mediated gene delivery, and PEG-mediated transfection in protoplast, etc. may be used, but are not limited thereto.
In a specific embodiment, the contacting with the eukaryotic cells may include culturing the eukaryotic cells in the presence of the composition.
In a specific embodiment, the culturing includes culturing in the presence of a chondrogenic inducer.
In a specific embodiment, the method of producing the extracellular matrix of the present disclosure may further include isolating the extracellular matrix from the contacting product.
In another specific embodiment, the method of producing the extracellular matrix may include contacting chondrocytes with the composition for promoting chondrogenesis of the present disclosure.
Still another aspect provides a method of forming a cartilage, the method including contacting chondrocytes with the composition for promoting chondrogenesis of the present disclosure.
In a specific embodiment, the chondrocytes may be isolated from a subject.
In a specific embodiment, the chondrocytes may be derived from a subject to be transplanted with the produced cartilage.
Still another aspect provides a method of producing ECM, the method including culturing eukaryotic cells having increased extracellular matrix productivity of the present disclosure to produce ECM; and isolating ECM from the culture.
In a specific embodiment, the culturing may be culturing in the presence of a chondrogenic inducer.
In a specific embodiment, the chondrogenic inducer may be BMP.
A composition for promoting production of an extracellular matrix according to an aspect may be injected into a subject who requires supply of the extracellular matrix, thereby preventing or treating diseases including a joint disease, and improving symptoms thereof, and the composition may be applied to a method of efficiently producing the extracellular matrix from eukaryotic cells.
A composition for promoting chondrogenesis of chondrocytes according to another aspect may be injected into a subject, thereby preventing or treating diseases including a joint disease, and improving symptoms thereof. The composition may promote chondrogenesis of chondrocytes isolated from the subject, and thus it may be applied to a method of efficiently producing various components including extracellular matrice which are produced by chondrogenesis.
According to a method of producing an extracellular matrix from eukaryotic cells according to still another aspect, the extracellular matrix may be efficiently produced from eukaryotic cells.
FIG. 1 illustrates a method of preparing MAST4 knockout mice using a CRISPR/Cas9 system;
FIG. 2A shows RT-PCR results of examining changes in expression levels of respective genes in MAST4 knockout mouse type A and B, and FIG. 2B shows protein expression patterns in MAST4 knockout mice;
FIG. 3 shows identification of MAST4 knockout in C3H10T1/2 cells in which MAST4 was knocked out using the CRISPR/Cas9 system;
FIG. 4 shows RT-PCR results of examining changes in expression levels of respective genes in C3H10T1/2 cells in which MAST4 was knocked out using the CRISPR/Cas9 system;
FIG. 5 shows RT-PCR results of examining changes in expression levels of respective genes in a micromass culture to confirm chondrogenesis;
FIG. 6 shows alcian blue staining results of examining a difference in cartilage differentiation in C3H10T1/2 cells in which MAST4 was knocked out using the CRISPR/Cas9 system;
FIG. 7 shows sequence information of target genes used to knockout MAST4 of human cells;
FIG. 8A shows human chondrocytes in which MAST4 was knocked out using siRNA, and FIG. 8B shows expression levels of extracellular matrix factors in human chondrocytes in which MAST4 was knocked out using the CRISPR/Cas9 system;
FIG. 9A shows changes in the expression level of MAST4 after treatment of human primary chondrocytes with TGF-β1, and expression levels of extracellular matrix factors thereby, FIG. 9B shows changes in the expression level of MAST4 after treatment of human primary chondrocytes with TGF-β1, and expression levels of extracellular matrix factors thereby; and
FIG. 10 shows chondrogenesis and regeneration effects in the tibia of the MAST4 knockout mouse.
Hereinafter, the present disclosure will be described in more detail with reference to embodiments. However, these embodiments are for illustrative purposes only, and the scope of the present disclosure is not intended to be limited by these embodiments.
1-1. Preparation of MAST4 Knockout Mouse Using CRISPR/Cas9 System
To examine whether an extracellular matrix as a cartilage component was increased by suppressing MAST4 expression, MAST4 knockout mice were prepared using a CRISPR/Cas9 system.
In detail, to prepare CRISPR knockout mice, pX330-U6-Chimeric_BB-CBh-hSpCas9 (Addgene, #42230), donated by Dr. Feng Zhang (Cong et al., 2013), was used as a plasmid capable of expressing Cas9 mRNA and guide RNA. Since MAST4 is a large protein of 7 kb or more, it was designed such that the gene editing was allowed to target two parts, exon 1 and exon 15. A guide RNA sequence targeting exon 1 of MAST4 is 5â˛-GGAAACTCTGTCGGAGGAAGGGG-3Ⲡand a sequence targeting exon 15 is 5â˛-GGCACAAAGAGTCCCGCCAGAGG-3â˛. The guide RNA sequence was used to prepare oligomers as in MAST4 CRISPR oligomers of the following Table in accordance with the manufacturer's protocol (http://crispr.mit.edu/, Zhang Feng Lab), and each oligomer was inserted into a px330 plasmid to clone two plasmids targeting exon 1 and exon 15, respectively.
| TABLEâ1 | |
| MAST4âexonâ1âCRISPRâFâ(SEQâIDâNO:â18) | 5â˛-caccGGAAACTCTGTCGGAGGAAG- |
| 3Ⲡ| |
| MAST4âexonâ1âCRISPRâRâ(SEQâIDâNO:â19) | 5â˛-aaacCTTCCTCCGACAGAGTTTCC-3Ⲡ|
| MAST4âexonâ15âCRISPRâFâ(SEQâIDâNO: | 5â˛-caccGGCACAAAGAGTCCCGCCAG- |
| 20) | 3Ⲡ|
| MAST4âexonâ15âCRISPRâRâ(SEQâIDâNO: | 5â˛-aaacCTGGCGGGACTCTTTGTGCC- |
| 21) | 3Ⲡ|
To obtain embryos, 5 IU of pregnant mare serum gonadotrophin (PMSG; Prospec, cat. No. HOR-272) was administered to a C57BL/6J female mouse 2 days before mating, and after 47 hours, 5 IU of humanchorionic gonadotrophin (hCG, Prospec, cat. HOR-250) was administered thereto . . . . Thereafter, the mouse was mated with C57BL/6J male mouse, and embryos were obtained from fallopian tubes. A microinjection mixture including 5 ng/Îźl of the prepared plasmid and 10 ng of ssDNA donor was injected into the pronuclei of the embryos at a one-cell-stage with reference to an existing standard protocol (Gordon and Ruddle, 1981). The injected one-cell-embryos were transferred to pseudopregnant ICR mice.
Phenotypic analysis of born mice was performed for exon 1 and exon 15. Finally, two types of MAST4 knockout mice were obtained. Information about the two types of MAST4 knockout mice, type A and type B are shown as in FIG. 1 and the following Table 2 (5â˛â3â˛).
| TABLEâ2 | |
| TypeâAâMAST4âKO | ATGGGGGAGAAAGTTTCCGAGGCGCCTGAGCCCGT |
| (71âbpâdeletionâinâexonâ1) | GCCCCGGGGCTGCAGCGGACACGGCGCCCGGACCC |
| (SEQâIDâNO:â22) | TAGTCTCTTCGGCGGCAGCCGTGTCCTCGGAGGGCG |
| CTTCCTCAGCGGAGTCATCCTCTGGCTCGGAAACTCT | |
| GTCGGAGGAAGGGGAGCCCAGCCGCTTCTCCTGCA | |
| GGTCGCAGCCGCCGCGGCCGCCGGGCGGCGCCCT | |
| GGGAACCCGGCTACCCGCCGCGTGGGCTCCCGCGC | |
| GCGTGGCTCTGGAGCGTGGAGTCCCTACCCTGCCG | |
| CTGCCGCACCCGGGAGGAGCGGTGCTGCCGGTGCC | |
| CCAGGTCAGCAGCGCATCCCAAGAGGAGCAGGATGA | |
| AGAG | |
| TypeâBâMAST4âKO | ATGGGGGAGAAAGTTTCCGAGGCGCCTGAGCCCGT |
| (90âbpâdeletionâinâexonâ1) | GCCCCGGGGCTGCAGCGGACACGGCGCCCGGACCC |
| (SEQâIDâNO:â23) | TAGTCTCTTCGGCGGCAGCCGTGTCCTCGGAGGGCG |
| CTTCCTCAGCGGAGTCATCCTCTGGCTCGGAAACTCT | |
| GTCGGAGGAAGGGGAGCCCAGCCGCTTCTCCTGCA | |
| GGTCGCAGCCGCCGCGGCCGCCGGGCGGCGCCCT | |
| GGGAACCCGGCTACCCGCCGCGTGGGCTCCCGCGC | |
| GCGTGGCTCTGGAGCGTGGAGTCCCTACCCTGCCG | |
| CTGCCGCACCCGGGAGGAGCGGTGCTGCCGGTGCC | |
| CCAGGTCAGCAGCGCATCCCAAGAGGAGCAGGATGA | |
| AGAG | |
| typeâAâMAST4âKO | GGCAGTCTACTTTGTTCGGCACAAAGAGTCCCGCCA |
| (3âbpâdeletionâinâexonâ15) | GAGGTTTGCCATGAAGAAGATCAA |
| (SEQâIDâNO:â24) | CAAGCAGAACCTCATCCTTCGGAACCAGATCCAGCA |
| GGCCTTCGTGGAGCGAGACATCCT | |
| GACTTTCGCAGAGAACCCCTTTGTGGTCAGCATGTAT | |
| TGCTCCTTTGAAACGAGGCGTCA | |
| CTTATGCATGGTCATGGAGTATGTAGAAG | |
| typeâBâMAST4âKO | GGCAGTCTACTTTGTTCGGCACAAAGAGTCCCGCCA |
| (13âbpâdeletionâinâexonâ15) | GAGGTTTGCCATGAAGAAGATCAA |
| (SEQâIDâNO:â25) | CAAGCAGAACCTCATCCTTCGGAACCAGATCCAGCA |
| GGCCTTCGTGGAGCGAGACATCCT | |
| GACTTTCGCAGAGAACCCCTTTGTGGTCAGCATGTAT | |
| TGCTCCTTTGAAACGAGGCGTCA | |
| CTTATGCATGGTCATGGAGTATGTAGAAG | |
Bases to be deleted in Table 2 are shown in bold.
1-2. RNA-Sequencing for Confirmation of Change of Cartilage Component Expression in MAST4 Knockout Mouse
To examine changes in the extracellular matrix as a cartilage component in MAST4 knockout mice prepared in Example 1-1, RNA-sequencing was performed for respective genes.
In detail, 1 day-old-MAST4 knockout mice prepared in Example 1-1, hetero-type mice, and wild-type mice were sacrificed, and then their tibia was excised. Each of the excised tibias was placed in a dish containing DEPC-PBS on ice, and cartilage and bone in the tibia were separated using a needle under a dissecting microscope. The tissues separated from each group was immersed in 500 Îźl of TRIzol (purchased from Invitrogen), which were then used as samples. RNA was extracted according to a method well known in the art, and quantified using a nanodrop (Thermo scientific).
RNA-sequencing was performed by Theragen Etex. In detail, mRNA was isolated from 2 Îźg of total RNA extracted from the mouse of each group using oligo(dT). After fragmentation of the mRNA, single-stranded cDNA was synthesized through random hexamer priming. This single-strand cDNA was used as a template to synthesize a second strand, thereby synthesizing a double-stranded cDNA. To prepare blunt-ends, end repair was performed, and to ligate an adapter, A-tailing and adapter ligation were performed. Thereafter, cDNA library was amplified by polymerase chain reaction (PCR). A concentration and size of the final product were examined using 2100 BioAnalyzer. The produced library was finally quantified using a KAPA library quantification kit, and then sequence interpretation was performed using Hiseq2500. To remove low-quality sequences from the interpreted sequences, filtering was performed such that reads containing 10% or more of bases marked as âNâs in the sequence information or reads containing 40% or more of bases less than Q20 were removed, and reads whose average quality is Q20 or less were also removed. The whole filtering process was performed using the in-house program. The filtered sequences were aligned to a reference genome sequence (hg19) of the corresponding species using STAR v2.4.0b (Dobin et al, 2013).
Expression level was measured using Cufflinks v2.1.1 (Trapnell C. et al, 2010), and the calculated expression values were expressed as fragments read per kilobase of exon per million fragments mapped (FPKM). Ensemble 72 was used as a genetic information database, and a non-coding gene region was removed with expression-mask option. To increase measurement accuracy of the expression levels, multi-read-correction and frag-bias-correct options were additionally used, and all other options were set to default values.
To examine genes which were changed by MAST4 knockout, expression values of the samples of each group, which were obtained through Cufflinks, were used. Genes, of which expression values were twice or more, as compared with those of wild-type MAST4, and which had a significance of P value <0.01, were selected, and the expression values of the selected genes and their differences are listed in Table 3.
As a result, it was confirmed that expression of many genes associated with extracellular matrix as a cartilage component was increased as in the following Table 3. However, in all of the two types of MAST4 knockout mice, reduced expression of mmp8 and mmp9 which are extracellular matrix-degrading enzymes was observed.
1-3. RT-PCR for Confirmation of Change of Cartilage Component Expression in MAST4 Knockout Mouse
To more specifically examine changes in the extracellular matrix as a cartilage component in MAST4 knockout mice prepared in Example 1-1, a part of genes showing changes in the expression in the RNA sequencing results of Example 1-2 was selected and subjected to RT-PCR.
In detail, RT-PCR was performed using a set of primers of the following Table 4 and AccuPower PCR premix (BIONEER, Korea) according to the manufacturer's instructions.
As a result, results were consistent with the RNA sequencing results of Example 1-2, and it was confirmed that expression of genes associated with extracellular matrix as a cartilage component was increased (FIG. 2).
1-4. Confirmation of Expression Level of Chondrocyte Marker in MAST4 Knockout Mouse
To examine the effect of MAST4 knockout on chondrocytes, Col2a1 which is known as a chondrocyte marker was stained with fluorescence in the mouse tibia.
In detail, the tibia tissue was obtained from the mouse model of Example 1-1, and fixed with 4% paraformaldehyde (PFA, Wako, Osaka, JAPAN) in 0.01 M phosphate buffer saline (PBS, pH 7.4) at 4° C. overnight. The tissue was decalcified with 10% EDTA, and embedded in paraffin (Leica Biosystems, MO, USA), and sectioned 6 mm in thickness. The sample slide was stained with hematoxylin and eosin, and the tissue section was incubated with a primary antibody at 4° C. overnight. The primary antibody targets ColI2a1 (Abcam, Cambridge, UK). After washing with PBS, the tissue section was sequentially incubated with AlexaFluor 488 (Invitrogen, CA, USA) at room temperature for 2 hours. Each image was obtained using a confocal microscope LSM700 (Carl Zeiss, Oberkochen, Germany), and a representative sample section was stained with freshly prepared Russell-Movatmodified pentachrome (American MasterTech, CA, USA).
As a result, FIG. 10 is an enlargement of a specific area of the observed sample, where Col2a1 (fluorescent green zone/grey background zone) was significantly increased in the tibia of the MAST4 knockout mouse model. TOPRO-3 (areas marked by red dots/gray dots) shows staining of the nuclei of chondrocytes. Therefore, it was confirmed that chondrogenesis and cartilage regeneration may be promoted by MAST4 knockout.
2-1. Preparation of MAST4 Knockout Cells Using CRISPR/Cas9 System
To examine whether increased extracellular matrix in the MAST4 knockout mice is also reproduced in vitro, MAST4 knockout cells were prepared using the CRISPR/Cas9 system.
In detail, C3H/10T1/2, Clone 8 (ATCCCCL-226â˘) which is a mouse-derived fibroblast cell and is able to differentiate into chondrocytes was purchased ((C3H10T1/2 cell) provided by prof. Seon-Yong Jeong's lab, Department of Medical Genetics, School of Medicine, Ajou University). To knockout the cells, lentiCRISPR v2 (Plasmid #52961), pVSVg (AddGene 8454), and psPAX2 (AddGene 12260) were purchased from Addgene, and oligomers of the following Table 5 were used to insert guide RNA targeting exon 1 of mouse MAST4 gene (ENSMUSG00000034751) into LentiCRISPR v2 plasmid according to the manufacturer's instructions (lentiCRISPRv2 and lentiGuide oligo cloning protocol), thereby preparing a plasmid expressing guide RNA and Cas9 enzyme at the same time (as a control group, a plasmid having no guideRNA and expressing only Cas9 was used).
| TABLEâ5 | |
| Oligomer | Sequence |
| mMAST4âCRISPRâexonâ1âsgRNAâF | 5â˛-CACCGTACCCTGCCGCTGCCGCACC-3Ⲡ|
| (SEQâIDâNO:â70) | |
| mMAST4âCRISPRâexonâ1âsgRNAâR | 5â˛-AAACGGTGCGGCAGCGGCAGGGTAC-3Ⲡ|
| (SEQâIDâNO:â71) | |
| mouseâMAST4âexonâ1 | 5â˛- |
| (SEQâIDâNO:â72) | ATGGGGGAGAAAGTTTCCGAGGCGCCTG |
| AGCCCGTGCCCCGGGGCTGCAGCGGACA | |
| CGGCGCCCGGACCCTAGTCTCTTCGGCG | |
| GCAGCCGTGTCCTCGGAGGGCGCTTCCT | |
| CAGCGGAGTCATCCTCTGGCTCGGAAACT | |
| CTGTCGGAGGAAGGGGAGCCCAGCCGCT | |
| TCTCCTGCAGGTCGCAGCCGCCGCGGCC | |
| GCCGGGCGGCGCCCTGGGAACCCGGCT | |
| ACCCGCCGCGTGGGCTCCCGCGCGCGT | |
| GGCTCTGGAGCGTGGAGTCCCTACCCTG | |
| CCGCTGCCGCACCCGGGAGGAGCGGTG | |
| CTGCCGGTGCCCCAGGTCAGCAGCGCAT | |
| CCCAAGAGGAGCAGGATGAAGAG-3Ⲡ| |
This method is a lentivirus-based CRISPR knockout method. To prepare a virus, the three plasmids prepared above (LentiCRISPR v2 (+guide RNA): guide RNA+Cas9 expressing plasmid, pVSVg: Virus envelop plasmid, psPAX2: Virus packaging plasmid) were transfected into 293T cells using a polyethyenimine (PEI) reagent. 18 hours later, the medium was replaced with a fresh medium, and only the medium was collected, and viruses were obtained using a 0.45 Îźm filter. The obtained viruses were transfected into a 6-well dish to which C3H10T/12 was seeded. 24 hours after treatment with 1 ml of virus+1 ml of DMEM/FBS+2 Îźl of polybren, the medium was replaced with fresh DMEM/FBS. 24 hours later, only infected cells were selected by treatment with puromycin, and subcultured to 40% confluency in a 10 cm dish. Since gene editing by CRISPR may randomly occur in cells, single colony selection was performed. Cells were seeded in 10 cm dishes such that 50 cells existed in each dish. When cells formed colonies over time, these colonies were defined as one clone, and genomic DNA was extracted from each clone. PCR was performed using primers specifically amplifying exon 1 (F: 5â˛->3ⲠCTGTGGTCCAACCTCTGTCA, R: 5â˛->3ⲠATCGGCTCAGTGACACTTCC). The amplified PCR products were analyzed by the sequencing company. As a result of sequencing analysis, cells in which gene editing by frameshift was identified were used in the experiment, together with control cells. The sequences targeted by the prepared guide RNA were are in bold in Table 5. As a result of sequencing the MAST4 knockout results, deletion of two nucleotides occurred in mouse MAST4 exon 1, indicating frameshift induction.
2-2. RT-PCR for Confirmation of Change of Cartilage Component Expression in MAST4 Knockout Cells
To examine changes in the extracellular matrix as a cartilage component in MAST4 knockout mice prepared in Example 1-1, RT-PCR was performed for respective genes.
10 Οl of a medium containing total 105 cells was put in the center of 12 wells, and incubated for 2 hours. 1 ml of DMEM containing 10% FBS was added to each well. 24 hours later, cells were harvested, and RNA was extracted using an easy-BLUE⢠Total RNA Extraction Kit (Intron, Cat 17061) according to the manufacturer's instructions. Next, cDNA was synthesized using M-MLV reverse transcriptase (Promega, M1705) according to the manufacturer's instructions. Primers used in RT-PCR are as described in Table 4.
As a result, increased expression of extracellular matrix-associated genes was also found in MAST4 knockout cells, as consistent with the results of Example 1-2 and Example 1-3 (FIG. 4), indicating that the same results as in the MAST4 knockout mouse were also obtained in vitro.
3-1. Micromass Culture of MAST4 Knockout Cells
To evaluate chondrogenic ability of the MAST4 knockout cells of Example 2-2, micromass culture was performed.
In detail, MAST4 knockout cells were prepared as in Example 2-1, and micromass culture was performed with reference to a known method (Differentiation and Mineralization of Murine Mesenchymal C3H10T1/2 Cells in Micromass Culture, 2010, Rani Roy). First, 10 Îźl of a medium containing total 105 fibroblast cells were put in the center of each well of a 12-well plate, and incubated for 2 hours. 1 ml of DMEM containing 10% FBS was added to each well. Thereafter, 100 ng/ml, 500 ng/ml, or 1000 ng/ml of BMP2 was added to each culture depending on the purpose of cartilage induction, respectively. Thereafter, the medium was replaced with a fresh medium every three days.
3-2. Confirmation of Reproduction of Effects of Micromass-Cultured MAST4 Knockout Cells
To examine whether production of extracellular matrix as a cartilage component was also increased in the MAST4 knockout cells cultured according to Example 3-1, as in the MAST4 knockout cells of Example 2-2, and finally, chondrogenic ability was increased therein, RT-PCR was performed.
In detail, cells, which were cultured for 0 day, 3 days, and 6 days from the day when the cells were seeded in a plate for micromass culture, were harvested, respectively, and RNA was extracted therefrom on the same day. RT-PCR was performed for respective genes, as in Example 1-3, and whether or not production of the cartilage component was increased was examined.
As a result, as consistent with the results observed in the MAST4 knockout cells of Example 2-2, expression of extracellular matrix components was increased, and at the same time, differentiation into chondrocytes began with aggrecan expression on day 3 after induction using BMP2, and as a result, it was confirmed that chondrogenic ability was increased (FIG. 5). In particular, when MAST4 was knock-outed, some genes (hapIn1) showed no significant difference in the expression on day 3, but all of the indicated extracellular matrix-associated genes showed overexpression on day 6. In contrast, in the control group, some proteins were less expressed or rather decreased on day 6 (e.g., Matn3, or Comp). The MAST4 knockout cells were found to be useful in the overexpression of all various extracellular matrices.
3-3. Confirmation of Chondrogenesis of Mass-Cultured MAST4 Knockout Cells
With regard to the overexpression of the respective extracellular matrix-associated genes observed in Example 3-2, to examine whether or not the expression was actually increased at the level of isolated proteins, not at the gene expression level, alcian blue staining was performed.
In detail, plates of cells corresponding to each date were washed twice with PBS and fixed for 15 minutes by adding 1 ml of 4% paraformaldehyde. Then, 1 ml of 1% alcian blue 8-GX (Sigma-Aldrich, A5268) dissolved in 0.1 N HCl (pH 1.0) was added and stained overnight. After washing twice with 500 Îźl of 0.1 N HCl, images were obtained.
As a result, in the case of MAST4 knockout cells, chondrogenesis was increased from day 3, and extracellular matrix secretion was increased, and the degree was increased with increasing BMP2 concentration (FIG. 6).
It was examined whether the results confirmed in the knockout mouse model and mouse cells were also induced in human cells.
In detail, human primary chondrocytes (donated by College of Medicine, Inha University) were knocked-out by transient transfection with MAST4 siRNA(h) (sc-106201; Santa Cruz biotechnology) (FIG. 8A) or MAST4 expression was knocked-out by the CRISPR/Cas9 system. MAST4 siRNA was transfected using a Lipofectamine RNAiMAX transfection reagent of ThermoFisher SCIENTIFIC, and information of primers used herein is as described in the following Table 6. Preparation and treatment of the CRISPR/Cas9 system were performed in the same manner as in Example 1-1 with reference to GeneArt⢠Precision gRNA Synthesis Kit (A29377) of ThermoScientific, and information of primers used herein is as described in the following Table 6.
For high transfection efficiency, siRNA transfection was performed by a reverse transfection technique in which cell planting and transfection are performed at the same time, and a transfection reagent was Lipofectamine RNAiMAX transfection reagent of ThermoFisher SCIENTIFIC. In detail, 15 nM of MAST4 siRNA and 4.5 Îźl of Lipofectamine RNAiMax were mixed in 40 Îźl of Gibco⢠Opti-MEMâ˘, and incubated for 15 minutes. Thereafter, human primary chondrocytes of 1.5Ă105 cell/well were plated together with 2 ml of a medium (FBS 10%) containing no gentamicin in a 6-well plate (ColI coated plate), and the siRNA mixture was added thereto. 72 hours later, the cells were harvested and RNA was isolated. Human primary chondrocytes were cultured in a collagen I-coated flask (175, Col I Straight Vent 356487, Corning) under conditions of DMEM (17-205-CVR Corning), FBS Qualified (USA origin 500 mL 26140-079, Gibco), L-glutamine (200 mM) (100Ă25030-081, Gibco), and gentamicin (5 ug/ml) (10 mL 15700-060, Thermofisher).
Knockout was performed by targeting 20 nt on the genome of MAST4 (target sequences are marked in bold), and specifically, #1 and #3 target Exon5, and #2 targets Exon 8. #1 and #3 were prepared in the reverse direction, and #2 was prepared in the forward direction. The human MAST4 gene used in the preparation of CRISPR/Cas9 system was with reference to MAST4 ENSG00000069020 (http://asia.ensembl.org/). Information of targeted Exon sequences and NGG PAM sequences (grey box) on which CRISPR deletion occurred are shown in detail in FIG. 7.
| TABLEâ6 | |
| hMAST4âCR#1âFâ(SEQâIDâNO:â73) | 5â˛-TAATACGACTCACTATAG |
| GAGTGTGGTCGAGGCAATGC-3Ⲡ| |
| hMAST4âCR#1âRâ(SEQâIDâNO:â74) | 5â˛-TTCTAGCTCTAAAAC |
| GCATTGCCTCGACCACACTC-3Ⲡ| |
| hMAST4âCR#2âFâ(SEQâIDâNO:â75) | 5â˛-TAATACGACTCACTATAG |
| GTAACTCGTCTGGTGTTGGT-3Ⲡ| |
| hMAST4âCR#2âRâ(SEQâIDâNO:â76) | 5â˛-TTCTAGCTCTAAAAC |
| ACCAACACCAGACGAGTTAC-3Ⲡ| |
| hMAST4âCR#3âFâ(SEQâIDâNO:â77) | 5â˛-TAATACGACTCACTATAG |
| AGCAACCGGAAAAGCTTAAT-3Ⲡ| |
| hMAST4âCR#3âRâ(SEQâIDâNO:â78) | 5â˛-TTCTAGCTCTAAAAC |
| ATTAAGCTTTTCCGGTTGCT-3Ⲡ| |
| HumanAcanRTâForwardâ(336) | 5â˛-gaatcaactgctgcagacca-3Ⲡ|
| (SEQâIDâNO:â82) | |
| HumanAcanâRTâReverseâ(336) | 5â˛-gtgccagatcatcaccacac-3Ⲡ|
| (SEQâIDâNO:â83) | |
| HumanCol9a1RTâForwardâ(467) | 5â˛-CGTGGATTTCCAGGCCGTGG-3Ⲡ|
| (SEQâIDâNO:â84) | |
| HumanCol9a1RTâReverseâ(467) | 5â˛-TCGCTGTCCTTGATCACCAG-3Ⲡ|
| (SEQâIDâNO:â85) | |
| HumanGapdhRTâForwardâ(156) | 5â˛-TGGCAAAGTGGAGATTGTTGCC-3Ⲡ|
| (SEQâIDâNO:â86) | |
| HumanGapdhRTâReverseâ(156) | 5â˛-AAGATGGTGATGGGCTTCCCG-3Ⲡ|
| (SEQâIDâNO:â87) | |
As a result, as shown in FIG. 8A, when MAST4 siRNA was transfected, MAST4 expression was decreased, and at this time, expression of extracellular matrix factors such as Acan was increased. Further, as shown in FIG. 8B, when MAST4 was knocked out, expression of extracellular matrix factors such as Acan and Col9a1 was increased. These results are the same as those demonstrated in the previous mouse models and mouse cells. Therefore, with regard to other extracellular matrix factors and chondrogenic effects, the same results as those demonstrated in the mouse may be also obtained by suppressing MAST4 expression in human cells.
It was examined whether suppression of MAST4 expression as confirmed in Example 4-1 was induced by TGF-β1 and expression of extracellular matrix factors was affected thereby.
In detail, the human primary chondrocytes of Example 4-1 were treated with TGF-β1, and an expression level thereof was measured by RT-PCR as in Examples 1-2 and 1-3 and Western blotting.
As a result, as shown in FIG. 9, when TGF-β1 (5 ng/ml) was treated for 24 hours, 48 hours, or 72 hours, respectively, MAST4 expression was suppressed, and as a result, expression of extracellular matrix factors was increased. When co-treatment with TGF-β1 (5 ng/ml) and TEW-7197 which is a TGF-β1 inhibitor was performed (FIG. 9B), Acan expression increased by TGF-β1 was suppressed and the inhibitory effect on MAST4 expression was also decreased, as compared with single treatment with TGF-β1.
1. A composition for promoting production of an extracellular matrix from eukaryotic cells, the composition comprising a compound capable of specifically binding to Microtubule Associated Serine/Threonine Kinase Family Member 4 (MAST4) protein or a fragment thereof, or a compound capable of specifically binding to a nucleic acid encoding the MAST4 protein or the fragment thereof.
2. The composition of claim 1, wherein the MAST4 protein comprises any one amino acid sequence of SEQ ID NOS: 1 to 7 and 15, and the nucleic acid encoding the MAST4 protein comprises any one polynucleotide sequence of SEQ ID NOS: 8 to 14 and 16.
3. The composition of claim 1, wherein the compound capable of specifically binding to the MAST4 protein or the fragment thereof, or the compound capable of specifically binding to the nucleic acid encoding the MAST4 protein or the fragment thereof is a chemically synthesized compound, polypeptide, or polynucleotide that inhibits activity or expression of the MAST4 protein, or a combination thereof.
4. The composition of claim 3, wherein the polypeptide is an antibody or an antigen-binding site thereof.
5. The composition of claim 1, wherein the compound capable of specifically binding to the nucleic acid encoding the MAST4 protein or the fragment thereof is microRNA (miRNA), small interfering RNA (siRNA), short hairpin RNA (shRNA), Piwi-interacting RNA (piRNA), small nuclear RNA (snRNA), or antisense oligonucleotide, each specific to the nucleic acid encoding the MAST4 protein or the fragment thereof, or a combination thereof.
6. The composition of claim 1, wherein the compound capable of specifically binding to the nucleic acid encoding the MAST4 protein or the fragment thereof is CRISPR-Cas comprising guide RNA specific to the nucleic acid encoding the MAST4 protein or the fragment thereof.
7. The composition of claim 6, wherein the guide RNA is a dual RNA comprising CRISPR RNA (crRNA) and transactivating crRNA (tracrRNA) specific to the nucleic acid encoding the MAST4 protein or the fragment thereof, or a single strand guide RNA comprising parts of the crRNA and the tracrRNA and hybridizing with the nucleic acid encoding the MAST4 protein or the fragment thereof.
8. The composition of claim 1, wherein the eukaryotic cells are fibroblast cells or chondrocytes.
9. The composition of claim 1, wherein the composition is to promote chondrogenesis of the eukaryotic cells.
10. The composition of claim 1, wherein the composition is to prevent or treat a joint disease or to improve symptoms thereof.
11. The composition of claim 9, wherein to promote chondrogenesis is to induce chondrogenesis.
12. The composition of claim 1, wherein the composition is used for tissue regeneration or anti-aging.
13. The composition of claim 1, further comprising TGF-β1.
14. A method of preventing, treating, or improving a joint disease, the method comprising administering the composition of claim 1 to a subject.
15. A method of producing an extracellular matrix from eukaryotic cells, the method comprising contacting the eukaryotic cells with the composition for promoting production of extracellular matrix from eukaryotic cells of claim 1.
16. The method of claim 15, wherein the eukaryotic cells are isolated from a subject.
17. The method of claim 15, wherein the contacting with the eukaryotic cells comprises culturing the eukaryotic cells in the presence of the composition.
18. The method of claim 17, wherein the culturing is to culture in the presence of a chondrogenic inducer.
19. The method of claim 15, further comprising isolating the extracellular matrix from the contacting product.
20. The method of claim 15, wherein the eukaryotic cells are chondrocytes.