Patent application title:

COMPOSITIONS AND METHODS FOR IMPROVING POD SHATTER TOLERANCE IN CANOLA

Publication number:

US20220298520A1

Publication date:
Application number:

17/619,583

Filed date:

2020-06-17

Abstract:

Genome edited plants, plant cells, seeds and plant parts of Brassica are provided where expression levels and/or activities of pod dehiscence genes are modulated to improve one or more agronomic characteristics such as pod shatter. Also provided are compositions comprising polynucleotides encoding polypeptides and guide RNAs targeted to endogenous Brassica proteins involved in pod dehiscence including for example, targeted site-directed mutagenesis using CRISPR-associated nucleases. Additionally, various methods of employing the polynucleotides and genetic modifications in plants, such as methods for modulating expression level in a Brassica plant and methods for increasing pod shatter tolerance of a Brassica plant are also provided herein.

Inventors:

Assignee:

Interested in similar patents?

Get notified when new applications in this technology area are published.

Classification:

C12N15/8213 »  CPC main

Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor; Recombinant DNA-technology; Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression; Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs); Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation Targeted insertion of genes into the plant genome by homologous recombination

C12N15/111 »  CPC further

Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor; Recombinant DNA-technology; DNA or RNA fragments; Modified forms thereof General methods applicable to biologically active non-coding nucleic acids

C12N2310/20 »  CPC further

Structure or type of the nucleic acid; Type of nucleic acid involving clustered regularly interspaced short palindromic repeats [CRISPRs]

C12N15/82 IPC

Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor; Recombinant DNA-technology; Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression; Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)

C12N9/22 »  CPC further

Enzymes; Proenzymes; Compositions thereof ; Processes for preparing, activating, inhibiting, separating or purifying enzymes; Hydrolases (3) acting on ester bonds (3.1) Ribonucleases RNAses, DNAses

C12N9/24 »  CPC further

Enzymes; Proenzymes; Compositions thereof ; Processes for preparing, activating, inhibiting, separating or purifying enzymes; Hydrolases (3) acting on glycosyl compounds (3.2)

C12Q1/6895 »  CPC further

Measuring or testing processes involving enzymes, nucleic acids or microorganisms ; Compositions therefor; Processes of preparing such compositions involving nucleic acids; Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae

C12N15/11 IPC

Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor; Recombinant DNA-technology DNA or RNA fragments; Modified forms thereof

Description

CROSS-REFERENCE TO RELATED APPLICATIONS

This Application claims priority from, and benefit of, U.S. Provisional Application 62/863,551 filed on June 19, 2019. The entire contents of the provisional application are hereby incorporated by reference herein.

REFERENCE TO SEQUENCE LISTING SUBMITTED ELECTRONICALLY

The official copy of the sequence listing is submitted electronically via EFS-Web as an ASCII formatted sequence listing with a file named 8043WOPCT_ST25.txt created on Jun. 13, 2020 and having a size of 368 kilobytes and is filed concurrently with the specification. The sequence listing comprised in this ASCII formatted document is part of the specification and is herein incorporated by reference in its entirety.

FIELD

This disclosure relates to compositions and methods for improving agronomic traits in plants, specifically improving pod shatter tolerance in Brassica plants.

BACKGROUND

Brassica napus (also referred to as canola or oilseed rape) is one of the most important vegetable oilseed crops in the world, especially in China, Canada, the European Union and Australia, where the oils are used extensively in the food industry and for biodiesel production. Oilseed rape is a recently domesticated plant and retains some of the traits of its wild ancestors which were useful in the wild but are not useful in commercial crop plants. One example of such a trait is fruit dehiscence, which refers to the natural opening of reproductive structures to disperse seeds. In species that disperse their fruit through dehiscense, siliques or pods are composed of two carpels that are held together by a central replum via a valve margin. Where the valve margin connects to the replum is called the dehiscence zone (DZ). When the pod is ripe, the valve margin detaches from the replum and the pod splits open, releasing the seeds inside. The DZ demarcates the precise location where the valves detach.

During crop domestication, farmers and breeders have selected for Brassica plants that avoid releasing their seeds early, before the crop is harvested. However, such early pod dehiscence (also known as “pod shatter”, “seed shatter” or “seed shedding”) has not been fully eliminated. Therefore, B. napus plants remain prone to seed losses due to pod shatter prior to harvest. Pod shatter poses significant problems for commercial production of canola seeds and adverse weather conditions can exacerbate the process resulting in an increase in shatter-related losses of 25% or more. This loss of seed not only has a dramatic effect on yield but can also result in the emergence of the crop as a weed in the subsequent growing season.

In addition to direct losses of income from reduced seed yield, increased input costs and reduced price paid for low oil content seeds, pod shatter also results in additional indirect costs to the grower. The shed seed results in self-sown or volunteer B. napus plants growing in the next year's crop, which creates further expense due to the need for increased herbicide use. Such self-sown B. napus plants cause losses due to competition with subsequent crop and can cause problems for farmers using reduced-tillage strategies such as no-till, zone-till, and strip tillage.

Resistance to pod shatter (indehiscent phenotype) is a key trait that has been selected during crop domestication. Plants have been also generated using Ethyl Methane Sulfonate (EMS) mutagenesis or through single guide gene editing. Rajani and Sundaresan, 2001, Current Biology, 11(24), 1914-1922; Liljegren et al., 2004, Cell, 116(6), 843-853; Braatz et al., 2017, Plant Physiology, 174(2), 935-942; Braatz et al., 2018, Euphytica, 214(2), 29; Braatz et al., 2018, Theor. Applied Genetics, 131(4), 959-971. However, some of these approaches have produced plants with “huge background mutations” and plants that are otherwise “unsuitable for agronomic purposes” (Zhai et al., 2019, Theor. Applied Genetics, 132: 2111-2123 at 2112 and 2121). Thus, there remain varieties of B. napus that are still dehiscent and prone to pod shatter. In view of the foregoing, there is a need for more B. napus lines having a pod shatter tolerance, i.e., indehiscent phenotype, and new approaches for generating such plants. There is also a need for pod-shatter phenotypes that permit plant seeds to be collected at harvest by threshing pods, e.g., using a combine harvester, with minimal damage to the seed.

SUMMARY

Brassica napus (2n =38) is an amphidiploid species that originated from the spontaneous hybridization between B. oleracea (2n =18) and B. rapa (2n =20). The B. napus genome comprises an A and a C genome.

Provided herein are methods for introducing a targeted genomic modification in a B. napus plant that contributes to an increasing pod shatter tolerance phenotype in the plant or in progeny from the plant. Generally, the method includes introducing a targeted modification into the genome of a B. napus plant, plant cell, or seed thereof, wherein the targeted modification includes excising endogenous genomic sequence of an INDEHISCENT (BnIND) gene, ALCATRAZ (BnALC) gene, POLYGALACTURONASE (BnPGAZ) gene, or any combination thereof. Each of these excisions or targeted deletions of genomic sequence is referred to herein as a “dropout” that inactivates the targeted gene.

In one aspect, the disclosure provides a method for increasing pod shatter tolerance in a B. napus plant (or in the plant's progeny) by introducing a targeted genomic modification in a B. napus plant, plant cell, or seed thereof. The disclosure also provides the modified B. napus plant, plant cell, or seed thereof, which is produced by the disclosed method. Thus a modified B. napus plant, plant cell, or seed thereof includes a targeted genomic modification that is a deletion or dropout of at least one allele of the following genes: the A genome BnIND-A (e.g., gene encoding SEQ ID NO:1, 2 or 3), C genome BnIND-C (e.g., gene encoding SEQ ID No:5, 6, or 7), A genome BnALC-A (e.g., gene encoding SEQ ID No:16, 17, or 18), C genome BnALC-C (e.g., gene encoding SEQ ID No:19, 20, or 21), A genome BnPGAZ-A (e.g., gene encoding SEQ ID NO:8, 9, 10, or 11), or C genome BnPGAZ-C gene (e.g., gene encoding SEQ ID NO:12, 13, 14, or 15). For example, the method can include introducing a dropout of at least one allele of BnIND-A (SEQ ID NO:56, 69, 105, 106, or 107); BnIND-C (SEQ ID NO:57, 67, 70, 108, 109, 110, or 111); BnALC-A (SEQ ID No:71, 73, 120, 122, or 124); BnALC-C (SEQ ID No:72, 74, 121, 123, or 125); BnPGAZ-A (SEQ ID No:60, 112, 113, 114, 115, 126, or 128); or BnPGAZ-C (SEQ ID No:61, 116, 117, 118, 119, 127, or 128). The method can further include introducing one or more combinations of the foregoing targeted dropouts. Thus, the modified B. napus plant, plant cell, or seed thereof can comprise one, two, three or four excised alleles of the BnIND gene; one, two, three or four excised alleles of the BnALC gene; or one, two, three or four excised alleles of the BnPGAZ gene.

In some examples, the modified B. napus plant is homozygous for gene edited deletions and includes a targeted dropout at both alleles of the BnIND-A gene, BnIND-C gene, BnALC-A gene, BnALC-C gene, BnPGAZ-A gene, BnPGAZ-C gene, or any combination of the foregoing. In other examples, the modified B. napus plant is heterozygous for the dropout and includes a dropout at only a single allele of the BnIND-A gene, BnIND-C gene, BnALC-A gene, BnALC-C gene, BnPGAZ-A gene, BnPGAZ-C gene, or any combination of the foregoing. In still other examples, the modified B. napus plant combines heterozygous and homozygous targeted excisions at BnIND-A gene, BnIND-C gene, BnALC-A gene, BnALC-C gene, BnPGAZ-A gene, or BnPGAZ-C gene. Thus, a modified B. napus plant can have one or a combination of the genotypes shown in Table 1 (wherein, in accordance with convention, superscript+indicates” wildtype allele and−indicates an allele modified by targeted excision of endogenous genomic sequence).

TABLE 1
W X Y Z
1 BnIND-A+/− BnIND-A−/−− BnIND-C+/− BnIND-C−/−
2 BnALC-A+/− BnALC-A−/− BnALC-C+/− BnALC-C−/−
3 BnPGAZ-A+/− BnPGAZ-A−/− BnPGAZ-C+/− BnPGAZ-C−/−

In a preferred aspect, the modified B. napus plant comprises three or four excised alleles of the BnIND gene identified by (row number column header) in Table 1: (1W, 1Z); (1X, 1Y); (1X, 1Y); or (1X, 1Z). In another preferred aspect, the modified B. napus plant comprises three or four excised alleles of the BnALC gene identified by reference to Table 1: (2W, 2Z); (2X, 2Y); (2X, 2Y); or (2X, 2Z); or three or four excised alleles of the BnPGAZ gene identified by reference to Table 1: (3W, 3Z); (3X, 3Y); (3X, 3Y); or (3X, 3Z).

Modified B. napus plant can include dropout genotypic combinations identified by reference to Table 1 (row number column header): (1W, 2W); (2W, 3W); (1W, 3W); (1W, 2W, 3W); (1X, 2X); (2X, 3X); (1X, 3X); (1X, 2X, 3X); (1Y, 2Y); (2Y, 3Y); (1Y, 3Y); (1Y, 2Y, 3Y); (1Z, 2Z); (2Z, 3Z); (1Z, 3Z); (1Z, 2Z, 3Z); (1W, 2X); (1W, 3X); (1W, 1X); (2W, 1X); (2W, 3X); (2W, 2X); (3W, 2X); (3W, 1X); (3W, 3X); (1Y, 2W, 3W); (1W, 2Y, 3W); (1W, 2W, 3Y); (1Z, 2W, 3W); (1W, 2Z, 3W); (1W, 2W, 3Z); (1X, 2W, 3W); (1W, 2X, 3W); (1W, 2W, 3X); (1W, 2X, 3X); (1X, 2W, 3X); (1X, 2X, 3W); (1W, 2Y, 3Y); (1Y, 2W, 3Y); (1Y, 2Y, 3W); (1X, 2Y, 3Y); (1Y, 2X, 3Y); (1Y, 2Y, 3X); (1X, 2Z, 3Z); (1Z, 2X, 3Z); (1Z, 2Z, 3X); (1W, 2X, 3Y); (1Y, 2X, 3W); (1X, 2W, 3Y); (1Y, 2W, 3X); (1X, 2Y, 3W); (1W, 2Y, 3X); (1W, 2Z, 3Y); (1Y, 2Z, 3W); (1Z, 2W, 3Y); (1Y, 2W, 3Z); (1Z, 2Y, 3W); (1W, 2Y, 3Z); (1Z, 2X, 3Y); (1Y, 2X, 3Z); (1X, 2Z, 3Y); (1Y, 2Z, 3X); (1X, 2Y, 3Z); (1Z, 2Y, 3X); (1W, 2X, 3Z); (1Z, 2X, 3W); (1X, 2W, 3Z); (1Z, 2W, 3X); (1X, 2Z, 3W); (1W, 2Z, 3X); (1X, 1Y); (1X, 1Z); (1X, 2Y); (1X, 2Z); (1X, 3Y); (1X, 3Z); (1W, 1Y); (1W, 1Z); (1W, 2Y); (1W, 2Z); (1W, 3Y); (1W, 3Z); (2X, 1Y); (2X, 1Z); (2X, 2Y); (2X, 2Z); (2X, 3Y); (2X, 3Z); (2W, 1Y); (2W, 1Z); (2W, 2Y); (2W, 2Z); (2W, 3Y); (2W, 3Z); (3X, 1Y); (3X, 1Z); (3X, 2Y); (3X, 2Z); (3X, 3Y); (3X, 3Z); (3W, 1Y); (3W, 1Z); (3W, 2Y); (3W, 2Z); (3W, 3Y); or (3W, 3Z).

Methods for generating the foregoing targeted modifications can include inducing double strand breaks using a TALE-nuclease (TALEN), a meganuclease, a zinc finger nuclease, or a CRISPR-associated nuclease. In a preferred aspect, the method includes introducing a CRISPR-associated nuclease and guide RNAs into a B. napus plant cell to generate one or more of the excised alleles or dropouts identified in Table 1.

The disclosure also provides a first and a second guide RNAs, which can be used in the disclosed CRISPR method. Exemplary guide RNAs can include any of the foregoing 1) a first guide RNA comprising SEQ ID NO:26 and a second guide RNA comprising SEQ ID NO:27 that catalyze targeted deletion of endogenous genomic BnIND sequence in the plant cell; 2) a first guide RNA comprising SEQ ID NO:28 and a second guide RNA comprising SEQ ID NO:29 that catalyze targeted deletion of endogenous genomic BnPGAZ sequence in the plant cell; 3) a first guide RNA comprising SEQ ID NO:30 and a second guide RNA comprising SEQ ID NO:29 that catalyze targeted deletion of endogenous genomic BnPGAZ sequence in the plant cell; 4) a first guide RNA comprising SEQ ID NO:31 and a second guide RNA comprising SEQ ID NO:32 that catalyze targeted deletion of endogenous genomic BnALC sequence in the plant cell; 5) a first guide RNA comprising SEQ ID NO:33 and a second guide RNA comprising SEQ ID NO:34 that catalyze targeted deletion of endogenous genomic BnALC sequence in the plant cell; or 6) a first guide RNA comprising SEQ ID NO:35 and a second guide RNA comprising SEQ ID NO:33 that catalyze targeted deletion of endogenous genomic BnALC sequence in the plant cell. In an aspect of the disclosure, the guide RNA is at least 99% identical to sequence encoding an amino acid sequence selected from the group consisting of SEQ ID NOs: 1-21.

Also provided herein is a modified B. napus plant, seed, or plant cell comprising a gene-edited deletion that removes one or more of the following genomic segments: (i) in BnIND-A the genomic segment corresponding to the sequence from position 7740 to position 10346 of SEQ ID NO:56 or the genomic segment corresponding to the sequence from position 2018 to position 4639 of SEQ ID NO:69; (ii) in BnIND-C the genomic segment corresponding to the sequence from position 2676 to position 5101 of SEQ ID NO:57, the genomic segment corresponding to the sequence from position 2019 to position 4441 of SEQ ID NO:67, or the genomic segment corresponding to the sequence from position 2018 to position 4446 of SEQ ID NO:70; (iii) in BnALC-A the genomic segment corresponding to the sequence from position 1723 to position 2849 of SEQ ID NO:71, the genomic segment corresponding to the sequence from position 1722 to position 2851 of SEQ ID NO:73, the genomic segment corresponding to the sequence from position 6369 to position 7511 of SEQ ID NO:72; (iv) in BnALC-C the genomic segment corresponding to the sequence from position 6368 to position 7510 of SEQ ID NO:74, the genomic segment corresponding to the sequence from position 3417 to position 6368 of SEQ ID NO:72, or the genomic segment from corresponding to position 3416 to position 6367 of SEQ ID NO:74; (v) in BnPGAZ-A the genomic segment corresponding to position 2720 to position 5866 of SEQ ID NO:60, the genomic segment corresponding to position 2720 to position 5865 of SEQ ID NO:60, the genomic segment corresponding to position 2015 to position 5235 of SEQ ID NO:126, the genomic segment corresponding to position 2015 to position 5231 of SEQ ID NO:126, the genomic segment corresponding to position 2019 to position 5235 of SEQ ID NO:128, or the genomic segment corresponding to position 2016 to position 5249 of SEQ ID NO:128; (vi) in BnPGAZ-C the genomic segment corresponding to position 2705 to position 5804 of SEQ ID NO:61, the genomic segment corresponding to position 2704 to position 5802 of SEQ ID NO:61, the genomic segment corresponding to position 2705 to position 5802 of SEQ ID NO:61, the genomic segment corresponding to position 2019 to position 5167 of SEQ ID NO:127, or the genomic segment corresponding to position 2023 to position 5192 of SEQ ID NO:129.

A modified B. napus plant can be generated from the modified B. napus plant cell or seed disclosed herein that comprises one or more allele of the gene-edited deletion of native BnIND sequence, native BnALC sequence, or native BnPGAZ sequence disclosed in the foregoing paragraph. The modified B. napus plant can comprise one, two, three or four excised alleles of the BnIND gene; one, two, three or four excised alleles of the BnALC gene; or one, two, three or four excised alleles of the BnPGAZ gene. For example, the modified B. napus plant can comprise three or four alleles of the gene-edited deletion of native BnIND disclosed in the foregoing paragraph that corresponds to the combination of alleles identified in Table 1 (row number column header): (1W, 1Z); (1X, 1Y): (1X, 1Y); or (1X, 1Z). In another example, the modified B. napus can comprise three or four alleles of the gene-edited deletion of native BnALC disclosed in the foregoing paragraph that can be described by reference to Table 1: (2W, 2Z); (2X, 2Y): (2X, 2Y); or (2X, 2Z). In yet another example, the modified B. napus plant can comprise three or four alleles of the gene-edited deletion of native BnPGAZ gene disclosed in the foregoing paragraph that corresponds that can be described by reference to Table 1: (3W, 3Z); (3X, 3Y): (3X, 3Y); or (3X, 3Z).

For example, the modified B. napus plants, plant cell or seed thereof can comprise one or more of the following genomic deletion or dropout sequences. BnIND dropout sequence can comprise SEQ ID NOs:58, 59, 68, 75, or 76. BnPGAZ dropout sequence can comprise SEQ ID NOs:62, 63, 64, 65, 66, 77, 78, 79, or 80. Accordingly, a B. napus plants, plant cell or seed thereof having a genomic modification that contributes to pod shatter tolerance can be identified and selected for using a method that includes isolating genomic DNA, optionally amplifying the genomic DNA, performing DNA sequencing. The presence of SEQ ID NO:58, 59, 68, 75, or 76 in the sequence indicates the B. napus plant, plant cell or seed thereof comprises a BnIND dropout that contributes to pod-shatter tolerance. The presence of a gene-edited deletion of BnALC-A genomic sequence corresponding to position 1723 to position 2849 of SEQ ID NO:71, BnALC-A genomic sequence corresponding to position 1722 to position 2851 of SEQ ID NO:73, BnALC-C genomic sequence corresponding to position 6369 to position 7511 of SEQ ID NO:72, BnALC-C genomic sequence corresponding to position 6368 to position 7510 of SEQ ID NO:74, BnALC-C genomic sequence corresponding to position 3417 to position 6368 of SEQ ID NO:72, or BnALC-C genomic sequence corresponding to position 3416 to position 6367 of SEQ ID NO:74 indicates the B. napus plant, plant cell or seed thereof comprises a BnALC dropout that contributes to pod-shatter tolerance. The presence of SEQ ID NOs:62, 63, 64, 65, 66, 77, 78, 79, or 80 in the sequence indicates the B. napus plant, plant cell or seed thereof comprises a BnPGAZ dropout that contributes to pod-shatter tolerance.

The modified B. napus plants disclosed herein are characterized by having increased pod shatter tolerant phenotype relative to an unmodified isogenic B. napus plant lacking the gene-edited deletion of BnIND gene, BnALC gene, or BnPGAZ gene disclosed herein. Alternatively, the modified B. napus plants can be used to generate, e.g., by breeding, a B. napus plant seed with increased pod shatter tolerance. Thus, when the modified B. napus plant disclosed herein is used as a first parent plant for breeding with a second parent B. napus plant, the gene-edited deletion of BnIND gene, BnALC gene, BnPGAZ, or a combination thereof can contribute to the pod shatter tolerant phenotype of resulting progeny. Such progeny plant can have increased pod shatter tolerance relative to alternative progeny produced using an unmodified, isogenic B. napus plant lacking the gene-edited deletion (instead of the first parent plant) in a breeding pair with the second parent plant.

Also provided herein is a method of introducing a natural deletion of the BnIND-A gene into a modified B. napus plant. The method includes crossing a B. napus plant comprising a native BnIND-A deletion with a modified B. napus parent plant disclosed herein having one, two, or three or four excised alleles of the BnIND, BnALC, or BnALC gene disclosed herein. For example, the modified parent plant can comprise three or four excised alleles of the BnIND gene identified by (row number column header) in Table 1: (1W, 1Z); (1X, 1Y): (1X, 1Y); or (1X, 1Z), (ii) three or four excised alleles of the BnALC gene identified by reference to Table 1: (2W, 2Z); (2X, 2Y): (2X, 2Y); or (2X, 2Z), or (iii) three or four excised alleles of the BnALC gene identified by reference to Table 1: (3W, 3Z); (3X, 3Y): (3X, 3Y); or (3X, 3Z). The cross produces hybrid progeny plants having the natural deletion of the BnIND-A gene and the one or more gene-edited targeted deletion of a BnIND, BnALC, or BnPGAZ gene allele of the modified parent plant. The method can further include selecting for one or more progeny plant(s) having both the natural deletion of the BnIND-A gene and at least one gene-edited targeted deletion of a BnIND, BnALC, or BnPGAZ gene disclosed herein. In a further aspect, the one or more progeny plant(s) can be (a) crossed with the modified B. napus parent plant to produce backcross progeny plants and (b) selecting backcross progeny plants that have the natural deletion of the BnIND-A gene and the one or targeted dropout of a BnIND, BnALC, or BnPGAZ gene disclosed herein. Further backcrossing includes using the selected backcross progeny plants to repeat steps (a) and (b) at least three or more times to produce further backcrossed progeny plants that comprise the natural deletion of the BnIND-A gene and the higher fraction of genetic material from the modified B. napus parent plant. This higher fraction of genetic material results in further backcrossed progeny plants having comparable or the same agronomic properties as the modified B. napus parent plant when grown in the same environmental conditions.

In preferred embodiments, each of the modified B. napus plant disclosed herein containing one or more targeted dropouts of a BnIND, BnALC, or BnPGAZ allele have suitable agronomic properties for commercial crop use.

Additionally, the disclosure provides Arabidopsis plants that comprise targeted dropouts of one or more alleles of the AtIND gene, AtALC gene, or a combination thereof.

The compositions and methods provided by this disclosure can be more fully understood from the following detailed description and the accompanying drawings and Sequence Listing, which form a part of this application.

BRIEF DESCRIPTION OF THE DRAWINGS AND SEQUENCE LISTING

FIG. 1 is a genomic map of AtIND Chr4:40000.45000 annotated to show CRISPR guide RNAs.

FIG. 2: is a genomic map of AtALC Chr5:2678000-2679100 annotated to show CRISPR guide RNAs.

FIG. 3: is a genomic map of IND-A and IND-C loci, which is annotated to show the position of target and cut sites of BNA-IND-CR1 and BNA-IND-CR2 in the A and C genomes of B. napus line NS1822BC. Primers used for genotyping using amplicon DNA sequencing are also indicated.

FIG. 4: is a genomic map of IND-C locus of B. napus line G00010BC annotated to show the guide RNA target sites and genotyping primers.

FIG. 5 is a genomic map of IND-A and IND-C loci B. napus line G00555MC annotated to show guide RNA target sites and genotyping primers.

FIG. 6 is a schematic illustrating a KASPAR™assay designed to detect a BnIND-A natural deletion on chromosome NO3 (SEQ ID NO: 130). In FIG. 6, “1” indicates a wildtype allele-specific forward primer (e.g. SEQ ID NO:131); “2” indicates a wildtype specific common or reverse primer (e.g. SEQ ID NO:132), “3” indicates a natural deletion allele-specific forward primer (e.g. SEQ ID NO:133), and “4” indicates a natural deletion allele-specific common or reverse primer (e.g. SEQ ID NO:134).

FIG. 7 is a schematic illustrating a TAQMAN™ assay design to detect a BnIND-A natural deletion on chromosome NO3. In FIG. 7, “star 1” indicates a wildtype specific probe (e.g. SEQ ID NO:137; “star 2” indicates a natural deletion specific probe (e.g. SEQ ID NO:139); “3” indicates a wildtype and mutant common forward primer (e.g. SEQ ID NO:135), “4” indicates a wildtype allele-specific reverse primer (e.g. SEQ ID NO:136); and “5” indicates a natural deletion allele-specific reverse primer (e.g. SEQ ID NO:138).

FIG. 8 is a bar graph showing average percentage shattered pods of B. napus inbreds G00010BC, NS1822BC, and G00555MC, which were evaluated using a method for laboratory phenotyping pod shatter tolerance as disclosed herein.

FIG. 9 is a bar graph showing the average percentage shattered pods of G00010BC plants segregating for an IND-C dropout determined using a laboratory method for phenotyping pod shatter tolerance. Asterisk indicates a significant difference (T-test, p<0.05) as compared to wild-type (WT) plants. N=number of 15 pods replications for each zygosity category.

FIG. 10 is a bar graph showing the average percentage shattered pods of NS1822BC plants having indicated gene edited deletions. Pod shatter tolerance was determined using a laboratory phenotyping method. Hom refers to plants homozygous for the indicated gene edited deletion locus (IND-A or IND-C), Het refers to plants heterozygous for the indicated gene edited deletion locus (IND-A or IND-C), WT indicates unmodified NS1822BC and Double Het refers plants heterozygous at both IND-A or IND-C loci. Asterisk indicates a significant difference (T-test, p<0.05) as compared to WT plants.

FIG. 11 is a bar graph showing the average percentage of shattered pods of a commercial pod-shatter tolerant line (PST Check 1), G00010BC plants (2 KO), and modified G00010BC plants that are either homozygous (4 KO) or heterozygous (3 KO) for gene-edited deletions of IND-C gene allele. Pod shatter tolerance was determined using a laboratory phenotyping method.

FIG. 12 is a bar graph showing the average percentage of shattered pods (SHTPC) of B. napus plants homozygous or heterozygous, as indicated, for targeted deletions of IND-A or/and IND-C as compared to wildtype unmodified NS1822BC plants (WT). Single asterisk indicates a significant difference (T-test, p<0.01) and double asterisk indicates a significant difference (T-test, p<0.05), each as compared to WT plants that were not transformed. Pod shatter tolerance was determined using a field phenotyping method.

FIG. 13 is a bar graph showing the SHTPC of WT untransformed, which are unmodified G00010BC plants (2K0), WT segregant (2K0), and G00010BC plants that are either homozygous (4 KO) or heterozygous (3 KO) for gene-edited deletions of IND-C gene allele. Pod shatter tolerance was determined using a field phenotyping method.

FIG. 14 is a bar graph showing the average percentage of shattered pods Shatter tolerance of G00555MC x G00010BC gene edited hybrids with indicated dropout allele combinations and hybrid checks calculated as average percent shattered pods +/−SE. Pod shatter tolerance was determined using a lab phenotyping method. A and C indicate functional IND-A and IND-C alleles, respectively and lower case a and c indicate deletions of IND-A and IND-C alleles, respectively. Single asterisk indicates a significant difference (T-test, p<0.05) and double asterisk indicates a significant difference (T-test, p<0.01).

FIG. 15 is a set of four genomic maps of B. napus ALC-A and ALC-C regions in G00010BC (10BC) and G00555MC (55MC), respectively.

FIG. 16 is a genomic map of the B. napus PGAZ-A and PGAZ-C loci indicating the position of the target and cut sites of BNA-PGAZ-CR1 and BNA-PGAZ-CR2 on the NS1822BC A and C genomes. Primers used for genotyping using amplicon NextGen DNA sequencing are also indicated.

Nucleic acid sequences listed in the accompanying sequence listing and referenced herein are shown using standard letter abbreviations for nucleotide bases. Only one strand of each nucleic acid sequence is shown, but the complementary strand is understood to be included by any reference to the displayed strand. Sequence listings are described in the following Table 2.

TABLE 2
SEQ ID NO Description
SEQ ID NO: 1 BnIND A genome protein
SEQ ID NO: 2 NS1822BC BnIND A genome protein
SEQ ID NO: 3 G00555MC BnIND A genome protein
SEQ ID NO: 4 BnIND C genome protein
SEQ ID NO: 5 NS1822BC BnIND C genome protein
SEQ ID NO: 6 G00010BC BnIND C genome protein
SEQ ID NO: 7 G00555MC BnIND C genome protein
SEQ ID NO: 8 BnPGAZ A genome protein
SEQ ID NO: 9 NS1822BC BnPGAZ A genome protein
SEQ ID NO: 10 G00010BC BnPGAZ A genome protein
SEQ ID NO: 11 G00555MC BnPGAZ A genome protein
SEQ ID NO: 12 BnPGAZ C genome protein
SEQ ID NO: 13 NS1822BC BnPGAZ C genome protein
SEQ ID NO: 14 G00010BCBnPGAZ C genome protein
SEQ ID NO: 15 G00555MC BnPGAZ C genome protein
SEQ ID NO: 16 BnALC A genome protein
SEQ ID NO: 17 G00010BC BnALC A genome protein
SEQ ID NO: 18 G00555MC BnALC A genome protein
SEQ ID NO: 19 BnALC C genome protein
SEQ ID NO: 20 G00010BC BnALC C genome protein
SEQ ID NO: 21 G00555MC BnALC C genome protein
SEQ ID NO: 22 G00010BC BnALC A genome promoter
SEQ ID NO: 23 G00555MC BnALC A genome promoter
SEQ ID NO: 24 G00010BC BnALC C genome promoter
SEQ ID NO: 25 G00555MC BnALC C genome promoter
SEQ ID NO: 26 BnIND guide RNA
SEQ ID NO: 27 BnIND guide RNA
SEQ ID NO: 28 BnPGAZ guide RNA
SEQ ID NO: 29 BnPGAZ guide RNA
SEQ ID NO: 30 BnPGAZ guide RNA
SEQ ID NO: 31 BnALC A genome RNA guide
SEQ ID NO: 32 BnALC A genome RNA guide
SEQ ID NO: 33 BnALC C genome RNA guide
SEQ ID NO: 34 BnALC C genome RNA guide
SEQ ID NO: 35 BnALC C genome promoter RNA guide
SEQ ID NO: 36 AtIND coding sequence
SEQ ID NO: 37 AtIND guide RNA
SEQ ID NO: 38 AtIND guide RNA
SEQ ID NO: 39 AtIND guide RNA
SEQ ID NO: 40 AtIND guide RNA
SEQ ID NO: 41 AtIND guide RNA
SEQ ID NO: 42 AtIND guide RNA
SEQ ID NO: 43 AtALC coding sequence
SEQ ID NO: 44 AtALC guide RNA
SEQ ID NO: 45 AtALC guide RNA
SEQ ID NO: 46 AtALC guide RNA
SEQ ID NO: 47 AtALC guide RNA
SEQ ID NO: 48 AtALC guide RNA
SEQ ID NO: 49 AtALC guide RNA
SEQ ID NO: 50 AtALC guide RNA targets promoter
SEQ ID NO: 51 AtALC guide RNA targets promoter
SEQ ID NO: 52 genotyping primer AtIND dropout
SEQ ID NO: 53 genotyping primer AtIND dropout
SEQ ID NO: 54 genotyping primer AtIND dropout
SEQ ID NO: 55 genotyping primer AtIND dropout
SEQ ID NO: 56 NS1822BC BnIND genomic seq A genome
SEQ ID NO: 57 NS1822BC BnIND genomic seq C genome
SEQ ID NO: 58 NS1822BC BnIND A genome dropout
SEQ ID NO: 59 NS1822BC BnIND C genome dropout
SEQ ID NO: 60 NS1822BC BnPGAZ genomic seq A genome
SEQ ID NO: 61 NS1822BC BnPGAZ genomic seq C genome
SEQ ID NO: 62 NS1822BC BnPGAZ A genome dropout 1
SEQ ID NO: 63 NS1822BC BnPGAZ A genome dropout 2
SEQ ID NO: 64 NS1822BC BnPGAZ C genome dropout 1
SEQ ID NO: 65 NS1822BC BnPGAZ C genome dropout 2
SEQ ID NO: 66 NS1822BC BnPGAZ C genome dropout 3
SEQ ID NO: 67 G00010BC BnIND genomic seq C genome
SEQ ID NO: 68 G00010BC BnIND C genome dropout
SEQ ID NO: 69 G00555MC BnIND genomic seq A genome
SEQ ID NO: 70 G00555MC BnIND genomic seq C genome
SEQ ID NO: 71 G00010BC BnALC genomic seq A genome
SEQ ID NO: 72 G00010BC BnALC genomic seq C genome
SEQ ID NO: 73 G00555MC BnALC genomic seq A genome
SEQ ID NO: 74 G00555MC BnALC genomic seq C genome
SEQ ID NO: 75 G00555MC BnIND A genome dropout
SEQ ID NO: 76 G00555MC BnIND C genome dropout
SEQ ID NO: 77 G00010BC BnPGAZ A genome dropout
SEQ ID NO: 78 G00010BC BnPGAZ C genome dropout
SEQ ID NO: 79 G00555MC BnPGAZ A genome dropout
SEQ ID NO: 80 G00555MC BnPGAZ C genome dropout
SEQ ID NO: 81 NS1822BC_C75 IND-C FAMProbe
SEQ ID NO: 82 NS1822BC_C75 IND-C VICProbe
SEQ ID NO: 83 NS1822BC_C75 IND-C FP
SEQ ID NO: 84 NS1822BC_C75 IND-C RP
SEQ ID NO: 85 NS1822BC_C75 IND-C FP2
SEQ ID NO: 86 NS1822BC_C75 IND-C RP2
SEQ ID NO: 87 NS1822BC_C7B IND-C FAMProbe
SEQ ID NO: 88 NS1822BC_C7B IND-C VICProbe
SEQ ID NO: 89 NS1822BC_C7B IND-C FP
SEQ ID NO: 90 NS1822BC_C7B IND-C RP
SEQ ID NO: 91 NS1822BC_C7B IND-C FP2
SEQ ID NO: 92 NS1822BC_C7B IND-C RP2
SEQ ID NO: 93 NS1822BC_C7M IND-A FAMProbe
SEQ ID NO: 94 NS1822BC_C7M IND-A VICProbe
SEQ ID NO: 95 NS1822BC_C7M IND-A FP
SEQ ID NO: 96 NS1822BC_C7M IND-A RP
SEQ ID NO: 97 NS1822BC_C7M IND-A FP2
SEQ ID NO: 98 NS1822BC_C7M IND-A RP2
SEQ ID NO: 99 NS1822BC_C7N IND-A FAMProbe
SEQ ID NO: 100 NS1822BC_C7N IND-A VICProbe
SEQ ID NO: 101 NS1822BC_C7N IND-A FP
SEQ ID NO: 102 NS1822BC_C7N IND-A RP
SEQ ID NO: 103 NS1822BC_C7N IND-A FP2
SEQ ID NO: 104 NS1822BC_C7N IND-A RP2
SEQ ID NO: 105 BnIND-A/BnaA03g27180D/LK031800.1
coding region
SEQ ID NO: 106 BnIND-A/NS1822BC coding region
SEQ ID NO: 107 BnIND-A/G00555MC coding region
SEQ ID NO: 108 BnIND-C/BnaC03g32180D/LK031870.1
coding region
SEQ ID NO: 109 BnIND-C/NS1822BC coding region
SEQ ID NO: 110 BnIND-C/G00010BC coding region
SEQ ID NO: 111 BnIND-C/G00555MC coding region
SEQ ID NO: 112 BnPGAZ-A/BnaA04g24130D coding region
SEQ ID NO: 113 BnPGAZ-A/NS1822BC coding region
SEQ ID NO: 114 BnPGAZ-A/G00010BC coding region
SEQ ID NO: 115 BnPGAZ-A/G00555MC coding region
SEQ ID NO: 116 BnPGAZ-C/BnaC04g47880D coding region
SEQ ID NO: 117 BnPGAZ-C/NS1822BC coding region
SEQ ID NO: 118 BnPGAZ-C/G00010BC coding region
SEQ ID NO: 119 BnPGAZ-C/G00555MC coding region
SEQ ID NO: 120 BnALC-A/BnaA07g12110D coding region
SEQ ID NO: 121 BnALC-C/BnaC07g16290D coding region
SEQ ID NO: 122 BnALC-A/G00010BC coding region
SEQ ID NO: 123 BnALC-C/G00010BC coding region
SEQ ID NO: 124 BnALC-A/G00555MC coding region
SEQ ID NO: 125 BnALC-C/G00555MC coding region
SEQ ID NO: 126 G00010BC BnPGAZ genomic seq A genome
SEQ ID NO: 127 G00010BC BnPGAZ genomic seq C genome
SEQ ID NO: 128 G00555MC BnPGAZ genomic seq A genome
SEQ ID NO: 129 G00555MC BnPGAZ genomic seq C genome
SEQ ID NO: 130 G00010BC IND genomic seq A genome
SEQ ID NO: 131 BnIND-A WT F Primer
SEQ ID NO: 132 BnIND-A WT R Primer
SEQ ID NO: 133 BnIND-A natural deletion Mutant F Primer
SEQ ID NO: 134 BnIND-A natural deletion Mutant R Primer
SEQ ID NO: 135 BnIND-A WT and mutant common F Primer
SEQ ID NO: 136 BnIND-A WT R Primer
SEQ ID NO: 137 BnIND-A WT Probe
SEQ ID NO: 138 BnIND-A natural deletion Mutant R Primer
SEQ ID NO: 139 BnIND-A natural deletion Mutant Probe
SEQ ID NO: 140 G00010BC BnPGAZ A genome dropout 2
SEQ ID NO: 141 G00555MC BnPGAZ A genome dropout 2
SEQ ID NO: 142 IND_CR1-FP detection of BnIND dropout
SEQ ID NO: 143 IND_CR1-RP detection of BnIND dropout
SEQ ID NO: 144 IND_CR2-FP detection of BnIND dropout
SEQ ID NO: 145 IND_CR2-RP detection of BnIND dropout

DETAILED DESCRIPTION

Seed yield of B. napus and related plants is limited by pod “dehiscence” a process that occurs late in fruit development whereby the pod, or “silique” is opened and the enclosed seeds released. Degradation and separation of cell walls along a discrete layer of cells dividing the two halves of the pod, termed the “dehiscence zone” result in separation of the two halves of the pod and release of the contained seeds. The dehiscence zone is a region of only one to three cells in width that extends along the entire length of the valve/replum boundary (Meakin and Roberts, 1990, Exp. Botany, 41:995-1002). As the cells in the dehiscence zone separate from one another, the valves detach from the replum, allowing seeds to be dispersed. Seed “shattering,” whereby seeds are prematurely shed through dehiscence before the crop can be harvested, is a significant problem faced by commercial seed producers and represents a loss of income to the industry.

Described herein are modified Brassica napus and Arabidoposis thaliana plants that provide resistance to seed shattering, i.e., the modified plants are pod shatter tolerant or their genotypes contribute to pod shatter tolerance of their progeny. The disclosed modified B. napus plants include a targeted modification, i.e., a gene-edited excision or dropout of endogenous genomic sequence of an INDEHISCENT (BnIND), ALCATRAZ (BnALC), or POLYGALACTURONASE (BnPGAZ).

Methods for creating such plants are also disclosed. The method for generating dropouts comprises inducing a first and second double strand break in genomic DNA using a TALE-nuclease (TALEN), a meganuclease, a zinc finger nuclease, or a CRISPR-associated nuclease. In a preferred aspect, the method comprises introducing a CRISPR-associated nuclease and guide RNAs into a B. napus plant cell. A CRISPR associated nuclease can be a CRISPR-Cas9 and guide RNAs can be one or more pairs of guide RNAs disclosed in Table 2 herein.

In some examples, the modified B. napus plants disclosed herein are characterized by having increased pod shatter tolerant phenotype relative to the same plant prior to modification (the plant lacking the gene-edited dropout of BnIND gene, BnALC gene, or BnPGAZ gene disclosed herein). In other examples, the modified B. napus plants disclosed herein can be used to generate, e.g., by breeding, a B. napus plant that has increased pod shatter tolerance. The modified B. napus plant disclosed can be used as a first parent plant for breeding with a second parent B. napus plant to create progeny that includes the targeted dropout of BnIND gene, BnALC gene, BnPGAZ, or a combination thereof. The dropout contributes to an increased pod shatter tolerant phenotype of resulting progeny having the one or more targeted dropout, as compared to progeny lacking the one or more gene-edited dropouts of BnIND gene, BnALC gene, or BnPGAZ gene allele as disclosed herein.

Terms and Definitions

“Increased pod shatter tolerance” and “reduced seed shattering”, as used herein, refers to a decreased seed shatter tendency and/or a delay in the timing of seed shattering, in particular until harvest, of Brassica plants, the fruits of which normally do not mature synchronously, but sequentially, so that some pods burst open and shatter their seeds before or during harvest.

The term “ALCATRAZ gene”, “ALC gene”, “ALCATRAZ allele” or “ALC allele” refers herein to a gene that can contribute to pod shatter resistance in B. napus and A. thaliana (e.g. the gene encoding SEQ ID No:16, 17, 18, 19, 20, or 21). ALC gene plays a role in cell separation during fruit dehiscence by promoting the differentiation of a cell layer that is the site of separation between the valves and the replum within the dehiscence zone. Examples of ALC gene sequences include BnALC-A (SEQ ID No:71, 73, 120, 122, or 124) and BnALC-C (SEQ ID No:72, 74, 121, 123, or 125).

The term “INDEHISCENT gene”, “IND gene”, “INDEHISCENT allele” or “IND allele” refers herein to a gene that can contribute to pod shatter resistance in B. napus and A. thaliana. IND encodes a member of an atypical class of eukaryotic bHLH proteins (e.g., SEQ ID NO:1, 2, 3, 4, 5, 6, or 7) and is required for seed dispersal. IND is involved in the differentiation of all three cell types required for fruit dehiscence and acts as the key regulator in a network that controls specification of the valve margin. Examples of IND gene sequences include BnIND-A (SEQ ID NO:56, 69, 105, 106, or 107) and BnIND-C (SEQ ID NO:57, 67, 70, 108, 109, 110, or 111).

The term “POLYGALACTURONASE gene”, “PGAZ gene”, “POLYGALACTURONASE allele” or “PGAZ allele” refers herein to “polygalacturonase expressed in abscission zone” gene. PGAZ is involved in pectin degradation and subsequent loss of cell cohesion (Hadfield and Bennet 1998, Plant physiology, 117(2), 337-343.). PGAZ expression increases during a number of developmental processes thought to involve cell wall breakdown, including silique shattering (Jenkins et al., 1996, Journal of Exp. Botany, 47(1), 111-115; Jenkins et al., 1999, Plant, Cell & Environment, 22(2), 159-167; Ferrándiz, 2002, Journal of Exp. Botany, 53(377), 2031-2038). Examples of PGAZ-encoded protein products include SEQ ID NO:8, 9, 10, 11, 12, 13, 14, or 15) and examples of PGAZ genes include BnPGAZ-A (SEQ ID No:60, 112, 113, 114, 115, 126, or 128) and BnPGAZ-C (SEQ ID NO:61, 116, 117, 118, 119, 127, or 128) of SEQ ID NO:105 and SEQ ID NO:108.

In connection with pod shatter phenotypes evaluated herein, “fully shattered pods” are those with both valves detached from the replum and all seeds dispersed. “Half shattered pods” are those with one valve fully or partially detached from the replum, seeds dispersed, though the second valve is still attached and all or some seeds remain between the attached valve and the septum. “Unshattered pods” have both valves attached to the replum and seeds are contained between both valves and the septum. For laboratory phenotyping, “percent shattered pods” or “SHTPC” is the number of fully shattered +half shattered pods/total number of pods*100. For field phenotyping, “half shattered” pods are not counted, so “percent shattered pods” or “SHTPC” is the number of fully shattered/total number of pods*100. SHTPC is compared to the wildtype after the shatter inducing treatment.

Brassica” refers to any one of Brassica napus (AACC, 2n=38), Brassica juncea (AABB, 2n=36), Brassica carinata (BBCC, 2n=34), Brassica rapa (syn. B. campestris) (AA, 2n=20), Brassica oleracea (CC, 2n=18) or Brassica nigra (BB, 2n=16).

An “allele” is one of several alternative forms of a gene occupying a given locus on a chromosome. When all the alleles present at a given locus on a chromosome are the same, that plant is “homozygous” at that locus. If the alleles present at a given locus on a chromosome differ, that plant is “heterozygous” at that locus. In B. napus, a plant can be homozygous. wildtype for the IND gene in the A genome, but heterozygous mutant for the IND gene in the C genome.

An “amplicon” is amplified nucleic acid, e.g., a nucleic acid that is produced by amplifying a template nucleic acid by any available amplification method (e.g., PCR, LCR, transcription, or the like).

“Backcrossing” refers to the process whereby hybrid progeny are repeatedly crossed back to one of the parents. In a backcrossing scheme, the “donor” parent refers to the parental plant with the desired gene or locus to be introgressed. The “recipient” parent (used one or more times) or “recurrent” parent (used two or more times) refers to the parental plant into which the gene or locus is being introgressed.

“CRISPR” (Clustered Regularly Interspaced Short Palindromic Repeats) loci refers to certain genetic loci encoding components of DNA cleavage systems, for example, used by bacterial and archaeal cells to destroy foreign DNA (Horvath and Barrangou, 2010, Science 327: 167-170; International Application Publication WO2007/025097, published 1 Mar. 2007). A CRISPR locus can consist of a CRISPR array, comprising short direct repeats (CRISPR repeats) separated by short variable DNA sequences (called spacers), which can be flanked by diverse Cas (CRISPR-associated) genes.

The term “Cas protein” refers to a polypeptide encoded by a Cas (CRISPR-associated) gene. A Cas protein includes but is not limited to: a Cas9 protein, a Cpf1 (Cas12) protein, a C2c1 protein, a C2c2 protein, a C2c3 protein, Cas3, Cas3-HD, Cas 5, Cas7, Cas8, Cas10, or combinations or complexes of these. A Cas protein may be a “Cas endonuclease” or “Cas effector protein”, that when in complex with a suitable polynucleotide component, is capable of recognizing, binding to, and optionally nicking or cleaving all or part of a specific polynucleotide target sequence. A Cas endonuclease described herein comprises one or more nuclease domains. The endonucleases of the disclosure may include those having one or more RuvC nuclease domains. A Cas protein is further defined as a functional fragment or functional variant of a native Cas protein, or a protein that shares at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with a native Cas protein, and retains at least partial activity.

A “Cas endonuclease” may comprise domains that enable it to function as a double-strand-break-inducing agent. A “Cas endonuclease” may also comprise one or more modifications or mutations that abolish or reduce its ability to cleave a double-strand polynucleotide (dCas). In some aspects, the Cas endonuclease molecule may retain the ability to nick a single-strand polynucleotide (for example, a D10A mutation in a Cas9 endonuclease molecule) (nCas9).

“Gene” includes a nucleic acid fragment that expresses a functional molecule such as, but not limited to, a specific protein, including regulatory sequences preceding (5′ non-coding sequences) and following (3′ non-coding sequences) the coding sequence, as well as intervening intron sequences. “Native gene” refers to a gene as found in its natural endogenous location with its own regulatory sequences.

A “mutated gene” or “modified gene” is a gene that has been altered through human intervention. Such a “mutated” or “modified” gene has a sequence that differs from the sequence of the corresponding non-mutated gene by at least one nucleotide addition, deletion, or substitution. In certain embodiments of the disclosure, the mutated gene comprises an excision or deletion of a sequence of nucleotides within that results from two double strands break which are specifically targeted to a genomic sequence by guide polynucleotide/Cas endonuclease system as disclosed herein. A “mutated” or “modified” plant is a plant comprising a mutated gene or deletion.

As used herein, a “targeted mutation” is a mutation in a gene (referred to as the target gene), including a native gene, that was made by altering a target sequence within the target gene using any method known to one skilled in the art, including a method involving a guided Cas endonuclease system as disclosed herein.

The terms “dropout”, “gene dropout”, “knockout” and “gene knockout” refers to a DNA sequence of a cell (e.g. the BnIND gene) that has been excised from the genome by targeted deletion mediated by a Cas protein.

The term “genome” as it applies to a prokaryotic and eukaryotic cell or organism cells encompasses not only chromosomal DNA found within the nucleus, but organelle DNA found within subcellular components (e.g., mitochondria, or plastid) of the cell.

As used herein, a “genomic sequence” or “genomic region” is a segment of a chromosome in the genome of a cell that is present on either side of the target site or, alternatively, also comprises the target site or a portion thereof. An “endogenous genomic sequence” refers to genomic sequence within a plant cell, (e.g. an endogenous genomic sequence of an IND gene present within the genome of a Brassica plant cell).

A “genomic locus” as used herein refers to the genetic or physical location on a chromosome of a gene. As used herein, “gene” includes a nucleic acid fragment that expresses a functional molecule such as, but not limited to, a specific protein coding sequence and regulatory elements, such as those preceding (5′ non-coding sequences) and following (3′ non-coding sequences) the coding sequence.

As used herein, “genotype” is the actual nucleic acid sequence at one or more loci in an individual plant. As used herein, “phenotype” means the detectable characteristics (e.g. pod shatter tolerance) of a cell or organism which can be influenced by genotype.

As used herein, the term “guide polynucleotide”, relates to a polynucleotide sequence that can form a complex with a Cas endonuclease, including the Cas endonuclease described herein, and enables the Cas endonuclease to recognize, optionally bind to, and optionally cleave a DNA target site. The guide polynucleotide sequence can be a RNA sequence, a DNA sequence, or a combination thereof (a RNA-DNA combination sequence).

The terms “single guide RNA” and “sgRNA” are used interchangeably herein and relate to a synthetic fusion of two RNA molecules, a crRNA (CRISPR RNA) comprising a variable targeting domain (linked to a tracr mate sequence that hybridizes to a tracrRNA), fused to a tracrRNA (trans-activating CRISPR RNA). The single guide RNA can comprise a crRNA or crRNA fragment and a tracrRNA or tracrRNA fragment of the type II CRISPR/Cas system that can form a complex with a type II Cas endonuclease, wherein said guide RNA/Cas endonuclease complex can direct the Cas endonuclease to a DNA target site, enabling the Cas endonuclease to recognize, optionally bind to, and optionally nick or cleave (introduce a single or double-strand break) the DNA target site.

As used herein, the terms “guide polynucleotide/Cas endonuclease complex”, “guide polynucleotide/Cas endonuclease system”, “ guide polynucleotide/Cas complex”, “guide polynucleotide/Cas system” and “guided Cas system” “Polynucleotide-guided endonuclease” , “PGEN” are used interchangeably herein and refer to at least one guide polynucleotide and at least one Cas endonuclease, that are capable of forming a complex, wherein said guide polynucleotide/Cas endonuclease complex can direct the Cas endonuclease to a DNA target site, enabling the Cas endonuclease to recognize, bind to, and optionally nick or cleave (introduce a single or double-strand break) the DNA target site. A guide polynucleotide/Cas endonuclease complex herein can comprise Cas protein(s) and suitable polynucleotide component(s) of any of the known CRISPR systems (Horvath and Barrangou, 2010, Science 327: 167-170; Makarova et al. 2015, Nature Reviews Microbiology Vol. 13: 1-15; Zetsche et al., 2015, Cell 163, 1-13; Shmakov et al., 2015, Molecular Cell 60, 1-13).

As used herein, a ‘nucleic acid molecule” is a polymeric form of nucleotides, which can include both sense and anti-sense strands of RNA, cDNA, genomic DNA, and synthetic forms and mixed polymers of the above. A nucleotide refers to a ribonucleotide, deoxynucleotide, or a modified form of either type of nucleotide. A “nucleic acid molecule” as used herein is synonymous with “nucleic acid”, “nucleotide sequence”, “nucleic acid sequence”, and “polynucleotide.” The term includes single- and double-stranded forms of DNA. A nucleic acid molecule can include either or both naturally occurring and modified nucleotides linked together by naturally occurring and/or non-naturally occurring nucleotide linkages.

Nucleic acid molecules may be modified chemically or biochemically, or may contain non-natural or derivatized nucleotide bases, as will be readily appreciated by those of skill in the art. Such modifications include, for example, labels, methylation, substitution of one or more of the naturally occurring nucleotides with an analog, internucleotide modifications, such as uncharged linkages (e.g., methyl phosphonates, phosphotriesters, phosphoramidates, carbamates, etc.), charged linkages (e.g., phosphorothioates, phosphorodithioates, etc.), pendent moieties (e.g., peptides), intercalators (e.g., acridine, psoralen, etc.), chelators, alkylators, and modified linkages (e.g., alpha anomeric nucleic acids, etc.). The term “nucleic acid molecule” also includes any topological conformation, including single-stranded, double-stranded, partially duplexed, triplexed, hairpinned, circular, and padlocked conformations. An “endogenous nucleic acid sequence” refers to a nucleic acid sequence within a plant cell, (e.g. an endogenous allele of an IND gene present within the genome of a Brassica plant cell).

A “protospacer adjacent motif” (PAM) herein refers to a short nucleotide sequence adjacent to a target sequence (protospacer) that is recognized (targeted) by a guide polynucleotide/Cas endonuclease system described herein. The Cas endonuclease may not successfully recognize a target DNA sequence if the target DNA sequence is not followed by a PAM sequence. The sequence and length of a PAM herein can differ depending on the Cas protein or Cas protein complex used. The PAM sequence can be of any length but is typically 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 nucleotides long.

As used herein, the term “plant material” refers to any processed or unprocessed material derived, in whole or in part, from a plant. For example, and without limitation, a plant material may be a plant part, a seed, a fruit, a leaf, a root, a plant tissue, a plant tissue culture, a plant explant, or a plant cell.

The terms “recombinant DNA molecule”, “recombinant DNA construct”, “expression construct”, “construct”, and “recombinant construct” are used interchangeably herein. A recombinant DNA construct comprises an artificial combination of nucleic acid sequences, e.g., regulatory and coding sequences that are not all found together in nature. For example, a recombinant DNA construct may comprise regulatory sequences and coding sequences that are derived from different sources, or regulatory sequences and coding sequences derived from the same source, but arranged in a manner different than that found in nature. In one aspect, a “construct” comprises a double-strand-break inducing agent (e.g. a Cas endonuclease and guide RNA complex). Such a construct may be used by itself or may be used in conjunction with a vector. If a vector is used, then the choice of vector is dependent upon the method that will be used to introduce the vector into the host cells. For example, a plasmid vector can be used that comprises the genetic elements needed to transform, select and propagate vector host cells. Different independent transformation events may result in different levels and patterns of expression (Jones et al., 1985, EMBO J4: 2411-2418; De Almeida et al., 1989, Mol Gen Genetics 218: 78-86), and thus multiple events are typically screened in order to obtain lines displaying the desired expression level and pattern. Such screening may be accomplished standard molecular biological, biochemical, and other assays including Southern analysis of DNA, Northern analysis of mRNA expression, PCR, real time quantitative PCR (qPCR), reverse transcription PCR (RT-PCR), immunoblotting analysis of protein expression, enzyme or activity assays, and/or phenotypic analysis.

The terms “target site”, “target sequence”, “target site sequence, “target DNA”, “target locus”, “genomic target site”, “genomic target sequence”, “genomic target locus”, and “target polynucleotide”, can be used interchangeably herein and refer to a polynucleotide sequence such as, but not limited to, a nucleotide sequence on a chromosome, episome, a locus, or any other DNA molecule in the genome (including chromosomal, chloroplastic, mitochondrial DNA, plasmid DNA) of a cell, at which a guide polynucleotide/Cas endonuclease complex can recognize, bind to, and optionally nick or cleave . The target site can be an endogenous site in the genome of a cell, or alternatively, the target site can be heterologous to the cell and thereby not be naturally occurring in the genome of the cell, or the target site can be found in a heterologous genomic location compared to where it occurs in nature. As used herein, terms “endogenous target sequence” and “native target sequence” are used interchangeable herein to refer to a target sequence that is endogenous or native to the genome of a cell and is at the endogenous or native position of that target sequence in the genome of the cell.

A virus or vector “transforms” or “transduces” a cell when it transfers nucleic acid molecules into the cell. A cell is “transformed” by a nucleic acid molecule transduced into the cell when the nucleic acid molecule becomes stably replicated by the cell, either by incorporation of the nucleic acid molecule into the cellular genome, or by episomal replication. As used herein, the term “transformation” encompasses all techniques by which a nucleic acid molecule can be introduced into such a cell. Examples include, but are not limited to, transfection with viral vectors, transformation with plasmid vectors, electroporation (Fromm et al., 1986, Nature 319: 791-3), lipofection (Feigner et al., 1987, Proc. Natl. Acad. Sci. USA 84: 7413-7), microinjection (Mueller et al., 1978, Cell 15: 579-85), Agrobacterium-mediated transfer (Fraley et al., 1983, Proc. Natl. Acad. Sci. USA 80: 4803-7), direct DNA uptake, and microprojectile bombardment (Klein et al., 1987, Nature 327: 70).

The phrase “under stringent conditions” refers to conditions under which a probe or polynucleotide will hybridize to a specific nucleic acid sequence, typically in a complex mixture of nucleic acids, but to essentially no other sequences. Stringent conditions are sequence-dependent and will be different in different circumstances.

“Variants” is intended to mean substantially similar sequences. For polynucleotides, a variant comprises a deletion and/or addition of one or more nucleotides at one or more internal sites within the native polynucleotide and/or a substitution of one or more nucleotides at one or more sites in the native polynucleotide (e.g. an IND dropout variant, with the chromosome region containing the IND gene excised). As used herein, a “native” polynucleotide or polypeptide comprises a naturally occurring nucleotide sequence or amino acid sequence, respectively.

“Variant” protein is intended to mean a protein derived from the native protein by deletion or addition of one or more amino acids at one or more internal sites in the native protein and/or substitution of one or more amino acids at one or more sites in the native protein.

III. Double-Strand-Break (DSB) Inducing Agents (DSB Agents)

Double-strand breaks can be induced by agents such as endonucleases that cleave the phosphodiester bond within a polynucleotide chain, can result in the induction of DNA repair mechanisms, including the non-homologous end-joining pathway, and homologous recombination. Endonucleases include a range of different enzymes, including restriction endonucleases (see e.g. Roberts et al., 2003 Nucleic Acids Res 1: 418-20, Roberts et al., 2003, Nucleic Acids Res 31: 1805-12, and Belfort et al., 2002 in Mobile DNA II, pp. 761-783, Eds. Craigie et al., (ASM Press, Washington, D.C.)), meganucleases (see e.g., International Application Publication WO 2009/114321; Gao et al., 2010, Plant Journal 1: 176-187), and TAL effector nucleases or TALENs (see e.g., US Application Publication US 20110145940 and Christian et al., 2010, Genetics 186(2): 757-61). Methods of targeting DNA double-strand breaks have been described for TALENs (Christian et al., 2010, Genetics 186(2): 757-61 and Boch et al., 2009, Science 326(5959): 1509-12), zinc finger nucleases (see e.g. Kim, et al., 1996, Proc. Nat'l Acad. Sci USA 93(3)1156-1160) and CRISPR-Cas endonucleases (see e.g. International Application Publication WO2007/025097).

Any DSB or -nick or -modification inducing agent may be used for the methods described herein, including for example but not limited to: Cas endonucleases, recombinases, TALENs, zinc finger nucleases, restriction endonucleases, meganucleases, and deaminases.

Methods and compositions are provided for polynucleotide modification with a CRISPR Associated (Cas) endonuclease. Class I Cas endonucleases comprise multi-subunit effector complexes (Types I, III, and IV), while Class 2 systems comprise single protein effectors (Types II, V, and VI) (Makarova et al., 2015, Nature Reviews Microbiology 13: 1-15; Zetsche et al., 2015, Cell 163: 1-13; Shmakov et al., 2015, Molecular Cell 60, 1-13; Haft et al., 2005, Computational Biology, PLoS Comput Biol (6): e60; and Koonin et al., 2017, Curr Opinion Microbiology 37: 67-78). In Class 2 Type II systems, the Cas endonuclease acts in complex with a guide RNA (gRNA) that directs the Cas endonuclease to cleave the DNA target to enable target recognition, binding, and cleavage by the Cas endonuclease. The gRNA comprises a Cas endonuclease recognition (CER) domain that interacts with the Cas endonuclease, and a Variable Targeting (VT) domain that hybridizes to a nucleotide sequence in a target DNA. In some aspects, the gRNA comprises a CRISPR RNA (crRNA) and a trans-activating CRISPR RNA (tracrRNA) to guide the Cas endonuclease to its DNA target. The crRNA comprises a spacer region complementary to one strand of the double strand DNA target and a region that base pairs with the tracrRNA, forming an RNA duplex. In many systems, the Cas endonuclease-guide polynucleotide complex recognizes a short nucleotide sequence adjacent to the target sequence (protospacer), called a “protospacer adjacent motif” (PAM).

Examples of a Cas endonuclease include but are not limited to Cas9 and Cpf1. Cas9 (formerly referred to as Cas5, Csn1, or Csx12) is a Class 2 Type II Cas endonuclease (Makarova et al., 2015, Nature Reviews Microbiology 13: 1-15). A Cas9-gRNA complex recognizes a 3′ PAM sequence (NGG for the S. pyogenes Cas9) at the target site, permitting the spacer of the guide RNA to invade the double-stranded DNA target, and, if sufficient homology between the spacer and protospacer exists, generate a DSB cleavage. Cas9 endonucleases comprise RuvC and HNH domains that together produce DSBs, and separately can produce single strand breaks. For the S. pyogenes Cas9 endonuclease, the DSB leaves a blunt end. Cpf1 is a Class 2 Type V Cas endonuclease, and comprises nuclease RuvC domain but lacks an HNH domain (Yamane et al., 2016, Cell 165: 949-962). Cpf1 endonucleases create “sticky” overhang ends.

Some uses for Cas9-gRNA systems at a genomic target site include but are not limited to insertions, deletions, substitutions, or modifications of one or more nucleotides at the target site; modifying or replacing nucleotide sequences of interest (such as a regulatory elements); insertion of polynucleotides of interest; gene dropout; gene knock-out; gene knock in; modification of splicing sites and/or introducing alternate splicing sites; modifications of nucleotide sequences encoding a protein of interest; amino acid and/or protein fusions; and gene silencing by expressing an inverted repeat into a gene of interest. Genome editing using DSB-inducing agents, such as Cas9-gRNA complexes, has been described, for example in U.S. Patent Application US 2015-0082478 A1, published on March 19, 2015, International Application Publication WO2015/026886 A1, published on Feb. 26, 2015, WO2016007347, published on Jan. 14, 2016, and International Application Publication WO201625131, published on Feb. 18, 2016, all of which are incorporated by reference herein.

In some aspects of the disclosure, a targeted genomic modification is introduced in a B. napus plant cell, wherein the targeted modification includes excising endogenous genomic sequence of an INDEHISCENT (BnIND) gene, ALCATRAZ (BnALC), or POLYGALACTURONASE (BnPGAZ) in a B. napus plant cell. In a further aspect, the targeted genomic modification comprises first and second double strand breaks induced by a CRISPR-associated nuclease, Cas9. Cas9 is introduced into the B. napus cell with a first and second guide RNAs as Cas9-gRNA complexes that recognizes target sequences in the genome of the B. napus cell and is able to induce DSBs in the genomic sequence. In an aspect, the DSBs flank the endogenous target gene BnIND, BnALC, or BnPGAZ, allowing for the excision of the target gene.

IV. Recombinant Constructs and Transformation of Cells

The disclosed guide polynucleotides can be introduced into a cell with the disclosed CRISPR-Cas endonucleases. Cells include, but are not limited to, human, non-human, animal, bacterial, fungal, insect, yeast, non-conventional yeast, and plant cells as well as plants and seeds produced by the methods described herein. In a preferred aspect of the disclosure, the cells are B. napus cells.

Standard recombinant DNA and molecular cloning techniques used herein are well known in the art and are described more fully in Sambrook et al., Molecular Cloning: A Laboratory Manual; Cold Spring Harbor Laboratory: Cold Spring Harbor, N.Y. (1989). Transformation methods are well known to those skilled in the art and are described infra.

Vectors and constructs include circular plasmids, and linear polynucleotides, comprising a polynucleotide of interest and optionally other components including linkers, adapters, regulatory or analysis. In some examples a recognition site and/or target site can be comprised within an intron, coding sequence, 5′ UTRs, 3′ UTRs, and/or regulatory regions.

In one aspect, the constructs of the disclosure comprise a promoter operably linked to a nucleotide sequence encoding a Streptococcus pyrogenes Cas9 gene and a promoter operably linked to a guide RNA of the present disclosure. The promoter is capable of driving expression of an operably linked nucleotide sequence in a prokaryotic or eukaryotic cell/organism. In some aspects, target specific guide RNAs are built as a fusion of CRISPR RNA (crRNA) fused to trans-activating CRISPR RNA (tracrRNA) of Streptococcus pyrogenes.

In accordance with the methods disclosed herein, a first guide RNA comprising SEQ ID NO:26 and a second guide RNA comprising SEQ ID NO:27 can be used to catalyze targeted deletion of endogenous genomic BnIND sequence in the B. napus plant cell; a first guide RNA comprising SEQ ID NO:31 or SEQ ID NO:35 and a second guide RNA comprising SEQ ID NO:32 can be used to catalyze targeted deletion of endogenous genomic BnALC sequence in the B. napus plant cell; ; a first guide RNA comprising SEQ ID NO:33 and a second guide RNA comprising SEQ ID NO:34 can be used to catalyze targeted deletion of endogenous genomic BnALC sequence in the B. napus plant cell; and a first guide RNA comprising SEQ ID NO:28 or 30 and a second guide RNA comprising SEQ ID NO:29 can be used to catalyze targeted deletion of endogenous genomic BnPGAZ sequence in the B. napus plant cell.

The polynucleotides, constructs and vectors disclosed herein (e.g., for expression of endonucleases or guide RNAs) can comprise a selectable marker to identify or select for or against a molecule or a cell that comprises the construct or vector. Examples of selectable markers that can be used in a construct or vector disclosed herein include DsRed and Glyphosate N-Acetyltransferase (GAT) gene variant 4621 for herbicide resistance.

IV. Plant Transformation

Any of the techniques known in the art for introduction of transgenes into plants may be used to produce a transformed plant or plant cell disclosed herein. Suitable methods for transformation of plants are believed to include virtually any method by which DNA can be introduced into a cell, such as: by electroporation as illustrated in U.S. Pat. No. 5,384,253; by microprojectile bombardment, as illustrated in U.S. Pat. Nos. 5,015,580, 5,550,318, 5,538,880, 6,160,208, 6,399,861, and 6,403,865; by Agrobacterium-mediated transformation as illustrated in U.S. Pat. Nos. 5,635,055, 5,824,877, 5,591, 616; 5,981,840, and 6,384,301; and by protoplast transformation, as set forth in U.S. Pat. No. 5,508,184, etc. These techniques can be used to transform plant cells and these cells may be developed into transgenic plants by techniques known to those of skill in the art. Techniques for transforming Brassica plants in particular are disclosed, for example, in U.S. Pat. No. 5,750,871.

After effecting delivery of exogenous DNA to recipient cells, transformed cells are identified for further culturing and plant regeneration. In order to improve the ability to identify transformants, one may desire to employ a selectable marker gene with the transformation vector used to generate the transformant. In this case, the potentially transformed cell population can be assayed by exposing the cells to a selective agent or agents, or the cells can be screened for the desired marker.

Cells that survive the exposure to the selective agent, or cells that have been scored positive in a screening assay, may be cultured in media that supports regeneration of plants. In some embodiments, any suitable plant tissue culture media (e.g., MS and N6 media) may be modified by including further substances, such as growth regulators. Tissue may be maintained on a basic media with growth regulators until sufficient tissue is available to begin plant regeneration efforts, or following repeated rounds of manual selection, until the morphology of the tissue is suitable for regeneration (e.g., at least 2 weeks), then transferred to media conducive to shoot formation. Cultures are transferred periodically until sufficient shoot formation has occurred. Once shoots are formed, they are transferred to media conducive to root formation. Once sufficient roots are formed, plants can be transferred to soil for further growth and maturity.

The excision of an endogenous gene (e.g., BnIND, BnALC, or BnPGAZ) in regenerating plants can be confirmed by one or more assays, for example, a molecular biological assay, such as Southern blotting, Northern blotting, or PCR; a biochemical assay, such as detecting the absence of a protein product by immunoassay (ELISA or Western blot) or by screening for reduced enzymatic function; plant part assays, such as leaf or root assays; and analysis of the phenotype of the whole regenerated plant. In aspects of the disclosure, KASPAR™ and TAQMAN™ assays are provided to determine the zygosity of endogenous genes BnIND, BnALC, or BnPGAZ in the regenerating plants.

Using the methods disclosed herein, BnIND, BnALC, or BnPGAZ dropout variant plants are generated. For example, a dropout variant plant comprise excised endogenous genomic sequence of at least one allele of the BnIND-A gene (SEQ ID NO:105, 106, 107), BnIND-C gene (SEQ ID No:108), or combinations thereof; at least one allele of the BnALC-A gene (SEQ ID No:120), BnALC-C gene (SEQ ID No:121), or combinations thereof; or at least one allele of BnPGAZ-A gene (SEQ ID No:112), BnPGAZ-C gene (SEQ ID No:116), or combinations thereof. In a further aspect, the modified B. napus plant comprises one, two, three or four excised alleles of the BnIND gene; one, two, three or four excised alleles of the BnALC gene; or one, two, three or four excised alleles of the BnPGAZ gene. In a preferred aspect, the modified B. napus plant comprises three or four excised alleles of the BnIND gene; three or four excised alleles of the BnALC gene; or three or four excised alleles of the BnPGAZ gene.

V. Cultivation and Use of Transgenic Plants

A plant exhibiting a targeted genomic modification according to the present invention may have one or more desirable traits. Such traits can include, for example: resistance to insects and other pests and disease causing agents; tolerances to herbicides; enhanced stability, yield, or shelf-life; environmental tolerances; pharmaceutical production; industrial product production; and nutritional enhancements. The desirable traits may be the result of the excision of endogenous genomic sequence or gene through the introduction of a CRISPR-associated nuclease and guide RNAs that flank the endogenous genomic sequence or gene. The elimination of the endogenous genomic sequence or gene results in a desirable trait which can then be introgressed to other plants or inherited by subsequent generations of the plant.

Thus, in one aspect, the desired trait can be due to the excision of endogenous genomic sequence or gene in the plant. In an additional aspect, the desirable trait can be obtained through conventional breeding, which trait may be developed by a CRISPR-Cas9 based gene editing approach by creating gene dropout mutants for one or more endogenous genes. In an aspect, the desirable trait is increased pod shatter tolerance. In an additional aspect, the one or more endogenous genes are involved in fruit dehiscence and comprise BnIND, BnALC, or BnPGAZ or combinations thereof.

Plants exhibiting endogenous genomic sequence or gene excision according to the invention may be used or cultivated in any manner, wherein transmission of the excised nucleic acid sequence to other plants is undesirable. Accordingly, modified plants that have been engineered to, inter alia, have one or more desired traits, may be transformed with nucleic acid molecules according to the invention, and cropped and cultivated by any method known to those of skill in the art.

Several methods of mechanical testing of pod shatter are described in the art including the cantilever test (Kadkol et al. 1984. Euphytica, 33, 61-71) and the pendulum method (Liu et al. 1994. Journal of Texture Studies, 25, 179-189). Additionally, the Examples provided in this disclosure describe laboratory testing and field testing methods that can be used to identify and quantify pod shatter tolerance phenotype.

Disclosed herein is a method to evaluate pod shatter tolerance in a laboratory. This method for laboratory phenotyping pod shatter tolerance includes adding closed pods to a container, adding ball bearings to the container and shaking the container with a mechanical shaker.

Also provided herein is a method to measure shatter tolerance in the field that includes growing plants in a replicated field trial; introducing a shatter inducing treatment to the plants. Shatter treatment includes the application of wind at average speeds of from 100 km/h to 200 km/h, 100 km/h to 150 km/h, or 120 km/h to 140 km/h. In particular examples, wind speed can average approximately 100 km/h, 105 km/h, 110 km/h, 115 km/h, 120 km/h, 125 km/h, 130, km/h or 135 km/h. In other examples, wind speed can average approximately 140 km/h, 145 km/h, 150 km/h, 155 km/h, 160 km/h, 165 km/h, 170 km/h, 175km/h, 180, km/h 185 km/h, 190 km/h, 195 km/h, or 200 km/h. Applied wind can be generated using a blower mounted in front of a tractor; applying the treatment 12 times at a tractor speed of —5 km/h; varying the wind angle compared to planted rows from perpendicular to oblique; and allowing natural additional shatter pressure for an additional two weeks where pod integrity is challenged due to weather related events such as moisture, rain, dryness, temperature and natural wind.

Shatter tolerance can be assessed based on the condition of pods following treatment which can be half-shattered, fully shattered, or unshattered, as defined herein. For laboratory phenotyping, “percent shattered pods” or “SHTPC” is the number of fully shattered +half shattered pods/total number of pods*100. For field phenotyping, “half shattered” pods are not counted, so “percent shattered pods” or “SHTPC” is the number of fully shattered/total number of pods*100. SHTPC is compared to the wildtype after the shatter inducing treatment.

The following are examples of specific embodiments of some aspects of the invention. The examples are offered for illustrative purposes only and are not intended to limit the scope of the invention in any way.

EXAMPLES

Example 1: Constructs and Guide RNA Selection for Genome Editing of Arabidopsis IND and ALC

The first approach to improving shatter tolerance through gene editing relies on creating dropouts of INDEHISCENT (IND) and ALCATRAZ (ALC), two genes known to be involved in pod shatter. However, all Arabidopsis and Brassica mutants have either been generated by Ethyl Methane Sulfonate (EMS) mutagenesis and consist in frameshifts occurring in the genes coding sequences, or have been generated through single guide gene editing (Rajani and Sundaresan, 2001; Liljegren et al., 2004; Braatz et al., 2017; Braatz et al., 2018; Braatz et al., 2018). It is therefore unknown that complete deletion of the IND and ALC genes would result in improved pod shatter tolerance. To test this hypothesis in Arabidopsis, plants with a dropout of the AtIND genomic region were created.

Arabidopsis INDEHISCENT (AtIND) GenBank locus ID is AT4G00120 (SEQ ID NO:36). The AtIND gene is localized on Chr4: (40000 . . . 45000).

CRISPR-Plant and a suitable guide RNA identification program was used to identify guides that were in the 40000-41804 bp and 42400-45000 bp regions of chromosome 4. (Xie et al. 2014. Molecular Plant. 7(5): 923-6). Guide RNAs and position of primers are shown in Table 3 and FIG. 1.

TABLE 3
Guide RNA (first 
SEQ ID base changed to G 
NO: Guide name Pair# when something else)
37 AT-IND-CR8 3 GCCCATGGATAAATGTGCCT
38 AT-IND-CR6 2 GTCCAAACTGTCTACACCGA
39 AT-IND-CR2 1 GTGAAGCAGGGTCGACCTTT
40 AT-IND-CR3 1 GGGGAATCAGTATATTAGCT
41 AT-IND-CR5 2 GGATTGACTGTCTAATTGGG
42 AT-IND-CR7 3 GCTGATTAAATTGTTCATGC

Sequences for expressing gRNAs were built into three constructs with the following gRNA combinations: AT-IND-CR2-CR3, AT-IND-CR5-CR6, and AT-IND-CR7-CR8. The guide RNA sequences were subcloned into proprietary vectors and cloned using Invitrogen Gateway technology (Thermo Fisher Scientific, Waltham, MA) in a specially designed vector that contained a GM-GY1 PRO:DS-RED:UBQ3TERM cassette for seed sorting and a NOS PRO:BAR:NOSterm cassette for herbicide selection. Constructs were transformed in GV3101 Agrobacterium.

The same approach was followed for Arabidopsis ALCATRAZ (AtALC), corresponding to GenBank locus ID AT5G67110 (SEQ ID NO:43). The AtALC gene is localized at Chr5: 26780000: :26791000. Selected AtALC guide RNAs are shown in Table 4 and placement is shown in FIG. 2. Constructs were made for each of the following gRNA combinations: AT-ALC-CR1-CR2, AT-ALC-CR3-CR6, AT-ALC-CR5-CR4, AT-ALC-CR4-CR7, and AT-ALC-CR2-CR8. These guide RNAs were expressed from constructs to induce excisions of the genomic region containing AtALC and/or its promoter and thereby create AtALC dropouts. Because the ICU2 gene runs into the 3′ UTR of AtALC, several of the guide RNAs (AT-ALC-CR1 through AT-ALC-CR6) clip the ICU2 gene. Consequently, sequences encoding guides AT-ALC-CR7-CR8 were designed to target the AtALC promoter chr5:26786433-26787809. The cloning strategy described herein to create AtIND constructs was also used to create AtALC constructs.

TABLE 4
Guide RNA sequence 
SEQ ID (first base changed to 
NO: G when required) Guide name Pair#
44 GTCTCTGTGCCCTGGCTCCC AT-ALC-CR1 1
45 GCCAGCCTACGCTGGTGGAC AT-ALC-CR3 2
46 GAGACCGGTGTGCTTATGGA AT-ALC-CR5 3
47 GCGTTCTTCAGAGAAGCGCG AT-ALC-CR6 2
48 GGACACCAGATTCTGTCTAT AT-ALC-CR2 1
49 GTCTTCAGAGAAGCGCGTGG AT-ALC-CR4 3
50 GTGAAATCCAACGAGATAAA AT-ALC-CR7 1
51 GAACTTGCCATCTAAATAAA AT-ALC-CR8 2

This example demonstrates the selection of guide RNAs targeting the AtIND and AtALC genes, the production of constructs for transformation incorporating the gRNA pairs.

Example 2: Selection of T1 Seeds and Germination Rates

Constructs for AtIND and AtALC dropouts described in Example 1 were transformed in Arabidopsis Columbia-0 using a floral dip protocol described in Clough and Bent, 1998, The plant journal, 16(6), 735-743. Seeds of primary transformants were harvested and the presence of transgenic seeds for each construct identified by visualizing under red fluorescence filter. On average, more red seeds were observed for the AtIND-related constructs than for the AtALC-related constructs. Some DsRed positive seeds of AtALC-related constructs appeared shriveled at the base in the chalazal region.

Approximately 100 DsRed positive seeds for IND93017 (AT-IND-CR2-CR3) and ALC93022 (AT-ALC-CR5-CR4) were selected and planted in 36-pot flats. Flats were left at 4° C. for 3 days and plants were grown in a growth chamber using a diurnal program with 16 hours light, 23° C., 55% relative humidity (RH), 8 hours dark, 20° C., 55% RH.

Germination rate of IND93017 was 76.4%, while the germination rate of ALC93022 was significantly lower at 18.5%. In addition, 15 (out of 20 total) ALC93022 plants displayed a normal phenotype; and the other 5 plants showed a clearly abnormal phenotype of stunted plants and shriveled leaves. All IND93017 plants looked phenotypically like wild-types. The AtALC phenotype is likely due to the proximity and disruption of the ICU2 gene.

This example demonstrates the successful transformation of AtIND and AtALC dropout constructs and successful germination of resultant T1 seeds.

Example 3: Genotyping of IND93017 and ALC93022 T1 Plants

Genomic DNA of T1 plants was extracted using GENEJET Plant Genomic DNA purification kit (Thermo Fisher Scientific, Waltham, MA). PCR amplification of RNA guide pairs was carried out with 50 ng template DNA, 10 μM each forward and reverse primers, and 2× PHUSION Master Mix (New England BioLabs Inc., Ipswich, Mass.) and a profile of 30 seconds initial denaturation at 98° C., followed by 35 cycles of 98° C. for 10 seconds, 60° C. for 20 seconds and 72° C. for 30 seconds, and ending with a final extension of 72° C. for 5 minutes. For full locus amplification, the same PCR mix and amplification profile were used, except primer extension was at 72° C. for 3 min instead of 30 seconds. Genotyping of the IND93017 T1 plants was performed using primers IND-3,5,7_F-Pair#1(SEQ ID NO:52) and IND-2,6,8_R-Pair#1 (SEQ ID NO:53) and results are shown in Table 5.

TABLE 5
Description Number %
Plants with data 89 100
Plants with a detectable dropout 42 47.2
(candidate het and homo)
Plants with candidate homozygous dropout 16 18.0
Plant with candidate het dropout 26 29.2
Plants with WT 47 52.8

ALC93022 T1 plants with normal phenotypes were genotyped as described above using ALC-1,2_F-Pair#1 (SEQ ID NO:54) and ALC-2,4,6_R-Pair#1 (SEQ ID NO:55) primers. None of the T1 plants with normal phenotypes had a detectable dropout when genotyped.

Example 4: Genotyping and Phenotyping of IND93017 AtIND Dropouts

The progeny of 3 candidate homozygous dropout T1 plants 1, 71, and 85 were planted and genotyped. All plants corresponding to variants 1 and 85 appeared to have inherited the dropout mutation. None of the WT plants have the dropout mutation. The progeny of variant 71 had both detected dropout and WT bands and was not carried over for phenotyping.

A total of 32 plants corresponding to the progeny of TO dropout variants 1 and 85 and a set of wildtype Col-0 plants were phenotyped using a GENO/GRINDER (SPEX® SamplePrep, Metuchen, N.J.) with 10 siliques per vial and two reps per plants. Initial shaking conditions were 750 rpm for 15 seconds, then 850 rpm for 30 seconds, and then used 1500 rpm for 30 seconds. The phenotype was recorded as fully shattered pods (both valves detached from the replum and seeds dispersed), half shattered (one valve detached from the replum and half seeds dispersed) or unshattered pods (both valves attached and containing seeds).

Increasing rpm and time conditions increased the shattering of wildtype plants reaching 100% at 1500 rpm for 30 seconds. All AtIND dropout variant 1 plants were shatter tolerant compared to wildtype plants with only 3 siliques shattered out of 240 tested (1.25%) at 1500 rpm for 30 seconds. The broken mutant siliques were broken in half horizontally with both valves still attached but seeds were fully out of the siliques. The progeny of dropout variant 85 appeared to still be segregating for the mutation. Eleven plants were shatter tolerant while 7 were shatter susceptible compared to wildtype plants.

This example shows that AtIND dropout variant plants having an indehiscent phenotype were successfully created in Brassicaceae species Arabidopsis thaliana.

Example 5: Constructs and Guide RNAs for Genome Editing of Brassica napus IND Via Microspore Bombardment

The gene editing dropout approach described above for Arabidopsis was adapted and evaluated to determine if it could improve shatter tolerance in B. napus. Constructs were designed to create dropouts of IND, ALC, and polygalacturonase expressed in abscission zone (POLYGALACTURONASE; PGAZ) in proprietary Brassica napus germplasm.

Gene edits were created in Brassica napus IND-A and IND-C genomes (BnIND-A, SEQ ID NO:56 and BnIND-C, SEQ ID NO:57) in B. napus line NS1822BC. Microspore bombardment of linearized plasmids was used. One linearized plasmid vector contained the selectable marker Glyphosate N-Acetyltransferase (GAT) gene variant 4621 for herbicide resistance, a separate vector was used to express Streptococcus pyrogenes Cas 9, and a third vector was used to deliver expression of BnIND target specific guide RNAs. Guide RNAs were built as a fusion of CRISPR RNA (crRNA) BNA-IND-CR1 (SEQ ID NO:26) and BNA-IND-CR2 (SEQ ID NO:27), each was fused to trans-activating CRISPR RNA (tracrRNA) of Streptococcus pyrogenes. BNA-IND-CR1 and BNA-IND-CR2 were designed to target both BnIND-A and BnIND-C genes in NS1822BC as shown in FIG. 3. Method of transforming B. napus microspores for genome editing are described in PCT/US2019/34531, filed May 30, 2019 which is incorporated herein by reference in its entirety.

After microspore bombardment and regeneration, transgenic plants were screened for the presence of genomic dropouts through sequencing PCR amplicons. Forward primer IND_CR1-FP, TTGTCAAAAAGAGGAGAGAGAGG (SEQ ID NO:142) and reverse primer IND_CR1-RP, GAAAGATCAAGAACACAGGA (SEQ ID NO:143) flanking the IND-CR1 cut site and forward primer IND CR2-FP, CGACCAAAAATATGAAATACT (SEQ ID NO:144) and reverse primer IND_CR2-RP, GCTACGGCTAACACACATACG (SEQ ID NO:145) flanking the IND-CR2 site as shown in FIG. 3 were designed for amplification. Both site specific assays and a spanning assay (IND-CR1-FP/IND-CR2-RP) were used. Amplicon reads were differentially assigned to the A and C genomes because of single nucleotide differences in the BnIND-A and BnIND-C predicted amplicon sequences.

Transgenic plants with detected dropouts were backcrossed to wildtype NS1822BC plants. T1 plants were screened for the presence of dropouts (2,607 bp deletion for BnIND-A and 2,426 bp deletion for BnIND-C) and plants showing a deletion were selfed to create homozygous dropouts. T2 plants homozygous for BnIND-A or BnIND-C dropouts without plasmid components were identified using Southern by Sequencing (SbS) and selfed to create T3 homozygous seeds. One NS1822BC BnIND-A dropout variant (SEQ ID NO:58) and two NS1822BC BnIND-C dropout variants (SEQ ID NO:59) were created.

This example describes the construction of guide RNAs and plasmid vectors used to produce BnIND-A and BnIND-C dropout plants via microparticle bombardment; and their confirmation by molecular analysis of targeted dropouts in B. napus T1 and T2 plants.

Example 6: Development of TAQMAN™ Molecular Assays for NS1822BC IND-A and IND-C Dropouts

TAQMAN™ assays were developed for use as molecular markers to track the BnIND-A and BnIND-C1 and BnIND-C4 (BnIND-C1 and BnIND-C4 are the same dropout obtain from different events). TAQMAN™ markers can be used to track individual dropouts and zygosity. TAQMAN™ primer and probe for each loci (BnIND-A and BnIND-C) are shown in Table 6.

TABLE 6
SEQ ID
NO: Oligo Name Sequence
81 NS1822BC_C75 IND-C FAMProbe TCTCTTTCCTTCTTCATC
82 NS1822BC_C75 IND-C VICProbe CTTGGTTCTAGAAGCATAA
83 NS1822BC_C75 IND-C FP AAAATGGAGACATGTGTTGAGTAACTA
84 NS1822BC_C75 IND-C RP TTTGGACTAATGCCCAACTGA
85 NS1822BC_C75 IND-C FP2 TGATATCATCACCAAAGTGCAA
86 NS1822BC_C75 IND-C RP2 CAAAATCATGGTTACTCAAAAAGC
87 NS1822BC_C7B IND-C FAMProbe TCTCTTTCCTTCTTCATC
88 NS1822BC_C7B IND-C VICProbe CTTGGTTCTAGAAGCATAA
89 NS1822BC_C7B IND-C FP AAAATGGAGACATGTGTTGAGTAACTA
90 NS1822BC_C7B IND-C RP TGGACTAATGCCCAACTGATT
91 NS1822BC_C7B IND-C FP2 TGATATCATCACCAAAGTGCAA
92 NS1822BC_C7B IND-C RP2 CAAAATCATGGTTACTCAAAAAGC
93 NS1822BC_C7M IND-A FAMProbe CTTATTCCAGACATTTG
94 NS1822BC_C7M IND-A VICProbe CTTGGTTCAGAAGCA
95 NS1822BC_C7M IND-A FP AAAATGGAGACATGTGTTGAGTAACTA
96 NS1822BC_C7M IND-A RP CTTCATTGTTTCATTGTTTCAGTAGC
97 NS1822BC_C7M IND-A FP2 TGGATATAACATATGAATCGGATAAGTG
98 NS1822BC_C7M IND-A RP2 TTAGAGAAAGGCTTGGTTCTCC
99 NS1822BC_C7N IND-A FAMProbe CTTATTCCAGACATTTG
100  NS1822BC_C7N IND-A VICProbe CTTGGTTCAGAAGCA
101  NS1822BC_C7N IND-A FP AAAATGGAGACATGTGTTGAGTAACTA
102  NS1822BC_C7N IND-A RP CTTCATTGTTTCATTGTTTCAGTAGC
103  NS1822BC_C7N IND-A FP2 GGATATAACATATGAATCGGATAAGTGT
104  NS1822BC_C7N IND-A RP2 TTAGAGAAAGGCTTGGTTCTCC

Example 7: Genome Editing of Brassica napus IND via Agrobacterium Transformation

BnIND-C dropout variants were created in B. napus lines G00010BC and G00555MC using an Agrobacterium transformation method based on Moloney et al. (1989) Plant Cell Reports 8: 238-242. Lines were transformed with a vector for expression of tracrRNAs containing BNA-IND-CR1 (SEQ ID NO:26) and BNA-IND-CR2 (SEQ ID NO:27) crRNAs. The presence and nature of the deletion as well as absence of transformation vector components was determined using SbS. No BnIND-A dropouts were identified in G00010BC because, as later discovered through whole genome sequencing, a region of —240-300kb is missing from chromosome 3A in this inbred. The map of the G00010BC BnIND-C locus and G00555MC BnIND-A and BnIND-C loci are shown in FIG. 4 and FIG. 5, respectively. Sequences of wildtype G00010BC BnIND-C (SEQ ID NO:67), wildtype G00555MC BnIND-A (SEQ ID NO:69), and wildtype BnIND-C (SEQ ID NO:70) are provided.

TO transformants were characterized at the molecular level for the presence of BnIND-A orBnIND-C dropouts using NextGen sequencing of PCR amplicons generated from genomic DNA of candidate dropout plants using primers having sequence provided in SEQ ID NOs:75, 76, 77, and 78, respectively. A G00010BC IND-C dropout (SEQ ID NO:68) was identified. The progeny of selected plants was grown for further analysis. A T1 transgene positive G00555MC plants with a heritable dropout was identified. The plant was found to be heterozygous for a BnIND-A dropout (SEQ ID NO:75) and wildtype for the BnIND-C locus. The progeny of this plant was used to segregate the transgene and obtain BnIND-A G00555MC transgene free homozygous dropout and wildtype segregant plants.

The transgene that was still active in the T1 G00555MC plant heterozygous for a BnIND-A dropout and wildtype for the BnIND-C locus, still expressed guide RNAs and Cas9 in the germline and provided a possibility to generate and detect an BnIND-C dropout event in further progeny. Two plants (of 512 total G00555MC T2 plants analyzed) were found to be positive for an BnIND-C dropout (SEQ ID NO:76) and wildtype for the BnIND-A locus.

These plants were backcrossed to wildtype parental lines in order to segregate T-DNA from the dropout allele. They were also crossed to transgene-free G00555MC plants homozygous dropouts for the BnIND-A to create transgene free homozygous double BnIND-A/C dropout plants, which can be used as males to create hybrids.

This example demonstrates the production of BnIND-A/C dropout plants, which were confirmed through molecular characterization.

Example 8: Discovery and Validation of a Natural Deletion Harboring INDEHISCENT Gene (IND-A) in G00010BC

An investigation of the inability to generate BnIND-A dropouts in G00010BC revealed a natural deletion in the INDEHISCENT gene on chromosome 3A (IndA).

Whole genome sequence was performed and the two main homoeologous copies of INDEHISCENT genes from chromosomes N03 (BnIND-A; BnaA03g27180D) and N13 (BnIND-C; BnaC03g32180D) were compared to five references genomes using the Basic Local Alignment Search Tool (BLAST™) algorithm available from the National Center for Biotechnology Information (NCBI). Altschul et al. (1990) J. Mol. Biol. 215: 403-10). The five reference genomes were DH12075 (public spring canola), Darmor (public winter canola), and three high quality third generation proprietary spring canola lines (NS1822BC, G00010BC, and G00055MC). Orthologous matches for both genes were found in all genomes, except for BnIND-A in G00010BC. Comparative global sequence alignment of an extended genomic region surrounding BnIND-A revealed a large segmental deletion in the G00010BC genome. The deletion is from 229 — 307 kb in length, depending on reference genome used for alignment. The physical starting and ending position of the BnIND-A deletion segment, as determined by alignment to each reference genome, is shown in Table 7.

TABLE 7
Genome Start Position End Position Length (bp)
NS1822BC 14,710,075 14,958,191 248,116
DH12075_v1.1 14,449,859 14,690,232 240,373
Darmor_v4.1.1 13,306,888 13,535,922 229,034
G0055MC 14,915,907 15,223,431 307,524
G00010BC 14,989,780 14,989,781 (deletion breakpoint)

Example 9: Molecular Assays to Detect the BnIND-A Natural Deletion in G00010BC

The G00010BC and wildtype reference N3 sequences were used to develop molecular assays to detect the presence or absence of native BnIND-A deleted segment as well as sequences flanking the breakpoint site of the deletion.

KASPAR™ assay comprised of four primers was developed using an assay design algorithm available as Kraken™ (LGC Genomics, Hoddesdon, Hertfordshire, UK). Initially, BnIND-A gene sequence on N03 was compared to the homoeologous BnIND-C gene on N13 to identify unique polymorphisms. Potential primer sequence targets were then identified to detect the wildtype and natural deletion states of BnIND-A. To detect the natural deletion, allele-specific, fluorescently tagged forward primer and common reverse primers flanking the breakpoint were designed as shown in FIG. 6 (N03 Deletion). To detect the wildtype state, a different fluorescently tagged forward primer and reverse primer were designed to hybridize within the native deletion segment sequence as shown in FIG. 6 (N03 WT). The primer sequences shown in Table 8 were used in a four primer, co-dominant composite marker KASPAR™ assay to detect the presence or absence of BnIND-A deletion segment.

TABLE 8
SEQ ID NO: Oligo Name Description
131 IND_A_001_F001 WT Forward Primer
132 IND_A_001_R001 WT Reverse Primer
133 BP_F003 Mutant Forward Primer
134 BP_R003 Mutant Reverse Primer

The KASPAR™ assay mixture was composed of 12 μl of 100 mM of each forward primer and 30 μl of 100 mM of each reverse primer. 13.6 μl of this mixture was combined with 1000 μl of KASP Master Mix™ (LGC Genomics, Hoddesdon, Hertfordshire, UK). A Meridian™ (LGC Genomics) liquid handler dispensed 1.3 μl of the mix onto a 1536 plate containing ˜6 ng of dried DNA. The plate was sealed with a Phusion™ laser sealer (LGC Genomics) and thermocycled using a Hydrocycler™ (LGC Genomics) under the following conditions: 95° C. for 15 minutes (min), 10 cycles of 95° C. for 20 seconds (sec), 61° C. stepped down to 55° C. for 1 min, 29 cycles of 95° C. for 20 sec, and 55° C. for 1 min. The excitation at wavelengths 485 (FAM) and 520 (VIC) was measured with a Pherastar™ plate reader (BMG Labtech, Offenburg, Germany). Values were normalized against the passive reference dye ROX (i.e., 5-(and-6)-Carboxy-X-rhodamine, succinimidyl ester), plotted and scored on scatterplots utilizing the Kraken™ software (LGC Genomics).

A variation on conventional TAQMAN™ end-point genotyping system was developed. Conventional TAQMAN™ assays use a forward and reverse primer and two fluorescent labeled probes. The TAQMAN™ variation developed to detect the presence or absence of the BnIND-A deletion segment is a compound assay that comprises two independent amplification reactions. The first reaction amplifies and detects wildtype gene sequence using forward and reverse primers capable of hybridizing to sequences that flank the 3′ breakpoint of the BnIND-A deletion segment in wildtype N03 chromosome as shown in FIG. 7 (N03 WT). Because the deletion segment is present in wild type N03 chromosome, the wildtype primers amplify sequence upstream the 3′ breakpoint and the amplified sequence is detected using a wild type probe. The second assay reaction detects the presence of BnIND-A deletion using a deletion forward primer that hybridizes upstream of the 5′ breakpoint and a deletion reverse primer that hybridizes downstream of the 3′ breakpoint of the deletion as shown in lower portion of FIG. 7 (N03 Deletion). When the deletion segment is missing, the second assay amplifies sequence containing both the joined 5′ breakpoint and 3′ breakpoint. By contrast the second assay will not amplify N03 genomic sequence that includes the deletion segment because the 5′ and 3′ breakpoints are too far apart to be amplified effectively under assay conditions. The primers and probes for both wildtype and deletion reactions (4 primers and two probes shown in Table 9) were combined and the reactions were run simultaneously.

TABLE 9
SEQ ID NO: Oligo Name Description
135 N101T11-F001 WT and mutant common F Primer
136 N101T11-R001 WT R Primer
137 N101T11-001-X001 WT Probe
138 N101T10-R001 Deletion R Primer
139 N101T10-001-X001 Deletion Probe

The combination TAQMAN™ assay included 13.6 μl of a primer probe mixture (18 μM of each probe, 4 μM of each primer) and 1000 μl of master mix from ToughMix™ kit (Quanta Beverly, Mass.). A liquid handler dispensed 1.3 μl of the mix onto a 1536 plate containing ˜6 ng of dried DNA. The plate was sealed with a laser sealer and thermocycled in a Hydrocycler device (LGC Genomic Limited, Middlesex, United Kingdom) under the following conditions: 94° C. for 15 min, 40 cycles of 94° C. for 30 secs, 60° C. for 1 min. PCR products are measured using at wavelengths 485 (FAM) and 520 (VIC) by a Pherastar™ plate reader (BMG Labtech, Offenburg, Germany). The values are normalized against ROX and plotted and scored on scatterplots utilizing the Kraken™ software. The combined TAQMAN™ produced the results of co-dominant assay and was capable of distinguishing and displaying sample clusters that were homozygous wildtype for BnIND-A, homozygous BnIND-A deletions, and hemizygous deletions (WT/of BnIND-A deletion)

This example describes the development of diagnostic assays for the detection of and introgression of the BnIND-A natural deletion disclosed herein.

Example 10: Description and Validation of Lab Phenotyping For Pod Shatter Tolerance

A laboratory assay was developed to evaluate the shatter resistance of pods subjected to mechanical agitation at specified speeds and times. GENO/GRINDER device (SPEX®SamplePrep, Metuchen, N.J.) was used to mechanically break canola pods and thereby assess shattering tolerance or susceptibility. Different speeds (rpm) and times were tested with intact pods from inbred NS1822BC grown in controlled environment growth chamber (Conviron, Winnipeg, Canada). Fully shattered pods (both valves detached from the replum and seeds dispersed), half shattered (one valve detached from the replum and half seeds dispersed) or unshattered pods (both valves attached and containing seeds) were measured. Fifteen pods were used for each data point. Results showed a linear relationship between the mechanical speed at which pods are agitated and the number of shattered (full+half shattered) pods (r2=0.944).

In another experiment, a group of 15 pods (ranging from 3 to 6 cm in length) for three different inbred lines, NS1822BC, G00010BC, and G00055MC grown in a controlled environment were tested. Results indicated a direct relationship between speed of mechanical agitation and pod shatter for the inbreds that were tested. Pods of all three inbreds were almost fully shattered at speed equal to or greater than 1200 rpm.

At 750 rpm, pod shattering of G00010BC was found to be significantly lower than the other two inbreds. These results show that, compared to the other two inbreds evaluated under the foregoing conditions, the native BnIND-A deletion line (G00010BC) provided an improved shatter tolerance phenotype.

A second laboratory assay phenotyping experiment was conducted using 5 to 6 plants of each the foregoing three genotypes. As described above, plants were grown in a growth chamber, and pods collected at maturity were phenotyped using the GENO/GRINDER assay (15 pods at 1000rpm for 30 sec). Percentage shattered pods was recorded for each assay repetition. The results shown in FIG. 8 demonstrated statistically significant differences (t-test: two-sample assuming unequal variances, p<0.01) between indicated genotypes. Pods collected from G00010BC were found to be on average significantly more shatter tolerant than pods collected from the other two genotypes. These results provide additional evidence that the presence of the IND-A natural deletion in G00010BC contributes to higher mechanical resistance and an improved shatter tolerance phenotype as compared to the other two genotypes tested.

This example describes a laboratory assay to induce pod shattering and evaluate pod shatter tolerance. Results of two studies using the assay showed increased shatter tolerance for G00010BC relative to lines NS1822BC and G00055MC and provided evidence that the natural BnIND-A deletion in G00010BC contributes to increased shatter tolerance.

Example 11: Laboratory Phenotyping of T2 BnIND-C Dropout and Wildtype Plants

Second generation T2 G00010BC BnIND-C homozygous dropout variant and wildtype plants were grown in controlled environment growth chambers (Conviron) under standard conditions. Pods were harvested at maturity after 2 weeks without water. Pods were left to acclimate in the laboratory at 23 ° C. for 5 days. Fifteen pods of similar sizes were harvested for 5 individual G00010BC homozygous dropout plants and 5 segregating wild-type plants. Pods from individual plants were placed in plastic boxes of 12×8.5×6.5 cm and mechanically agitated at 1700 rpm for 30 seconds using GENO/GRINDER device. After disruption, individual pods were scored according to half shattered, fully shattered, and unshattered phenotype. Total number of shattered pods was calculated as the sum of the half shattered and fully shattered pods. The average percentage of shattered pods for homozygous BnIND-C dropout variants was 0.00%, as compared to an average of 92.00% shattered pods for wildtype plants. Thus, non-functional gene deletion of the IND gene in the C genome produced a fully controlled genetic trait that can impart shatter tolerance in B. napus.

This example demonstrates the successful development of homozygous BnIND-C dropout variant in Brassica napus that show an indehiscent phenotype.

Example 12: Laboratory Phenotyping of T3 Heterozygous and Homozygous IND-C Dropout Plants

Sixty-four T3 seeds from two T2 G00010BC plants heterozygous for the BnIND-C dropout were planted and genotyped using a dropout specific PCR assay followed by NextGen sequencing (as described in Example 5). Plants that were homozygous (9), heterozygous (10), and wildtype (8) for the BnIND-C dropout were identified and grown to maturity in a growth chamber in 16 hour light (23° C.) (˜360 μE light intensity) and 8 hour dark (20° C.) regimen at ˜55% humidity. At maturity, plants were allowed to dry. Pods were harvested and phenotyped using the GENO/GRINDER laboratory assay at 1100 rpm for 15 seconds. For each replication using 15 intact pods, pods were visually inspected after the assay and classified according to fully shattered, half shattered or unshattered pod phenotype.

FIG. 9 shows shatter tolerance of G00010BC plants segregating for a BnIND-C dropout calculated as the average percentage of shattered pods from replicated assays. The number of knocked out alleles (KO) are indicated for each zygosity category, where 4 KO are homozygous for the BnIND-C dropout, 3 KO are heterozygous for the BnIND-C dropout, and 2 KO do not include any BnIND-C dropout alleles. Since G00010BC background has a native —300kb deletion on chromosome 3 including BnIND-A and therefore already 2 deleted alleles (or 2 knockouts and thus 2 KO). Plants heterozygous for the BnIND-C dropout have three deleted alleles (or 3 knockouts and thus 3 KO) and homozygous plants have four missing alleles (or 4 knockouts and thus 4 KO). B napus plants with 4 KO showed a strong shatter tolerant phenotype, and plants with 3 KO showed a significant reduction in the percentage of shattered pods compared to unmodified G00010BC plants (t-test, p<0.05).

This example shows that number of knocked out IND alleles correlated with pod shatter tolerance. Double knockout plants (all A and C alleles knocked out) showed higher shatter tolerance than plants with 3 knocked out alleles (2 KO for A and 1 KO for C).

Example 13: Description and Validation of Field Phenotyping For Pod Shatter Tolerance

Plants were grown in a replicated trial in Rockwood, Ontario, Canada. Plants in the field received a shatter-inducing treatment in the form of 135 km/h wind generated by a blower mounted in front of a tractor. The treatment was applied 12 times at a tractor speed of ˜5 km/h four months after planting. Wind angle compared to planted rows was varied from perpendicular to oblique for maximum effect. The trial saw additional shatter pressure for another two weeks after this shatter inducing treatment due to weather related events such as moisture, rain, dryness, temperature and natural wind. Percent shattered pods (SHTPC) was determined using visual evaluation of plants from 5 replications. Intensity of shatter pressure was evaluated using the following reference lines: 45H33 is a moderately susceptible check line; 45CM39 and 45M35 were used as shatter resistant checks. Results showed statistically significant separation between SHTPC of the most shatter susceptible hybrid 45H33 (60% shattered pods), and shatter tolerant HARVESTMAX hybrids 45M35 and 45CM39 (˜30% shattered pods). A statistically significant difference was also found between susceptible (wildtype G00555MC and G00182MC) and tolerant (N00644BC and NS7627MC) inbreds, both indicative of significant shatter pressure on the trial.

The foregoing provides a validated field method for phenotyping pod shatter under controlled conditions that induce pod shatter. The method successfully distinguished between shatter susceptible and shatter tolerant lines of B. napus plants.

Example 14: Lab Phenotyping of BnIND-C Dropout and Wildtype Plants Grown in the Field

Pods were collected at maturity from multiple plants grown in one of the six field replications described in Example 6 prior to the field shatter inducing treatment and phenotyped in the laboratory using the GENO/GRINDER assay.

Intact pods of similar sizes were collected from untransformed NS1822BC wildtype plants and gene edited plants having an BnIND-A and/or BnIND-C dropout at different zygosity levels. Percentage shattered pods after GENO/GRINDER assay (1000rpm, 15 sec.) are shown in FIG. 10.

NS1822BC plants with two dropout alleles (homozygous BnIND-A, homozygous BnIND-C1 or double heterozygous BnIND-A and BnIND-C1) showed statistically significant increases in shatter tolerance compared to wildtype plants. In this assay, plants with only one dropout allele (heterozygous BnIND-A or heterozygous BnIND-C1) did not show significant difference in pod mechanical resistance compared to wildtype untransformed control plants.

These results indicate that deletions of either BnIND-A (as shown by the natural BnIND-A deletion found in G00010BC) or BnIND-C can significantly contribute to the shatter tolerant phenotype of an B. napus plant (in this case inbred line NS1822BC).

Intact pods of similar sizes were collected from G00010BC plants having the native BnIND-A deletion disclosed herein and gene edited G00010BC plants that were homozygous or heterozygous for a BnIND-C dropout. The mechanical resistance of these pods was compared to that of a commercially released pod shatter tolerant (PST) line check, which is referenced herein as PST Check 1. Pods were shaken in the GENO/GRINDER at 1500 rpm for 15 sec and results are presented in FIG. 11. At this speed, only about 1% of PST Check 1 and G00010BC BnIND-C homozygous (4 KO) dropout pods shattered. Pods of G00010BC BnIND-C heterozygous plants (3K0) produced approximately 4% fewer shattered pods than wildtype controls, though this difference was not statistically significant (t-test, p<0.01) due to the GENO/GRINDER assay use of significantly higher forces than forces used in the field phenotyping assay described in Example 13. That is, because higher forces overcome the mechanical resistance in more pods of both G00010BC plants (2K0) and G00010BC plants with a heterozygous BnIND-C dropout (3K0), the GENO/GRINDER assay did not detect the significant difference in pod shatter tolerance that was observed with this material in the field phenotyping study (FIG. 13) or the lab assay study described in FIG. 9.

This example demonstrates that combining BnIND-A deletion with 2 dropout alleles improved pod shatter tolerance induced under high forces of the laboratory assay conditions. Mechanical resistance was substantially improved relative to a combination of the BnIND-A deletion with a single other dropout allele.

Example 15: Field Phenotyping of BnIND Dropout and Wildtype Plants

Plants in five of the six field replications described in Example 13 were subjected to pod shatter inducing treatment. Plant pods were scored in the field.

NS1822BC inbred plants having different number of BnIND dropout alleles were grown in the same field and scored for pod shatter phenotype. Results in FIG. 12 show that plants harboring one or two dropouts of BnIND-A and/or BnIND-C performed statistically better in the field than the wildtype control. Plants homozygous for a BnIND-A dropout (IND-A Hom) or a BnIND-C dropout (IND-C Hom) showed a statistically significant ˜65% reduction (t-test, p<0.01) in SHTPC scores compared to wildtype plants. Plants heterozygous for the BnIND-C or the BnIND-A dropout presented statistically significant reductions in SHTPC scores compared to wildtype of ˜60% and ˜40%, respectively. Double heterozygous BnIND-A and BnIND-C dropout plants (IND-A/C Het) also demonstrated significantly increased shatter tolerance.

Wildtype and inbred G00010BC plants with different BnIND-C gene-edited dropouts were grown in the same field and characterized. G00010BC plants homozygous for BnIND-A native deletion and heterozygous BnIND-C dropout have three loss of function IND alleles (3 KO). These 3KO plants had significantly reduced SHTPC scores compared to wildtype and G00010BC (2KO) following shatter inducing treatment in the field. SHTPC scores of heterozygous plants were reduced by 40% to 45% compared to wildtype controls (WT and WT untransformed) (FIG. 13). Plants homozygous for the BnIND-C dropout did not shatter confirming the strong shatter tolerance of BnIND-A and BnIND-C double homozygous knockout.

This example confirmed lab assay results and showed that deletions of BnIND-A and BnIND-C contributed to increased field-induced shatter tolerance in different B. napus lines.

Example 16: Laboratory Phenotyping of Hybrid Plants Having Different Allelic Combinations of BnIND Dropouts

G00555MC SbS green plants homozygous for the BnIND-A dropout were crossed to G00010BC plants homozygous for an BnIND-C dropout and wildtype G00010BC plants to create hybrid plants with different allelic combinations of dropout and wildtype alleles. A small amount of hybrid seed was generated to grow plants for laboratory assay pod phenotyping. Specific allelic combinations of BnIND dropout variants are shown in Table 10 (for hybrid genotypes: first letter designates the male parent allele, second letter the female parent allele; upper case letter designates wild-type allele, lower case indicates a gene-edited dropout allele, except for bold and underlined “a” which designates G00010BC BnIND-A natural deletion allele).

TABLE 10
G00555MC male parent G00010BC female parent Hybrid genotype
IND-A HO DO (aa/CC) IND-C HO DO (aa/cc) aa/Cc
IND-A HO DO (aa/CC) IND-C WT (aa/CC) aa/CC
IND-A WT (AA/CC) IND-C HO DO (aa/cc) Aa/Cc
IND-A WT (AA/CC) IND-C WT (aa/CC) Aa/CC

G00555MC×G00010BC hybrid plants and hybrid checks were grown in a growth chamber. 45H33 was used as a moderately susceptible hybrid for pod shatter check. Shatter resistant checks were HARVESTMAX Hybrids 45CM39 and 45M35. Four plants were grown for each entry except for 45CM39 for which only 3 plants were grown. Intact pods were collected from individual plants and GENO/GRINDER assays were conducted using 10- At 750 rpm, pod shattering of G00010BC was found 15 pods per assays as described in Example 11. Percentages of shattered pods were calculated. Pods from each hybrid ranged from 3 cm to 6 cm in size and hybrids showed comparable pod size distributions except for 45H33 which had a higher number of smaller pods on average. Results of the phenotyping experiment are presented in FIG. 14.

HARVESTMAX hybrids (45CM39 and 45M35) showed a ˜50% reduction in percent shattered pods compared to 45H33 in this assay. This is similar to the difference in SHPTPC observed in the field for these hybrids. Accordingly, these results indicate that the laboratory assay results are sufficiently predictive to identify and distinguish shatter tolerant plants (HARVESTMAX hybrids) from moderately shatter susceptible plants (45H33) in a manner that is consistent with their shatter tolerance performance in the field. Compare FIG. 9 and FIG. 13 for G00010BC and FIG. 10 and FIG. 12 for NS1822BC.

The results of this assay also showed that a G00055MC x G00010BC hybrid with three (3) dropout alleles in aa/Cc allelic combination produced shatter resistance comparable to the commercial HARVESTMAX hybrids, which have been bred for improved shatter tolerance using existing natural variation. This allelic combination introduced into a HARVESTMAX genetic background further contributes to shatter tolerance of these hybrids.

In order to study the contributions of unique BnIND-A and BnIND-C functional alleles in a G00555MC x G00010BC hybrid, seeds for new allelic combinations were created using crosses between G00555MC BnIND-C homozygous dropout plants and G00010BC BnIND-C homozygous dropout plants and controls (Table 11). For hybrid genotypes: first letter designates the male parent allele, second letter the female parent allele; upper case letter designates wild-type allele, lower case indicates a gene-edited dropout allele, except for bold and underlined “a” which designates G00010BC BnIND-A natural deletion allele.

The shatter tolerance of these new allelic combinations (including Aa/cc) are tested in comparison to allelic combinations tested in FIGS. 14 and 45H33 and 45M35.

TABLE 11
G00555MC male parent G00010BC female parent Hybrid genotype
IND-C HO DO (AA/cc) IND-C HO DO (aa/cc) Aa/cc
IND-C HO DO (AA/cc) WT (aa/CC) Aa/cC

The foregoing demonstrates that B. napus hybrid plants having 3 BnIND dropout alleles produced average percent shattered pods scores comparable to commercial HARVESTMAX shatter tolerant hybrids checks and that introgression of the natural BnIND-A deletion of G00010BC, in combination with the CRISPR generated dropout alleles can generate hybrids having an improved shatter tolerance phenotype that is comparable to commercial shatter tolerant hybrids.

Example 17: Constructs and Guide RNA Selection for Genome Editing of B. napus ALC in G00010BC and G00555MC

The following guides were designed for use in genome editing excision (dropout) of the genes or the promoters of Brassica napus ALCATRAZ (BnALC) in the A and C genomes of Brassica lines G00010BC and G00555MC (Table 12). Vector construction and Agrobacterium transformation was done as described herein.

TABLE 12
SEQ ID
NO. Guide name RNA Guide Sequence Dropout target
31 BNA-ALC-CR10 GAACGTAAGCCACCAGATTA BnALC-A gene
32 BNA-ALC-CR11 GTGGAGAGGAAATCTGACTT
33 BNA-ALC-CR12 GGAAGAATTCACAGAGAGAG BnALC-C gene
34 BNA-ALC-CR15 GGACTGAACAAAACTGCTAC
35 BNA-ALC-CR14 GCAACTAACGAAGAGACAGA BnALC-C promoter
combined with CR12

ALC-CR10 is specific to BnALC-A (last G of PAM is missing in BnALC-C). ALC-CR11 is specific to BnALC-A (last G of PAM is missing in BnALC-C). ALC-CR12 is specific to BnALC-C (last G of PAM is missing in ALC-A). ALC-CR15 specific to BnALC-C (this sequence doesn't exist in BnALC-A). ALC-CR14 and ALC-CR12 will specifically delete —3kb of BnALC-C promoter as shown in FIG. 15. Genomic sequences for G00010BC BnALC-A (SEQ ID NO:71) and BnALC-C (SEQ ID NO:72) and G00555MC BnALC-A (SEQ ID NO:73) and BnALC-C (SEQ ID NO:74) are provided.

BnALC-A/C homozygous and heterozygous dropout plants provide improved pod shatter tolerance.

Example 18: Constructs and Guide RNA Selection for Genome Editing of Brassica napus PGAZ Gene by Microspore Transformation

Microspore bombardment of NS1822BC was also performed with linearized plasmids to deliver expression of Streptococcus pyrogenes Cas9, and another plasmid was used to deliver B. napus POLYGALACTURONASE (BnPGAZ) target specific guide RNAs, which were constructed as fusions of CRISPR RNA (crRNA) to BNA-PGAZ-CR1 and BNA-PGAZ-CR2, respectively, each of which was fused to trans-activating CRISPR RNA (tracrRNA) of Streptococcus pyrogenes. BNA-PGAZ-CR1 (SEQ ID NO: 28) and BNA-PGAZ-CR2 (SEQ ID NO:29) target both BnPGAZ-A (SEQ ID NO:60) and BnPGAZ-C (SEQ ID NO:61) genes in NS1822BC as shown in FIG. 16.

Amplicon NextGen DNA sequencing was used to identify four plants that carry a dropout mutation for BnPGAZ-A (SEQ ID NOs:61-62) and five plants that carry a dropout mutation for BnPGAZ-C (SEQ ID NOs:63-65). BnPGAZ-A dropout variants were crossed to BnPGAZ-C dropout variants to create plants containing different allelic combinations of dropouts in both genes. Microspores of heterozygous double dropout plants were used to create homozygous double dropout plants through microspore doubling and screening of regenerated plants.

The foregoing describes the use of guide RNAs and constructs to produce BnPGAZ-A and BnPGAZ-C dropout allele combinations in B. napus cells and plants by microspore bombardment, microspore doubling and crossing.

Example 19: Constructs and Guide RNA Selection For Genome Editing of Brassica napus PGAZ Gene by Agrobacterium Transformation

BnPGAZ-A and BnPGAZ-C TO dropouts were obtained in G00010BC and G00555MC using Agrobacterium transformation with plasmid PHP92921 and crRNAs BNA-PGAZ-CR11 (SEQ ID NO:30) and BNA-PGAZ-CR2 (SEQ ID NO:29). Plants were genotyped. Amplicon NextGen sequencing was used to identify dropouts for BnPGAZ-A (SEQ ID NO:77) and BnPGAZ-C (SEQ ID NO:78) in G00010BC, as well as dropouts for PGAZ-A (SEQ ID NO:79), and BnPGAZ-C (SEQ ID NO:80) in G00555MC.

The foregoing describes the use of guide RNAs and constructs to produce BnPGAZ-A and BnPGAZ-C dropouts in B. napus cells and plants.

All patent applications, patents, and printed publications cited herein are incorporated herein by reference in the entireties, except for any definitions, subject matter disclaimers or disavowals and except to the extent that the incorporated material is inconsistent with the express disclosure herein, in which case the language in this disclosure controls.

Claims

1. A method for introducing a genomic modification that contributes to pod shatter tolerance in B. napus plant, the method comprising introducing a targeted modification into the genome of a B. napus plant, plant cell or seed thereof wherein the targeted modification includes excising endogenous genomic sequence of an INDEHISCENT (BnIND), ALCATRAZ (BnALC), or POLYGALACTURONASE (BnPGAZ) gene in a B. napus plant cell.

2. The method of claim 1, wherein the targeted genomic modification comprises first and second double strand breaks induced by a TALE-nuclease (TALEN), a meganuclease, a zinc finger nuclease, or a CRISPR-associated nuclease.

3. The method of claim 1, wherein the method comprises introducing a CRISPR-associated nuclease and guide RNAs into a B. napus plant cell.

4. The method of claim 3, wherein the guide RNAs comprise:

a. a first guide RNA comprising SEQ ID NO:26 and a second guide RNA comprising SEQ ID NO:27 that catalyze targeted deletion of endogenous genomic BnIND sequence in the plant cell;

b. a first guide RNA comprising SEQ ID NO:28 and a second guide RNA comprising SEQ ID NO:29 that catalyze targeted deletion of endogenous genomic BnPGAZ sequence in the plant cell;

c. a first guide RNA comprising SEQ ID NO:30 and a second guide RNA comprising SEQ ID NO:29 that catalyze targeted deletion of endogenous genomic BnPGAZ sequence in the plant cell;

d. a first guide RNA comprising SEQ ID NO:31 and a second guide RNA comprising SEQ ID NO:32 that catalyze targeted deletion of endogenous genomic BnALC sequence in the plant cell;

e. a first guide RNA comprising SEQ ID NO:33 and a second guide RNA comprising SEQ ID NO:34 that catalyze targeted deletion of endogenous genomic BnALC sequence in the plant cell; or

f. a first guide RNA comprising SEQ ID NO:35 and a second guide RNA comprising SEQ ID NO:33 that catalyze targeted deletion of endogenous genomic BnALC sequence in the plant cell.

5. The method of claim 1, wherein the excised endogenous genomic sequence comprises:

a. Nucleotides at position 7740 to position 10346 of SEQ ID NO:56;

b. Nucleotides at position 2676 to position 5101 of SEQ ID NO:57;

c. Nucleotides at position 2720 to position 5866 of SEQ ID NO:60;

d. Nucleotides at position 2720 to position 5865 of SEQ ID NO:60;

e. Nucleotides at position 2705 to position 5804 of SEQ ID NO:61;

f. Nucleotides at position 2704 to position 5802 of SEQ ID NO:61;

g. Nucleotides at position 2705 to position 5802 of SEQ ID NO:61;

h. Nucleotides at position 2019 to position 4441 of SEQ ID NO:67;

i. Nucleotides at position 2018 to position 4639 of SEQ ID NO:69;

j. Nucleotides at position 2018 to position 4446 of SEQ ID NO:70;

k. Nucleotides at position 1723 to position 2849 of SEQ ID NO:71;

l. Nucleotides at position 1722 to position 2851 of SEQ ID NO:73;

m. Nucleotides at position 6369 to position 7511 of SEQ ID NO:72;

n. Nucleotides at position 6368 to position 7510 of SEQ ID NO:74;

o. Nucleotides at position 3417 to position 6368 of SEQ ID NO:72;

p. Nucleotides at position 3416 to position 6367 of SEQ ID NO:74;

q. Nucleotides at position 2015 to position 5235 of SEQ ID NO:126;

r. Nucleotides at position 2015 to position 5231 of SEQ ID NO:126;

s. Nucleotides at position 2019 to position 5167 of SEQ ID NO:127;

t. Nucleotides at position 2019 to position 5235 of SEQ ID NO:128;

u. Nucleotides at position 2016 to position 5249 of SEQ ID NO:128; or

v. Nucleotides at position 2023 to position 5192 of SEQ ID NO:129.

6. The method of claim 1, wherein the targeted modification is introduced into a B. napus plant cell genome, and the method further includes generating a modified B. napus plant from the modified B. napus plant cell, wherein the modified B. napus plant has increased pod shatter tolerance relative to an unmodified B. napus that comprises the native BnIND, native BnALC, or native BnPGAZ gene sequence excised from the modified B. napus plant cell.

7. A modified B. napus plant, plant cell, or seed produced according to the method of claim 1.

8. A modified B. napus plant produced according to the method of claim 6.

9. A modified B. napus plant, plant cell or seed according to claim 7, wherein the plant, plant cell, or seed thereof comprises a deletion of BnIND-A genomic sequence corresponding to position 7740 to position 10346 of SEQ ID NO:56; BnIND-A genomic sequence corresponding to position 2018 to position 4639 of SEQ ID NO:69, BnIND-C genomic sequence corresponding to position 2676 to position 5101 of SEQ ID NO:57, BnIND-C genomic sequence corresponding to position 2019 to position 4441 of SEQ ID NO:67, BnIND-C genomic sequence corresponding to position 2018 to position 4446 of SEQ ID NO:70, BnALC-A genomic sequence corresponding to position 1723 to position 2849 of SEQ ID NO:71, BnALC-A genomic sequence corresponding to position 1722 to position 2851 of SEQ ID NO:73, BnALC-A genomic sequence corresponding to position 6369 to position 7511 of SEQ ID NO:72, BnALC-C genomic sequence corresponding to position 6368 to position 7510 of SEQ ID NO:74, BnALC-C genomic sequence corresponding to position 3417 to position 6368 of SEQ ID NO:72, BnALC-C genomic sequence corresponding to position 3416 to position 6367 of SEQ ID NO:74, BnPGAZ-A genomic sequence corresponding to position 2720 to position 5866 of SEQ ID NO:60, BnPGAZ-A genomic sequence corresponding to position 2720 to position 5865 of SEQ ID NO:60, BnPGAZ-A genomic sequence corresponding to position 2015 to position 5235 of SEQ ID NO:126, BnPGAZ-A genomic sequence corresponding to position 2015 to position 5231 of SEQ ID NO:126, BnPGAZ-A genomic sequence corresponding to position 2019 to position 5235 of SEQ ID NO:128, BnPGAZ-A genomic sequence corresponding to position 2016 to position 5249 of SEQ ID NO:128, BnPGAZ-C genomic sequence corresponding to position 2705 to position 5804 of SEQ ID NO:61, BnPGAZ-C genomic sequence corresponding to position 2704 to position 5802 of SEQ ID NO:61, BnPGAZ-C genomic sequence corresponding to position 2705 to position 5802 of SEQ ID NO:61, BnPGAZ-C genomic sequence corresponding to position 2019 to position 5167 of SEQ ID NO:127, or BnPGAZ-C genomic sequence corresponding to position 2023 to position 5192 of SEQ ID NO:129.

10. The modified B. napus plant of claim 8, wherein the plant comprises at least one excised allele of the BnIND-A gene (SEQ ID No:105), BnIND-C gene (SEQ ID No:108), or combinations thereof; at least one excised allele of the BnALC-A gene (SEQ ID No:120), BnALC-C gene (SEQ ID No:121), or combinations thereof; or at least one excised allele of BnPGAZ-A gene (SEQ ID No:112), BnPGAZ-C gene (SEQ ID No:116), or combinations thereof.

11. The modified B. napus plant of claim 7, wherein the plant comprises three or four excised alleles of the BnIND gene; three or four excised alleles of the BnALC gene; or three or four excised alleles of the BnPGAZ gene.

12. The modified B. napus plant of claim 7, wherein the plant has increased pod shatter tolerance relative to an unmodified B. napus that comprises the native BnIND, BnALC, or BnPGAZ genomic sequence deleted in the modified B. napus plant.

13.-15. (canceled)

16. A method of introducing a natural deletion of the BnIND-A gene into a B. napus plant comprising:

a. crossing a first parent B. napus plant which is a plant comprising the targeted genome modification in accordance with claim 7 with a second B. napus plant comprising a native BnIND-A deletion to produce hybrid progeny plants; and

b. selecting hybrid progeny plants that have both the targeted genome modification of the first the native BnIND-A deletion and the targeted genome modification.

17. The method of claim 16 further comprising:

c. crossing the selected progeny plants with the first parent B. napus plant to produce backcross progeny plants;

d. selecting for backcross progeny plants that have the natural deletion of the BnIND-A gene to produce selected backcross progeny plants; and

e. repeating steps (c) and (d) to produce another generation of backcross progeny plants.

18. The method of claim 17 further comprising:

f. repeating steps (c) and (d) three or more times to produce backcross progeny plants that comprise the natural deletion of the BnIND-A gene and the agronomic characteristics of the first parent plant when grown in the same environmental conditions.

19. A method for detecting the natural deletion of a BnIND-A gene in a B. napus plant, the method comprising:

a. performing a first PCR assay using a first probe of SEQ ID NO:137, a first forward primer of SEQ ID NO:135, and a first reverse primer of SEQ ID NO:136 on a polynucleotide from a B. napus plant sample;

b. performing a second PCR assay using a second probe of SEQ ID NO:140, a second forward primer of SEQ ID NO:135, and a second reverse primer of SEQ ID NO:139 on the polynucleotide sample;

c. quantifying the first and second probe; and,

d. comparing the quantified first and second probe to determine zygosity.

20. A PCR assay method for detecting the natural deletion of a BnIND-A gene in a B. napus plant, the method comprising;

a. performing a first PCR assay using of first forward primer of SEQ ID NO:131, and a first reverse primer of SEQ ID NO:132 on a polynucleotide from a B. napus plant sample;

b. performing a second PCR assay using a second forward primer of SEQ ID NO:133, and a second reverse primer of SEQ ID NO:134 on the polynucleotide sample; and

c. quantifying the first and second resultant amplicon and comparing the quantified first and second resultant amplicon to determine zygosity.

Resources

Images & Drawings included:

Sources:

Recent applications in this class:

Recent applications for this Assignee: