US20160130567A1
2016-05-12
14/929,366
2015-11-01
This invention provides a range of translatable messenger UNA (mUNA) molecules. The mUNA molecules can be translated in vitro and in vivo to provide an active polypeptide or protein, or to provide an immunization agent or vaccine component. The mUNA molecules can be used as an active agent to express an active polypeptide or protein in cells or subjects. Among other things, the mUNA molecules are useful in methods for treating rare diseases.
Get notified when new applications in this technology area are published.
C12N9/1018 » CPC main
Enzymes; Proenzymes; Compositions thereof ; Processes for preparing, activating, inhibiting, separating or purifying enzymes; Transferases (2.) transferring one-carbon groups (2.1) Carboxy- and carbamoyl transferases (2.1.3)
C07K14/8125 » CPC further
Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof; Protease inhibitors; Endopeptidase (E.C. 3.4.21-99) inhibitors; Serine protease (E.C. 3.4.21) inhibitors; Serpins Alpha-1-antitrypsin
C12N9/0071 » CPC further
Enzymes; Proenzymes; Compositions thereof ; Processes for preparing, activating, inhibiting, separating or purifying enzymes; Oxidoreductases (1.) acting on paired donors with incorporation of molecular oxygen (1.14)
C07K14/4717 » CPC further
Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used Plasma globulins, lactoglobulin
C12N9/1051 » CPC further
Enzymes; Proenzymes; Compositions thereof ; Processes for preparing, activating, inhibiting, separating or purifying enzymes; Transferases (2.); Glycosyltransferases (2.4) Hexosyltransferases (2.4.1)
C12N9/1205 » CPC further
Enzymes; Proenzymes; Compositions thereof ; Processes for preparing, activating, inhibiting, separating or purifying enzymes; Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7) Phosphotransferases with an alcohol group as acceptor (2.7.1), e.g. protein kinases
C12N9/2402 » CPC further
Enzymes; Proenzymes; Compositions thereof ; Processes for preparing, activating, inhibiting, separating or purifying enzymes; Hydrolases (3) acting on glycosyl compounds (3.2) hydrolysing O- and S- glycosyl compounds (3.2.1)
C12Y304/21022 » CPC further
Hydrolases acting on peptide bonds, i.e. peptidases (3.4); Serine endopeptidases (3.4.21) Coagulation factor IXa (3.4.21.22)
C12Y403/02001 » CPC further
Carbon-nitrogen lyases (4.3); Amidine-lyases (4.3.2) Argininosuccinate lyase (4.3.2.1)
C12Y114/16001 » CPC further
Oxidoreductases acting on paired donors, with incorporation or reduction of molecular oxygen (1.14) with reduced pteridine as one donor, and incorporation of one atom of oxygen (1.14.16) Phenylalanine 4-monooxygenase (1.14.16.1)
C12Y201/03003 » CPC further
Transferases transferring one-carbon groups (2.1); Carboxy- and carbamoyltransferases (2.1.3) Ornithine carbamoyltransferase (2.1.3.3)
C12Y204/01025 » CPC further
Glycosyltransferases (2.4); Hexosyltransferases (2.4.1) 4-Alpha-glucanotransferase (2.4.1.25)
C12Y207/0104 » CPC further
Transferases transferring phosphorus-containing groups (2.7); Phosphotransferases with an alcohol group as acceptor (2.7.1) Pyruvate kinase (2.7.1.40)
C12Y302/01033 » CPC further
Hydrolases acting on glycosyl compounds, i.e. glycosylases (3.2); Glycosidases, i.e. enzymes hydrolysing O- and S-glycosyl compounds (3.2.1) Amylo-alpha-1,6-glucosidase (3.2.1.33)
A61K39/00 » CPC further
Medicinal preparations containing antigens or antibodies
C12N9/10 IPC
Enzymes; Proenzymes; Compositions thereof ; Processes for preparing, activating, inhibiting, separating or purifying enzymes Transferases (2.)
C07K14/505 » CPC further
Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans; Growth factors; Growth regulators Erythropoietin [EPO]
C07K14/81 IPC
Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof Protease inhibitors
C07K14/705 » CPC further
Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans Receptors; Cell surface antigens; Cell surface determinants
C12N9/88 » CPC further
Enzymes; Proenzymes; Compositions thereof ; Processes for preparing, activating, inhibiting, separating or purifying enzymes Lyases (4.)
C12N9/24 IPC
Enzymes; Proenzymes; Compositions thereof ; Processes for preparing, activating, inhibiting, separating or purifying enzymes; Hydrolases (3) acting on glycosyl compounds (3.2)
C07K14/575 » CPC further
Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans Hormones
C07K14/47 » CPC further
Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
C12N9/12 IPC
Enzymes; Proenzymes; Compositions thereof ; Processes for preparing, activating, inhibiting, separating or purifying enzymes; Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)
C07K14/445 » CPC further
Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from protozoa Plasmodium
C07K14/005 » CPC further
Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
C12N9/64 IPC
Enzymes; Proenzymes; Compositions thereof ; Processes for preparing, activating, inhibiting, separating or purifying enzymes; Hydrolases (3) acting on peptide bonds (3.4); Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from animal tissue
It has long been difficult to utilize messenger RNA molecules in medicines. Synthetic mRNA can be designed with inherent translational activity for making an active protein, which could be used in various therapeutic strategies. However, the expression of protein involves a number of steps that are localized and/or regulated. Further, plentiful RNase enzymes can degrade mRNA. Moreover, use of a synthetic mRNA requires clinical formulation and delivery to cells. These steps of mRNA delivery, partitioning and dynamics increase the need for stability and longevity of the synthetic mRNA.
For efficient translation, natural mRNA transcripts incorporate a 5′ 7-methylguanosine cap and a 3′ polyA tail. PolyA binding proteins (PABPs) bind to the tail and cooperate with the 5′ cap via looping interactions to recruit the machinery of translation. A 3′ polyA tail of at least about 20 nucleotides is needed to activate the mRNA for translation. Translational activity can decrease to low levels in the absence of either the 5′ cap or the 3′ polyA tail.
One drawback in using mRNA molecules in medicines is that the lifetime of the molecule in the cytoplasm of mammalian cells is relatively short. In general, ubiquitous mRNA degradation pathways actively clear out transcripts from the mRNA pool. The principle pathways for mRNA degradation involve deadenylation or trimming of the 3′ polyA tail by 3′-exoribonucleases and cleavage of the 5′-5′ triphosphate linkage that attaches the methylguanosine cap by a decapping complex.
One way to increase mRNA longevity might be to increase 3′-nuclease resistance by incorporating nucleotide analogues or chemical modifications in either the phosphodiester backbone or the nucleotides, which are localized to the 3′ end to be compatible with enzymatic synthesis and efficient translation. A drawback of this approach is that it may not be possible to selectively incorporate such chemical modifications at 3′ termini, or to retain activity.
There is an urgent need for molecules, structures and compositions having specific translational activity to provide active peptides and proteins, both in vitro and in vivo. Such new molecules having functional cytoplasmic half-life for producing active peptides and proteins can yield new drug molecules, therapeutic modalities, vaccines, and immunotherapies.
What is needed are translatable molecules that have increased specific activity and/or lifetime over native mRNA, to be used in methods and compositions for producing and delivering active peptides and proteins in medicines.
This invention relates to the fields of molecular biology and genetics, as well as to biopharmaceuticals and therapeutics generated from translatable molecules. More particularly, this invention relates to methods, structures and compositions for molecules having translational activity for making active peptides or proteins in vivo.
This invention provides methods and compositions for novel molecules having translational activity, which can be used to provide active peptides and proteins.
The molecules of this invention can have functional cytoplasmic half-life for producing peptides and proteins. The peptides and proteins can be active for therapeutic modalities, as well as in vaccines and immunotherapies.
The molecules of this invention can be translatable messenger molecules, which can have long half-life, particularly in the cytoplasm of a cell. The longer duration of the translatable messenger molecules of this invention can be significant for providing a translation product that is active for ameliorating, preventing or treating various diseases. The diseases can be associated with undesirable modulation of protein concentration, or undesirable activity of a protein.
This disclosure provides a range of structures for translatable molecules that have increased specific activity and/or lifetime over native mRNA. The translatable molecules of this invention can be used in medicines, and for methods and compositions for producing and delivering active peptides and proteins.
Embodiments of this disclosure provide a wide range of novel, translatable messenger molecules. The translatable messenger molecules can contain monomers that are unlocked nucleomonomers (UNA monomers). The long duration of translatable messenger UNA molecules (mUNA molecules) of this invention can be useful for providing an active peptide or protein translation product. The mUNA molecules of this invention can be used in medicines for ameliorating, preventing or treating disease.
The translatable mUNA molecules of this invention can be used to provide peptides or proteins in vitro, ex vivo, or in vivo.
The translatable mUNA molecules of this invention can provide high-efficiency expression of virtually any protein.
In some embodiments, the mUNA molecules of this invention have increased cytoplasmic half-life over a native, mature mRNA that provides the same peptide or protein. The mUNA structures and compositions of this invention can provide increased functional half-life with respect to native, mature mRNAs.
In further aspects, a mUNA molecule of this invention can provide increased activity as a drug providing a peptide or protein product, as compared to a native, mature mRNA. In some embodiments, a mUNA molecule can reduce the expected dose level that would be required for efficacious therapy.
Additional embodiments of this invention can provide vaccine compositions for immunization and immunotherapies using mUNA molecules.
Embodiments of this invention include the following:
A mUNA molecule, containing one or more UNA monomers, and containing nucleic acid monomers, wherein the mUNA molecule is translatable to express a polypeptide or protein. The molecule may have from 200 to 12,000 monomers, or from 200 to 4,000 monomers. In some embodiments, the molecule can have from 1 to 8,000 UNA monomers, or from 1 to 100 UNA monomers, or from 1 to 20 UNA monomers.
A mUNA molecule can have one or more modified nucleic acid nucleotides, and/or one or more chemically-modified nucleic acid nucleotides.
In some embodiments, a mUNA molecule can contain a 5′ cap, a 5′ untranslated region of monomers, a coding region of monomers, a 3′ untranslated region of monomers, and a tail region of monomers. In certain embodiments, the molecule can contain a translation enhancer in a 5′ or 3′ untranslated region.
The mUNA molecules of this invention can be translatable in vivo, or in vitro, or in a mammalian cell, or in a human in vivo. In some embodiments, a translation product of a mUNA molecule can be an active peptide or protein.
In certain embodiments, a translation product of a mUNA molecule is human EPO, human Factor IX, human alpha-1-antitrypsin, human CFTR, human ASL, human PAH, human NIS, or human hepcidin.
In another aspect, a mUNA molecule can exhibit at least 2-fold, 3-fold, 5-fold, or 10-fold increased translation efficiency in vivo as compared to a native mRNA that encodes the same translation product.
In certain embodiments, a mUNA molecule can have a cytoplasmic half-life in a cell at least 2-fold greater than a native mRNA of the cell that encodes the same translation product.
Embodiments of this invention further contemplate therapeutic mUNA agents for a rare disease, a liver disease, or a cancer. A mUNA molecule can be an immunization agent or vaccine component for a rare disease, a liver disease, or a cancer.
This invention further provides compositions containing a mUNA molecule and a pharmaceutically acceptable carrier, and vaccine or immunization compositions containing a mUNA molecule. The carrier can be a nanoparticle or liposome.
In additional embodiments, this invention provides methods for ameliorating, preventing or treating a disease or condition in a subject comprising administering to the subject a composition containing a mUNA molecule. The disease or condition can be a rare disease, liver disease, or cancer.
In certain embodiments, this invention provides methods for producing a polypeptide or protein in vivo, by administering to a mammal a composition containing a mUNA molecule. The polypeptide or protein may be deficient in a disease or condition of a subject or mammal. The protein can be human EPO, human Factor IX, human alpha-1-antitrypsin, human CFTR, human ASL, human PAH, human NIS, or human hepcidin.
This invention further provides methods for producing a polypeptide or protein in vitro, by transfecting a cell with a mUNA molecule. The polypeptide or protein can be deficient in a disease or condition of a subject or mammal. The protein can be human EPO, human Factor IX, human alpha-1-antitrypsin, human CFTR, human ASL, human PAH, human NIS, or human hepcidin.
FIG. 1 shows the results of expressing human Factor IX (F9) in vivo using a translatable mUNA molecule of this invention, as compared to expression of a native mRNA of Factor IX. FIG. 1 shows that the translation efficiency of this mUNA molecule was doubled as compared to the native mRNA of F9. The mUNA molecule of this embodiment was translated in C57BL/c mouse to produce human F9.
FIG. 2 shows the results of expressing human Factor IX (F9) in vitro using a translatable mUNA molecule of this invention, as compared to expression of a native mRNA of Factor IX. FIG. 2 shows that the translation efficiency of this mUNA molecule was increased by 5-fold after 48 hours, as compared to the native mRNA of F9. The mUNA molecule of this embodiment was traslated in mouse hepatocyte cell line Hepa1-6 to produce human F9.
FIG. 3 shows the results of expressing human Erythropoietin (EPO) in vitro using a translatable mUNA molecule of this invention, as compared to expression of a native mRNA of human EPO. FIG. 3 shows that the translation efficiency of this mUNA molecule was increased nearly 3-fold after 48 hours, as compared to the native mRNA of EPO. The mUNA molecule of this embodiment was translated in mouse hepatocyte cell line Hepa1-6 to produce human EPO.
FIG. 4 shows the results of expressing mouse Erythropoietin (EPO) in vitro using several translatable mUNA molecules of this invention, as compared to expression of a native mRNA of mouse EPO. FIG. 4 shows that the translation efficiencies of the mUNA molecules (#2, 3, 4, 5, 6, 7, 8, 9, 10 and 11) were increased by up to 10-fold after 72 hours, as compared to the native mRNA of EPO. The mUNA molecules of this embodiment were translated in mouse hepatocyte cell line Hepa1-6 to produce mouse EPO.
FIG. 5 shows the results of expressing human alpha-1-antitrypsin in vivo using a translatable mUNA molecule of this invention, as compared to expression of a native mRNA of human alpha-1-antitrypsin. FIG. 5 shows that the translation efficiency of this mUNA molecule at 72 hrs was increased more than 3-fold as compared to the native mRNA of human alpha-1-antitrypsin. The mUNA molecule of this embodiment was translated in C57BL/c mouse to produce human alpha-1-antitrypsin.
FIG. 6 shows the results of expressing human erythropoietin (EPO) in vivo using a translatable mUNA molecule of this invention, as compared to expression of a native mRNA of human EPO. FIG. 6 shows that the translation efficiency of this mUNA molecule at 72 hrs was increased more than 10-fold as compared to the native mRNA of human EPO. The mUNA molecule of this embodiment was translated in C57BL/c mouse to produce human EPO.
FIG. 7 shows the primary structure of a functional mRNA transcript in the cytoplasm. The mRNA includes a 5′ methylguanosine cap, a protein coding sequence flanked by untranslated regions (UTRs), and a polyadenosine (polyA) tail bound by polyA binding proteins (PABPs).
FIG. 8 shows the 5′ cap and PABPs cooperatively interacting with proteins involved in translation to facilitate the recruitment and recycling of ribosome complexes.
FIG. 9 shows the splint-mediated ligation scheme, in which an acceptor RNA with a 30-monomer stub polyA tail (A(30)) was ligated to a 30-monomer donor oligomer A(30). The splint-mediated ligation used a DNA oligomer splint which was complementary to the 3′ UTR sequence upstream of the stub polyA tail, and included a 60-monomer oligo(dT) 5′ heel (T(60)) to splint the ligation. The anchoring region of the splint was complementary to the UTR sequence to ensure that a 5′ dT30 overhang was presented upon hybridization to the acceptor. This brings the donor oligomer into juxtaposition with the 3′ terminus of the stub tail, dramatically improving the kinetics of ligation.
FIG. 10 shows experimental results of splint-mediated ligation of a donor oligomer to an acceptor. FIG. 10 shows the results of ligation using 2 ug of a 120-monomer acceptor with an A30 stub tail that was ligated to a 5′-phosphorylated A30 RNA donor oligomer using T4 RNA Ligase 2. The reaction was incubated overnight at 37° C. The ligation and a mock reaction done without enzyme were purified, treated with DNAse I for 1 hour to degrade and detach the splint oligomers, and re-purified in a volume of 30 uL. The ligation efficiency was nearly 100%. The absence of a size shift in the mock-reaction prep shows that the acceptor and donor were truly ligated and not simply held together by undigested splint oligomers.
FIG. 11 shows the results of splint-mediated ligation using an acceptor RNA with a 30-monomer stub polyA tail (A(30)). The ligation reactions were performed with three different donor oligomer species: A(30), A(60), and A(120). Based on the gel shifts, the ligations have attained nearly 100% efficiency.
FIG. 12 shows the results of one-hour splint-mediated ligations that were performed on nGFP-A30 transcripts. The resulting ligation products were compared to untreated transcripts and native nGFP-A60 IVT products. The native nGFP-A60 and the ligated products were up-shifted on the gel relative to the untreated nGFP-A30 transcripts and mock-ligated material, showing that the ligation yield was nearly 100%.
FIG. 13 shows increased lifetime and translational activity for an nGFP-A60 ligation product. In FIG. 13, nuclearized transcripts were transfected into fibroblasts, and a comparison of fluoresence signals was made for nGFP-A30, mock-ligated nGFP-A30, and an nGFP-A60 ligation product (FIG. 13, left to right). The significantly higher fluorescence signal observed for the nGFP-A60 ligation product shows that it has markedly increased translational activity.
FIG. 14 shows the results of a ligation performed with a 100-monomer acceptor RNA that was treated for 3 hours at room temperature with T4 RNA Ligase 2 (truncated KQ mutant) using a 10 uM concentration of a polyA tail 30-monomer donor oligomer. 15% PEG 8000 was included in the reaction as a volume excluder to promote efficient ligation. The ligation reaction showed that a high molecular weight product was formed, having a size in between the 100-monomer acceptor RNA and a 180-monomer RNA transcript included as a size standard. These results show that the ligation reaction produced a predominant product having high molecular weight with nearly 100% ligation of the donor to the acceptor. Additional experiments with concentrations of the polyA tail at 10 uM, 20 uM, and 40 uM showed that from about 50% to about 100% of the acceptor RNA was ligated.
This invention provides a range of novel agents and compositions to be used for therapeutic applications. The molecules and compositions of this invention can be used for ameliorating, preventing or treating various diseases associated with genomic functionalities.
The molecules of this invention can be translatable messenger UNA molecules, which can have long half-life, particularly in the cytoplasm. The long duration mUNA molecules (mUNA molecules) can be used for ameliorating, preventing or treating various diseases associated with undesirable modulation of protein concentration, or activity of a protein.
The properties of the mUNA compounds of this invention arise according to their molecular structure, and the structure of the molecule in its entirety, as a whole, can provide significant benefits based on those properties. Embodiments of this invention can provide mUNA molecules having one or more properties that advantageously provide enhanced effectiveness in regulating protein expression or concentration, or modulating protein activity. The molecules and compositions of this invention can provide formulations for therapeutic agents for various diseases and conditions, which can provide clinical agents.
This invention provides a range of mUNA molecules that are surprisingly translatable to provide active peptide or protein, in vitro and in vivo.
The mUNA structures and compositions can have increased translational activity and cytoplasmic half-life. In these embodiments, the mUNA structures and compositions can provide increased functional half-life in the cytoplasm of mammalian cells over native mRNA molecules. The inventive mUNA molecules can have increased half-life of activity with respect to a corresponding native mRNA.
A wide range of novel mUNA molecules are provided herein, each of which can incorporate specialized linker groups. The linker groups can be attached in a chain in the mUNA molecule. Each linker group can also be attached to a nucleobase.
In some aspects, a linker group can be a monomer. Monomers can be attached to form a chain molecule. In a chain molecule of this invention, a linker group monomer can be attached at any point in the chain.
In certain aspects, linker group monomers can be attached in a chain molecule of this invention so that the linker group monomers reside near the ends of the chain, or at any position in the chain.
As used herein, a chain molecule can also be referred to as an oligomer.
In further aspects, the linker groups of a chain molecule can each be attached to a nucleobase. The presence of nucleobases in the chain molecule can provide a sequence of nucleobases in the chain molecule.
In certain embodiments, this invention provides oligomer mUNA molecules having chain structures that incorporate novel combinations of the linker group monomers, along with certain natural nucleotides, or non-natural nucleotides, or modified nucleotides, or chemically-modified nucleotides.
The oligomer mUNA molecules of this invention can display a sequence of nucleobases, and can be designed to express a polypeptide or protein, in vitro, ex vivo, or in vivo. The expressed polypeptide or protein can have activity in various forms, including activity corresponding to protein expressed from natural mRNA, or activity corresponding to a negative or dominant negative protein.
In some aspects, this invention can provide active mUNA oligomer molecules having a base sequence that corresponds to at least a fragment of a native nucleic acid molecule of a cell.
In some embodiments, the cell can be a eukaryotic cell, a mammalian cell, or a human cell.
This invention provides structures, methods and compositions for oligomeric mUNA agents that incorporate the linker group monomers. The oligomeric molecules of this invention can be used as active agents in formulations for therapeutics.
This invention provides a range of mUNA molecules that are useful for providing therapeutic effects because of their longevity of activity in providing an expressed peptide or protein.
In certain embodiments, an active mUNA molecule can be structured as an oligomer composed of monomers. The oligomeric structures of this invention may contain one or more linker group monomers, along with certain nucleotides.
An expressed peptide or protein can be modified or mutated as compared to a native variant, or can be a homolog or ortholog for enhanced expression in a eukaryotic cell. An active mUNA molecule can be human codon optimized. Methodologies for optimizing codons are known in the art.
In certain embodiments, a mUNA molecule may contain a sequence of nucleobases, and can be designed to express a peptide or protein of any isoform, in part by having sufficient homology with a native polynucleotide sequence.
In some embodiments, a mUNA molecule can be from about 200 to about 12,000 monomers in length, or more. In certain embodiments, a mUNA molecule can be from 200 to 12,000 monomers in length, or 200 to 10,000 monomers, or 200 to 8,000 monomers, or 200 to 6000 monomers, or 200 to 5000 monomers, or 200 to 4000 monomers, or 200 to 3600 monomers, or 200 to 3200 monomers, or 200 to 3000 monomers, or 200 to 2800 monomers, or 200 to 2600 monomers, or 200 to 2400 monomers, or 200 to 2200 monomers, or 600 to 3200 monomers, or 600 to 3000 monomers, or 600 to 2600 monomers.
In some embodiments, a mUNA molecule can contain from 1 to about 8,000 UNA monomers. In certain embodiments, a mUNA molecule can contain from 1 to 8,000 UNA monomers, or 1 to 6,000 UNA monomers, or 1 to 4,000 UNA monomers, or 1 to 3,000 UNA monomers, or 1 to 2,000 UNA monomers, or 1 to 1,000 UNA monomers, or 1 to 500 UNA monomers, or 1 to 300 UNA monomers, or 1 to 200 UNA monomers, or 1 to 100 UNA monomers, or 1 to 50 UNA monomers, or 1 to 40 UNA monomers, or 1 to 30 UNA monomers, or 1 to 20 UNA monomers, or 1 to 10 UNA monomers, or 1 to 6 UNA monomers.
In some embodiments, a mUNA molecule can be from about 200 to about 12,000 bases in length, or more. In certain embodiments, a mUNA molecule can be from 200 to 12,000 bases in length, or 200 to 10,000 bases, or 200 to 8,000 bases, or 200 to 6000 bases, or 200 to 5000 bases, or 200 to 4000 bases, or 200 to 3600 bases, or 200 to 3200 bases, or 200 to 3000 bases, or 200 to 2800 bases, or 200 to 2600 bases, or 200 to 2400 bases, or 200 to 2200 bases, or 600 to 3200 bases, or 600 to 3000 bases, or 600 to 2600 bases.
A mUNA molecule of this invention may comprise a 5′ cap, a 5′ untranslated region of monomers, a coding region of monomers, a 3′ untranslated region of monomers, and a tail region of monomers. Any of these regions of monomers may comprise one or more UNA monomers.
A mUNA molecule of this invention may comprise a 5′ untranslated region of monomers containing one or more UNA monomers.
A mUNA molecule of this invention may comprise a coding region of monomers containing one or more UNA monomers.
A mUNA molecule of this invention may comprise a 3′ untranslated region of monomers containing one or more UNA monomers.
A mUNA molecule of this invention may comprise a tail region of monomers containing one or more UNA monomers.
A mUNA molecule of this invention may comprise a 5′ cap containing one or more UNA monomers.
A mUNA molecule of this invention can be translatable, and may comprise regions of sequences or structures that are operable for translation in a cell, or which have the functionality of regions of an mRNA including, for example, a 5′ cap, a 5′ untranslated region, a coding region, a 3′ untranslated region, and a polyA tail.
This invention further contemplates methods for delivering one or more vectors, or one or more mUNA molecules to a cell.
In some embodiments, one or more mUNA molecules can be delivered to a cell, in vitro, ex vivo, or in vivo. Viral and non-viral transfer methods as are known in the art can be used to introduce mUNA molecules in mammalian cells. mUNA molecules can be delivered with a pharmaceutically acceptable vehicle, or for example, encapsulated in a liposome.
A peptide or protein expressed by a mUNA molecule can be any peptide or protein, endogenous or exogenous in nature with respect to a eukaryotic cell, and may be a synthetic or non-natural peptide or protein with activity or effect in the cell.
In some embodiments, mUNA structures and compositions of this invention can reduce the number and frequency of transfections required for cell-fate manipulation in culture as compared to utilizing native compositions.
In additional aspects, this invention provides increased activity for mUNA-based drugs as compared to utilizing native compositions, and can reduce the dose levels required for efficacious therapy.
In further aspects, this invention provides increased activity for mUNA-based molecules, as compared to utilizing a native mRNA as active agent.
In some aspects, this invention can provide mUNA molecules that may reduce the cellular innate immune response, as compared to that induced by a natural nucleic acid, peptide or protein.
In further aspects, embodiments of this invention can provide increased efficacy for single-dose therapeutic modalities, including mUNA immunization and immunotherapies.
This invention can provide synthetic mUNA molecules that are refractory to deadenylation as compared to native molecules.
In certain embodiments, this invention can provide synthetic mUNA molecules with increased specific activity and longer functional half-life as compared to native molecules. The synthetic mUNA molecules of this invention can provide increased levels of ectopic protein expression. When using a mUNA molecule as a vector, cellular-delivery can be at increased levels, and cytotoxic innate immune responses can be restrained so that higher levels of ectopic protein expression can be achieved. The mUNA molecules of this invention can have increased specific activity and longer functional half-life than mRNAs.
In certain aspects, a mUNA molecule may have a number of mutations from a native mRNA, or from a disease associated mRNA.
In further embodiments, this invention can provide mUNA molecules having cleavable delivery and targeting moieties attached at the 3′ end.
In general, the specific activity for a synthetic translatable molecule delivered by transfection can be viewed as the number of molecules of protein expressed per delivered transcript per unit time.
As used herein, translation efficiency refers to a measure of the production of a protein or polypeptide by translation of a messenger molecule in vitro or in vivo.
This invention provides a range of mUNA molecules, which can contain one or more UNA monomers, and a number of nucleic acid monomers, wherein the mUNA molecule can be translated to express a polypeptide or protein.
In some embodiments, this invention includes a range of mUNA molecules, which contain one or more UNA monomers in one or more untranslated regions, and a number of nucleic acid monomers, wherein the mUNA molecule can be translated to express a polypeptide or protein.
In some embodiments, this invention includes a range of mUNA molecules, which contain one or more UNA monomers in a tail region or monomers, and a number of nucleic acid monomers, wherein the mUNA molecule can be translated to express a polypeptide or protein.
In some embodiments, a mUNA molecule can contain a modified 5′ cap.
In some embodiments, a mUNA molecule can contain one ore more UNA monomers in a 5′ cap.
In further embodiments, a mUNA molecule can contain a translation enhancing 5′ untranslated region of monomers.
In further embodiments, a mUNA molecule can contain one or more UNA monomers in a 5′ untranslated region.
In additional embodiments, a mUNA molecule can contain a translation enhancing 3′ untranslated region of monomers.
In additional embodiments, a mUNA molecule can contain one or more UNA monomers in a 3′ untranslated region of monomers.
In additional embodiments, a mUNA molecule can contain one or more UNA monomers in a tail region of monomers.
In additional embodiments, a mUNA molecule can contain one or more UNA monomers in a polyA tail.
In another aspect, a mUNA molecule can exhibit at least 2-fold, 3-fold, 5-fold, or 10-fold increased translation efficiency in vivo as compared to a native mRNA that encodes the same translation product.
In another aspect, a mUNA molecule can produce at least 2-fold, 3-fold, 5-fold, or 10-fold increased polypeptide or protein in vivo as compared to a native mRNA that encodes the same polypeptide or protein.
In additional embodiments, this invention provides methods for treating a rare disease or condition in a subject by administering to the subject a composition containing a mUNA molecule.
In additional embodiments, this invention provides methods for treating a liver disease or condition in a subject by administering to the subject a composition containing a mUNA molecule.
Modalities for Peptides and Proteins
A mUNA molecule of this invention may be used for ameliorating, preventing or treating a disease through enzyme modulation or replacement. In these embodiments, a mUNA molecule of this invention can be administered to regulate, modulate, increase, or decrease the concentration or effectiveness of a natural enzyme in a subject.
In some aspects, the enzyme can be an unmodified, natural enzyme for which the patient has an abnormal quantity.
In some embodiments, a mUNA molecule can be delivered to cells or subjects, and translated to supply increased levels of the natural enzyme.
A mUNA molecule of this invention may be used for ameliorating, preventing or treating a disease through modulation or introduction of a peptide or protein. In these embodiments, a mUNA molecule of this invention can be administered to regulate, modulate, increase, or decrease the concentration or effectiveness of a peptide or protein in a subject, where the peptide or protein is non-natural or mutated, as compared to a native peptide or protein.
In some aspects, the peptide or protein can be a modified, non-natural, exogenous, or synthetic peptide or protein, which has a pharmacological effect in a subject.
In some embodiments, a mUNA molecule can be delivered to cells or subjects, and translated to supply a concentration of the peptide or protein.
Examples of diseases for enzyme modulation include lysosomal diseases, for example, Gaucher disease, Fabry disease, Mucopolysaccharidoses (MPS) and related diseases including MPS I, MPS II (Hunter syndrome), and MPS VI, as well as Glycogen storage disease type II.
Examples of diseases for enzyme modulation include hematologic diseases, for example, sickle-cell disease, thalassemia, methemoglobinemia, anemia due to deficiency of hemoglobin or B12 intrinsic factor, spherocytosis, glucose-6-phosphate dehydrogenase deficiency, and pyruvate kinase deficiency.
Examples of diseases for enzyme modulation include hemophilia, Von Willebrand disease, Protein S deficiency, age-related macular degeneration, trinucleotide repeat disorders, muscular dystrophy, insertion mutation diseases, DNA repair-deficiency disorders, and deletion mutation diseases.
Rare Diseases
Examples of diseases and/or conditions for which the mUNA molecules of this invention can be translatable to provide an active agent include those in Table 1.
| TABLE 1 |
| Rare diseases |
| RARE DISEASE | DEFICIENCY |
| Aminoacylase 1 deficiency | Aminoacylase 1 |
| Apo A-I deficiency | Apo A-I |
| Carbamoyl phosphate synthetase 1 | Carbamoyl phosphate synthetase 1 |
| deficiency | |
| Ornithine transcarbamylase | Ornithine transcarbamylase |
| deficiency | |
| Plasminogen activator inhibitor | Plasminogen activator inhibitor type 1 |
| type 1 deficiency | |
| Flaujeac factor deficiency | Flaujeac factor (High-molecular-weight kininogen) |
| High-molecular-weight kininogen | High-molecular-weight kininogen (Flaujeac factor) |
| deficiency congenital | |
| PEPCK 1 deficiency | PEPCK 1 |
| Pyruvate kinase deficiency liver | Pyruvate kinase liver type |
| type | |
| Alpha 1-antitrypsin deficiency | Alpha 1-antitrypsin |
| Anti-plasmin deficiency congenital | Anti-plasmin |
| Apolipoprotein C 2I deficiency | Apolipoprotein C 2I |
| Butyrylcholinesterase deficiency | Butyrylcholinesterase |
| Complement component 2 | Complement component 2 |
| deficiency | |
| Complement component 8 | Complement component 8 type 2 |
| deficiency type 2 | |
| Congenital antithrombin | Antithrombin |
| deficiency type 1 | |
| Congenital antithrombin | Antithrombin, type 2 |
| deficiency type 2 | |
| Congenital antithrombin | Antithrombin, type 3 |
| deficiency type 3 | |
| Cortisone reductase deficiency 1 | Cortisone reductase |
| Factor VII deficiency | Factor VII |
| Factor X deficiency | Factor X |
| Factor XI deficiency | Factor XI |
| Factor XII deficiency | Factor XII |
| Factor XIII deficiency | Factor XIII |
| Fibrinogen deficiency congenital | Fibrinogen |
| Fructose-1 6-bisphosphatase | Fructose-1 6-bisphosphatase |
| deficiency | |
| Gamma aminobutyric acid | Gamma aminobutyric acid transaminase |
| transaminase deficiency | |
| Gamma-cystathionase deficiency | Gamma-cystathionase |
| Glut2 deficiency | Glut2 |
| GTP cyclohydrolase I deficiency | GTP cyclohydrolase I |
| Isolated growth hormone | Isolated growth hormone type 1B |
| deficiency type 1B | |
| Molybdenum cofactor deficiency | Molybdenum cofactor |
| Prekallikrein deficiency congenital | Prekallikrein |
| Proconvertin deficiency congenital | Proconvertin |
| Protein S deficiency | Protein S |
| Pseudocholinesterase deficiency | Pseudocholinesterase |
| Stuart factor deficiency congenital | Stuart factor |
| Tetrahydrobiopterin deficiency | Tetrahydrobiopterin |
| Type 1 plasminogen deficiency | Plasminogen |
| Urocanase deficiency | Urocanase |
| Chondrodysplasia punctata with | Chondrodysplasia punctata with steroid sulfatase/X- |
| steroid sulfatase deficiency | linked chondrodysplasia punctata 1 |
| Homocystinuria due to CBS | CBS |
| deficiency | |
| Guanidinoacetate | Guanidinoacetate methyltransferase |
| methyltransferase deficiency | |
| Pulmonary surfactant protein B | Pulmonary surfactant protein B |
| deficiency | |
| Aminoacylase 1 deficiency | Aminoacylase 1 |
| Acid Sphingomyelinase | Enzyme found in lysosomes, responsible for conversion of |
| Deficiency | lipid sphingomyelin into lipid ceramide |
| Adenylosuccinate Lyase | Neurological disorder, brain dysfunction (encephalopathy) |
| Deficiency | and to delayed development of mental and movement |
| abilities, autistic behaviors and seizures | |
| Aggressive Angiomyxoma | Myxoid tumor involving the blood vessels, may be a non- |
| metastasizing benign tumor | |
| Albrights Hereditary | Inherited in an autosomal dominant pattern, lack of |
| Osteodystrophy | responsiveness to parathyroid hormone, low serum |
| calcium, high serum phosphate | |
| Carney Stratakis Syndrome | Very rare syndrome characterized by gastrointestinal |
| stromal tumors and paragangliomas. | |
| Carney Triad Syndrome | Characterized by the coexistence of 3 types of neoplasms, |
| mainly in young women, including gastric gastrointestinal | |
| stromal tumor, pulmonary chondroma, and extra-adrenal | |
| paraganglioma | |
| CDKL5 Mutation | Results in severe neurodevelopmental impairment and early |
| onset, difficult to control seizures | |
| CLOVES Syndrome | Complex vascular anomalies: Congenital, Lipomatous |
| Overgrowth, Vascular malformations, Epidermal nevi and | |
| Scoliosis/Skeletal/Spinal anomalies | |
| Cockayne Syndrome | Characterized by short stature and an appearance of |
| premature aging, failure to gain weight, abnormally small | |
| head size, and impaired development of the nervous system | |
| Congenital Disorder of | Rare inborn errors of metabolism involving deficient or |
| Glycosylation type 1R | defective glycosylation |
| Cowden Syndrome | Characterized by multiple noncancerous, tumor-like |
| growths called hamartomas and an increased risk of | |
| developing certain cancers | |
| DEND Syndrome | Generally severe form of neonatal diabetes mellitus |
| characterized by a triad of developmental delay, epilepsy, | |
| and neonatal diabetes | |
| Dercum's Disease | Characterized by multiple, and painful lipomas. These |
| lipomas mainly occur on the trunk, the upper arms and | |
| upper legs | |
| Febrile Infection-Related Epilepsy | Explosive-onset, potentially fatal acute epileptic |
| Syndrome | encephalopathy, develops in previously healthy children |
| and adolescents following the onset of a non-specific | |
| febrile illness | |
| Fibular Aplasia Tibial Campomelia | Unknown genetic basis and inheritance with variable |
| Oligosyndactyly Syndrome | expressivity and penetrance |
| Food Protein-Induced Enterocolitis | A non-IgE mediated immune reaction in the gastrointestinal |
| Syndrome | system to one or more specific foods, commonly |
| characterized by profuse vomiting and diarrhea | |
| Foreign Body Giant Cell Reactive | Collection of fused macrophages which are generated in |
| Tissue Disease | response to the presence of a large foreign body; |
| particularly evident with implants that cause the body | |
| chronic inflammation and foreign body response | |
| Galloway-Mowat | Physical features may include an unusually small head and |
| additional abnormalities of the head and facial area; | |
| damage to clusters of capillaries in the kidneys resulting in | |
| abnormal kidney function; and, in many cases, protrusion | |
| of part of the stomach through an abnormal opening in the | |
| diaphragm | |
| Gitelman syndrome | Autosomal recessive kidney disorder characterized by |
| hypokalemic metabolic alkalosis with hypocalciuria, and | |
| hypomagnesemia. | |
| Glycerol Kinase Deficiency | X-linked recessive enzyme defect that is heterozygous in |
| nature, responsible gene in a region containing genes in | |
| which deletions can cause DMD and adrenal hypoplasia | |
| congenita | |
| Glycogen Storage Disease type 9 | Caused by the inability to break down glycogen. The |
| different forms of the condition can affect glycogen | |
| breakdown in liver cells, muscle cells or both | |
| gm1 gangliosidosis | Autosomal recessive lysosomal storage disease |
| characterized by accumulation of ganglioside substrates in | |
| lysosomes | |
| Hereditary spherocytosis | Affects red blood cells, shortage of red blood cells, |
| yellowing of the eyes and skin, and an enlarged spleen | |
| Hidradenitis Suppurativa Stage III | Disorder of the terminal follicular epithelium in the |
| apocrine gland-bearing skin, frequently causing keloids, | |
| contractures, and immobility. Stage III is defined as | |
| multiple lesions, with more extensive sinus tracts and | |
| scarring | |
| Horizonatal Gaze Palsy with | Disorder that affects vision and also causes an abnormal |
| Progressive Scoliosis | curvature of the spine |
| IMAGe syndrome | The combination of intrauterine growth restriction, |
| metaphyseal dysplasia, adrenal hypoplasia congenita, and | |
| genital anomalies (only about 20 cases reported in the | |
| medical literature) | |
| Isodicentric 15 | Chromosome abnormality in which a child is born with |
| extra genetic material from chromosome 15 | |
| isolated hemihyperplasia | One side of the body grows more than other, causing |
| asymmetry | |
| Juvenile Xanthogranuloma | Usually benign and self-limiting. It occurs most often in the |
| skin of the head, neck, and trunk but can also occur in the | |
| arms, legs, feet, and buttocks | |
| Kasabach-Merritt Syndrome | A vascular tumor leads to decreased platelet counts and |
| sometimes other bleeding problems | |
| Kniest Dysplasia | Disorder of bone growth characterized by short stature |
| (dwarfism) with other skeletal abnormalities and problems | |
| with vision and hearing | |
| Koolen de-Vries Syndrome | Disorder characterized by developmental delay and mild to |
| moderate intellectual disability. They usually have weak | |
| muscle tone in childhood. About half have recurrent | |
| seizures | |
| Lennox-Gastaut syndrome | Type of epilepsy with multiple different types of seizures, |
| particularly tonic (stiffening) and atonic (drop) seizures. | |
| Intellectual development is usually, but not always, | |
| impaired | |
| Lymphangiomatosis | Congenital and can affect any of the body's systems except |
| the central nervous system (including the brain) | |
| Lymphangiomiomytosis | Can occur either sporadically or in association with the |
| tuberous sclerosis complex (TSC) and is often considered a | |
| forme fruste of TSC | |
| MASA Syndrome | X-linked recessive neurological disorder |
| Mast Cell Activation disorder | Condition with signs and symptoms involving the skin, |
| gastrointestinal, cardiovascular, respiratory, and neurologic | |
| systems | |
| Mecp2 Duplication Syndrome | Genetic neurodevelopmental disorder characterized by low |
| muscle tone, potentially severe intellectual disability, | |
| developmental delays, recurrent respiratory infections, | |
| speech abnormalities, seizures, and progressive spasticity | |
| Mucha Habermann | Skin disorder |
| Neonatal Hemochromatosis | Severe liver disease of fetal or perinatal onset, associated |
| with deposition of stainable iron in extrahepatic sites, | |
| disordered iron handling due to injury to the perinatal liver, | |
| as a form of fulminant hepatic failure | |
| N-glycanase deficiency | The encoded enzyme may play a role in the proteasome- |
| mediated degradation of misfolded glycoproteins | |
| Opsoclonus Myoclonus Syndrome | Neurological disorder of unknown causes which appears to |
| be the result of an autoimmune process involving the | |
| nervous system | |
| Persistent genital arousal disorder | Results in a spontaneous, persistent, and uncontrollable |
| genital arousal, with or without orgasm or genital | |
| engorgement, unrelated to any feelings of sexual desire | |
| Pompe Disease | Inherited disorder caused by the buildup of glycogen in the |
| body's cells. The accumulation of glycogen in certain | |
| organs and tissues, especially muscles, impairs their ability | |
| to function normally | |
| Progressive Familial Intrahepatic | Disorder that causes progressive liver disease, which |
| Cholestasis | typically leads to liver failure. In people with PFIC, liver |
| cells are less able to secrete a digestive fluid called bile. | |
| The buildup of bile in liver cells causes liver disease in | |
| affected individuals | |
| Pseudohypoparathyroidism type 1a | Characterized by renal resistance to parathyroid hormone, |
| resulting in hypocalcemia, hyperphosphatemia, and | |
| elevated PTH; resistance to other hormones including | |
| thydroid stimulating hormone, gonadotropins and growth- | |
| hormone-releasing hormone | |
| PTEN Hamartoma Tumor | The gene was identified as a tumor suppressor that is |
| Syndrome | mutated in a large number of cancers at high frequency |
| Schnitzler syndrome | Characterised by chronic hives and periodic fever, bone |
| pain and joint pain (sometimes with joint inflammation), | |
| weight loss, malaise, fatigue, swollen lymph glands and | |
| enlarged spleen and liver | |
| Scleroderma | Chronic hardening and tightening of the skin and |
| connective tissues | |
| Semi Lobar Holoprosencephany | Holoprosencephany: birth defect of the brain, which often |
| can also affect facial features, including closely spaced | |
| eyes, small head size, and sometimes clefts of the lip and | |
| roof of the mouth. Semilobar holoprosencephaly is a | |
| subtype of holoprosencephaly characterised by an | |
| incomplete forebrain division | |
| Sjogren's Syndrome | Immune system disorder characterized by dry eyes and dry |
| mouth | |
| Specific Antibody Deficiency | Immune |
| Disease | |
| SYNGAP 1 | A ras GTPase-activating protein that is critical for the |
| development of cognition and proper synapse function | |
| Trigeminal Trophic Syndrome | This is the wing of tissue at the end of the nose above the |
| nostril. Trigeminal trophic syndrome is due to damage to | |
| the trigeminal nerve | |
| Undiffentiated Connective Tissue | Systemic autoimmune disease |
| Disease | |
| X-linked hypophosphatemia | X-linked dominant form of rickets (or osteomalacia) that |
| differs from most cases of rickets in that ingestion of | |
| vitamin D is relatively ineffective. It can cause bone | |
| deformity including short stature and genu varum | |
Modalities for Immune Modulation
The mUNA molecules of this invention can be translatable to provide an active protein. In certain embodiments, a translatable mUNA molecule can provide an active mRNA immunization agent, or an mRNA vaccine component.
A mUNA vaccine of this disclosure can advantageously provide a safe and efficacious genetic vaccine by inducing an immune response having both cellular and humoral components. In general, protein can be expressed using a mUNA vaccine of this invention.
In some embodiments, a mUNA vaccine can advantageously provide protein synthesis in the cytoplasm. In certain embodiments, a mUNA vaccine of this invention can provide internalization, release and transport of an exogenous mRNA in the cytoplasm.
In certain aspects, a mUNA vaccine of this invention can encode for a protein antigen that can be translated by host cells.
In further aspects, some mUNA vaccines of this disclosure can encode for tumor antigens, viral antigens, or allergens.
Modalities for administering a mUNA vaccine of this invention can include intravenous, intranodal, intradermal, subcutaneous and intrasplenic.
Embodiments of this invention further provide mUNA vaccines having increased half-life of translation, which can be used to reduce the necessary dose and exposure to antigen, and reduce the risk of inducing tolerance.
A mUNA vaccine of this invention can provide an immunological effect without the risk of integration of a component into the genome, and may reduce the risk of mutagenesis as compared to other genetic vaccines.
Additional embodiments of this disclosure include mUNA molecules having translational activity, where the translational activity can be described by a cytoplasmic half-life in a mammalian cell. The half-life can be determined by the time required for 50% of the mUNA molecule to be degraded in the cell.
A translatable mUNA molecule of this invention can be a precursor of an active molecule, which can be used in the treatment of a condition or disease in a subject.
In some embodiments, a translatable mUNA molecule of this invention can be a pharmacologically active molecule having increased half-life in the cytoplasm of mammalian cells.
Examples of mUNA molecules of this invention include a mUNA molecule that provides an mRNA encoding HIV-1 gag antigen, a mUNA molecule that provides an mRNA encoding antigens overexpressed in lung cancers, a mUNA molecule that provides an mRNA encoding malarial P. falciparum reticulocyte-binding protein homologue 5 (PfRHS), and a mUNA molecule that provides an mRNA encoding malarial Plasmodium falciparum PfSEA-1, a 244 KD malaria antigen expressed in schizont-infected RBCs.
UNA Monomers and Oligomers
In some embodiments, linker group monomers can be unlocked nucleomonomers (UNA monomers), which are small organic molecules based on a propane-1,2,3-tri-yl-trisoxy structure as shown below:
where R1 and R2 are H, and R1 and R2 can be phosphodiester linkages, Base can be a nucleobase, and R3 is a functional group described below.
In another view, the UNA monomer main atoms can be drawn in IUPAC notation as follows:
where the direction of progress of the oligomer chain is from the 1-end to the 3-end of the propane residue.
Examples of a nucleobase include uracil, thymine, cytosine, 5-methylcytosine, adenine, guanine, inosine, and natural and non-natural nucleobase analogues.
Examples of a nucleobase include pseudouracil, 1-methylpseudouracil, and 5-methoxyuracil.
In general, a UNA monomer, which is not a nucleotide, can be an internal linker monomer in an oligomer. An internal UNA monomer in an oligomer is flanked by other monomers on both sides.
A UNA monomer can participate in base pairing when the oligomer forms a complex or duplex, for example, and there are other monomers with nucleobases in the complex or duplex.
Examples of UNA monomer as internal monomers flanked at both the propane-1-yl position and the propane-3-yl position, where R3 is —OH, are shown below.
A UNA monomer can be a terminal monomer of an oligomer, where the UNA monomer is attached to only one monomer at either the propane-1-yl position or the propane-3-yl position. Because the UNA monomers are flexible organic structures, unlike nucleotides, the terminal UNA monomer can be a flexible terminator for the oligomer.
Examples of a UNA monomer as a terminal monomer attached at the propane-3-yl position are shown below.
Because a UNA monomer can be a flexible molecule, a UNA monomer as a terminal monomer can assume widely differing conformations. An example of an energy minimized UNA monomer conformation as a terminal monomer attached at the propane-3-yl position is shown below.
UNA-A terminal forms: the dashed bond shows the propane-3-yl attachment
Among other things, the structure of the UNA monomer allows it to be attached to naturally-occurring nucleotides.
A UNA oligomer can be a chain composed of UNA monomers, as well as various nucleotides that may be based on naturally-occurring nucleosides.
In some embodiments, the functional group R3 of a UNA monomer can be —OR4, —SR4, —NR42, —NH(C═O)R4, morpholino, morpholin-1-yl, piperazin-1-yl, or 4-alkanoyl-piperazin-1-yl, where R4 is the same or different for each occurrence, and can be H, alkyl, a cholesterol, a lipid molecule, a polyamine, an amino acid, or a polypeptide.
The UNA monomers are organic molecules. UNA monomers are not nucleic acid monomers or nucleotides, nor are they naturally-occurring nucleosides or modified naturally-occurring nucleosides.
A UNA oligomer of this invention is a synthetic chain molecule.
In some embodiments, as shown above, a UNA monomer can be UNA-A (designated Ã), UNA-U (designated Ũ), UNA-C (designated {hacek over (C)}) and UNA-G (designated {hacek over (G)}).
Designations that may be used herein include mA, mG, mC, and mU, which refer to the 2′-O-Methyl modified ribonucleotides.
Designations that may be used herein include dT, which refers to a 2′-deoxy T nucleotide.
Additional Monomers for Oligomers
As used herein, in the context of oligomer sequences, the symbol X represents a UNA monomer. When a mUNA oligomer is complexed or duplexed with a nucleic acid molecule, the UNA monomers of the mUNA oligomer can have any base attached that would be complementary to the monomer with which it is paired in the nucleic acid molecule.
As used herein, in the context of oligomer sequences, the symbol N can represent any natural nucleotide monomer, or any modified nucleotide monomer. When a mUNA oligomer is complexed or duplexed with a nucleic acid molecule, an N monomer of the mUNA oligomer can have any base attached that would be complementary to the monomer with which it is paired in the nucleic acid molecule.
As used herein, in the context of oligomer sequences, the symbol Q represents a non-natural, modified, or chemically-modified nucleotide monomer. When a mUNA oligomer is complexed or duplexed with a nucleic acid molecule, a Q monomer of the mUNA oligomer can have any base attached that would be complementary to the monomer with which it is paired in the nucleic acid molecule.
Examples of nucleic acid monomers include non-natural, modified, and chemically-modified nucleotides, including any such nucleotides known in the art.
Examples of non-natural, modified, and chemically-modified nucleotide monomers include any such nucleotides known in the art, for example, 2′-O-methyl ribonucleotides, 2′-O-methyl purine nucleotides, 2′-deoxy-2′-fluoro ribonucleotides, 2′-deoxy-2′-fluoro pyrimidine nucleotides, 2′-deoxy ribonucleotides, 2′-deoxy purine nucleotides, universal base nucleotides, 5-C-methyl-nucleotides, and inverted deoxyabasic monomer residues.
Examples of non-natural, modified, and chemically-modified nucleotide monomers include 3′-end stabilized nucleotides, 3′-glyceryl nucleotides, 3′-inverted abasic nucleotides, and 3′-inverted thymidine.
Examples of non-natural, modified, and chemically-modified nucleotide monomers include locked nucleic acid nucleotides (LNA), 2′-O,4′-C-methylene-(D-ribofuranosyl) nucleotides, 2′-methoxyethoxy (MOE) nucleotides, 2′-methyl-thio-ethyl, 2′-deoxy-2′-fluoro nucleotides, and 2′-O-methyl nucleotides.
Examples of non-natural, modified, and chemically-modified nucleotide monomers include 2′, 4′-Constrained 2′-O-Methoxyethyl (cMOE) and 2′-O-Ethyl (cEt) Modified DNAs.
Examples of non-natural, modified, and chemically-modified nucleotide monomers include 2′-amino nucleotides, 2′-O-amino nucleotides, 2′-C-allyl nucleotides, and 2′-O-allyl nucleotides.
Examples of non-natural, modified, and chemically-modified nucleotide monomers include N6-methyladenosine nucleotides.
Examples of non-natural, modified, and chemically-modified nucleotide monomers include nucleotide monomers with modified bases 5-(3-amino)propyluridine, 5-(2-mercapto)ethyluridine, 5-bromouridine; 8-bromoguanosine, or 7-deazaadenosine.
Examples of non-natural, modified, and chemically-modified nucleotide monomers include 2′-O-aminopropyl substituted nucleotides.
Examples of non-natural, modified, and chemically-modified nucleotide monomers include replacing the 2′-OH group of a nucleotide with a 2′-R, a 2′-OR, a 2′-halogen, a 2′-SR, or a 2′-amino, where R can be H, alkyl, alkenyl, or alkynyl.
Examples of nucleotide monomers include pseudouridine (psi-Uridine) and 1-methylpseudouridine.
Some examples of modified nucleotides are given in Saenger, Principles of Nucleic Acid Structure, Springer-Verlag, 1984.
mUNA Compounds
Aspects of this invention provide structures and compositions for mUNA molecules that are oligomeric compounds. The mUNA compounds can be active agents for pharmaceutical compositions.
An oligomeric mUNA agent of this invention may contain one or more UNA monomers. Oligomeric molecules of this invention can be used as active agents in formulations for supplying peptide and protein therapeutics.
In some embodiments, this invention provides oligomeric mUNA compounds having a structure that incorporates novel combinations of UNA monomers with certain natural nucleotides, non-natural nucleotides, modified nucleotides, or chemically-modified nucleotides.
Oligomeric mUNA compounds of this invention can have a length of from about 200 to about 12,000 bases in length. Oligomeric mUNA compounds of this invention can have a length of about 1800, or about 1900, or about 2000, or about 2100, or about 2200, or about 2300, or about 2400, or about 2500 bases.
In further aspects, the oligomeric mUNA compounds of this invention can be pharmacologically active molecules. A mUNA molecule can be used as an active pharmaceutical ingredient for generating a peptide or protein active agent in vitro, in vivo, or ex vivo.
A mUNA molecule of this invention can have the structure of Formula I
wherein L1 is a linkage, n is from 200 to 12,000, and for each occurrence L2 is a UNA linker group having the formula —C1—C2—C3—, where R is attached to C2 and has the formula —OCH(CH2R3)R5, where R3 is —OR4, —SR4, —NR42, —NH(C═O)R4, morpholino, morpholin-1-yl, piperazin-1-yl, or 4-alkanoyl-piperazin-1-yl, where R4 is the same or different for each occurrence and is H, alkyl, a cholesterol, a lipid molecule, a polyamine, an amino acid, or a polypeptide, and where R5 is a nucleobase, or L2(R) is a sugar such as a ribose and R is a nucleobase, or L2 is a modified sugar such as a modified ribose and R is a nucleobase. In certain embodiments, a nucleobase can be a modified nucleobase. L1 can be a phosphodiester linkage.
The base sequence of a mUNA molecule can be any sequence of nucleobases.
In some aspects, a mUNA molecule of this invention can have any number of phosphorothioate intermonomer linkages in any intermonomer location.
In some embodiments, any one or more of the intermonomer linkages of a mUNA molecule can be a phosphodiester, a phosphorothioate including dithioates, a chiral phosphorothioate, and other chemically modified forms.
When a mUNA molecule terminates in a UNA monomer, the terminal position has a 1-end, or the terminal position has a 3-end, according to the positional numbering shown above.
mUNA Molecules with Enhanced Translation
A mUNA molecule of this invention can incorporate a region that enhances the translational efficiency of the mUNA molecule.
In general, translational enhancer regions as known in the art can be incorporated into the structure of a mUNA molecule to increase peptide or protein yields.
A mUNA molecule containing a translation enhancer region can provide increased production of peptide or protein.
In some embodiments, a translation enhancer region can comprise, or be located in a 5′ or 3′ untranslated region of a mUNA molecule.
Examples of translation enhancer regions include naturally-occurring enhancer regions from TEV 5′UTR and Xenopus beta-globin 3′UTR.
mUNA Molecular Structure and Sequences
A mUNA molecule can be designed to express a target peptide or protein. In some embodiments, the target peptide or protein can be associated with a condition or disease in a subject.
In some aspects, the base sequence of a mUNA molecule can include a portion that is identical to at least an effective portion or domain of a base sequence of an mRNA, where an effective portion is sufficient to impart a therapeutic activity to a translation product of the mUNA molecule.
In some aspects, this invention provides active mUNA oligomer molecules having a base sequence identical to at least a fragment of a native nucleic acid molecule of a cell.
In certain embodiments, the base sequence of a mUNA molecule can include a portion that is identical to a base sequence of an mRNA, except for one or more base mutations. The number of mutations for the mUNA molecule should not exceed an amount that would produce a translation product of the mUNA molecule having substantially less activity than the mRNA.
The oligomer mUNA molecules of this invention can display a sequence of nucleobases, and can be designed to express a peptide or protein, in vitro, ex vivo, or in vivo. The expressed peptide or protein can have activity in various forms, including activity corresponding to protein expressed from a native or natural mRNA.
In some embodiments, a mUNA molecule of this invention may have a chain length of about 400 to 15,000 monomers, where any monomer that is not a UNA monomer can be a Q monomer.
mUNA Molecular Cap Structure
A mUNA molecule of this invention may have a 5′-end capped with various groups and their analogues as are known in the art. The 5′ cap may be a m7GpppGm cap. The 5′ cap may be an ARCA cap (3′-OMe-m7G(5′)pppG). The 5′ cap may be an mCAP (m7G(5′)ppp(5′)G, N7-Methyl-Guanosine-5′-Triphosphate-5′-Guanosine). The 5′ cap may be resistant to hydrolysis.
Some examples of 5′ cap structures are given in WO2015/051169A2.
Genetic Basis for mUNA Molecules
In some embodiments, the mUNA molecules of this invention can be structured to provide peptides or proteins that are nominally expressed by any portion of a genome. Examples of genes for which a mUNA molecule can be used to express the corresponding peptide or protein are set forth below.
Examples of genes for which a mUNA molecule can be used to express the corresponding peptide or protein include: Neoplasia, PTEN; ATM; ATR; EGFR; ERBB2; ERBB3; ERBB4; Notch1; Notch2; Notch3; Notch4; AKT; AKT2; AKT3; HIF; HIF1a; HIF3a; Met; HRG; Bc12; PPAR alpha; PPAR gamma; WT1 (Wilms Tumor); FGF Receptor Family members (5 members: 1, 2, 3, 4, 5); CDKN2a; APC; RB (retinoblastoma); MEN1; VHL; BRCA1; BRCA2; AR (Androgen Receptor); TSG101; IGF; IGF Receptor; Igf1 (4 variants); Igf2 (3 variants); Igf 1 Receptor; Igf 2 Receptor; Bax; Bc12; caspases family (9 members: 1, 2, 3, 4, 6, 7, 8, 9, 12); Kras; Apc.
Examples of genes for which a mUNA molecule can be used to express the corresponding peptide or protein include: Age-related Macular Degeneration, Schizophrenia, Aber; Cc12; Cc2; cp (ceruloplasmin); Timp3; cathepsinD; Vldlr; Ccr2 Neuregulin1 (Nrg 1); Erb4 (receptor for Neuregulin); Complexin1 (Cplx1); Tph1 Tryptophan hydroxylase; Tph2 Tryptophan hydroxylase 2; Neurexin 1; GSK3; GSK3a; GSK3b.
Examples of genes for which a mUNA molecule can be used to express the corresponding peptide or protein include: 5-HTT (Slc6a4); COMT; DRD (Drd1a); SLC6A3; DAOA; DTNBP1; Dao (Dao1).
Examples of genes for which a mUNA molecule can be used to express the corresponding peptide or protein include: Trinucleotide Repeat Disorders, HTT (Huntington's Dx); SBMA/SMAX1/AR (Kennedy's Dx); FXN/X25 (Friedrich's Ataxia); ATX3 (Machado-Joseph's Dx); ATXN1 and ATXN2 (spinocerebellar ataxias); DMPK (myotonic dystrophy); Atrophin-1 and Atn 1 (DRPLA Dx); CBP (Creb-BP-global instability); VLDLR (Alzheimer's); Atxn7; Atxn10.
Examples of genes for which a mUNA molecule can be used to express the corresponding peptide or protein include: Fragile X Syndrome, FMR2; FXR1; FXR2; mGLUR5.
Examples of genes for which a mUNA molecule can be used to express the corresponding peptide or protein include: Secretase Related Disorders, APH-1 (alpha and beta); Presenilin (Psen1); nicastrin (Ncstn); PEN-2.
Examples of genes for which a mUNA molecule can be used to express the corresponding peptide or protein include: Nos1.
Examples of genes for which a mUNA molecule can be used to express the corresponding peptide or protein include: Parp1.
Examples of genes for which a mUNA molecule can be used to express the corresponding peptide or protein include: Nat1; Nat2.
Examples of genes for which a mUNA molecule can be used to express the corresponding peptide or protein include: Prion-related disorders, Prp.
Examples of genes for which a mUNA molecule can be used to express the corresponding peptide or protein include: ALS disease, SOD1; ALS2; STEX; FUS; TARDBP; VEGF (VEGF-a; VEGF-b; VEGF-c).
Examples of genes for which a mUNA molecule can be used to express the corresponding peptide or protein include: Drug addiction, Prkce (alcohol); Drd2; Drd4; ABAT (alcohol); GRIA2; Grm5; Grin1; Htr1b; Grin2a; Drd3; Pdyn; Gria1 (alcohol).
Examples of genes for which a mUNA molecule can be used to express the corresponding peptide or protein include: Autism, Mecp2; BZRAP1; MDGA2; Sema5A; Neurexin 1; Fragile X (FMR2 (AFF2); FXR1; FXR2; Mglur5).
Examples of genes for which a mUNA molecule can be used to express the corresponding peptide or protein include: Alzheimer's Disease, E1; CHIP; UCH; UBB; Tau; LRP; PICALM; Clusterin; PS1; SORL1; CR1; Vld1r; Uba1; Uba3; CHIP28 (Aqp1, Aquaporin 1); Uch11; Uch13; APP.
Examples of genes for which a mUNA molecule can be used to express the corresponding peptide or protein include: Inflammation, 1L-10; IL-1 (1L-1a; IL-1b); 1L-13; IL-17 (IL-17a (CTLA8); IL-17b; IL-17c; IL-17d; IL-17f); II-23; Cx3er1; ptpn22; TNFa; NOD2/CARD15 for IBD; IL-6; 1L-12 (1L-12a; 1L-12b); CTLA4; Cx3cl1.
Examples of genes for which a mUNA molecule can be used to express the corresponding peptide or protein include: Parkinson's Disease, x-Synuclein; DJ-1; LRRK2; Parkin; PINK1.
Examples of genes for which a mUNA molecule can be used to express the corresponding peptide or protein include: Blood and coagulation diseases and disorders, Anemia (CDAN1, CDA1, RPS19, DBA, PKLR, PK1, NT5C3, UMPH1, PSN1, RHAG, RH50A, NRAMP2, SPTB, ALAS2, ANH1, ASB, ABCB7, ABC7, ASAT); Bare lymphocyte syndrome (TAPBP, TPSN, TAP2, ABCB3, PSF2, RING11, MHC2TA, C2TA, RFX5, RFXAP, RFX5), Bleeding disorders (TBXA2R, P2RX1, P2X1); Factor H and factor H-like 1 (HF1, CFH, HUS); Factor V and factor VIII (MCFD2); Factor VII deficiency (F7); Factor X deficiency (F10); Factor XI deficiency (F11); Factor XII deficiency (F12, HAF); Factor XIIIA deficiency (F13A1, F13A); Factor XIIIB deficiency (F13B); Fanconi anemia (FANCA, FACA, FA1, FA, FAA, FAAP95, FAAP90, FLJ34064, FANCB, FANCC, FACC, BRCA2, FANCD1, FANCD2, FANCD, FACD, FAD, FANCE, FACE, FANCF, XRCC9, FANCG, BRIP1, BACH1, FANCJ, PHF9, FANCL, FANCM, KIAA1596); Hemophagocytic lymphohistiocytosis disorders (PRF1, HPLH2, UNC13D, MUNC13-4, HPLH3, HLH3, FHL3); Hemophilia A (F8, F8C, HEMA); Hemophilia B (F9 Factor IX, HEMB), Hemorrhagic disorders (PI, ATT, F5); Leukocyde deficiencies and disorders (ITGB2, CD18, LCAMB, LAD, EIF2B1, EIF2BA, EIF2B2, EIF2B3, EIF2B5, LVWM, CACH, CLE, EIF2B4); Sickle cell anemia (HBB); Thalassemia (HBA2, HBB, HBD, LCRB, HBA1).
Examples of genes for which a mUNA molecule can be used to express the corresponding peptide or protein include: Cell dysregulation and oncology diseases and disorders, B-cell non-Hodgkin lymphoma (BCL7A, BCL7); Leukemia (TAL1 TCL5, SCL, TAL2, FLT3, NBS1, NBS, ZNFN1A1, IK1, LYF1, HOXD4, HOX4B, BCR, CML, PHL, ALL, ARNT, KRAS2, RASK2, GMPS, AF10, ARHGEF12, LARG, KIAA0382, CALM, CLTH, CEBPA, CEBP, CHIC2, BTL, FLT3, KIT, PBT, LPP, NPM1, NUP214, D9S46E, CAN, CAIN, RUNX1, CBFA2, AML1, WHSC1L1, NSD3, FLT3, AF1Q, NPM1, NUMA1, ZNF145, PLZF, PML, MYL, STAT5B, AF10, CALM, CLTH, ARL11, ARLTS1, P2RX7, P2X7, BCR, CML, PHL, ALL, GRAF, NF1, VRNF, WSS, NFNS, PTPN11, PTP2C, SHP2, NS1, BCL2, CCND1, PRAD1, BCL1, TCRA, GATA1, GF1, ERYF1, NFE1, ABL1, NQO1, DIA4, NMOR1, NUP214, D9S46E, CAN, CAIN).
Examples of genes for which a mUNA molecule can be used to express the corresponding peptide or protein include: Inflammation and immune related diseases and disorders, AIDS (KIR3DL1, NKAT3, NKB1, AMB11, KIR3DS1, IFNG, CXCL12, SDF1); Autoimmune lymphoproliferative syndrome (TNFRSF6, APT1, FAS, CD95, ALPS1A); Combined immuno-deficiency, (IL2RG, SCIDX1, SCIDX, IMD4); HIV-1 (CCL5, SCYA5, D17S136E, TCP228), HIV susceptibility or infection (IL10, CSIF, CMKBR2, CCR2, CMKBR5, CCCKR5 (CCR5)); Immuno-deficiencies (CD3E, CD3G, AICDA, AID, HIGM2, TNFRSF5, CD40, UNG, DGU, HIGM4, TNFSF5, CD40LG, HIGM1, IGM, FOXP3, IPEX, AIID, XPID, PIDX, TNFRSF14B, TACI); Inflammation (IL-10, IL-1 (IL-1a, IL-1b), IL-13, IL-17 (IL-17a (CTLA8), IL-17b, IL-17c, IL-17d, IL-17f, II-23, Cx3cr1, ptpn22, TNFa, NOD2/CARD15 for IBD, IL-6, IL-12 (IL-12a, IL-12b), CTLA4, Cx3c11); Severe combined immunodeficiencies (SCIDs) (JAK3, JAKL, DCLRE1C, ARTEMIS, SCIDA, RAG1, RAG2, ADA, PTPRC, CD45, LCA, IL7R, CD3D, T3D, IL2RG, SCIDX1, SCIDX, IMD4).
Examples of genes for which a mUNA molecule can be used to express the corresponding peptide or protein include: Metabolic, liver, kidney and protein diseases and disorders, Amyloid neuropathy (TTR, PALB); Amyloidosis (APOA1, APP, AAA, CVAP, AD1, GSN, FGA, LYZ, TTR, PALB); Cirrhosis (KRT18, KRT8, CIRH1A, NAIC, TEX292, KIAA1988); Cystic fibrosis (CFTR, BG213071, ABCC7, CF, MRP7); Glycogen storage diseases (SLC2A2, GLUT2, G6PC, G6PT, G6PT1, GAA, LAMP2, LAMPB, AGL, GDE, GBE1, GYS2, PYGL, PFKM); Hepatic adenoma, 142330 (TCF1, HNF1A, MODY3), Hepatic failure, early onset, and neurologic disorder (SCOD1, SCO1), Hepatic lipase deficiency (LIPC), Hepato-blastoma, cancer and carcinomas (CTNNB1, PDGFRL, PDGRL, PRLTS, AXIN1, AXIN, CTNNB1, TP53, P53, LFS1, IGF2R, MPRI, MET, CASP8, MCH5; Medullary cystic kidney disease (UMOD, HNFJ, FJHN, MCKD2, ADMCKD2); Phenylketonuria (PAH, PKU1, QDPR, DHPR, PTS); Polycystic kidney and hepatic disease (FCYT, PKHD1, ARPKD, PKD1, PKD2, PKD4, PKDTS, PRKCSH, G19P1, PCLD, SEC63).
Examples of genes for which a mUNA molecule can be used to express the corresponding peptide or protein include: Lipoprotein lipase, APOA1, APOC3 and APOA4.
Examples of genes for which a mUNA molecule can be used to express the corresponding peptide or protein include: Muscular/skeletal diseases and disorders, Becker muscular dystrophy (DMD, BMD, MYF6), Duchenne Muscular Dystrophy (DMD, BMD); Emery-Dreifuss muscular dystrophy (LMNA, LMN1, EMD2, FPLD, CMD1A, HGPS, LGMD1B, LMNA, LMN1, EMD2, FPLD, CMD1A); Facio-scapulohumeral muscular dystrophy (FSHMD1A, FSHD1A); Muscular dystrophy (FKRP, MDC1C, LGMD2I, LAMA2, LAMM, LARGE, KIAA0609, MDC1D, FCMD, TTID, MYOT, CAPN3, CANP3, DYSF, LGMD2B, SGCG, LGMD2C, DMDA1, SCG3, SGCA, ADL, DAG2, LGMD2D, DMDA2, SGCB, LGMD2E, SGCD, SGD, LGMD2F, CMD1L, TCAP, LGMD2G, CMD1N, TRIM32, HT2A, LGMD2H, FKRP, MDC1C, LGMD2I, TTN, CMD1G, TMD, LGMD2J, POMT1, CAV3, LGMD1C, SEPN1, SELN, RSMD1, PLEC1, PLTN, EBS1); Osteopetrosis (LRP5, BMND1, LRP7, LR3, OPPG, VBCH2, CLCN7, CLC7, OPTA2, OSTM1, GL, TCIRG1, TIRC7, OC116, OPTB1); Muscular atrophy (VAPB, VAPC, ALS8, SMN1, SMA1, SMA2, SMA3, SMA4, BSCL2, SPG17, GARS, SMAD1, CMT2D, HEXB, IGHMBP2, SMUBP2, CATF1, SMARD1).
Examples of genes for which a mUNA molecule can be used to express the corresponding peptide or protein include: Neurological and neuronal diseases and disorders, ALS (SOD1, ALS2, STEX, FUS, TARDBP, VEGF (VEGF-a, VEGF-b, VEGF-c); Alzheimer's Disease (APP, AAA, CVAP, AD1, APOE, AD2, PSEN2, AD4, STM2, APBB2, FE65L1, NOS3, PLAU, URK, ACE, DCP1, ACE1, MPO, PACIP1, PAXIP1L, PTIP, A2M, BLMH, BMH, PSEN1, AD3); Autism (Mecp2, BZRAP1, MDGA2, Sema5A, Neurexin 1, GLO1, MECP2, RTT, PPMX, MRX16, MRX79, NLGN3, NLGN4, KIAA1260, AUTSX2); Fragile X Syndrome (FMR2, FXR1, FXR2, mGLUR5); Huntington's disease and disease like disorders (HD, IT15, PRNP, PRIP, JPH3, JP3, HDL2, TBP, SCA17); Parkinson disease (NR4A2, NURR1, NOT, TINUR, SNCAIP, TBP, SCA17, SNCA, NACP, PARK1, PARK4, DJ1, PARK7, LRRK2, PARK8, PINK1, PARK6, UCHL1, PARK5, SNCA, NACP, PARK1, PARK4, PRKN, PARK2, PDJ, DBH, NDUFV2); Rett syndrome (MECP2, RTT, PPMX, MRX16, MRX79, CDKL5, STK9, MECP2, RTT, PPMX, MRX16, MRX79, x-Synuclein, DJ-1); Schizo-phrenia (Neuregulin1 (Nrg1), Erb4 (receptor for Neuregulin), Complexin1 (Cplx1), Tph1 Trypto-phan hydroxylase, Tph2, Tryptophan hydroxylase 2, Neurexin 1, GSK3, GSK3a, GSK3b, 5-HTT (S1c6a4), COMT, DRD (Drd1a), SLC6A3, DAOA, DTNBP1, Dao (Dao1)); Secretase Related Dis-orders (APH-1 (alpha and beta), Presenilin (Psen1), nicastrin, (Ncstn), PEN-2, Nos1, Parp1, Nat1, Nat2); Trinucleotide Repeat Disorders (HTT (Huntington's Dx), SBMA/SMAX1/AR (Kennedy's Dx), FXN/X25 (Friedrich's Ataxia), ATX3 (Machado-Joseph's Dx), ATXN1 and ATXN2 (spinocerebellar ataxias), DMPK (myotonic dystrophy), Atrophin-1 and Atn1 (DRPLA Dx), CBP (Creb-BP—global instability), VLDLR (Alzheimer's), Atxn7, Atxn10).
Examples of genes for which a mUNA molecule can be used to express the corresponding peptide or protein include: Occular diseases and disorders, Age-related macular degeneration (Aber, Cc12, Cc2, cp (ceruloplasmin), Timp3, cathepsinD, Vldlr, Ccr2); Cataract (CRYAA, CRYA1, CRYBB2, CRYB2, PITX3, BFSP2, CP49, CP47, CRYAA, CRYA1, PAX6, AN2, MGDA, CRYBA1, CRYB1, CRYGC, CRYG3, CCL, LIM2, MP19, CRYGD, CRYG4, BFSP2, CP49, CP47, HSF4, CTM, HSF4, CTM, MIP, AQP0, CRYAB, CRYA2, CTPP2, CRYBB1, CRYGD, CRYG4, CRYBB2, CRYB2, CRYGC, CRYG3, CCL, CRYAA, CRYA1, GJA8, CX50, CAE1, GJA3, CX46, CZP3, CAE3, CCM1, CAM, KRIT1); Corneal clouding and dystrophy (APOA1, TGFBI, CSD2, CDGG1, CSD, BIGH3, CDG2, TACSTD2, TROP2, M1S1, VSX1, RINX, PPCD, PPD, KTCN, COL8A2, FECD, PPCD2, PIP5K3, CFD); Cornea plana congenital (KERA, CNA2); Glaucoma (MYOC, TIGR, GLC1A, JOAG, GPOA, OPTN, GLC1E, FIP2, HYPL, NRP, CYP1B1, GLC3A, OPA1, NTG, NPG, CYP1B1, GLC3A); Leber congenital amaurosis (CRB1, RP12, CRX, CORD2, CRD, RPGRIP1, LCA6, CORD9, RPE65, RP20, AIPL1, LCA4, GUCY2D, GUC2D, LCA1, CORD6, RDH12, LCA3); Macular dystrophy (ELOVL4, ADMD, STGD2, STGD3, RDS, RP7, PRPH2, PRPH, AVMD, AOFMD, VMD2).
Examples of genes for which a mUNA molecule can be used to express the corresponding peptide or protein include: Epilepsy, myoclonic, EPM2A, MELF, EPM2 Lafora type, 254780 Epilepsy, myoclonic, NHLRC1, EPM2A, EPM2B Lafora type, 254780.
Examples of genes for which a mUNA molecule can be used to express the corresponding peptide or protein include: Duchenne muscular DMD, BMD dystrophy, 310200 (3) AIDS, delayed/rapid KIR3DL1, NKAT3, NKB1, AMB11, KIR3DS1 progression to (3).
Examples of genes for which a mUNA molecule can be used to express the corresponding peptide or protein include: AIDS, delayed/rapid KIR3DL1, NKAT3, NKB1, AMB11, KIR3DS1 progression to (3) AIDS, rapid IFNG progression to, 609423 (3) AIDS, resistance to CXCL12, SDF1 (3).
Examples of genes for which a mUNA molecule can be used to express the corresponding peptide or protein include: Alpha-1-Antitrypsin Deficiency, SERPINA1 [serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 1]; SERPINA2 [serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 2]; SERPINA3 [serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 3]; SERPINA5 [serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 5]; SERPINA6 [serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 6]; SERPINA7 [serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 7];” AND “SERPLNA6 (serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 6).
Examples of genes for which a mUNA molecule can be used to express the corresponding peptide or protein include: PI3K/AKT Signaling, PRKCE; ITGAM; ITGA5; IRAK1; PRKAA2; EIF2AK2; PTEN; EIF4E; PRKCZ; GRK6; MAPK1; TSC1; PLK1; AKT2; IKBKB; PIK3CA; CDK8; CDKN1B; NFKB2; BCL2; PIK3CB; PPP2R1A; MAPK8; BCL2L1; MAPK3; TSC2; ITGA1; KRAS; EIF4EBP1; RELA; PRKCD; NOS3; PRKAA1; MAPK9; CDK2; PPP2CA; PIM1; ITGB7; YWHAZ; ILK; TP53; RAF1.; IKBKG; RELB; DYRK1A; CDKN1A; ITGB1; MAP2K2; JAK1; AKT1; JAK2; PIK3R1; CHUK; PDPK1; PPP2R5C; CTNNB1.; MAP2K1; NFKB1; PAK3; ITGB3; CCND1; GSK3A; FRAP1; SFN; ITGA2; TTK; CSNK1A1; BRAF; GSK3B; AKT3; FOXO1; SGK; HSP90AA1; RPS6KB1.
Examples of genes for which a mUNA molecule can be used to express the corresponding peptide or protein include: ERK/MAPK Signaling, PRKCE; ITGAM; ITGA5; HSPB1; IRAK1; PRKAA2; EIF2AK2; RAC1; RAP1A; TLN1; EIF4E; ELK1; GRK6; MAPK1; RAC2; PLK1; AKT2; PIK3CA; CDK8; CREB1; PRKCI; PTK2; FOS; RPS6KA4; PIK3CB; PPP2R1A; PIK3C3; MAPK8; MAPK3; ITGA1; ETS1; KRAS; MYCN; EIF4EBP1; PPARG; PRKCD; PRKAA1; MAPK9; SRC; CDK2; PPP2CA; PIM1; PIK3C2A; ITGB7; YWHAZ; PPP1CC; KSR1; PXN; RAF1; FYN; DYRK1A; ITGB1; MAP2K2; PAK4; PIK3R1; STAT3; PPP2R5C; MAP2K1; PAK3; ITGB3; ESR1; ITGA2; MYC; TTK; CSNK1A1; CRKL; BRAF; ATF4; PRKCA; SRF; STAT1; SGK.
Examples of genes for which a mUNA molecule can be used to express the corresponding peptide or protein include: Serine/Threonine-Protein Kinase, CDK16; PCTK1; CDK5R1.
Examples of genes for which a mUNA molecule can be used to express the corresponding peptide or protein include: Glucocorticoid Receptor Signaling, RAC1; TAF4B; EP300; SMAD2; TRAF6; PCAF; ELK1; MAPK1; SMAD3; AKT2; IKBKB; NCOR2; UBE2I; PIK3CA; CREB1; FOS; HSPA5; NFKB2; BCL2; MAP3K14; STAT5B; PIK3CB; PIK3C3; MAPK8; BCL2L1; MAPK3; TSC22D3; MAPK10; NRIP1; KRAS; MAPK13; RELA; STAT5A; MAPK9; NOS2A; PBX1; NR3C1; PIK3C2A; CDKN1C; TRAF2; SERPINE1; NCOA3; MAPK14; TNF; RAF1; IKBKG; MAP3K7; CREBBP; CDKN1A; MAP2K2; JAK1; IL8; NCOA2; AKT1; JAK2; PIK3R1; CHUK; STAT3; MAP2K1; NFKB1; TGFBR1; ESR1; SMAD4; CEBPB; JUN; AR; AKT3; CCL2; MMP1; STAT1; IL6; HSP90AA1.
Examples of genes for which a mUNA molecule can be used to express the corresponding peptide or protein include: Axonal Guidance Signaling, PRKCE; ITGAM; ROCK1; ITGA5; CXCR4; ADAM12; IGF1; RAC1; RAP1A; E1F4E; PRKCZ; NRP1; NTRK2; ARHGEF7; SMO; ROCK2; MAPK1; PGF; RAC2; PTPN11; GNAS; AKT2; PIK3CA; ERBB2; PRKC1; PTK2; CFL1; GNAQ; PIK3CB; CXCL12; PIK3C3; WNT11; PRKD1; GNB2L1; ABL1; MAPK3; ITGA1; KRAS; RHOA; PRKCD; PIK3C2A; ITGB7; GLI2; PXN; VASP; RAF1; FYN; ITGB1; MAP2K2; PAK4; ADAM17; AKT1; PIK3R1; GLI1; WNT5A; ADAM10; MAP2K1; PAK3; ITGB3; CDC42; VEGFA; ITGA2; EPHA8; CRKL; RND1; GSK3B; AKT3; PRKCA.
Examples of genes for which a mUNA molecule can be used to express the corresponding peptide or protein include: Ephrin Receptor Signaling, PRKCE; ITGAM; ROCK1; ITGA5; CXCR4; IRAK1; PRKAA2; EIF2AK2; RAC1; RAP1A; GRK6; ROCK2; MAPK1; PGF; RAC2; PTPN11; GNAS; PLK1; AKT2; DOK1; CDK8; CREB1; PTK2; CFL1; GNAQ; MAP3K14; CXCL12; MAPK8; GNB2L1; ABL1; MAPK3; ITGA1; KRAS; RHOA; PRKCD; PRKAA1; MAPK9; SRC; CDK2; PIM1; ITGB7; PXN; RAF1; FYN; DYRK1A; ITGB1; MAP2K2; PAK4, AKT1; JAK2; STAT3; ADAM10; MAP2K1; PAK3; ITGB3; CDC42; VEGFA; ITGA2; EPHA8; TTK; CSNK1A1; CRKL; BRAF; PTPN13; ATF4; AKT3; SGK.
Examples of genes for which a mUNA molecule can be used to express the corresponding peptide or protein include: Actin Cytoskeleton Signaling, ACTN4; PRKCE; ITGAM; ROCK1; ITGA5; IRAK1; PRKAA2; EIF2AK2; RAC1; INS; ARHGEF7; GRK6; ROCK2; MAPK1; RAC2; PLK1; AKT2; PIK3CA; CDK8; PTK2; CFL1; PIK3CB; MYH9; DIAPH1; PIK3C3; MAPK8; F2R; MAPK3; SLC9A1; ITGA1; KRAS; RHOA; PRKCD; PRKAA1; MAPK9; CDK2; PIM1; PIK3C2A; ITGB7; PPP1CC; PXN; VIL2; RAF1; GSN; DYRK1A; ITGB1; MAP2K2; PAK4; PIP5K1A; PIK3R1; MAP2K1; PAK3; ITGB3; CDC42; APC; ITGA2; TTK; CSNK1A1; CRKL; BRAF; VAV3; SGK.
Examples of genes for which a mUNA molecule can be used to express the corresponding peptide or protein include: Huntington's Disease Signaling, PRKCE; IGF1; EP300; RCOR1.; PRKCZ; HDAC4; TGM2; MAPK1; CAPNS1; AKT2; EGFR; NCOR2; SP1; CAPN2; PIK3CA; HDAC5; CREB1; PRKC1; HSPA5; REST; GNAQ; PIK3CB; PIK3C3; MAPK8; IGF1R; PRKD1; GNB2L1; BCL2L1; CAPN1; MAPK3; CASP8; HDAC2; HDAC7A; PRKCD; HDAC11; MAPK9; HDAC9; PIK3C2A; HDAC3; TP53; CASP9; CREBBP; AKT1; PIK3R1; PDPK1; CASP1; APAF1; FRAP1; CASP2; JUN; BAX; ATF4; AKT3; PRKCA; CLTC; SGK; HDAC6; CASP3.
Examples of genes for which a mUNA molecule can be used to express the corresponding peptide or protein include: Apoptosis Signaling, PRKCE; ROCK1; BID; IRAK1; PRKAA2; EIF2AK2; BAK1; BIRC4; GRK6; MAPK1; CAPNS1; PLK1; AKT2; IKBKB; CAPN2; CDK8; FAS; NFKB2; BCL2; MAP3K14; MAPK8; BCL2L1; CAPN1; MAPK3; CASP8; KRAS; RELA; PRKCD; PRKAA1; MAPK9; CDK2; PIM1; TP53; TNF; RAF1; IKBKG; RELB; CASP9; DYRK1A; MAP2K2; CHUK; APAF1; MAP2K1; NFKB1; PAK3; LMNA; CASP2; BIRC2; TTK; CSNK1A1; BRAF; BAX; PRKCA; SGK; CASP3; BIRC3; PARP1.
Examples of genes for which a mUNA molecule can be used to express the corresponding peptide or protein include: B Cell Receptor Signaling, RAC1; PTEN; LYN; ELK1; MAPK1; RAC2; PTPN11; AKT2; IKBKB; PIK3CA; CREB1; SYK; NFKB2; CAMK2A; MAP3K14; PIK3CB; PIK3C3; MAPK8; BCL2L1; ABL1; MAPK3; ETS1; KRAS; MAPK13; RELA; PTPN6; MAPK9; EGR1; PIK3C2A; BTK; MAPK14; RAF1; IKBKG; RELB; MAP3K7; MAP2K2; AKT1; PIK3R1; CHUK; MAP2K1; NFKB1; CDC42; GSK3A; FRAP1; BCL6; BCL10; JUN; GSK3B; ATF4; AKT3; VAV3; RPS6KB1.
Examples of genes for which a mUNA molecule can be used to express the corresponding peptide or protein include: Leukocyte Extravasation Signaling, ACTN4; CD44; PRKCE; ITGAM; ROCK1; CXCR4; CYBA; RAC1; RAP1A; PRKCZ; ROCK2; RAC2; PTPN11; MMP14; PIK3CA; PRKCI; PTK2; PIK3CB; CXCL12; PIK3C3; MAPK8; PRKD1; ABL1; MAPK10; CYBB; MAPK13; RHOA; PRKCD; MAPK9; SRC; PIK3C2A; BTK; MAPK14; NOX1; PXN; VIL2; VASP; ITGB1; MAP2K2; CTNND1; PIK3R1; CTNNB1; CLDN1; CDC42; F11R; ITK; CRKL; VAV3; CTTN; PRKCA; MMP1; MMP9.
Examples of genes for which a mUNA molecule can be used to express the corresponding peptide or protein include: Integrin Signaling, ACTN4; ITGAM; ROCK1; ITGA5; RAC1; PTEN; RAP1A; TLN1; ARHGEF7; MAPK1; RAC2; CAPNS1; AKT2; CAPN2; P1K3CA; PTK2; PIK3CB; PIK3C3; MAPK8; CAV1; CAPN1; ABL1; MAPK3; ITGA1; KRAS; RHOA; SRC; PIK3C2A; ITGB7; PPP1CC; ILK; PXN; VASP; RAF1; FYN; ITGB1; MAP2K2; PAK4; AKT1; PIK3R1; TNK2; MAP2K1; PAK3; ITGB3; CDC42; RND3; ITGA2; CRKL; BRAF; GSK3B; AKT3.
Examples of genes for which a mUNA molecule can be used to express the corresponding peptide or protein include: Acute Phase Response Signaling, IRAK1; SOD2; MYD88; TRAF6; ELK1; MAPK1; PTPN11; AKT2; IKBKB; PIK3CA; FOS; NFKB2; MAP3K14; PIK3CB; MAPK8; RIPK1; MAPK3; IL6ST; KRAS; MAPK13; IL6R; RELA; SOCS1; MAPK9; FTL; NR3C1; TRAF2; SERPINE1; MAPK14; TNF; RAF1; PDK1; IKBKG; RELB; MAP3K7; MAP2K2; AKT1; JAK2; PIK3R1; CHUK; STAT3; MAP2K1; NFKB1; FRAP1; CEBPB; JUN; AKT3; IL1R1; IL6.
Examples of genes for which a mUNA molecule can be used to express the corresponding peptide or protein include: PTEN Signaling, ITGAM; ITGA5; RAC1; PTEN; PRKCZ; BCL2L11; MAPK1; RAC2; AKT2; EGFR; IKBKB; CBL; PIK3CA; CDKN1B; PTK2; NFKB2; BCL2; PIK3CB; BCL2L1; MAPK3; ITGA1; KRAS; ITGB7; ILK; PDGFRB; INSR; RAF1; IKBKG; CASP9; CDKN1A; ITGB1; MAP2K2; AKT1; PIK3R1; CHUK; PDGFRA; PDPK1; MAP2K1; NFKB1; ITGB3; CDC42; CCND1; GSK3A; ITGA2; GSK3B; AKT3; FOXO1; CASP3; RPS6KB1.
Examples of genes for which a mUNA molecule can be used to express the corresponding peptide or protein include: p53 Signaling, PTEN; EP300; BBC3; PCAF; FASN; BRCA1; GADD45A; BIRC5; AKT2; PIK3CA; CHEK1; TP53INP1; BCL2; PIK3CB; PIK3C3; MAPK8; THBS1; ATR; BCL2L1; E2F1; PMAIP1; CHEK2; TNFRSF10B; TP73; RBI; HDAC9; CDK2; PIK3C2A; MAPK14; TP53; LRDD; CDKN1A; HIPK2; AKT1; RIK3R1; RRM2B; APAF1; CTNNB1; SIRT1; CCND1; PRKDC; ATM; SFN; CDKN2A; JUN; SNAI2; GSK3B; BAX; AKT3.
Examples of genes for which a mUNA molecule can be used to express the corresponding peptide or protein include: Aryl Hydrocarbon Receptor Signaling, HSPB1; EP300; FASN; TGM2; RXRA; MAPK1; NQO1; NCOR2; SP1; ARNT; CDKN1B; FOS; CHEK1; SMARCA4; NFKB2; MAPK8; ALDH1A1; ATR; E2F1; MAPK3; NRIP1; CHEK2; RELA; TP73; GSTP1; RB1; SRC; CDK2; AHR; NFE2L2; NCOA3; TP53; TNF; CDKN1A; NCOA2; APAF1; NFKB1; CCND1; ATM; ESR1; CDKN2A; MYC; JUN; ESR2; BAX; IL6; CYP1B1; HSP90AA1.
Examples of genes for which a mUNA molecule can be used to express the corresponding peptide or protein include: Xenobiotic Metabolism Signaling, PRKCE; EP300; PRKCZ; RXRA; MAPK1; NQO1; NCOR2; PIK3CA; ARNT; PRKCI; NFKB2; CAMK2A; PIK3CB; PPP2R1A; PIK3C3; MAPK8; PRKD1; ALDH1A1; MAPK3; NRIP1; KRAS; MAPK13; PRKCD; GSTP1; MAPK9; NOS2A; ABCB1; AHR; PPP2CA; FTL; NFE2L2; PIK3C2A; PPARGC1A; MAPK14; TNF; RAF1; CREBBP; MAP2K2; PIK3R1; PPP2R5C; MAP2K1; NFKB1; KEAP1; PRKCA; EIF2AK3; IL6; CYP1B1; HSP90AA1.
Examples of genes for which a mUNA molecule can be used to express the corresponding peptide or protein include: SAPK/JNK Signaling, PRKCE; IRAK1; PRKAA2; EIF2AK2; RAC1; ELK1; GRK6; MAPK1; GADD45A; RAC2; PLK1; AKT2; PIK3CA; FADD; CDK8; PIK3CB; PIK3C3; MAPK8; RIPK1; GNB2L1; IRS1; MAPK3; MAPK10; DAXX; KRAS; PRKCD; PRKAA1; MAPK9; CDK2; PIM1; PIK3C2A; TRAF2; TP53; LCK; MAP3K7; DYRK1A; MAP2K2; PIK3R1; MAP2K1; PAK3; CDC42; JUN; TTK; CSNK1A1; CRKL; BRAF; SGK.
Examples of genes for which a mUNA molecule can be used to express the corresponding peptide or protein include: PPAr/RXR Signaling, PRKAA2; EP300; INS; SMAD2; TRAF6; PPARA; FASN; RXRA; MAPK1; SMAD3; GNAS; IKBKB; NCOR2; ABCA1; GNAQ; NFKB2; MAP3K14; STAT5B; MAPK8; IRS1; MAPK3; KRAS; RELA; PRKAA1; PPARGC1A; NCOA3; MAPK14; INSR; RAF1; IKBKG; RELB; MAP3K7; CREBBP; MAP2K2; JAK2; CHUK; MAP2K1; NFKB1; TGFBR1; SMAD4; JUN; IL1R1; PRKCA; IL6; HSP90AA1; ADIPOQ.
Examples of genes for which a mUNA molecule can be used to express the corresponding peptide or protein include: NF-KB Signaling, IRAK1; EIF2AK2; EP300; INS; MYD8; PRKCZ: TRAF6; TBK1; AKT2; EGFR; IKBKB; PIK3CA; BTRC; NFKB2; MAP3K14; PIK3CB; PIK3C3; MAPK8; RIPK1; HDAC2; KRAS; RELA; PIK3C2A; TRAF2; TLR4: PDGFRB; TNF; INSR; LCK; IKBKG; RELB; MAP3K7; CREBBP; AKT1; PIK3R1; CHUK; PDGFRA; NFKB1; TLR2; BCL10; GSK3B; AKT3; TNFAIP3; IL1R1.
Examples of genes for which a mUNA molecule can be used to express the corresponding peptide or protein include: Neuregulin Signaling, ERBB4; PRKCE; ITGAM; ITGA5: PTEN; PRKCZ; ELK1; MAPK1; PTPN11; AKT2; EGFR; ERBB2; PRKCI; CDKN1B; STAT5B; PRKD1; MAPK3; ITGA1; KRAS; PRKCD; STAT5A; SRC; ITGB7; RAF1; ITGB1; MAP2K2; ADAM17; AKT1; PIK3R1; PDPK1; MAP2K1; ITGB3; EREG; FRAP1; PSEN1; ITGA2; MYC; NRG1; CRKL; AKT3; PRKCA; HSP90AA1; RPS6KB1.
Examples of genes for which a mUNA molecule can be used to express the corresponding peptide or protein include: Wnt & Beta catenin Signaling, CD44; EP300; LRP6; DVL3; CSNK1E; GJA1; SMO; AKT2; PIN1; CDH1; BTRC; GNAQ; MARK2; PPP2R1A; WNT11; SRC; DKK1; PPP2CA; SOX6; SFRP2: ILK; LEF1; SOX9; TP53; MAP3K7; CREBBP; TCF7L2; AKT1; PPP2R5C; WNT5A; LRP5; CTNNB1; TGFBR1; CCND1; GSK3A; DVL1; APC; CDKN2A; MYC; CSNK1A1; GSK3B; AKT3; SOX2.
Examples of genes for which a mUNA molecule can be used to express the corresponding peptide or protein include: Insulin Receptor Signaling, PTEN; INS; EIF4E; PTPN1; PRKCZ; MAPK1; TSC1; PTPN11; AKT2; CBL; PIK3CA; PRKCI; PIK3CB; PIK3C3; MAPK8; IRS1; MAPK3; TSC2; KRAS; EIF4EBP1; SLC2A4; PIK3C2A; PPP1CC; INSR; RAF1; FYN; MAP2K2; JAK1; AKT1; JAK2; PIK3R1; PDPK1; MAP2K1; GSK3A; FRAP1; CRKL; GSK3B; AKT3; FOXO1; SGK; RPS6KB1.
Examples of genes for which a mUNA molecule can be used to express the corresponding peptide or protein include: IL-6 Signaling, HSPB1; TRAF6; MAPKAPK2; ELK1; MAPK1; PTPN11; IKBKB; FOS; NFKB2: MAP3K14; MAPK8; MAPK3; MAPK10; IL6ST; KRAS; MAPK13; IL6R; RELA; SOCS1; MAPK9; ABCB1; TRAF2; MAPK14; TNF; RAF1; IKBKG; RELB; MAP3K7; MAP2K2; IL8; JAK2; CHUK; STAT3; MAP2K1; NFKB1; CEBPB; JUN; IL1R1; SRF; IL6.
Examples of genes for which a mUNA molecule can be used to express the corresponding peptide or protein include: Hepatic Cholestasis, PRKCE; IRAK1; INS; MYD8; PRKCZ; TRAF6; PPARA; RXRA; IKBKB; PRKCI; NFKB2; MAP3K14; MAPK8; PRKD1; MAPK10; RELA; PRKCD; MAPK9; ABCB1; TRAF2; TLR4; TNF; INSR; IKBKG; RELB; MAP3K7; IL8; CHUK; NR1H2; TJP2; NFKB1; ESR1; SREBF1; FGFR4; JUN; IL1R1; PRKCA; IL6.
Examples of genes for which a mUNA molecule can be used to express the corresponding peptide or protein include: IGF-1 Signaling, IGF1; PRKCZ; ELK1; MAPK1; PTPN11; NEDD4; AKT2; PIK3CA; PRKC1; PTK2; FOS; PIK3CB; PIK3C3; MAPK8; 1GF1R; IRS1; MAPK3; IGFBP7; KRAS; PIK3C2A; YWHAZ; PXN; RAF1; CASP9; MAP2K2; AKT1; PIK3R1; PDPK1; MAP2K1; IGFBP2; SFN; JUN; CYR61; AKT3; FOXO1; SRF; CTGF; RPS6KB1.
Examples of genes for which a mUNA molecule can be used to express the corresponding peptide or protein include: NRF2-mediated Oxidative Stress Response, PRKCE; EP300; SOD2; PRKCZ; MAPK1; SQSTM1; NQO1; PIK3CA; PRKC1; FOS; PIK3CB; P1K3C3; MAPK8; PRKD1; MAPK3; KRAS; PRKCD; GSTP1; MAPK9; FTL; NFE2L2; PIK3C2A; MAPK14; RAF1; MAP3K7; CREBBP; MAP2K2; AKT1; PIK3R1; MAP2K1; PPIB; JUN; KEAP1; GSK3B; ATF4; PRKCA; EIF2AK3; HSP90AA1.
Examples of genes for which a mUNA molecule can be used to express the corresponding peptide or protein include: Hepatic, Fibrosis/Hepatic Stellate Cell Activation, EDN1; IGF1; KDR; FLT1; SMAD2; FGFR1; MET; PGF; SMAD3; EGFR; FAS; CSF1; NFKB2; BCL2; MYH9; IGF1R; IL6R; RELA; TLR4; PDGFRB; TNF; RELB; IL8; PDGFRA; NFKB1; TGFBR1; SMAD4; VEGFA; BAX; IL1R1; CCL2; HGF; MMP1; STAT1; IL6; CTGF; MMP9.
Examples of genes for which a mUNA molecule can be used to express the corresponding peptide or protein include: PPAR Signaling, EP300; INS; TRAF6; PPARA; RXRA; MAPK1; IKBKB; NCOR2; FOS; NFKB2; MAP3K14; STAT5B; MAPK3; NRIP1; KRAS; PPARG; RELA; STAT5A; TRAF2; PPARGC1A; PDGFRB; TNF; INSR; RAF1; IKBKG; RELB; MAP3K7; CREBBP; MAP2K2; CHUK; PDGFRA; MAP2K1; NFKB1; JUN; IL1R1; HSP90AA1.
Examples of genes for which a mUNA molecule can be used to express the corresponding peptide or protein include: Fc Epsilon RI Signaling, PRKCE; RAC1; PRKCZ; LYN; MAPK1; RAC2; PTPN11; AKT2; PIK3CA; SYK; PRKCI; PIK3CB; PIK3C3; MAPK8; PRKD1; MAPK3; MAPK10; KRAS; MAPK13; PRKCD; MAPK9; PIK3C2A; BTK; MAPK14; TNF; RAF1; FYN; MAP2K2; AKT1; PIK3R1; PDPK1; MAP2K1; AKT3; VAV3; PRKCA.
Examples of genes for which a mUNA molecule can be used to express the corresponding peptide or protein include: G-Protein Coupled Receptor Signaling, PRKCE; RAP1A; RGS16; MAPK1; GNAS; AKT2; IKBKB; PIK3CA; CREB1; GNAQ; NFKB2; CAMK2A; PIK3CB; PIK3C3; MAPK3; KRAS; RELA; SRC; PIK3C2A; RAF1; IKBKG; RELB; FYN; MAP2K2; AKT1; PIK3R1; CHUK; PDPK1; STAT3; MAP2K1; NFKB1; BRAF; ATF4; AKT3; PRKCA.
Examples of genes for which a mUNA molecule can be used to express the corresponding peptide or protein include: Inositol Phosphate Metabolism, PRKCE; IRAK1; PRKAA2; EIF2AK2; PTEN; GRK6; MAPK1; PLK1; AKT2; PIK3CA; CDK8; PIK3CB; PIK3C3; MAPK8; MAPK3; PRKCD; PRKAA1; MAPK9; CDK2; PIM1; PIK3C2A; DYRK1A; MAP2K2; PIP5K1A; PIK3R1; MAP2K1; PAK3; ATM; TTK; CSNK1A1; BRAF; SGK.
Examples of genes for which a mUNA molecule can be used to express the corresponding peptide or protein include: PDGF Signaling, EIF2AK2; ELK1; ABL2; MAPK1; PIK3CA; FOS; PIK3CB;PIK3C3; MAPK8; CAV1; ABL1; MAPK3; KRAS; SRC; PIK3C2A; PDGFRB; RAF1; MAP2K2; JAK1; JAK2; PIK3R1; PDGFRA; STAT3; SPHK1; MAP2K1; MYC; JUN; CRKL; PRKCA; SRF; STAT1; SPHK2.
Examples of genes for which a mUNA molecule can be used to express the corresponding peptide or protein include: VEGF Signaling, ACTN4; ROCK1; KDR; FLT1; ROCK2; MAPK1; PGF; AKT2; PIK3CA; ARNT; PTK2; BCL2; PIK3CB; PIK3C3; BCL2L1; MAPK3; KRAS; HIF1A; NOS3; PIK3C2A; PXN; RAF1; MAP2K2; ELAVL1; AKT1; PIK3R1; MAP2K1; SFN; VEGFA; AKT3; FOXO1; PRKCA.
Examples of genes for which a mUNA molecule can be used to express the corresponding peptide or protein include: Natural Killer Cell Signaling, PRKCE; RAC1; PRKCZ; MAPK1; RAC2; PTPN11; KIR2DL3; AKT2; PIK3CA; SYK; PRKCI; PIK3CB; PIK3C3; PRKD1; MAPK3; KRAS; PRKCD; PTPN6; PIK3C2A; LCK; RAF1; FYN; MAP2K2; PAK4; AKT1; PIK3R1; MAP2K1; PAK3; AKT3; VAV3; PRKCA.
Examples of genes for which a mUNA molecule can be used to express the corresponding peptide or protein include: Cell Cycle: G1/S Checkpoint Regulation, HDAC4; SMAD3; SUV39H1; HDAC5; CDKN1B; BTRC; ATR; ABL1; E2F1; HDAC2; HDAC7A; RB1; HDAC11; HDAC9; CDK2; E2F2; HDAC3; TP53; CDKN1A; CCND1; E2F4; ATM; RBL2; SMAD4; CDKN2A; MYC; NRG1; GSK3B; RBL1; HDAC6.
Examples of genes for which a mUNA molecule can be used to express the corresponding peptide or protein include: T Cell Receptor Signaling, RAC1; ELK1; MAPK1; IKBKB; CBL; PIK3CA; FOS; NFKB2; PIK3CB; PIK3C3; MAPK8; MAPK3; KRAS; RELA, PIK3C2A; BTK; LCK; RAF1; IKBKG; RELB, FYN; MAP2K2; PIK3R1; CHUK; MAP2K1; NFKB1; ITK; BCL10; JUN; VAV3.
Examples of genes for which a mUNA molecule can be used to express the corresponding peptide or protein include: Death Receptor Signaling, CRADD; HSPB1; BID; BIRC4; TBK1; IKBKB; FADD; FAS; NFKB2; BCL2; MAP3K14; MAPK8; RIPK1; CASP8; DAXX; TNFRSF10B; RELA; TRAF2; TNF; IKBKG; RELB; CASP9; CHUK; APAF1; NFKB1; CASP2; BIRC2; CASP3; BIRC3.
Examples of genes for which a mUNA molecule can be used to express the corresponding peptide or protein include: FGF Signaling RAC1; FGFR1; MET; MAPKAPK2; MAPK1; PTPN11; AKT2; PIK3CA; CREB1; PIK3CB; PIK3C3; MAPK8; MAPK3; MAPK13; PTPN6; PIK3C2A; MAPK14; RAF1; AKT1; PIK3R1; STAT3; MAP2K1; FGFR4; CRKL; ATF4; AKT3; PRKCA; HGF.
Examples of genes for which a mUNA molecule can be used to express the corresponding peptide or protein include: GM-CSF Signaling, LYN; ELK1; MAPK1; PTPN11; AKT2; PIK3CA; CAMK2A; STAT5B; PIK3CB; PIK3C3; GNB2L1; BCL2L1; MAPK3; ETS1; KRAS; RUNX1; PIM1; PIK3C2A; RAF1; MAP2K2; AKT1; JAK2; PIK3R1; STAT3; MAP2K1; CCND1; AKT3; STAT1.
Examples of genes for which a mUNA molecule can be used to express the corresponding peptide or protein include: Amyotrophic Lateral Sclerosis Signaling, BID; IGF1; RAC1; BIRC4; PGF; CAPNS1; CAPN2; PIK3CA; BCL2; PIK3CB; PIK3C3; BCL2L1; CAPN1; PIK3C2A; TP53; CASP9; PIK3R1; RAB5A; CASP1; APAF1; VEGFA; BIRC2; BAX; AKT3; CASP3; BIRC3.
Examples of genes for which a mUNA molecule can be used to express the corresponding peptide or protein include: JAK/Stat Signaling, PTPN1; MAPK1; PTPN11; AKT2; PIK3CA; STAT5B; PIK3CB; PIK3C3; MAPK3; KRAS; SOCS1; STAT5A; PTPN6; PIK3C2A; RAF1; CDKN1A; MAP2K2; JAK1; AKT1; JAK2; PIK3R1; STAT3; MAP2K1; FRAP1; AKT3; STAT1.
Examples of genes for which a mUNA molecule can be used to express the corresponding peptide or protein include: Nicotinate and Nicotinamide Metabolism, PRKCE; IRAK1; PRKAA2; EIF2AK2; GRK6; MAPK1; PLK1; AKT2; CDK8; MAPK8; MAPK3; PRKCD; PRKAA1; PBEF1; MAPK9; CDK2; PIM1; DYRK1A; MAP2K2; MAP2K1; PAK3; NT5E; TTK; CSNK1A1; BRAF; SGK.
Examples of genes for which a mUNA molecule can be used to express the corresponding peptide or protein include: Chemokine Signaling, CXCR4; ROCK2; MAPK1; PTK2; FOS; CFL1; GNAQ; CAMK2A; CXCL12; MAPK8; MAPK3; KRAS; MAPK13; RHOA; CCR3; SRC; PPP1CC; MAPK14; NOXI; RAF1; MAP2K2; MAP2K1; JUN; CCL2; PRKCA.
Examples of genes for which a mUNA molecule can be used to express the corresponding peptide or protein include: IL-2 Signaling, ELK1; MAPK1; PTPN11; AKT2; PIK3CA; SYK; FOS; STAT5B; PIK3CB; PIK3C3; MAPK8; MAPK3; KRAS; SOCS1; STAT5A; PIK3C2A: LCK; RAF1; MAP2K2; JAK1; AKT1; PIK3R1; MAP2K1; JUN; AKT3.
Examples of genes for which a mUNA molecule can be used to express the corresponding peptide or protein include: Synaptic Long Term Depression, PRKCE; IGF1; PRKCZ; PRDX6; LYN; MAPK1; GNAS; PRKC1; GNAQ; PPP2R1A; IGF1R; PRKID1; MAPK3; KRAS; GRN; PRKCD; NOS3; NOS2A; PPP2CA; YWHAZ; RAF1; MAP2K2; PPP2R5C; MAP2K1; PRKCA.
Examples of genes for which a mUNA molecule can be used to express the corresponding peptide or protein include: Estrogen Receptor Signaling, TAF4B; EP300; CARM1; PCAF; MAPK1; NCOR2; SMARCA4; MAPK3; NRIP1; KRAS; SRC; NR3C1; HDAC3; PPARGC1A; RBM9; NCOA3; RAF1; CREBBP; MAP2K2; NCOA2; MAP2K1; PRKDC; ESR1; ESR2.
Examples of genes for which a mUNA molecule can be used to express the corresponding peptide or protein include: Protein Ubiquitination Pathway, TRAF6; SMURF1; BIRC4; BRCA1; UCHL1; NEDD4; CBL; UBE2I; BTRC; HSPA5; USP7; USP10; FBXW7; USP9X; STUB1; USP22; B2M; BIRC2; PARK2; USPS; USP1; VHL; HSP90AA1; BIRC3.
Examples of genes for which a mUNA molecule can be used to express the corresponding peptide or protein include: IL-10 Signaling, TRAF6; CCR1; ELK1; IKBKB; SP1; FOS; NFKB2; MAP3K14; MAPK8; MAPK13; RELA; MAPK14; TNF; IKBKG; RELB; MAP3K7; JAK1; CHUK; STAT3; NFKB1; JUN; IL1R1; IL6.
Examples of genes for which a mUNA molecule can be used to express the corresponding peptide or protein include: VDR/RXR Activation, PRKCE; EP300; PRKCZ; RXRA; GADD45A; HEST; NCOR2; SP1; PRKC1; CDKN1B; PRKD1; PRKCD; RUNX2; KLF4; YY1; NCOA3; CDKN1A; NCOA2; SPP1; LRP5; CEBPB; FOXO1; PRKCA.
Examples of genes for which a mUNA molecule can be used to express the corresponding peptide or protein include: TGF-beta Signaling, EP300; SMAD2; SMURF1; MAPK1; SMAD3; SMAD1; FOS; MAPK8; MAPK3; KRAS; MAPK9; RUNX2; SERPINE1; RAF1; MAP3K7; CREBBP; MAP2K2; MAP2K1; TGFBR1; SMAD4; JUN; SMAD5.
Examples of genes for which a mUNA molecule can be used to express the corresponding peptide or protein include: Toll-like Receptor Signaling, IRAK1; EIF2AK2; MYD8; TRAF6; PPARA; ELK1; IKBKB; FOS; NFKB2; MAP3K14; MAPK8; MAPK13; RELA; TLR4; MAPK14; IKBKG; RELB; MAP3K7; CHUK; NFKB1; TLR2; JUN.
Examples of genes for which a mUNA molecule can be used to express the corresponding peptide or protein include: p38 MAPK Signaling, HSPB1; IRAK1; TRAF6; MAPKAPK2; ELK1; FADD; FAS; CREB1; DDIT3; RPS6KA4; DAXX; MAPK13; TRAF2; MAPK14; TNF; MAP3K7; TGFBR1; MYC; ATF4; IL1R1; SRF; STAT 1.
Examples of genes for which a mUNA molecule can be used to express the corresponding peptide or protein include: Neurotrophin/TRK Signaling, NTRK2; MAPK1; PTPN11; PIK3CA; CREB1; FOS; PIK3CB; PIK3C3; MAPK8; MAPK3; KRAS; PIK3C2A; RAF1; MAP2K2; AKT1; PIK3R1; PDPK1; MAP2K1; CDC42; JUN; ATF4.
Examples of genes for which a mUNA molecule can be used to express the corresponding peptide or protein include: FXR/RXR Activation, INS; PPARA; FASN; RXRA; AKT2; SDC1; MAPK8; APOB; MAPK10; PPARG; MTTP; MAPK9; PPARGC1A; TNF; CREBBP; AKT1; SREBF1; FGFR4; AKT3; FOXO1.
Examples of genes for which a mUNA molecule can be used to express the corresponding peptide or protein include: Synaptic Long Term Potentiation, PRKCE; RAP1A; EP300; PRKCZ; MAPK1; CREB1; PRKC1; GNAQ; CAMK2A; PRKD1; MAPK3; KRAS; PRKCD; PPP1CC; RAF1; CREBBP; MAP2K2; MAP2K1; ATF4; PRKCA.
Examples of genes for which a mUNA molecule can be used to express the corresponding peptide or protein include: Calcium Signaling, RAP1A; EP300; HDAC4; MAPK1; HDAC5; CREB1; CAMK2A; MYH9; MAPK3; HDAC2; HDAC7A; HDAC11; HDAC9; HDAC3; CREBBP; CALR; CAMKK2; ATF4; HDAC6.
Examples of genes for which a mUNA molecule can be used to express the corresponding peptide or protein include: EGF Signaling, ELK1; MAPK1; EGFR; PIK3CA; FOS; PIK3CB; PIK3C3; MAPK8; MAPK3; PIK3C2A; RAF1; JAK1; PIK3R1; STAT3; MAP2K1; JUN; PRKCA; SRF; STAT1.
Examples of genes for which a mUNA molecule can be used to express the corresponding peptide or protein include: Hypoxia Signaling in the Cardiovascular System, EDN1; PTEN; EP300; NQO1; UBE21; CREB1; ARNT; HIF1A; SLC2A4; NOS3; TP53; LDHA; AKT1; ATM; VEGFA; JUN; ATF4; VHL; HSP90AA1.
Examples of genes for which a mUNA molecule can be used to express the corresponding peptide or protein include: LPS/IL-1 Mediated Inhibition of RXR Function, IRAK1; MYD88; TRAF6; PPARA; RXRA; ABCA1, MAPK8; ALDH1A1; GSTP1; MAPK9; ABCB1; TRAF2; TLR4; TNF; MAP3K7; NR1H2; SREBF1; JUN; IL1R1.
Examples of genes for which a mUNA molecule can be used to express the corresponding peptide or protein include: LXR/RXR Activation, FASN; RXRA; NCOR2; ABCA1; NFKB2; IRF3; RELA; NOS2A; TLR4; TNF; RELB; LDLR; NR1H2; NFKB1; SREBF1; IL1R1; CCL2; IL6; MMP9.
Examples of genes for which a mUNA molecule can be used to express the corresponding peptide or protein include: Amyloid Processing, PRKCE; CSNK11E; MAPK1; CAPNS1; AKT2; CAPN2; CAPN1; MAPK3; MAPK13; MAPT; MAPK14; AKT1; PSEN1; CSNK1A1; GSK3B; AKT3; APP.
Examples of genes for which a mUNA molecule can be used to express the corresponding peptide or protein include: IL-4 Signaling, AKT2; PIK3CA; PIK3CB; PIK3C3; IRS1; KRAS; SOCS1; PTPN6; NR3C1; PIK3C2A; JAK1; AKT1; JAK2; PIK3R1; FRAP1; AKT3; RPS6KB1.
Examples of genes for which a mUNA molecule can be used to express the corresponding peptide or protein include: Cell Cycle: G2/M DNA Damage Checkpoint Regulation, EP300; PCAF; BRCA1; GADD45A; PLK1; BTRC; CHEK1; ATR; CHEK2; YWHAZ; TP53; CDKN1A; PRKDC; ATM; SFN; CDKN2A.
Examples of genes for which a mUNA molecule can be used to express the corresponding peptide or protein include: Nitric Oxide Signaling in the Cardiovascular System, KDR; FLT1; PGF; AKT2; PIK3CA; PIK3CB; PIK3C3; CAV1; PRKCD; NOS3; PIK3C2A; AKT1; PIK3R1; VEGFA; AKT3; HSP90AA1.
Examples of genes for which a mUNA molecule can be used to express the corresponding peptide or protein include: Purine Metabolism NME2; SMARCA4; MYH9; RRM2; ADAR; EIF2AK4; PKM2; ENTPD1; RAD51; RRM2B; TJP2; RAD51C; NT5E; POLD1; NME1.
Examples of genes for which a mUNA molecule can be used to express the corresponding peptide or protein include: cAMP-mediated Signaling, RAP1A; MAPK1; GNAS; CREB1; CAMK2A; MAPK3; SRC; RAF1; MAP2K2; STAT3; MAP2K1; BRAF; ATF4.
Examples of genes for which a mUNA molecule can be used to express the corresponding peptide or protein include: Mitochondrial Dysfunction Notch Signaling, SOD2; MAPK8; CASP8; MAPK10; MAPK9; CASP9; PARK7; PSEN1; PARK2; APP; CASP3 HES1; JAG1; NUMB; NOTCH4; ADAM17; NOTCH2; PSEN1; NOTCH3; NOTCH1; DLL4.
Examples of genes for which a mUNA molecule can be used to express the corresponding peptide or protein include: Endoplasmic Reticulum Stress Pathway, HSPA5; MAPK8; XBP1; TRAF2; ATF6; CASP9; ATF4; EIF2AK3; CASP3.
Examples of genes for which a mUNA molecule can be used to express the corresponding peptide or protein include: Pyrimidine Metabolism, NME2; AICDA; RRM2; EIF2AK4; ENTPD1; RRM2B; NT5E; POLD1; NME1.
Examples of genes for which a mUNA molecule can be used to express the corresponding peptide or protein include: Parkinson's Signaling, UCHL1; MAPK8; MAPK13; MAPK14; CASP9; PARK7; PARK2; CASP3.
Examples of genes for which a mUNA molecule can be used to express the corresponding peptide or protein include: Cardiac & Beta Adrenergic Signaling, GNAS; GNAQ; PPP2R1A; GNB2L1; PPP2CA; PPP1CC; PPP2R5C.
Examples of genes for which a mUNA molecule can be used to express the corresponding peptide or protein include: Glycolysis/Gluco-neogenesis, HK2; GCK; GPI; ALDH1A1; PKM2; LDHA; HK1.
Examples of genes for which a mUNA molecule can be used to express the corresponding peptide or protein include: Interferon Signaling, IRF1; SOCS1; JAK1; JAK2; IFITM1; STAT1; IFIT3.
Examples of genes for which a mUNA molecule can be used to express the corresponding peptide or protein include: Sonic Hedgehog Signaling, ARRB2; SMO; GLI2; DYRK1A; GLI1; GSK3B; DYRKIB.
Examples of genes for which a mUNA molecule can be used to express the corresponding peptide or protein include: Glycerophospholipid Metabolism, PLD1; GRN; GPAM; YWHAZ; SPHK1; SPHK2.
Examples of genes for which a mUNA molecule can be used to express the corresponding peptide or protein include: Phospholipid Degradation, PRDX6; PLD1; GRN; YWHAZ; SPHK1; SPHK2.
Examples of genes for which a mUNA molecule can be used to express the corresponding peptide or protein include: Tryptophan Metabolism, SIAH2; PRMT5; NEDD4; ALDH1A1; CYP1B1; SIAH1.
Examples of genes for which a mUNA molecule can be used to express the corresponding peptide or protein include: Lysine Degradation, SUV39H1; EHMT2; NSD1; SETD7; PPP2R5C.
Examples of genes for which a mUNA molecule can be used to express the corresponding peptide or protein include: Nucleotide Excision, ERCC5; ERCC4; XPA; XPC; ERCC1.
Examples of genes for which a mUNA molecule can be used to express the corresponding peptide or protein include: Repair Pathway Starch and Sucrose Metabolism, UCHL1; HK2; GCK; GPI; HK1.
Examples of genes for which a mUNA molecule can be used to express the corresponding peptide or protein include: Aminosugars Metabolism, NQO1; HK2; GCK; HK1.
Examples of genes for which a mUNA molecule can be used to express the corresponding peptide or protein include: Arachidonic Acid Metabolism, PRDX6; GRN; YWHAZ; CYP1B1.
Examples of genes for which a mUNA molecule can be used to express the corresponding peptide or protein include: Circadian Rhythm Signaling, CSNK1E; CREB1; ATF4; NR1D1.
Examples of genes for which a mUNA molecule can be used to express the corresponding peptide or protein include: Coagulation System, BDKRB1; F2R; SERPINE1; F3.
Examples of genes for which a mUNA molecule can be used to express the corresponding peptide or protein include: Dopamine Receptor Signaling, PPP2R1A; PPP2CA; PPP1CC; PPP2R5C.
Examples of genes for which a mUNA molecule can be used to express the corresponding peptide or protein include: Glutathione Metabolism, IDH2; GSTP1; ANPEP; IDH1.
Examples of genes for which a mUNA molecule can be used to express the corresponding peptide or protein include: Glycerolipid Metabolism, ALDH1A1; GPAM; SPHK1; SPHK2.
Examples of genes for which a mUNA molecule can be used to express the corresponding peptide or protein include: Linoleic Acid Metabolism, PRDX6; GRN; YWHAZ; CYP1B1.
Examples of genes for which a mUNA molecule can be used to express the corresponding peptide or protein include: Methionine Metabolism, DNMT1; DNMT3B; AHCY; DNMT3A.
Examples of genes for which a mUNA molecule can be used to express the corresponding peptide or protein include: Pyruvate Metabolism, GLO1; ALDH1A1; PKM2; LDHA.
Examples of genes for which a mUNA molecule can be used to express the corresponding peptide or protein include: Arginine and Proline Metabolism, ALDH1A1; NOS3; NOS2A.
Examples of genes for which a mUNA molecule can be used to express the corresponding peptide or protein include: Eicosanoid Signaling, PRDX6; GRN; YWHAZ.
Examples of genes for which a mUNA molecule can be used to express the corresponding peptide or protein include: Fructose and Mannose Metabolism, HK2; GCK; HK1.
Examples of genes for which a mUNA molecule can be used to express the corresponding peptide or protein include: Galactose Metabolism, HK2; GCK; HK1.
Examples of genes for which a mUNA molecule can be used to express the corresponding peptide or protein include: Stilbene, Coumarine and Lignin Biosynthesis, PRDX6; PRDX1; TYR.
Examples of genes for which a mUNA molecule can be used to express the corresponding peptide or protein include: Antigen Presentation Pathway, CALR; B2M.
Examples of genes for which a mUNA molecule can be used to express the corresponding peptide or protein include: Biosynthesis of Steroids, NQO1; DHCR7.
Examples of genes for which a mUNA molecule can be used to express the corresponding peptide or protein include: Butanoate Metabolism, ALDH1A1; NLGN1.
Examples of genes for which a mUNA molecule can be used to express the corresponding peptide or protein include: Citrate Cycle, IDH2; IDH1.
Examples of genes for which a mUNA molecule can be used to express the corresponding peptide or protein include: Fatty Acid Metabolism, ALDH1A1; CYP1B1.
Examples of genes for which a mUNA molecule can be used to express the corresponding peptide or protein include: Glycerophospholipid Metabolism, PRDX6; CHKA.
Examples of genes for which a mUNA molecule can be used to express the corresponding peptide or protein include: Histidine Metabolism, PRMT5; ALDH1A1.
Examples of genes for which a mUNA molecule can be used to express the corresponding peptide or protein include: Inositol Metabolism, ERO1L; APEX1.
Examples of genes for which a mUNA molecule can be used to express the corresponding peptide or protein include: Metabolism of Xenobiotics by Cytochrome p450, GSTP1; CYP1B1.
Examples of genes for which a mUNA molecule can be used to express the corresponding peptide or protein include: Methane Metabolism, PRDX6; PRDX1.
Examples of genes for which a mUNA molecule can be used to express the corresponding peptide or protein include: Phenylalanine Metabolism, PRDX6; PRDX1.
Examples of genes for which a mUNA molecule can be used to express the corresponding peptide or protein include: Propanoate Metabolism, ALDH1A1; LDHA.
Examples of genes for which a mUNA molecule can be used to express the corresponding peptide or protein include: Selenoamino Acid Metabolism, PRMT5; AHCY.
Examples of genes for which a mUNA molecule can be used to express the corresponding peptide or protein include: Sphingolipid Metabolism, SPHK1; SPHK2.
Examples of genes for which a mUNA molecule can be used to express the corresponding peptide or protein include: Aminophosphonate Metabolism, PRMT5.
Examples of genes for which a mUNA molecule can be used to express the corresponding peptide or protein include: Androgen and Estrogen Metabolism, PRMT5.
Examples of genes for which a mUNA molecule can be used to express the corresponding peptide or protein include: Ascorbate and Aldarate Metabolism, ALDH1A1.
Examples of genes for which a mUNA molecule can be used to express the corresponding peptide or protein include: Bile Acid Biosynthesis, ALDH1A1.
Examples of genes for which a mUNA molecule can be used to express the corresponding peptide or protein include: Cysteine Metabolism, LDHA.
Examples of genes for which a mUNA molecule can be used to express the corresponding peptide or protein include: Fatty Acid Biosynthesis, FASN.
Examples of genes for which a mUNA molecule can be used to express the corresponding peptide or protein include: Glutamate Receptor Signaling, GNB2L1.
Examples of genes and/or polynucleotides that can be edited with the guide molecules of this invention include: NRF2-mediated Oxidative Stress Response, PRDX1.
Examples of genes for which a mUNA molecule can be used to express the corresponding peptide or protein include: Pentose Phosphate Pathway, GPI.
Examples of genes for which a mUNA molecule can be used to express the corresponding peptide or protein include: Pentose and Glucuronate Interconversions, UCHL1.
Examples of genes for which a mUNA molecule can be used to express the corresponding peptide or protein include: Retinol Metabolism, ALDH1A1.
Examples of genes for which a mUNA molecule can be used to express the corresponding peptide or protein include: Riboflavin Metabolism, TYR.
Examples of genes for which a mUNA molecule can be used to express the corresponding peptide or protein include: Tyrosine Metabolism, PRMT5, TYR.
Examples of genes for which a mUNA molecule can be used to express the corresponding peptide or protein include: Ubiquinone Biosynthesis, PRMT5.
Examples of genes for which a mUNA molecule can be used to express the corresponding peptide or protein include: Valine, Leucine and Isoleucine Degradation, ALDH1A1.
Examples of genes for which a mUNA molecule can be used to express the corresponding peptide or protein include: Glycine, Serine and Threonine Metabolism, CHKA.
Examples of genes for which a mUNA molecule can be used to express the corresponding peptide or protein include: Lysine Degradation, ALDH1A1.
Examples of genes for which a mUNA molecule can be used to express the corresponding peptide or protein include: Pain/Taste, TRPM5; TRPA1.
Examples of genes for which a mUNA molecule can be used to express the corresponding peptide or protein include: Pain, TRPM7; TRPC5; TRPC6; TRPC1; Cnr1; cnr2; Grk2; Trpa1; Pomc; Cgrp; Crf; Pka; Era; Nr2b; TRPM5; Prkaca; Prkacb; Prkar1a; Prkar2a.
Examples of genes for which a mUNA molecule can be used to express the corresponding peptide or protein include: Mitochondrial Function, AIF; CytC; SMAC (Diablo); Aifm-1; Aifm-2.
Examples of genes for which a mUNA molecule can be used to express the corresponding peptide or protein include: Developmental Neurology, BMP-4; Chordin (Chrd); Noggin (Nog); WNT (Wnt2; Wnt2b; Wnt3a; Wnt4; Wnt5a; Wnt6; Wnt7b; Wnt8b; Wnt9a; Wnt9b; Wnt10a; Wnt10b; Wnt16); beta-catenin; Dick-1; Frizzled related proteins; Otx-2; Gbx2; FGF-8; Reelin; Dab1; unc-86 (Pou4f1 or Brn3a); Numb; Reln.
mUNA Methods
In various aspects, this invention provides methods for synthesis of mUNA messenger UNA oligomer molecules.
mUNA oligomer molecules of this invention can be synthesized and isolated using methods disclosed herein, as well as any pertinent techniques known in the art.
Some methods for preparing nucleic acids are given in, for example, Merino, Chemical Synthesis of Nucleoside Analogues, (2013); Gait, Oligonucleotide synthesis: a practical approach (1984); Herdewijn, Oligonucleotide Synthesis, Methods in Molecular Biology, Vol. 288 (2005).
In some embodiments, a ligase can be used to link a synthetic oligomer to the 3′ end of an RNA molecule or an RNA transcript to form a mUNA molecule. The synthetic oligomer that is ligated to the 3′ end can provide the functionality of a polyA tail, and advantageously provide resistance to its removal by 3′-exoribonucleases. The ligated product mUNA molecule can have increased specific activity and provide increased levels of ectopic protein expression.
In certain embodiments, ligated product mUNA molecules of this invention can be made with an RNA transcript that has native specificity. The ligated product can be a synthetic molecule that retains the structure of the RNA transcript at the 5′ end to ensure compatibility with the native specificity.
In further embodiments, ligated product mUNA molecules of this invention can be made with an exogenous RNA transcript or non-natural RNA. The ligated product can be a synthetic molecule that retains the structure of the RNA.
In general, the canonical mRNA degradation pathway in cells includes the steps: (i) the polyA tail is gradually cut back to a stub by 3′ exonucleases, shutting down the looping interaction required for efficient translation and leaving the cap open to attack; (ii) decapping complexes remove the 5′ cap; (iii) the unprotected and translationally incompetent residuum of the transcript is degraded by 5′ and 3′ exonuclease activity.
Embodiments of this invention involve new mUNA structures which can have increased translational activity over a native transcript. The mUNA molecules can prevent exonucleases from trimming back the polyA tail in the process of de-adenylation.
Embodiments of this invention provide structures, compositions and methods for translatable mUNA molecules. Embodiments of this invention can provide translatable mUNA molecules containing one or more UNA monomers and having increased functional half-life.
It has been found that ligation of a synthetic oligomer to the 3′ end of an mRNA transcript can surprisingly be accomplished with high conversion of the mRNA transcript to the ligation product. The ligase can catalyze the joining of the 3′-hydroxyl terminus of the RNA transcript to a synthetic oligomer bearing a 5′ monophosphate group. The 3′ end of the synthetic oligomer can be blocked to prevent circularization and concatemerization, while the presence of a triphosphate or cap moiety at the 5′ terminus of the mRNA transcript can prevent its entry into undesired side reactions.
In some embodiments, the yield of conversion of the mRNA transcript to the ligation product mUNA molecule can be from 70% to 100%. In some embodiments, the yield of conversion of the mRNA transcript to the ligation product can be 70%, 80%, 90%, 95%, 99%, or 100%.
As used herein, the terms polyA tail and polyA oligomer refer to an oligomer of monomers, wherein the monomers can include nucleotides based on adenine, UNA monomers, naturally-occurring nucelotides, modified nucleotides, or nucleotide analogues.
A modified nucleotide can be base-modified, sugar-modified, or linkage modified.
Splint Ligation Methods
Embodiments of this invention can employ splint ligation to synthesize mUNA molecules.
In some aspects, ligation of a tail oligomer to the 3′ end of an RNA molecule can surprisingly be accomplished with high conversion of the RNA molecule to the ligation product by using a DNA splint oligomer. Splint ligation of specific RNA molecules can be done with a DNA ligase and a bridging DNA splint oligomer that is complementary to the RNAs.
As used herein, a molecule to which a tail oligomer is added can be referred to as an acceptor oligomer, and a tail oligomer to be ligated to an acceptor oligomer can be referred to as a donor oligomer.
A donor oligomer of this invention may contain one or more UNA monomers. In some embodiments, a donor oligomer may be composed of UNA monomers and adenylate nucleotides.
A donor oligomer of this invention may include any number of UNA monomers within its total length.
An acceptor oligomer of this invention can be a RNA of any length, an mRNA, or a mammalian gene transcript.
In some aspects, ligation of a donor oligomer of any length to the 3′ end of an acceptor RNA molecule can surprisingly be accomplished with high conversion to the ligation product mUNA molecule by using a DNA splint oligomer.
In certain embodiments, a DNA splint oligomer can hybridize to the end of an mRNA having a short polyA tail, anchored in a specific position based on a region complementary to the end of the mRNA's 3′ UTR. The polyA tail can be about 30 monomers or less in length. The DNA splint oligomer can incorporate a poly(dT) tail that overhangs beyond the native polyA tail of the mRNA transcript. The poly(dT) tail can bring a polyA oligomer into position for efficient ligation to the synthetic mRNA.
Embodiments of this invention can employ splint ligation to introduce UNA monomers, modified nucleotides, or nucleotide analogues into RNA molecules.
In certain embodiments, in splint ligation the DNA ligase can be used to join RNA molecules in an RNA:DNA hybrid.
In some embodiments, the donor can be from 2 to 120 monomers in length, or from 3 to 120 monomers, or from 4 to 120 monomers, or from 5 to 120 monomers, or from 6 to 120 monomers, or longer.
The splint oligomer can be removed from the ligation product using a DNAse treatment, which can be required post-IVT to remove the DNA template for transcription.
Cohesive End Ligation
In some embodiments, a wild-type T4 RNA ligase can be used to join the 3′ hydroxyl terminus of an RNA transcript to a tail oligomer bearing a 5′ monophosphate group.
In further embodiments, a KQ mutant variant of T4 RNA Ligase 2, which requires a pre-adenylated donor, was used to join the 3′ hydroxyl terminus of an RNA transcript to a pre-adenylated tail oligomer.
In these embodiments, a preponderance of the tail can advantageously be incorporated co-transcriptionally in the IVT synthetic RNA transcript, and the donor oligomer can be correspondingly shortened.
Post-Ligation Treatment
In some aspects, a 3′-exonuclease treatment can be used to remove the unligated fraction of the product of the ligation reaction. Examples of a 3′-exonuclease include Exonuclease T, Ribonuclease R, and analogs thereof.
In certain embodiments, Ribonuclease R can be used with high processivity, and the ligation can be insensitive to sequence content and variations, as well as secondary structure.
Tail Oligomers
In some embodiments, the 100% bulk ligation of a tail oligomer to the 3′ end of an RNA has been achieved.
Donor oligomers of this invention for ligation to the 3′ end of an mRNA may be from 2 to 120 monomers in length, or from 3 to 120 monomers in length, or from 4 to 120 monomers in length, or from 5 to 120 monomers in length, or longer.
In further embodiments, a donor oligomer may have a 3′-terminal modification to block circularization or oligimerization of the synthetic oligomer in ligation reactions. Examples of a 3′-terminal modification include a 3′-terminal C3 spacer.
A donor oligomer of this invention may contain one or more UNA monomers.
A donor oligomer can include one or more nucleic acid monomers that are naturally-occurring nucleotides, modified naturally-occurring nucleotides, or non-naturally-occurring nucleotides.
A donor oligomer can include a nucleic acid monomer that is base-modified, sugar-modified, or linkage modified.
Pharmaceutical Compositions
In some aspects, this invention provides pharmaceutical compositions containing a mUNA oligomeric compound and a pharmaceutically acceptable carrier.
A pharmaceutical composition can be capable of local or systemic administration. In some aspects, a pharmaceutical composition can be capable of any modality of administration. In certain aspects, the administration can be intravenous, subcutaneous, pulmonary, intramuscular, intraperitoneal, dermal, oral, or nasal administration.
Embodiments of this invention include pharmaceutical compositions containing an oligomeric compound in a lipid formulation.
In some embodiments, a pharmaceutical composition may comprise one or more lipids selected from cationic lipids, anionic lipids, sterols, pegylated lipids, and any combination of the foregoing.
In certain embodiments, a pharmaceutical composition can be substantially free of liposomes.
In further embodiments, a pharmaceutical composition can include liposomes or nanoparticles.
Some examples of lipids and lipid compositions for delivery of an active molecule of this invention are given in WO/2015/074085, which is hereby incorporated by reference in its entirety.
In additional embodiments, a pharmaceutical composition can contain an oligomeric compound within a viral or bacterial vector.
A pharmaceutical composition of this disclosure may include carriers, diluents or excipients as are known in the art. Examples of pharmaceutical compositions and methods are described, for example, in Remington's Pharmaceutical Sciences, Mack Publishing Co. (A. R. Gennaro ed. 1985), and Remington, The Science and Practice of Pharmacy, 21st Edition (2005).
Examples of excipients for a pharmaceutical composition include antioxidants, suspending agents, dispersing agents, preservatives, buffering agents, tonicity agents, and surfactants.
An effective dose of an agent or pharmaceutical formulation of this invention can be an amount that is sufficient to cause translation of a mUNA molecule in a cell.
A therapeutically effective dose can be an amount of an agent or formulation that is sufficient to cause a therapeutic effect. A therapeutically effective dose can be administered in one or more separate administrations, and by different routes.
A therapeutically effective dose, upon administration, can result in serum levels of an active agent of 1-1000 pg/ml, or 1-1000 ng/ml, or 1-1000 μg/ml, or more.
A therapeutically effective dose of an active agent in vivo can be a dose of 0.001-0.01 mg/kg body weight, or 0.01-0.1 mg/kg, or 0.1-1 mg/kg, or 1-10 mg/kg, or 10-100 mg/kg.
A therapeutically effective dose of an active agent in vivo can be a dose of 0.001 mg/kg body weight, or 0.01 mg/kg, or 0.1 mg/kg, or 1 mg/kg, or 2 mg/kg, or 3 mg/kg, or 4 mg/kg, or 5 mg/kg, or more.
A subject can be an animal, or a human subject or patient.
Base sequences show herein are from left to right, 5′ to 3′, unless stated otherwise.
For the examples below, the mUNA transfection protocol in vitro was as follows:
For the examples below, the mUNA transfection protocol in vivo was as follows:
All of the comparative mUNA and mRNA molecules in the examples below were synthesized with the 5′ cap being a m7GpppGm cap. Unless otherwise specified, the mUNA molecules in the examples below contained a 5′-UTR of TEV, and a 3′ UTR of xenopus beta-globin.
In this example, a translatable mUNA molecule was made and used for expressing human Factor IX (FT9) in vivo with advantageously increased efficiency of translation, as compared to the mRNA of Factor IX. The translatable mUNA molecule expressing human Factor IX in vivo exhibited activity suitable for use in methods for ameliorating or treating hemophilia B. In this embodiment, the translatable mUNA molecule comprised a 5′ cap (m7GpppGm), a 5′ UTR of TEV, a F9 CDS, a 3′UTR of xenopus beta-globin, and a tail region.
The translation efficiency of this mUNA molecule is shown in FIG. 1, as compared to the mRNA of F9.
The mUNA molecule of this embodiment was translated in C57BL/c mouse to produce human F9.
FIG. 1 shows that the translation efficiency of this mUNA molecule was advantageously and surprisingly increased as compared to the mRNA of F9. In particular, after 55 hours, the translation efficiency of this mUNA molecule was increased by more than 2-fold (827/388) as compared to the mRNA of F9.
Details of the base structure of this translatable mUNA molecule are as follows:
| (SEQ ID NO: 1) |
| (m7GpppGm)GGGAAACAUAAGUCAACACAACAUAUACAAAACAAACGAA |
| UCUCAAGCAAUCAAGCAUUCUACUUCUAUUGCAGCAAUUUAAAUCAUUUC |
| UUUUAAAGCAAAAGCAAUUUUCUGAAAAUUUUCACCAUUUACGAACGAUA |
| GCCAUGGCCCAGCGCGUGAACAUGAUCAUGGCAGAAUCACCAGGCCUCAU |
| CACCAUCUGCCUUUUAGGAUAUCUACUCAGUGCUGAAUGUACAGUUUUUC |
| UUGAUCAUGAAAACGCCAACAAAAUUCUGAAUCGGCCAAAGAGGUAUAAU |
| UCAGGUAAAUUGGAAGAGUUUGUUCAAGGGAACCUUGAGAGAGAAUGUAU |
| GGAAGAAAAGUGUAGUUUUGAAGAAGCACGAGAAGUUUUUGAAAACACUG |
| AAAGAACAACUGAAUUUUGGAAGCAGUAUGUUGAUGGAGAUCAGUGUGAG |
| UCCAAUCCAUGUUUAAAUGGCGGCAGUUGCAAGGAUGACAUUAAUUCCUA |
| UGAAUGUUGGUGUCCCUUUGGAUUUGAAGGAAAGAACUGUGAAUUAGAUG |
| UAACAUGUAACAUUAAGAAUGGCAGAUGCGAGCAGUUUUGUAAAAAUAGU |
| GCUGAUAACAAGGUGGUUUGCUCCUGUACUGAGGGAUAUCGACUUGCAGA |
| AAACCAGAAGUCCUGUGAACCAGCAGUGCCAUUUCCAUGUGGAAGAGUUU |
| CUGUUUCACAAACUUCUAAGCUCACCCGUGCUGAGACUGUUUUUCCUGAU |
| GUGGACUAUGUAAAUUCUACUGAAGCUGAAACCAUUUUGGAUAACAUCAC |
| UCAAAGCACCCAAUCAUUUAAUGACUUCACUCGGGUUGUUGGUGGAGAAG |
| AUGCCAAACCAGGUCAAUUCCCUUGGCAGGUUGUUUUGAAUGGUAAAGUU |
| GAUGCAUUCUGUGGAGGCUCUAUCGUUAAUGAAAAAUGGAUUGUAACUGC |
| UGCCCACUGUGUUGAAACUGGUGUUAAAAUUACAGUUGUCGCAGGUGAAC |
| AUAAUAUUGAGGAGACAGAACAUACAGAGCAAAAGCGAAAUGUGAUUCGA |
| AUUAUUCCUCACCACAACUACAAUGCAGCUAUUAAUAAGUACAACCAUGA |
| CAUUGCCCUUCUGGAACUGGACGAACCCUUAGUGCUAAACAGCUACGUUA |
| CACCUAUUUGCAUUGCUGACAAGGAAUACACGAACAUCUUCCUCAAAUUU |
| GGAUCUGGCUAUGUAAGUGGCUGGGGAAGAGUCUUCCACAAAGGGAGAUC |
| AGCUUUAGUUCUUCAGUACCUUAGAGUUCCACUUGUUGACCGAGCCACAU |
| GUCUUCGAUCUACAAAGUUCACCAUCUAUAACAACAUGUUCUGUGCUGGC |
| UUCCAUGAAGGAGGUAGAGAUUCAUGUCAAGGAGAUAGUGGGGGACCCCA |
| UGUUACUGAAGUGGAAGGGACCAGUUUCUUAACUGGAAUUAUUAGCUGGG |
| GUGAAGAGUGUGCAAUGAAAGGCAAAUAUGGAAUAUAUACCAAGGUAUCC |
| CGGUAUGUCAACUGGAUUAAGGAAAAAACAAAGCUCACUUGACUAGUGAC |
| UGACUAGGAUCUGGUUACCACUAAACCAGCCUCAAGAACACCCGAAUGGA |
| GUCUCUAAGCUACAUAAUACCAACUUACACUUACAAAAUGUUGUCCCCCA |
| AAAUGUAGCCAUUCGUAUCUGCUCCUAAUAAAAAGAAAGUUUCUUCACAU |
| AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA |
| AAAAAAÃÃAA |
In this example, the translatable mUNA molecule of Example 1 (SEQ ID NO: 1) was made and used for expressing human Factor IX (F9) in vitro with advantageously increased efficiency of translation, as compared to the mRNA of Factor IX. The translatable mUNA molecule expressing human Factor IX exhibited activity suitable for use in methods for ameliorating or treating hemophilia B.
The translation efficiency of this mUNA molecule (SEQ ID NO: 1) is shown in FIG. 2, as compared to the mRNA of F9.
The mUNA molecule of this embodiment was traslated in mouse hepatocyte cell line Hepa1-6 to produce human F9.
FIG. 2 shows that the translation efficiency of this mUNA molecule was advantageously and surprisingly increased as compared to the mRNA of F9. In particular, after 48 hours, the translation efficiency of this mUNA molecule was increased by 5-fold (91/16) as compared to the mRNA of F9.
In this example, a translatable mUNA molecule was made and used for expressing human Erythropoietin (EPO) in vitro with advantageously increased efficiency of translation, as compared to the mRNA of EPO. The translatable mUNA molecule expressing human EPO exhibited activity suitable for use in methods for ameliorating or treating certain anemias, inflammatory bowel disease, and/or certain myelodysplasias. In this embodiment, the translatable mUNA molecule comprised a 5′ cap (m7GpppGm), a 5′ UTR of TEV, a human EPO CDS, a 3′UTR of xenopus beta-globin, and a tail region.
The translation efficiency of this mUNA molecule is shown in FIG. 3, as compared to the mRNA of EPO.
The mUNA molecule of this embodiment was translated in mouse hepatocyte cell line Hepa1-6 to produce human EPO.
FIG. 3 shows that the translation efficiency of this mUNA molecule was advantageously and surprisingly increased as compared to the mRNA of F9. In particular, after 48 hours, the translation efficiency of this mUNA molecule was more than doubled (4500/1784) as compared to the mRNA of EPO.
Details of the base structure of this translatable mUNA molecule are as follows:
| (SEQ ID NO: 2) |
| (m7GpppGm)GGGAAACAUAAGUCAACACAACAUAUACAAAACAAACGAA |
| UCUCAAGCAAUCAAGCAUUCUACUUCUAUUGCAGCAAUUUAAAUCAUUUC |
| UUUUAAAGCAAAAGCAAUUUUCUGAAAAUUUUCACCAUUUACGAACGAUA |
| GCCAUGGGGGUGCACGAAUGUCCUGCCUGGCUGUGGCUUCUCCUGUCCCU |
| GCUGUCGCUCCCUCUGGGCCUCCCAGUCCUGGGCGCCCCACCACGCCUCA |
| UCUGUGACAGCCGAGUCCUGGAGAGGUACCUCUUGGAGGCCAAGGAGGCC |
| GAGAAUAUCACGACGGGCUGUGCUGAACACUGCAGCUUGAAUGAGAAUAU |
| CACUGUCCCAGACACCAAAGUUAAUUUCUAUGCCUGGAAGAGGAUGGAGG |
| UCGGGCAGCAGGCCGUAGAAGUCUGGCAGGGCCUGGCCCUGCUGUCGGAA |
| GCUGUCCUGCGGGGCCAGGCCCUGUUGGUCAACUCUUCCCAGCCGUGGGA |
| GCCCCUGCAGCUGCAUGUGGAUAAAGCCGUCAGUGGCCUUCGCAGCCUCA |
| CCACUCUGCUUCGGGCUCUGGGAGCCCAGAAGGAAGCCAUCUCCCCUCCA |
| GAUGCGGCCUCAGCUGCUCCACUCCGAACAAUCACUGCUGACACUUUCCG |
| CAAACUCUUCCGAGUCUACUCCAAUUUCCUCCGGGGAAAGCUGAAGCUGU |
| ACACAGGGGAGGCCUGCAGGACAGGGGACAGAUGACUAGUGACUGACUAG |
| GAUCUGGUUACCACUAAACCAGCCUCAAGAACACCCGAAUGGAGUCUCUA |
| AGCUACAUAAUACCAACUUACACUUACAAAAUGUUGUCCCCCAAAAUGUA |
| GCCAUUCGUAUCUGCUCCUAAUAAAAAGAAAGUUUCUUCACAUAAAAAAA |
| AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAÃ |
| ÃAA |
In this example, several translatable mUNA molecules were made and used for expressing mouse Erythropoietin (EPO) in vitro with advantageously increased efficiency of translation, as compared to the mRNA of EPO. In this embodiment, the translatable mUNA molecules each comprised a 5′ cap (m7GpppGm), a 5′ UTR of TEV, a mouse EPO CDS, a 3′UTR of xenopus beta-globin, and a tail region.
The translation efficiency of these mUNA molecules (#2, 3, 4, 5, 6, 7, 8, 9, 10 and 11) are shown in FIG. 4, as compared to the mRNA of EPO (#1).
The mUNA molecules of this embodiment were translated in mouse hepatocyte cell line Hepa1-6 to produce mouse EPO.
FIG. 4 shows that the translation efficiency of the mUNA molecules (#2, 3, 4, 5, 6, 7, 8, 9, 10 and 11) was advantageously and surprisingly increased as compared to the mRNA of EPO (#1). In particular, after 72 hours, the translation efficiency of the mUNA molecules was increased by up to 8-fold (0.203/0.025) as compared to the mRNA of EPO, and the translation efficiency of every mUNA molecule (#2, 3, 4, 5, 6, 7, 8, 9, 10 and 11) was increased as compared to the mRNA of EPO (#1).
Details of the base structure of the translatable mUNA molecule #2 are as follows:
| (SEQ ID NO: 3) |
| (m7GpppGm)GGGAAACAUAAGUCAACACAACAUAUACAAAACAAACGAA |
| UCUCAAGCAAUCAAGCAUUCUACUUCUAUUGCAGCAAUUUAAAUCAUUUC |
| UUUUAAAGCAAAAGCAAUUUUCUGAAAAUUUUCACCAUUUACGAACGAUA |
| GCCAUGGGGGUGCCCGAACGUCCCACCCUGCUGCUUUUACUCUCCUUGCU |
| ACUGAUUCCUCUGGGCCUCCCAGUCCUCUGUGCUCCCCCACGCCUCAUCU |
| GCGACAGUCGAGUUCUGGAGAGGUACAUCUUAGAGGCCAAGGAGGCAGAA |
| AAUGUCACGAUGGGUUGUGCAGAAGGUCCCAGACUGAGUGAAAAUAUUAC |
| AGUCCCAGAUACCAAAGUCAACUUCUAUGCUUGGAAAAGAAUGGAGGUGG |
| AAGAACAGGCCAUAGAAGUUUGGCAAGGCCUGUCCCUGCUCUCAGAAGCC |
| AUCCUGCAGGCCCAGGCCCUGCUAGCCAAUUCCUCCCAGCCACCAGAGAC |
| CCUUCAGCUUCAUAUAGACAAAGCCAUCAGUGGUCUACGUAGCCUCACUU |
| CACUGCUUCGGGUACUGGGAGCUCAGAAGGAAUUGAUGUCGCCUCCAGAU |
| ACCACCCCACCUGCUCCACUCCGAACACUCACAGUGGAUACUUUCUGCAA |
| GCUCUUCCGGGUCUACGCCAACUUCCUCCGGGGGAAACUGAAGCUGUACA |
| CGGGAGAGGUCUGCAGGAGAGGGGACAGGTGACUAGUGACUGACUAGGAU |
| CUGGUUACCACUAAACCAGCCUCAAGAACACCCGAAUGGAGUCUCUAAGC |
| UACAUAAUACCAACUUACACUUACAAAAUGUUGUCCCCCAAAAUGUAGCC |
| AUUCGUAUCUGCUCCUAAUAAAAAGAAAGUUUCUUCACAUAAAAAAAAAA |
| AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA{tilde over (ÃA)} |
Details of the base structure of the translatable mUNA molecules #3 through #11 that were made are the same as molecule #2, except that the 3′ terminal tail regions, the last 40 monomers are as follows:
| mUNA molecule #3 | |
| (SEQ ID NO: 4) | |
| AAAAAAAAAAAAAAAAAAAAAAAAAAAAAA | |
| AAAAAAAAAAAAAAAAAAAAAAAAAAÃÃAA | |
| mUNA molecule #4 | |
| (SEQ ID NO: 5) | |
| AAAAAAAAAAAAAAAAAAAAAAAAAAAAAA | |
| AAAAAAAAAAAAAAAAAAAAAAAAÃÃAAAA | |
| mUNA molecule #5 | |
| (SEQ ID NO: 6) | |
| AAAAAAAAAAAAAAAAAAAAAAAAAAAAAA | |
| AAAAAAAAAAAAAAAAAAAAAAÃÃAAAAAA | |
| mUNA molecule #6 | |
| (SEQ ID NO: 7) | |
| AAAAAAAAAAAAAAAAAAAAAAAAAAAAAA | |
| AAAAAAAAAAAAAAAAAAAAÃÃAAAAAAAA | |
| mUNA molecule #7 | |
| (SEQ ID NO: 8) | |
| AAAAAAAAAAAAAAAAAAAAAAAAAAAAAA | |
| AAAAAAAAAAAAAAAAAAÃÃAAAAAAAAAA | |
| mUNA molecule #8 | |
| (SEQ ID NO: 9) | |
| AAAAAAAAAAAAAAAAAAAAAAAAAAAAAA | |
| AAAAAAAAAAAAAAAAÃÃAAAAAAAAAAAA | |
| mUNA molecule #9 | |
| (SEQ ID NO: 10) | |
| AAAAAAAAAAAAAAAAAAAAAAAAAAAAAA | |
| AAAAAAAAAAAAAAÃÃAAAAAAAAAAAAAA | |
| mUNA molecule #10 | |
| (SEQ ID NO: 11) | |
| AAAAAAAAAAAAAAAAAAAAAAAAAAAAAA | |
| AAAAAAAAAAAAÃÃAAAAAAAAAAAAAAAA | |
| mUNA molecule #11 | |
| (SEQ ID NO: 12) | |
| AAAAAAAAAAAAAAAAAAAAAAAAAAAAAA | |
| AAAAAAAAAAÃÃAAAAAAAAAAAAAAAAAA |
In this example, a translatable mUNA molecule was made and used for expressing human alpha-1-Antitrypsin in vivo with advantageously increased efficiency of translation, as compared to the mRNA of human alpha-1-Antitrypsin. The translatable mUNA molecule expressing human alpha-1-Antitrypsin exhibited activity suitable for use in methods for ameliorating or treating alpha-1-Antitrypsin deficiency. In this embodiment, the translatable mUNA molecule comprised a 5′ cap (m7GpppGm), a 5′ UTR of TEV, a human alpha-1-Antitrypsin CDS, a 3′UTR of xenopus beta-globin, and a tail region.
The translation efficiency of this mUNA molecule is shown in FIG. 5, as compared to the mRNA of human alpha-1-Antitrypsin.
The mUNA molecule of this embodiment was translated in C57BL/c mouse to produce human alpha-1-Antitrypsin.
FIG. 5 shows that the translation efficiency of this mUNA molecule was advantageously and surprisingly increased as compared to the mRNA of human alpha-1-Antitrypsin. In particular, after 72 hours, the translation efficiency of this mUNA molecule was increased by more than 3-fold (87.8/25.4) as compared to the mRNA of human alpha-1-Antitrypsin.
Details of the base structure of this translatable mUNA molecule were as follows:
| (SEQ ID NO: 13) |
| (m7GpppGm)GGGAAACAUAAGUCAACACAACAUAUACAAAACAAACGAA |
| UCUCAAGCAAUCAAGCAUUCUACUUCUAUUGCAGCAAUUUAAAUCAUUUC |
| UUUUAAAGCAAAAGCAAUUUUCUGAAAAUUUUCACCAUUUACGAACGAUA |
| GCCAUGCCGUCUUCUGUCUCGUGGGGCAUCCUCCUGCUGGCAGGCCUGUG |
| CUGCCUGGUCCCUGUCUCCCUGGCUGAGGAUCCCCAGGGAGAUGCUGCCC |
| AGAAGACAGAUACAUCCCACCAUGAUCAGGAUCACCCAACCUUCAACAAG |
| AUCACCCCCAACCUGGCUGAGUUCGCCUUCAGCCUAUACCGCCAGCUGGC |
| ACACCAGUCCAACAGCACCAAUAUCUUCUUCUCCCCAGUGAGCAUCGCUA |
| CAGCCUUUGCAAUGCUCUCCCUGGGGACCAAGGCUGACACUCACGAUGAA |
| AUCCUGGAGGGCCUGAAUUUCAACCUCACGGAGAUUCCGGAGGCUCAGAU |
| CCAUGAAGGCUUCCAGGAACUCCUCCGUACCCUCAACCAGCCAGACAGCC |
| AGCUCCAGCUGACCACCGGCAAUGGCCUGUUCCUCAGCGAGGGCCUGAAG |
| CUAGUGGAUAAGUUUUUGGAGGAUGUUAAAAAGUUGUACCACUCAGAAGC |
| CUUCACUGUCAACUUCGGGGACACCGAAGAGGCCAAGAAACAGAUCAACG |
| AUUACGUGGAGAAGGGUACUCAAGGGAAAAUUGUGGAUUUGGUCAAGGAG |
| CUUGACAGAGACACAGUUUUUGCUCUGGUGAAUUACAUCUUCUUUAAAGG |
| CAAAUGGGAGAGACCCUUUGAAGUCAAGGACACCGAGGAAGAGGACUUCC |
| ACGUGGACCAGGUGACCACCGUGAAGGUGCCUAUGAUGAAGCGUUUAGGC |
| AUGUUUAACAUCCAGCACUGUAAGAAGCUGUCCAGCUGGGUGCUGCUGAU |
| GAAAUACCUGGGCAAUGCCACCGCCAUCUUCUUCCUGCCUGAUGAGGGGA |
| AACUACAGCACCUGGAAAAUGAACUCACCCACGAUAUCAUCACCAAGUUC |
| CUGGAAAAUGAAGACAGAAGGUCUGCCAGCUUACAUUUACCCAAACUGUC |
| CAUUACUGGAACCUAUGAUCUGAAGAGCGUCCUGGGUCAACUGGGCAUCA |
| CUAAGGUCUUCAGCAAUGGGGCUGACCUCUCCGGGGUCACAGAGGAGGCA |
| CCCCUGAAGCUCUCCAAGGCCGUGCAUAAGGCUGUGCUGACCAUCGACGA |
| GAAAGGGACUGAAGCUGCUGGGGCCAUGUUUUUAGAGGCCAUACCCAUGU |
| CUAUCCCCCCCGAGGUCAAGUUCAACAAACCCUUUGUCUUCUUAAUGAUU |
| GAACAAAAUACCAAGUCUCCCCUCUUCAUGGGAAAAGUGGUGAAUCCCAC |
| CCAAAAAUAACUAGUGACUGACUAGGAUCUGGUUACCACUAAACCAGCCU |
| CAAGAACACCCGAAUGGAGUCUCUAAGCUACAUAAUACCAACUUACACUU |
| ACAAAAUGUUGUCCCCCAAAAUGUAGCCAUUCGUAUCUGCUCCUAAUAAA |
| AAGAAAGUUUCUUCACAUAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA |
| AAAAAAAAAAAAAAAAAAAAAAÃÃAAAA |
In this example, a translatable mUNA molecule was made and used for expressing human Erythropoietin (EPO) in vivo with advantageously increased efficiency of translation, as compared to the mRNA of EPO. The translatable mUNA molecule expressing human EPO exhibited activity suitable for use in methods for ameliorating or treating certain anemias, inflammatory bowel disease, and/or certain myelodysplasias. In this embodiment, the translatable mUNA molecule comprised a 5′ cap (m7GpppGm), a 5′ UTR of TEV, a human EPO CDS, a 3′UTR of xenopus beta-globin, and a tail region.
The translation efficiency of this mUNA molecule is shown in FIG. 6, as compared to the mRNA of EPO.
The mUNA molecule of this embodiment was translated in C57BL/c mouse to produce human EPO.
FIG. 6 shows that the translation efficiency of this mUNA molecule was advantageously and surprisingly increased as compared to the mRNA of EPO. In particular, after 72 hours, the translation efficiency of this mUNA molecule was increased by more than 10-fold (1517/143) as compared to the mRNA of EPO.
Details of the base structure of this translatable mUNA molecule were as follows:
| (SEQ ID NO: 14) |
| (m7GpppGm)GGGAAACAUAAGUCAACACAACAUAUACAAAACAAACGA |
| AUCUCAAGCAAUCAAGCAUUCUACUUCUAUUGCAGCAAUUUAAAUCAUU |
| UCUUUUAAAGCAAAAGCAAUUUUCUGAAAAUUUUCACCAUUUACGAACG |
| AUAGCCAUGGGGGUGCACGAAUGUCCUGCCUGGCUGUGGCUUCUCCUGU |
| CCCUGCUGUCGCUCCCUCUGGGCCUCCCAGUCCUGGGCGCCCCACCACG |
| CCUCAUCUGUGACAGCCGAGUCCUGGAGAGGUACCUCUUGGAGGCCAAG |
| GAGGCCGAGAAUAUCACGACGGGCUGUGCUGAACACUGCAGCUUGAAUG |
| AGAAUAUCACUGUCCCAGACACCAAAGUUAAUUUCUAUGCCUGGAAGAG |
| GAUGGAGGUCGGGCAGCAGGCCGUAGAAGUCUGGCAGGGCCUGGCCCUG |
| CUGUCGGAAGCUGUCCUGCGGGGCCAGGCCCUGUUGGUCAACUCUUCCC |
| AGCCGUGGGAGCCCCUGCAGCUGCAUGUGGAUAAAGCCGUCAGUGGCCU |
| UCGCAGCCUCACCACUCUGCUUCGGGCUCUGGGAGCCCAGAAGGAAGCC |
| AUCUCCCCUCCAGAUGCGGCCUCAGCUGCUCCACUCCGAACAAUCACUG |
| CUGACACUUUCCGCAAACUCUUCCGAGUCUACUCCAAUUUCCUCCGGGG |
| AAAGCUGAAGCUGUACACAGGGGAGGCCUGCAGGACAGGGGACAGAUGA |
| CUAGUGACUGACUAGGAUCUGGUUACCACUAAACCAGCCUCAAGAACAC |
| CCGAAUGGAGUCUCUAAGCUACAUAAUACCAACUUACACUUACAAAAUG |
| UUGUCCCCCAAAAUGUAGCCAUUCGUAUCUGCUCCUAAUAAAAAGAAAG |
| UUUCUUCACAUAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA |
| AAAAAAAAAAAAAAAAÃÃAAAA |
In this example, a translatable mUNA molecule is made for use in expressing human CFTR in vivo. The translatable mUNA molecule expressing human CFTR in vivo is suitable for use in methods for ameliorating or treating cystic fibrosis. In this embodiment, the translatable mUNA molecule comprises a 5′ cap (m7GpppGm), a 5′ UTR of TEV, a CFTR CDS, a 3′UTR of xenopus beta-globin, and a tail region shown in Example 4.
Human CFTR is accession NM_000492.3.
In this example, a translatable mUNA molecule is made for use in expressing human argininosuccinate lyase (ASL) in vivo. The translatable mUNA molecule expressing human ASL in vivo is suitable for use in methods for ameliorating or treating ASL deficiency. In this embodiment, the translatable mUNA molecule comprises a 5′ cap (m7GpppGm), a 5′ UTR of TEV, a ASL CDS, a 3′UTR of xenopus beta-globin, and a tail region shown in Example 4.
Human ASL is accession NM_001024943.1.
In this example, a translatable mUNA molecule is made for use in expressing human Phenylalanine-4-hydroxylase (PAH) in vivo. The translatable mUNA molecule expressing human PAH in vivo is suitable for use in methods for ameliorating or treating Phenylketonuria (PKU). In this embodiment, the translatable mUNA molecule comprises a 5′ cap (m7GpppGm), a 5′ UTR of TEV, a PAH CDS, a 3′UTR of xenopus beta-globin, and a tail region shown in Example 4.
Human PAH is accession NM_000277.1.
In this example, a translatable mUNA molecule is made for use in expressing human Sodium/iodide cotransporter (NIS) in vivo. The translatable mUNA molecule expressing human NIS in vivo is suitable for use in methods for ameliorating or treating thyroid disease. In this embodiment, the translatable mUNA molecule comprises a 5′ cap (m7GpppGm), a 5′ UTR of TEV, a NIS CDS, a 3′UTR of xenopus beta-globin, and a tail region shown in Example 4.
Human NIS is accession BC105047.
In this example, a translatable mUNA molecule is made for use in expressing human Sodium/iodide cotransporter (NIS) in vivo. The translatable mUNA molecule expressing human NIS in vivo is suitable for use in methods for ameliorating or treating thyroid disease. In this embodiment, the translatable mUNA molecule comprises a 5′ cap (m7GpppGm), a 5′ UTR of TEV, a NIS CDS, a 3′UTR of xenopus beta-globin, and a tail region shown in Example 4.
Human NIS is accession BC105047.
In this example, a translatable mUNA molecule is made for use in expressing human Hepcidin in vivo. The translatable mUNA molecule expressing human Hepcidin in vivo is suitable for use in methods for ameliorating or treating iron deficiency disease. In this embodiment, the translatable mUNA molecule comprises a 5′ cap (m7GpppGm), a 5′ UTR of TEV, a Hepcidin CDS, a 3′UTR of xenopus beta-globin, and a tail region shown in Example 4.
Human Hepcidin is accession NM_021175.3.
In this example, the structures of mUNA molecules for use in expressing Factor IX are shown.
Factor IX (F9) is associated with hemophilia B.
The base sequences shown below are the portion of the mUNA molecule that may correspond in functionality to the open reading frame of the native mRNA of human Factor IX. The complete mUNA molecule comprises a 5′ cap (m7GpppGm), and a 5′-UTR upstream of the sequence below, and a 3′ UTR and polyA tail (SEQ ID Nos: 4 to 12) downstream of the sequence below, each of which corresponds to the structure of the native mRNA of human Factor IX.
| Human Factor IX is accession NM_000133.3. |
| (SEQ ID NO: 15) |
| AU{circumflex over (G)}CAGCGCGUGAACAUGAUCAUGGCAGAAUC{tilde over (A)}CCAGGCCUCAUCACCA |
| UCUGCCUUUUAGG{tilde over (A)}UAUCUACUCAGUGCUGAAUGUACAGUUUU{tilde over (U)}CUUGA |
| UCAUGAAAACGCCAACAAAAUUCU{circumflex over (G)}AAUCGGCCAAAGAGGUAUAAUUCA |
| GGUAA{tilde over (A)}UUGGAAGAGUUUGUUCAAGGGAACCUUGA{circumflex over (G)}AGAGAAUGUAUGG |
| AAGAAAAGUGUAGUUU{tilde over (U)}GAAGAAGCACGAGAAGUUUUUGAAAACAC{tilde over (U)}GA |
| AAGAACAACUGAAUUUUGGAAGCAGUA{tilde over (U)}GUUGAUGGAGAUCAGUGUGAG |
| UCCAAUCC{tilde over (A)}UGUUUAAAUGGCGGCAGUUGCAAGGAUGA{circumflex over (C)}AUUAAUUCCU |
| AUGAAUGUUGGUGUCCCUU{tilde over (U)}GGAUUUGAAGGAAAGAACUGUGAAUUAGA |
| {tilde over (U)}GUAACAUGUAACAUUAAGAAUGGCAGAUG{circumflex over (C)}GAGCAGUUUUGUAAAAAU |
| AGUGCUGAUAA{circumflex over (C)}AAGGUGGUUUGCUCCUGUACUGAGGGAUA{tilde over (U)}CGACUUG |
| CAGAAAACCAGAAGUCCUGUGA{tilde over (A)}CCAGCAGUGCCAUUUCCAUGUGGAAG |
| AGU{tilde over (U)}UCUGUUUCACAAACUUCUAAGCUCACCCG{tilde over (U)}GCUGAGACUGUUUUU |
| CCUGAUGUGGACUA{tilde over (U)}GUAAAUUCUACUGAAGCUGAAACCAUUUUG{circumflex over (G)}AUA |
| ACAUCACUCAAAGCACCCAAUCAUU{tilde over (U)}AAUGACUUCACUCGGGUUGUUGG |
| UGGAGA{tilde over (A)}GAUGCCAAACCAGGUCAAUUCCCUUGGCA{circumflex over (G)}GUUGUUUUGAAU |
| GGUAAAGUUGAUGCAUU{circumflex over (C)}UGUGGAGGCUCUAUCGUUAAUGAAAAAUG{circumflex over (G)}A |
| UUGUAACUGCUGCCCACUGUGUUGAAAC{tilde over (U)}GGUGUUAAAAUUACAGUUGU |
| CGCAGGUGA{tilde over (A)}CAUAAUAUUGAGGAGACAGAACAUACAGA{circumflex over (G)}CAAAAGCGA |
| AAUGUGAUUCGAAUUAUUCC{tilde over (U)}CACCACAACUACAAUGCAGCUAUUAAUA |
| A{circumflex over (G)}UACAACCAUGACAUUGCCCUUCUGGAACU{circumflex over (G)}GACGAACCCUUAGUGCU |
| AAACAGCUACGU{tilde over (U)}ACACCUAUUUGCAUUGCUGACAAGGAAUA{circumflex over (C)}ACGAAC |
| AUCUUCCUCAAAUUUGGAUCUGG{circumflex over (C)}UAUGUAAGUGGCUGGGGAAGAGUCU |
| UCCA{circumflex over (C)}AAAGGGAGAUCAGCUUUAGUUCUUCAGUA{circumflex over (C)}CUUAGAGUUCCACU |
| UGUUGACCGAGCCAC{tilde over (A)}UGUCUUCGAUCUACAAAGUUCACCAUCUA{tilde over (U)}AAC |
| AACAUGUUCUGUGCUGGCUUCCAUGA{tilde over (A)}GGAGGUAGAGAUUCAUGUCAAG |
| GAGAUAG{tilde over (U)}GGGGGACCCCAUGUUACUGAAGUGGAAGG{circumflex over (G)}ACCAGUUUCUU |
| AACUGGAAUUAUUAGCUG{circumflex over (G)}GGUGAAGAGUGUGCAAUGAAAGGCAAAUA{tilde over (U)} |
| GGAAUAUAUACCAAGGUAUCCCGGUAUGU{circumflex over (C)}AACUGGAUUAAGGAAAAAA |
| CAAAGCUCAC{tilde over (U)}UAA |
| (SEQ ID NO: 16) |
| A{tilde over (U)}{circumflex over (G)}{circumflex over (C)}AGCGCGUGAACAUGAUCAUGGCAGAAUCACCAGGCCUCAUCACCA |
| UCUGCCUUUUAGGAUAUCUACUCAGUGCUGAAUGUACAGUUUUUCUUGA |
| UCAUGAAAACGCCAACAAAAUUCUGAAUCGGCCAAAGAGGUAUAAUUCA |
| GGUAAAUUGGAAGAGUUUGUUCAAGGGAACCUUGAGAGAGAAUGUAUGG |
| AAGAAAAGUGUAGUUUUGAAGAAGCACGAGAAGUUUUUGAAAACACUGA |
| AAGAACAACUGAAUUUUGGAAGCAGUAUGUUGAUGGAGAUCAGUGUGAG |
| UCCAAUCCAUGUUUAAAUGGCGGCAGUUGCAAGGAUGACAUUAAUUCCU |
| AUGAAUGUUGGUGUCCCUUUGGAUUUGAAGGAAAGAACUGUGAAUUAGA |
| UGUAACAUGUAACAUUAAGAAUGGCAGAUGCGAGCAGUUUUGUAAAAAU |
| AGUGCUGAUAACAAGGUGGUUUGCUCCUGUACUGAGGGAUAUCGACUUG |
| CAGAAAACCAGAAGUCCUGUGAACCAGCAGUGCCAUUUCCAUGUGGAAG |
| AGUUUCUGUUUCACAAACUUCUAAGCUCACCCGUGCUGAGACUGUUUUU |
| CCUGAUGUGGACUAUGUAAAUUCUACUGAAGCUGAAACCAUUUUGGAUA |
| CACAUCACUCAAAGCACCCAAUCAUUUAAUGACUUCACUCGGGUUGUUG |
| GUGGAGAAGAUGCCAAACCAGGUCAAUUCCCUUGGCAGGUUGUUUUGAA |
| UGGUAAAGUUGAUGCAUUCUGUGGAGGCUCUAUGUUAAUGAAAAAUGGA |
| UUGUAACUGCUGCCCACUGUGUUGAAACUGGUGUUAAAAUUACAGUUGU |
| CGCAGGUGAACAUAAUAUUGAGGAGACAGAACAUACAGAGCAAAAGCGA |
| AAUGUGAUUCGAAUUAUUCCUCACCACAACUACAAUGCAGCUAUUAAUA |
| AGUACAACCAUGACAUUGCCCUUCUGGAACUGGACGAACCCUUAGUGCU |
| AAACAGCUACGUUACACCUAUUUGCAUUGCUGACAAGGAAUACACGAAC |
| AUCUUCCUCAAAUUUGGAUCUGGCUAUGUAAGUGGCUGGGGAAGAGUCU |
| UCCACAAAGGGAGAUCAGCUUUAGUUCUUCAGUACCUUAGAGUUCCACU |
| UGUUGACCGAGCCACAUGUCUUCGAUCUACAAAGUUCACCAUCUAUAAC |
| AACAUGUUCUGUGCUGGCUUCCAUGAAGGAGGUAGAGAUUCAUGUCAAG |
| GAGAUAGUGGGGGACCCCAUGUUACUGAAGUGGAAGGGACCAGUUUCUU |
| AACUGGAAUUAUUAGCUGGGGUGAAGAGUGUGCAAUGAAAGGCAAAUAU |
| GGAAUAUAUACCAAGGUAUCCCGGUAUGUCAACUGGAUUAAGGAAAAAA |
| CAAAGCUCAC{tilde over (U)}{tilde over (U)}{tilde over (A)}A |
| (SEQ ID NO: 17) |
| A{tilde over (U)}GCAGCGCG{tilde over (U)}GAACA{tilde over (U)}GA{tilde over (U)}CAGGCAGAA{tilde over (U)}CACCAGGCC{tilde over (U)}CA{tilde over (U)}CACCA{tilde over (U)} |
| C{tilde over (U)}GCC{tilde over (U)}{tilde over (U)}{tilde over (U)}{tilde over (U)}AGGA{tilde over (U)}A{tilde over (U)}C{tilde over (U)}AC{tilde over (U)}CAG{tilde over (U)}GC{tilde over (U)}GAA{tilde over (U)}G{tilde over (U)}ACAG{tilde over (U)}{tilde over (U)}{tilde over (U)}{tilde over (U)}{tilde over (U)}C{tilde over (U)}{tilde over (U)}GA{tilde over (U)} |
| CA{tilde over (U)}GAAAACGCCAACAAAA{tilde over (U)}{tilde over (U)}C{tilde over (U)}GAA{tilde over (U)}CGGCCAAAGAGG{tilde over (U)}A{tilde over (U)}AA{tilde over (U)}{tilde over (U)}CAG |
| G{tilde over (U)}AAA{tilde over (U)}{tilde over (U)}GGAAGAG{tilde over (U)}{tilde over (U)}{tilde over (U)}G{tilde over (U)}{tilde over (U)}CAAGGGAACC{tilde over (U)}{tilde over (U)}GAGAGAGAA{tilde over (U)}G{tilde over (U)}A{tilde over (U)}GGA |
| AGAAAAG{tilde over (U)}G{tilde over (U)}AG{tilde over (U)}{tilde over (U)}{tilde over (U)}{tilde over (U)}GAAGAAGCACGAGAAG{tilde over (U)}{tilde over (U)}{tilde over (U)}{tilde over (U)}{tilde over (U)}GAAAACAC{tilde over (U)}GAA |
| AGAACAAC{tilde over (U)}GAA{tilde over (U)}{tilde over (U)}{tilde over (U)}{tilde over (U)}GGAAGCAG{tilde over (U)}A{tilde over (U)}G{tilde over (U)}{tilde over (U)}GA{tilde over (U)}GGAGA{tilde over (U)}CAG{tilde over (U)}G{tilde over (U)}GAG{tilde over (U)} |
| CCAA{tilde over (U)}CCA{tilde over (U)}G{tilde over (U)}{tilde over (U)}{tilde over (U)}AAA{tilde over (U)}GGCGGCAG{tilde over (U)}{tilde over (U)}GCAAGGA{tilde over (U)}GACA{tilde over (U)}{tilde over (U)}AA{tilde over (U)}{tilde over (U)}CC{tilde over (U)}A |
| {tilde over (U)}GAA{tilde over (U)}G{tilde over (U)}{tilde over (U)}GG{tilde over (U)}G{tilde over (U)}CCC{tilde over (U)}{tilde over (U)}{tilde over (U)}GGA{tilde over (U)}{tilde over (U)}{tilde over (U)}GAAGGAAAGAAC{tilde over (U)}G{tilde over (U)}GAA{tilde over (U)}{tilde over (U)}AGA{tilde over (U)} |
| G{tilde over (U)}AACA{tilde over (U)}G{tilde over (U)}AACA{tilde over (U)}{tilde over (U)}AAGAA{tilde over (U)}GGCAGA{tilde over (U)}GCGAGCAG{tilde over (U)}{tilde over (U)}{tilde over (U)}{tilde over (U)}G{tilde over (U)}AAAAA{tilde over (U)}A |
| G{tilde over (U)}GC{tilde over (U)}GA{tilde over (U)}AACAAGG{tilde over (U)}GG{tilde over (U)}{tilde over (U)}{tilde over (U)}GC{tilde over (U)}CC{tilde over (U)}G{tilde over (U)}AC{tilde over (U)}GAGGGA{tilde over (U)}A{tilde over (U)}CGAC{tilde over (U)}{tilde over (U)}GC |
| AGAAAACCAGAAG{tilde over (U)}CC{tilde over (U)}G{tilde over (U)}GAACCAGCAG{tilde over (U)}GCCA{tilde over (U)}{tilde over (U)}{tilde over (U)}CCA{tilde over (U)}G{tilde over (U)}GGAAGA |
| G{tilde over (U)}{tilde over (U)}{tilde over (U)}C{tilde over (U)}G{tilde over (U)}{tilde over (U)}{tilde over (U)}CACAAAC{tilde over (U)}{tilde over (U)}C{tilde over (U)}AAGC{tilde over (U)}CACCCG{tilde over (U)}GC{tilde over (U)}GAGAC{tilde over (U)}G{tilde over (U)}{tilde over (U)}{tilde over (U)}{tilde over (U)}{tilde over (U)}C |
| C{tilde over (U)}GA{tilde over (U)}G{tilde over (U)}GGAC{tilde over (U)}A{tilde over (U)}G{tilde over (U)}AAA{tilde over (U)}{tilde over (U)}C{tilde over (U)}AC{tilde over (U)}GAAGC{tilde over (U)}GAAACCA{tilde over (U)}{tilde over (U)}{tilde over (U)}{tilde over (U)}GGA{tilde over (U)}AA |
| CA{tilde over (U)}CAC{tilde over (U)}CAAAGCACCCAA{tilde over (U)}CA{tilde over (U)}{tilde over (U)}{tilde over (U)}AA{tilde over (U)}GAC{tilde over (U)}{tilde over (U)}CAC{tilde over (U)}CGGG{tilde over (U)}{tilde over (U)}G{tilde over (U)}{tilde over (U)}GG{tilde over (U)} |
| GGAGAAGA{tilde over (U)}GCCAAACCAGG{tilde over (U)}CAA{tilde over (U)}{tilde over (U)}CCC{tilde over (U)}{tilde over (U)}GGCAGG{tilde over (U)}{tilde over (U)}G{tilde over (U)}{tilde over (U)}{tilde over (U)}{tilde over (U)}GAA{tilde over (U)}G |
| G{tilde over (U)}AAAG{tilde over (U)}{tilde over (U)}GA{tilde over (U)}GCA{tilde over (U)}{tilde over (U)}C{tilde over (U)}G{tilde over (U)}GGAGGC{tilde over (U)}C{tilde over (U)}A{tilde over (U)}CG{tilde over (U)}{tilde over (U)}AA{tilde over (U)}GAAAAA{tilde over (U)}GGA{tilde over (U)} |
| {tilde over (U)}G{tilde over (U)}AAC{tilde over (U)}GC{tilde over (U)}GCCCAC{tilde over (U)}G{tilde over (U)}G{tilde over (U)}{tilde over (U)}GAAAC{tilde over (U)}GG{tilde over (U)}G{tilde over (U)}{tilde over (U)}AAAA{tilde over (U)}{tilde over (U)}ACAG{tilde over (U)}{tilde over (U)}G{tilde over (U)}C |
| GCAGG{tilde over (U)}GAACA{tilde over (U)}AA{tilde over (U)}A{tilde over (U)}{tilde over (U)}GAGGAGACAGAACA{tilde over (U)}ACAGAGCAAAAGCGAA |
| A{tilde over (U)}G{tilde over (U)}GA{tilde over (U)}{tilde over (U)}CGAA{tilde over (U)}{tilde over (U)}A{tilde over (U)}{tilde over (U)}CC{tilde over (U)}CACCACAAC{tilde over (U)}ACAA{tilde over (U)}GCAGC{tilde over (U)}A{tilde over (U)}{tilde over (U)}AA{tilde over (U)}AA |
| G{tilde over (U)}ACAACCA{tilde over (U)}GACA{tilde over (U)}{tilde over (U)}GCCC{tilde over (U)}{tilde over (U)}C{tilde over (U)}GGAAC{tilde over (U)}GGACGAACCC{tilde over (U)}{tilde over (U)}AG{tilde over (U)}GC{tilde over (U)}A |
| AACAGC{tilde over (U)}ACG{tilde over (U)}{tilde over (U)}ACACC{tilde over (U)}A{tilde over (U)}{tilde over (U)}{tilde over (U)}GCA{tilde over (U)}{tilde over (U)}GC{tilde over (U)}GACAAGGAA{tilde over (U)}ACACGAACA |
| {tilde over (U)}C{tilde over (U)}{tilde over (U)}CC{tilde over (U)}CAAA{tilde over (U)}{tilde over (U)}{tilde over (U)}GGA{tilde over (U)}C{tilde over (U)}GGC{tilde over (U)}A{tilde over (U)}G{tilde over (U)}AAG{tilde over (U)}GGC{tilde over (U)}GGGGAAGAG{tilde over (U)}C{tilde over (U)}{tilde over (U)} |
| CCACAAAGGGAGA{tilde over (U)}CAGC{tilde over (U)}{tilde over (U)}{tilde over (U)}AG{tilde over (U)}{tilde over (U)}C{tilde over (U)}{tilde over (U)}CAG{tilde over (U)}ACC{tilde over (U)}{tilde over (U)}AGAG{tilde over (U)}{tilde over (U)}CCAC{tilde over (U)}{tilde over (U)} |
| G{tilde over (U)}{tilde over (U)}GACCGAGCCACA{tilde over (U)}G{tilde over (U)}C{tilde over (U)}{tilde over (U)}CGA{tilde over (U)}C{tilde over (U)}ACAAAG{tilde over (U)}{tilde over (U)}CACCA{tilde over (U)}C{tilde over (U)}A{tilde over (U)}AACA |
| ACA{tilde over (U)}G{tilde over (U)}{tilde over (U)}C{tilde over (U)}G{tilde over (U)}GC{tilde over (U)}GGC{tilde over (U)}{tilde over (U)}CCA{tilde over (U)}GAAGGAGG{tilde over (U)}AGAGA{tilde over (U)}{tilde over (U)}CA{tilde over (U)}G{tilde over (U)}CAAGG |
| AGA{tilde over (U)}AG{tilde over (U)}GGGGGACCCCA{tilde over (U)}G{tilde over (U)}{tilde over (U)}AC{tilde over (U)}GAAG{tilde over (U)}GGAAGGGACCAG{tilde over (U)}{tilde over (U)}{tilde over (U)}C{tilde over (U)}{tilde over (U)}A |
| AC{tilde over (U)}GGAA{tilde over (U)}{tilde over (U)}A{tilde over (U)}{tilde over (U)}AGC{tilde over (U)}GGGG{tilde over (U)}GAAGAG{tilde over (U)}G{tilde over (U)}GCAA{tilde over (U)}GAAAGGCAAA{tilde over (U)}A{tilde over (U)}G |
| GAA{tilde over (U)}A{tilde over (U)}A{tilde over (U)}ACCAAGG{tilde over (U)}A{tilde over (U)}CCCGG{tilde over (U)}A{tilde over (U)}G{tilde over (U)}CAAC{tilde over (U)}GGA{tilde over (U)}{tilde over (U)}AAGGAAAAAAC |
| AAAGC{tilde over (U)}CAC{tilde over (U)}{tilde over (U)}AA |
In this example, the structures of mUNA molecules for use in expressing alpha-1-Antitrypsin are shown.
Alpha-1-Antitrypsin is associated with alpha-1-Antitrypsin deficiency disease, cystic fibrosis, interstitial lung disease, and pulmonary arterial hypertension.
The base sequences shown below are the portion of the mUNA molecule that may correspond in functionality to the open reading frame of the native mRNA of alpha-1-Antitrypsin. The complete mUNA molecule comprises a 5′ cap (m7GpppGm), and a 5′-UTR upstream of the sequence below, and a 3′ UTR and polyA tail (SEQ ID Nos: 4 to 12) downstream of the sequence below, each of which corresponds to the structure of the native mRNA of alpha-1-Antitrypsin.
| Human alpha-1-antitrypsin mRNA is accession |
| NM_000295.4. |
| (SEQ ID NO: 18) |
| AU{circumflex over (G)}CCGUCUUCUGUCUCGUGGGGCAUCCUCCU{circumflex over (G)}CUGGCAGGCCUGUGCU |
| GCCUGGUCCCUGU{circumflex over (C)}UCCCUGGCUGAGGAUCCCCAGGGAGAUGC{tilde over (U)}GCCCA |
| GAAGACAGAUACAUCCCACCAUGA{tilde over (U)}CAGGAUCACCCAACCUUCAACAAG |
| AUCA{circumflex over (C)}CCCCAACCUGGCUGAGUUCGCCUUCAGCCU{tilde over (A)}UACCGCCAGCUGG |
| CACACCAGUCCAACAG{circumflex over (C)}ACCAAUAUCUUCUUCUCCCCAGUGAGCAU{circumflex over (C)}GC |
| UACAGCCUUUGCAAUGCUCUCCCUGGG{circumflex over (G)}ACCAAGGCUGACACUCACGAU |
| GAAAUCCU{circumflex over (G)}GAGGGCCUGAAUUUCAACCUCACGGAGAU{tilde over (U)}CCGGAGGCUC |
| AGAUCCAUGAAGGCUUCCA{circumflex over (G)}GAACUCCUCCGUACCCUCAACCAGCCAGA |
| {circumflex over (C)}AGCCAGCUCCAGCUGACCACCGGCAAUGG{circumflex over (C)}CUGUUCCUCAGCGAGGGC |
| CUGAAGCUAGU{circumflex over (G)}GAUAAGUUUUUGGAGGAUGUUAAAAAGUU{circumflex over (G)}UACCACU |
| CAGAAGCCUUCACUGUCAACUU{circumflex over (C)}GGGGACACCGAAGAGGCCAAGAAACA |
| GAU{circumflex over (C)}AACGAUUACGUGGAGAAGGGUACUCAAGG{circumflex over (G)}AAAAUUGUGGAUUUG |
| GUCAAGGAGCUUGA{circumflex over (C)}AGAGACACAGUUUUUGCUCUGGUGAAUUA{circumflex over (C)}AUCU |
| UCUUUAAAGGCAAAUGGGAGAGACC{circumflex over (C)}UUUGAAGUCAAGGACACCGAGGA |
| AGAGGA{circumflex over (C)}UUCCACGUGGACCAGGUGACCACCGUGAA{circumflex over (G)}GUGCCUAUGAUG |
| AAGCGUUUAGGCAUGUU{tilde over (U)}AACAUCCAGCACUGUAAGAAGCUGUCCAG{circumflex over (C)}U |
| GGGUGCUGCUGAUGAAAUACCUGGGCAA{tilde over (U)}GCCACCGCCAUCUUCUUCCU |
| GCCUGAUGA{circumflex over (G)}GGGAAACUACAGCACCUGGAAAAUGAACU{circumflex over (C)}ACCCACGAU |
| AUCAUCACCAAGUUCCUGGA{tilde over (A)}AAUGAAGACAGAAGGUCUGCCAGCUUAC |
| A{tilde over (U)}UUACCCAAACUGUCCAUUACUGGAACCUA{tilde over (U)}GAUCUGAAGAGCGUCCU |
| GGGUCAACUGGG{circumflex over (C)}AUCACUAAGGUCUUCAGCAAUGGGGCUGA{circumflex over (C)}CUCUCC |
| GGGGUCACAGAGGAGGCACCCCU{circumflex over (G)}AAGCUCUCCAAGGCCGUGCAUAAGG |
| CUGU{circumflex over (G)}CUGACCAUCGACGAGAAAGGGACUGAAGC{tilde over (U)}GCUGGGGCCAUGUU |
| UUUAGAGGCCAUACC{circumflex over (C)}AUGUCUAUCCCCCCCGAGGUCAAGUUCAA{circumflex over (C)}AAA |
| CCCUUUGUCUUCUUAAUGAUUGAACA{tilde over (A)}AAUACCAAGUCUCCCCUCUUCA |
| UGGGAAA{tilde over (A)}GUGGUGAAUCCCACCCAAAAAU{tilde over (A)}A |
| (SEQ ID NO: 19) |
| A{tilde over (U)}{circumflex over (G)}{circumflex over (C)}CGUCUUCUGUCUCGUGGGGCAUCCUCCUGCUGGCAGGCCUGUGCU |
| GCCUGGUCCCUGUCUCCCUGGCUGAGGAUCCCCAGGGAGAUGCUGCCCA |
| GAAGACAGAUACAUCCCACCAUGAUCAGGAUCACCCAACCUUCAACAAG |
| AUCACCCCCAACCUGGCUGAGUUCGCCUUCAGCCUAUACCGCCAGCUGG |
| CACACCAGUCCAACAGCACCAAUAUCUUCUUCUCCCCAGUGAGCAUCGC |
| UACAGCCUUUGCAAUGCUCUCCCUGGGGACCAAGGCUGACACUCACGAU |
| GAAAUCCUGGAGGGCCUGAAUUUCAACCUCACGGAGAUUCCGGAGGCUC |
| AGAUCCAUGAAGGCUUCCAGGAACUCCUCCGUACCCUCAACCAGCCAGA |
| CAGCCAGCUCCAGCUGACCACCGGCAAUGGCCUGUUCCUCAGCGAGGGC |
| CUGAAGCUAGUGGAUAAGUUUUUGGAGGAUGUUAAAAAGUUGUACCACU |
| CAGAAGCCUUCACUGUCAACUUCGGGGACACCGAAGAGGCCAAGAAACA |
| GAUCAACGAUUACGUGGAGAAGGGUACUCAAGGGAAAAUUGUGGAUUUG |
| GUCAAGGAGCUUGACAGAGACACAGUUUUUGCUCUGGUGAAUUACAUCU |
| UCUUUAAAGGCAAAUGGGAGAGACCCUUUGAAGUCAAGGACACCGAGGA |
| AGAGGACUUCCACGUGGACCAGGUGACCACCGUGAAGGUGCCUAUGAUG |
| AAGCGUUUAGGCAUGUUUAACAUCCAGCACUGUAAGAAGCUGUCCAGCU |
| GGGUGCUGCUGAUGAAAUACCUGGGCAAUGCCACCGCCAUCUUCUUCCU |
| GCCUGAUGAGGGGAAACUACAGCACCUGGAAAAUGAACUCACCCACGAU |
| AUCAUCACCAAGUUCCUGGAAAAUGAAGACAGAAGGUCUGCCAGCUUAC |
| AUUUACCCAAACUGUCCAUUACUGGAACCUAUGAUCUGAAGAGCGUCCU |
| GGGUCAACUGGGCAUCACUAAGGUCUUCAGCAAUGGGGCUGACCUCUCC |
| GGGGUCACAGAGGAGGCACCCCUGAAGCUCUCCAAGGCCGUGCAUAAGG |
| CUGUGCUGACCAUCGACGAGAAAGGGACUGAAGCUGCUGGGGCCAUGUU |
| UUUAGAGGCCAUACCCAUGUCUAUCCCCCCCGAGGUCAAGUUCAACAAA |
| CCCUUUGUCUUCUUAAUGAUUGAACAAAAUACCAAGUCUCCCCUCUUCA |
| UGGGAAAAGUGGUGAAUCCCACCCAAAA{tilde over (A)}{tilde over (U)}{tilde over (A)}A |
| (SEQ ID NO: 20) |
| A{tilde over (U)}GCCG{tilde over (U)}C{tilde over (U)}{tilde over (U)}C{tilde over (U)}G{tilde over (U)}C{tilde over (U)}CG{tilde over (U)}GGGGCA{tilde over (U)}CC{tilde over (U)}CC{tilde over (U)}GC{tilde over (U)}GGCAGGCC{tilde over (U)}G{tilde over (U)}GC{tilde over (U)} |
| GCC{tilde over (U)}GG{tilde over (U)}CCC{tilde over (U)}G{tilde over (U)}C{tilde over (U)}CCC{tilde over (U)}GGC{tilde over (U)}GAGGA{tilde over (U)}CCCCAGGGAGA{tilde over (U)}GC{tilde over (U)}GCCCA |
| GAAGACAGA{tilde over (U)}ACA{tilde over (U)}CCCACCA{tilde over (U)}GA{tilde over (U)}CAGGA{tilde over (U)}CACCCAACC{tilde over (U)}{tilde over (U)}CAACAAG |
| A{tilde over (U)}CACCCCCAACC{tilde over (U)}GGC{tilde over (U)}GAG{tilde over (U)}{tilde over (U)}CGCC{tilde over (U)}{tilde over (U)}CAGCC{tilde over (U)}A{tilde over (U)}ACCGCCAGC{tilde over (U)}GG |
| CACACCAG{tilde over (U)}CCAACAGCACCAA{tilde over (U)}A{tilde over (U)}C{tilde over (U)}{tilde over (U)}C{tilde over (U)}{tilde over (U)}C{tilde over (U)}CCCCAG{tilde over (U)}GAGCA{tilde over (U)}CGC |
| {tilde over (U)}ACAGCC{tilde over (U)}{tilde over (U)}{tilde over (U)}GCAA{tilde over (U)}GC{tilde over (U)}C{tilde over (U)}CCC{tilde over (U)}GGGGACCAAGGC{tilde over (U)}GACAC{tilde over (U)}CACGA{tilde over (U)} |
| GAAA{tilde over (U)}CC{tilde over (U)}GGAGGGCC{tilde over (U)}GAA{tilde over (U)}{tilde over (U)}{tilde over (U)}CAACC{tilde over (U)}CACGGAGA{tilde over (U)}{tilde over (U)}CCGGAGGC{tilde over (U)}C |
| AGA{tilde over (U)}CCA{tilde over (U)}GAAGGC{tilde over (U)}{tilde over (U)}CCAGGAAC{tilde over (U)}CC{tilde over (U)}CCG{tilde over (U)}ACCC{tilde over (U)}CAACCAGCCAGA |
| CAGCCAGC{tilde over (U)}CCAGC{tilde over (U)}GACCACCGGCAA{tilde over (U)}GGCC{tilde over (U)}G{tilde over (U)}{tilde over (U)}CC{tilde over (U)}CAGCGAGGGC |
| C{tilde over (U)}GAAGC{tilde over (U)}AG{tilde over (U)}GGA{tilde over (U)}AAG{tilde over (U)}{tilde over (U)}{tilde over (U)}{tilde over (U)}{tilde over (U)}GGAGGA{tilde over (U)}G{tilde over (U)}{tilde over (U)}AAAAAG{tilde over (U)}{tilde over (U)}G{tilde over (U)}ACCAC{tilde over (U)} |
| CAGAAGCC{tilde over (U)}{tilde over (U)}CAC{tilde over (U)}G{tilde over (U)}CAAC{tilde over (U)}{tilde over (U)}CGGGGACACCGAAGAGGCCAAGAAACA |
| GA{tilde over (U)}CAACGA{tilde over (U)}{tilde over (U)}ACG{tilde over (U)}GGAGAAGGG{tilde over (U)}AC{tilde over (U)}CAAGGGAAAA{tilde over (U)}{tilde over (U)}G{tilde over (U)}GGA{tilde over (U)}{tilde over (U)}{tilde over (U)}G |
| G{tilde over (U)}CAAGGAGC{tilde over (U)}{tilde over (U)}GACAGAGACACAG{tilde over (U)}{tilde over (U)}{tilde over (U)}{tilde over (U)}{tilde over (U)}GC{tilde over (U)}C{tilde over (U)}GG{tilde over (U)}GAA{tilde over (U)}{tilde over (U)}ACA{tilde over (U)}C{tilde over (U)} |
| {tilde over (U)}C{tilde over (U)}{tilde over (U)}{tilde over (U)}AAAGGCAAA{tilde over (U)}GGGAGAGACCC{tilde over (U)}{tilde over (U)}{tilde over (U)}GAAG{tilde over (U)}CAAGGACACCGAGGA |
| AGAGGAC{tilde over (U)}{tilde over (U)}CCACG{tilde over (U)}GGACCAGG{tilde over (U)}GACCACCG{tilde over (U)}GAAGG{tilde over (U)}GCC{tilde over (U)}A{tilde over (U)}GA{tilde over (U)}G |
| AAGCG{tilde over (U)}{tilde over (U)}{tilde over (U)}AGGCA{tilde over (U)}G{tilde over (U)}{tilde over (U)}{tilde over (U)}AACA{tilde over (U)}CCAGCAC{tilde over (U)}G{tilde over (U)}AAGAAGC{tilde over (U)}G{tilde over (U)}CCAGC{tilde over (U)} |
| GGG{tilde over (U)}GC{tilde over (U)}GC{tilde over (U)}GA{tilde over (U)}GAAA{tilde over (U)}ACC{tilde over (U)}GGGCAA{tilde over (U)}GCCACCGCCA{tilde over (U)}C{tilde over (U)}{tilde over (U)}C{tilde over (U)}{tilde over (U)}CC{tilde over (U)} |
| GCC{tilde over (U)}GA{tilde over (U)}GAGGGGAAAC{tilde over (U)}ACAGCACC{tilde over (U)}GGAAAA{tilde over (U)}GAAC{tilde over (U)}CACCCACGA{tilde over (U)} |
| A{tilde over (U)}CA{tilde over (U)}CACCAAG{tilde over (U)}{tilde over (U)}CC{tilde over (U)}GGAAAA{tilde over (U)}GAAGACAGAAGG{tilde over (U)}C{tilde over (U)}GCCAGC{tilde over (U)}{tilde over (U)}AC |
| A{tilde over (U)}{tilde over (U)}{tilde over (U)}ACCCAAAC{tilde over (U)}G{tilde over (U)}CCA{tilde over (U)}{tilde over (U)}AC{tilde over (U)}GGAACC{tilde over (U)}A{tilde over (U)}GA{tilde over (U)}C{tilde over (U)}GAAGAGCG{tilde over (U)}CC{tilde over (U)} |
| GGG{tilde over (U)}CAAC{tilde over (U)}GGGCA{tilde over (U)}CAC{tilde over (U)}AAGG{tilde over (U)}C{tilde over (U)}{tilde over (U)}CAGCAA{tilde over (U)}GGGGC{tilde over (U)}GACC{tilde over (U)}C{tilde over (U)}CC |
| GGGG{tilde over (U)}CACAGAGGAGGCACCCC{tilde over (U)}GAAGC{tilde over (U)}C{tilde over (U)}CCAAGGCCG{tilde over (U)}GCA{tilde over (U)}AAGG |
| C{tilde over (U)}G{tilde over (U)}GC{tilde over (U)}GACCA{tilde over (U)}CGACGAGAAAGGGAC{tilde over (U)}GAAGC{tilde over (U)}GC{tilde over (U)}GGGGCCA{tilde over (U)}G{tilde over (U)}{tilde over (U)} |
| {tilde over (U)}{tilde over (U)}{tilde over (U)}AGAGGCCA{tilde over (U)}ACCCA{tilde over (U)}G{tilde over (U)}C{tilde over (U)}A{tilde over (U)}CCCCCCCGAGG{tilde over (U)}CAAG{tilde over (U)}{tilde over (U)}CAACAAA |
| CCC{tilde over (U)}{tilde over (U)}{tilde over (U)}G{tilde over (U)}C{tilde over (U)}{tilde over (U)}C{tilde over (U)}{tilde over (U)}AA{tilde over (U)}GA{tilde over (U)}{tilde over (U)}GAACAAAA{tilde over (U)}ACCAAG{tilde over (U)}C{tilde over (U)}CCCC{tilde over (U)}C{tilde over (U)}{tilde over (U)}CA |
| {tilde over (U)}GGGAAAAG{tilde over (U)}GG{tilde over (U)}GAA{tilde over (U)}CCCACCCAAAAA{tilde over (U)}AA |
In this example, the structures of mUNA molecules for use in expressing alpha-1-Antitrypsin are shown.
Alpha-1-Antitrypsin is associated with alpha-1-Antitrypsin deficiency disease, cystic fibrosis, interstitial lung disease, and pulmonary arterial hypertension.
The base sequences shown below are the portion of the mUNA molecule that may correspond in functionality to the 5′-UTR of the native mRNA of alpha-1-Antitrypsin. The complete mUNA molecule comprises a 5′ cap (m7GpppGm) upstream of the sequence below, and coding region (CDS) for human alpha-1-Antitrypsin, a 3′ UTR and polyA tail (SEQ ID Nos: 4 to 12) downstream of the sequence below, each of which corresponds to the structure of the native mRNA of alpha-1-Antitrypsin.
| Human alpha-1-antitrypsin mRNA is accession |
| NM_000295.4. |
| (SEQ ID NO: 21) |
| GGCACCACCACUGACCUGGGACAGUGAAUCGACAGCCGACC |
| (SEQ ID NO: 22) |
| GGCACCACCACUGACCUGGGACAGUGAAUCGACAGCCGA{circumflex over (C)}{circumflex over (C)} |
| (SEQ ID NO: 23) |
| GGCACCACCACUGACCUGGGACAGUGAAUCGACAGCC{circumflex over (G)}{tilde over (A)}CC |
| (SEQ ID NO: 24) |
| GGCACCACCACUGACCUGGGACAGUGAAUCGACAG{circumflex over (C)}{circumflex over (C)}GACC |
| (SEQ ID NO: 25) |
| GGCACCACCACUGACCUGGGACAGUGAAUCGAC{tilde over (A)}{circumflex over (G)}CCGACC |
| (SEQ ID NO: 26) |
| GGCACCACCACUGACCUGGGACAGUGAAUCG{tilde over (A)}{circumflex over (C)}AGCCGACC |
| (SEQ ID NO: 27) |
| GGCACCACCACUGACCUGGGACAGUGAAU{circumflex over (C)}{circumflex over (G)}ACAGCCGACC |
| (SEQ ID NO: 28) |
| GGCACCACCACUGACCUGGGACAGUGA{tilde over (A)}{tilde over (U)}CGACAGCCGACC |
| (SEQ ID NO: 29) |
| GGCACCACCACUGACCUGGGACAGU{circumflex over (G)}{tilde over (A)}AUCGACAGCCGACC |
| (SEQ ID NO: 30) |
| GGCACCACCACUGACCUGGGACA{circumflex over (G)}{tilde over (U)}GAAUCGACAGCCGACC |
| (SEQ ID NO: 31) |
| GGCACCACCACUGACCUGGGA{circumflex over (C)}{tilde over (A)}GUGAAUCGACAGCCGACC |
| (SEQ ID NO: 32) |
| GGCACCACCACUGACCUGG{circumflex over (G)}{tilde over (A)}CAGUGAAUCGACAGCCGACC |
| (SEQ ID NO: 33) |
| GGCACCACCACUGACCU{circumflex over (G)}{circumflex over (G)}GACAGUGAAUCGACAGCCGACC |
| (SEQ ID NO: 34) |
| GGCACCACCACUGAC{circumflex over (C)}{tilde over (U)}GGGACAGUGAAUCGACAGCCGACC |
| (SEQ ID NO: 35) |
| GGCACCACCACUG{tilde over (A)}{circumflex over (C)}UGGGACAGUGAAUCGACAGCCGACC |
| (SEQ ID NO: 36) |
| GGCACCACCAC{tilde over (U)}{circumflex over (G)}ACCUGGGACAGUGAAUCGACAGCCGACC |
| (SEQ ID NO: 37) |
| GGCACCACC{tilde over (A)}{circumflex over (C)}CUGACCUGGGACAGUGAAUCGACAGCCGACC |
| (SEQ ID NO: 38) |
| GGCACCA{circumflex over (C)}{circumflex over (C)}ACUGACCUGGGACAGUGAAUCGACAGCCGACC |
| (SEQ ID NO: 39) |
| GGCAC{circumflex over (C)}{tilde over (A)}CCACUGACCUGGGACAGUGAAUCGACAGCCGACC |
| (SEQ ID NO: 40) |
| GGC{tilde over (A)}{circumflex over (C)}CACCACUGACCUGGGACAGUGAAUCGACAGCCGACC |
| (SEQ ID NO: 41) |
| G{circumflex over (G)}{circumflex over (C)}ACCACCACUGACCUGGGACAGUGAAUCGACAGCCGACC |
| (SEQ ID NO: 42) |
| GGCACCACCACUGACCUGGGACAGUGAAUCGACAGCCG{tilde over (A)}C{circumflex over (C)} |
| (SEQ ID NO: 43) |
| GGCACCACCACUGACCUGGGACAGUGAAUCGACAGCC{circumflex over (G)}AC{circumflex over (C)} |
| (SEQ ID NO: 44) |
| GGCACCACCACUGACCUGGGACAGUGAAUCGACAGC{circumflex over (C)}AC{circumflex over (C)} |
| (SEQ ID NO: 45) |
| GGCACCACCACUGACCUGGGACAGUGAAUCGACAG{circumflex over (C)}CGAC{circumflex over (C)} |
| (SEQ ID NO: 46) |
| GGCACCACCACUGACCUGGGACAGUGAAUCGACA{circumflex over (G)}CCGAC{circumflex over (C)} |
| (SEQ ID NO: 47) |
| GGCACCACCACUGACCUGGGACAGUGAAUCGAC{tilde over (A)}GCCGAC{circumflex over (C)} |
| (SEQ ID NO: 48) |
| GGCACCACCACUGACCUGGGACAGUGAAUCGA{circumflex over (C)}AGCCGAC{circumflex over (C)} |
| (SEQ ID NO: 49) |
| GGCACCACCACUGACCUGGGACAGUGAAUCG{tilde over (A)}CAGCCGAC{circumflex over (C)} |
| (SEQ ID NO: 50) |
| GGCACCACCACUGACCUGGGACAGUGAAUC{circumflex over (G)}ACAGCCGAC{circumflex over (C)} |
| (SEQ ID NO: 51) |
| GGCACCACCACUGACCUGGGACAGUGAAU{circumflex over (C)}GACAGCCGAC{circumflex over (C)} |
| (SEQ ID NO: 52) |
| GGCACCACCACUGACCUGGGACAGUGAA{tilde over (U)}CGACAGCCGAC{circumflex over (C)} |
| (SEQ ID NO: 53) |
| GGCACCACCACUGACCUGGGACAGUGA{tilde over (A)}UCGACAGCCGAC{circumflex over (C)} |
| (SEQ ID NO: 54) |
| GGCACCACCACUGACCUGGGACAGUG{tilde over (A)}AUCGACAGCCGAC{circumflex over (C)} |
| (SEQ ID NO: 55) |
| GGCACCACCACUGACCUGGGACAGU{circumflex over (G)}AAUCGACAGCCGAC{circumflex over (C)} |
| (SEQ ID NO: 56) |
| GGCACCACCACUGACCUGGGACAG{tilde over (U)}GAAUCGACAGCCGAC{circumflex over (C)} |
| (SEQ ID NO: 57) |
| GGCACCACCACUGACCUGGGACA{circumflex over (G)}UGAAUCGACAGCCGAC{circumflex over (C)} |
| (SEQ ID NO: 58) |
| GGCACCACCACUGACCUGGGAC{tilde over (A)}GUGAAUCGACAGCCGAC{circumflex over (C)} |
| (SEQ ID NO: 59) |
| GGCACCACCACUGACCUGGGA{circumflex over (C)}AGUGAAUCGACAGCCGAC{circumflex over (C)} |
| (SEQ ID NO: 60) |
| GGCACCACCACUGACCUGGG{tilde over (A)}CAGUGAAUCGACAGCCGAC{circumflex over (C)} |
| (SEQ ID NO: 61) |
| GGCACCACCACUGACCUGG{circumflex over (G)}ACAGUGAAUCGACAGCCGAC{circumflex over (C)} |
| (SEQ ID NO: 62) |
| GGCACCACCACUGACCUG{circumflex over (G)}GACAGUGAAUCGACAGCCGAC{circumflex over (C)} |
| (SEQ ID NO: 63) |
| GGCACCACCACUGACCU{circumflex over (G)}GGACAGUGAAUCGACAGCCGAC{circumflex over (C)} |
| (SEQ ID NO: 64) |
| GGCACCACCACUGACC{tilde over (U)}GGGACAGUGAAUCGACAGCCGAC{circumflex over (C)} |
| (SEQ ID NO: 65) |
| GGCACCACCACUGAC{circumflex over (C)}UGGGACAGUGAAUCGACAGCCGAC{circumflex over (C)} |
| (SEQ ID NO: 66) |
| GGCACCACCACUGA{circumflex over (C)}UUGGGACAGUGAAUCGACAGCCGAC{circumflex over (C)} |
| (SEQ ID NO: 67) |
| GGCACCACCACUG{tilde over (A)}CCUGGGACAGUGAAUCGACAGCCGAC{circumflex over (C)} |
| (SEQ ID NO: 68) |
| GGCACCACCACU{circumflex over (G)}ACCUGGGACAGUGAAUCGACAGCCGAC{circumflex over (C)} |
| (SEQ ID NO: 69) |
| GGCACCACCAC{tilde over (U)}GACCUGGGACAGUGAAUCGACAGCCGAC{circumflex over (C)} |
| (SEQ ID NO: 70) |
| GGCACCACCA{circumflex over (C)}UGACCUGGGACAGUGAAUCGACAGCCGAC{circumflex over (C)} |
| (SEQ ID NO: 71) |
| GGCACCACC{tilde over (A)}CUGACCUGGGACAGUGAAUCGACAGCCGAC{circumflex over (C)} |
| (SEQ ID NO: 72) |
| GGCACCAC{circumflex over (C)}ACUGACCUGGGACAGUGAAUCGACAGCCGAC{circumflex over (C)} |
| (SEQ ID NO: 73) |
| GGCACCA{circumflex over (C)}CACUGACCUGGGACAGUGAAUCGACAGCCGAC{circumflex over (C)} |
| (SEQ ID NO: 74) |
| GGCACC{tilde over (A)}CCACUGACCUGGGACAGUGAAUCGACAGCCGAC{circumflex over (C)} |
| (SEQ ID NO: 75) |
| GGCAC{circumflex over (C)}ACCACUGACCUGGGACAGUGAAUCGACAGCCGAC{circumflex over (C)} |
| (SEQ ID NO: 76) |
| GGCA{circumflex over (C)}CACCACUGACCUGGGACAGUGAAUCGACAGCCGAC{circumflex over (C)} |
| (SEQ ID NO: 77) |
| GGC{tilde over (A)}CCACCACUGACCUGGGACAGUGAAUCGACAGCCGAC{circumflex over (C)} |
| (SEQ ID NO: 78) |
| GG{circumflex over (C)}ACCACCACUGACCUGGGACAGUGAAUCGACAGCCGAC{circumflex over (C)} |
| (SEQ ID NO: 79) |
| G{circumflex over (G)}CACCACCACUGACCUGGGACAGUGAAUCGACAGCCGAC{circumflex over (C)} |
| (SEQ ID NO: 80) |
| GGCACCACCACUGACCUGGGACAGUGAAUCGACAGCCG{tilde over (A)}{circumflex over (C)}{circumflex over (C)} |
| (SEQ ID NO: 81) |
| GGCACCACCACUGACCUGGGACAGUGAAUCGACAG{circumflex over (C)}{circumflex over (C)}{circumflex over (G)}ACC |
| (SEQ ID NO: 82) |
| GGCACCACCACUGACCUGGGACAGUGAAUCGA{circumflex over (C)}{tilde over (A)}{circumflex over (G)}CCGACC |
| (SEQ ID NO: 83) |
| GGCACCACCACUGACCUGGGACAGUGAAUCGACAGC{circumflex over (C)}{circumflex over (G)}{tilde over (A)}CC |
| (SEQ ID NO: 84) |
| GGCACCACCACUGACCUGGGACAGUG{tilde over (A)}{tilde over (A)}{tilde over (U)}CGACAGCCGACC |
| (SEQ ID NO: 85) |
| GGCACCACCACUGACCUGGGACA{circumflex over (G)}{tilde over (U)}{circumflex over (G)}AAUCGACAGCCGACC |
| (SEQ ID NO: 86) |
| GGCACCACCACUGACCUGGG{tilde over (U)}{circumflex over (C)}{tilde over (A)}GUGAAUCGACAGCCGACC |
| (SEQ ID NO: 87) |
| GGCACCACCACUGACCU{circumflex over (G)}{circumflex over (G)}{circumflex over (G)}ACAGUGAAUCGACAGCCGACC |
| (SEQ ID NO: 88) |
| GGCACCACCACUGA{circumflex over (C)}{circumflex over (C)}{tilde over (U)}GGGACAGUGAAUCGACAGCCGACC |
| (SEQ ID NO: 89) |
| GGCACCACCAC{tilde over (U)}{circumflex over (G)}{tilde over (A)}CCUGGGACAGUGAAUCGACAGCCGACC |
| (SEQ ID NO: 90) |
| GGCACCAC{circumflex over (C)}{tilde over (A)}{circumflex over (C)}UGACCUGGGACAGUGAAUCGACAGCCGACC |
| (SEQ ID NO: 91) |
| GGCAC{circumflex over (C)}{tilde over (A)}{circumflex over (C)}CACUGACCUGGGACAGUGAAUCGACAGCCGACC |
| (SEQ ID NO: 92) |
| GG{circumflex over (C)}{tilde over (A)}{circumflex over (C)}CACCACUGACCUGGGACAGUGAAUCGACAGCCGACC |
| (SEQ ID NO: 93) |
| G{circumflex over (G)}CACCACCACUGACCUGGGACAGUGAAUCGACAGCCG{tilde over (A)}C{circumflex over (C)} |
| (SEQ ID NO: 94) |
| G{circumflex over (G)}CACCACCACUGACCUGGGACAGUGAAUCGACAGCC{circumflex over (G)}AC{circumflex over (C)} |
| (SEQ ID NO: 95) |
| G{circumflex over (G)}CACCACCACUGACCUGGGACAGUGAAUCGACAGC{circumflex over (C)}GAC{circumflex over (C)} |
| (SEQ ID NO: 96) |
| G{circumflex over (G)}CACCACCACUGACCUGGGACAGUGAAUCGACAG{circumflex over (C)}CGAC{circumflex over (C)} |
| (SEQ ID NO: 97) |
| G{circumflex over (G)}CACCACCACUGACCUGGGACAGUGAAUCGACA{circumflex over (G)}CCGAC{circumflex over (C)} |
| (SEQ ID NO: 98) |
| G{circumflex over (G)}CACCACCACUGACCUGGGACAGUGAAUCG{tilde over (A)}CAGCCGAC{circumflex over (C)} |
| (SEQ ID NO: 99) |
| G{circumflex over (G)}CACCACCACUGACCUGGGACAGUGAAUCGA{circumflex over (C)}AGCCGAC{circumflex over (C)} |
| (SEQ ID NO: 100) |
| G{circumflex over (G)}CACCACCACUGACCUGGGACAGUGAAUCG{tilde over (A)}CAGCCGAC{circumflex over (C)} |
| (SEQ ID NO: 101) |
| G{circumflex over (G)}CACCACCACUGACCUGGGACAGUGAAUC{circumflex over (G)}ACAGCCGAC{circumflex over (C)} |
| (SEQ ID NO: 102) |
| G{circumflex over (G)}CACCACCACUGACCUGGGACAGUGAAU{circumflex over (C)}GACAGCCGAC{circumflex over (C)} |
| (SEQ ID NO: 103) |
| G{circumflex over (G)}CACCACCACUGACCUGGGACAGUGAA{tilde over (U)}CGACAGCCGAC{circumflex over (C)} |
| (SEQ ID NO: 104) |
| G{circumflex over (G)}CACCACCACUGACCUGGGACAGUGA{tilde over (A)}UCGACAGCCGAC{circumflex over (C)} |
| (SEQ ID NO: 105) |
| G{circumflex over (G)}CACCACCACUGACCUGGGACAGUG{tilde over (A)}AUCGACAGCCGAC{circumflex over (C)} |
| (SEQ ID NO: 106) |
| G{circumflex over (G)}CACCACCACUGACCUGGGACAGU{circumflex over (G)}AAUCGACAGCCGAC{circumflex over (C)} |
| (SEQ ID NO: 107) |
| G{circumflex over (G)}CACCACCACUGACCUGGGACAG{tilde over (U)}GAAUCGACAGCCGAC{circumflex over (C)} |
| (SEQ ID NO: 108) |
| G{circumflex over (G)}CACCACCACUGACCUGGGACA{circumflex over (G)}UGAAUCGACAGCCGAC{circumflex over (C)} |
| (SEQ ID NO: 109) |
| G{circumflex over (G)}CACCACCACUGACCUGGGAC{tilde over (A)}GUGAAUCGACAGCCGAC{circumflex over (C)} |
| (SEQ ID NO: 110) |
| G{circumflex over (G)}CACCACCACUGACCUGGGA{circumflex over (C)}AGUGAAUCGACAGCCGAC{circumflex over (C)} |
| (SEQ ID NO: 111) |
| G{circumflex over (G)}CACCACCACUGACCUGGG{tilde over (A)}CAGUGAAUCGACAGCCGAC{circumflex over (C)} |
| (SEQ ID NO: 112) |
| G{circumflex over (G)}CACCACCACUGACCUGG{circumflex over (G)}ACAGUGAAUCGACAGCCGAC{circumflex over (C)} |
| (SEQ ID NO: 113) |
| G{circumflex over (G)}CACCACCACUGACCUG{circumflex over (G)}GACAGUGAAUCGACAGCCGAC{circumflex over (C)} |
| (SEQ ID NO: 114) |
| G{circumflex over (G)}CACCACCACUGACCU{circumflex over (G)}GGACAGUGAAUCGACAGCCGAC{circumflex over (C)} |
| (SEQ ID NO: 115) |
| G{circumflex over (G)}CACCACCACUGACC{tilde over (U)}GGGACAGUGAAUCGACAGCCGAC{circumflex over (C)} |
| (SEQ ID NO: 116) |
| G{circumflex over (G)}CACCACCACUGAC{circumflex over (C)}UGGGACAGUGAAUCGACAGCCGAC{circumflex over (C)} |
| (SEQ ID NO: 117) |
| G{circumflex over (G)}CACCACCACUGA{circumflex over (C)}CUGGGACAGUGAAUCGACAGCCGAC{circumflex over (C)} |
| (SEQ ID NO: 118) |
| G{circumflex over (G)}CACCACCACUG{tilde over (A)}CCUGGGACAGUGAAUCGACAGCCGAC{circumflex over (C)} |
| (SEQ ID NO: 119) |
| G{circumflex over (G)}CACCACCACU{circumflex over (G)}ACCUGGGACAGUGAAUCGACAGCCGAC{circumflex over (C)} |
| (SEQ ID NO: 120) |
| G{circumflex over (G)}CACCACCAC{tilde over (U)}GACCUGGGACAGUGAAUCGACAGCCGAC{circumflex over (C)} |
| (SEQ ID NO: 121) |
| G{circumflex over (G)}CACCACCA{circumflex over (C)}UGACCUGGGACAGUGAAUCGACAGCCGAC{circumflex over (C)} |
| (SEQ ID NO: 122) |
| G{circumflex over (G)}CACC{tilde over (A)}CCACUGACCUGGGACAGUGAAUCGACAGCCGAC{circumflex over (C)} |
| (SEQ ID NO: 123) |
| G{circumflex over (G)}CACCAC{circumflex over (C)}ACUGACCUGGGACAGUGAAUCGACAGCCGAC{circumflex over (C)} |
| (SEQ ID NO: 124) |
| G{circumflex over (G)}CACCA{circumflex over (C)}CACUGACCUGGGACAGUGAAUCGACAGCCGAC{circumflex over (C)} |
| (SEQ ID NO: 125) |
| G{circumflex over (G)}CACC{tilde over (A)}CCACUGACCUGGGACAGUGAAUCGACAGCCGAC{circumflex over (C)} |
| (SEQ ID NO: 126) |
| G{circumflex over (G)}CAC{circumflex over (C)}ACCACUGACCUGGGACAGUGAAUCGACAGCCGAC{circumflex over (C)} |
| (SEQ ID NO: 127) |
| G{circumflex over (G)}CA{circumflex over (C)}CACCACUGACCUGGGACAGUGAAUCGACAGCCGAC{circumflex over (C)} |
| (SEQ ID NO: 128) |
| G{circumflex over (G)}C{tilde over (A)}CCACCACUGACCUGGGACAGUGAAUCGACAGCCGAC{circumflex over (C)} |
| (SEQ ID NO: 129) |
| G{circumflex over (G)}{circumflex over (C)}ACCACCACUGACCUGGGACAGUGAAUCGACAGCCGAC{circumflex over (C)} |
| (SEQ ID NO: 130) |
| {circumflex over (G)}{circumflex over (G)}CACCACCACUGACCUGGGACAGUGAAUCGACAGCCGAC{circumflex over (C)} |
In this example, the structures of mUNA molecules for use in expressing human Erythropoietin (EPO) are shown.
Erythropoietin is available as a commercial drug and is indicated for anemia resulting from chronic kidney disease, inflammatory bowel disease including Crohn's disease and ulcer colitis, and myelodysplasia from the treatment of cancer with chemotherapy or radiation.
The base sequences shown below are the portion of the mUNA molecule that may correspond in functionality to the open reading frame of the native mRNA of human Erythropoietin. The complete mUNA molecule comprises a 5′ cap (m7GpppGm), and a 5′-UTR upstream of the sequence below, and a 3′ UTR and polyA tail (SEQ ID Nos: 4 to 12) downstream of the sequence below, each of which corresponds to the structure of the native mRNA of human Erythropoietin.
| Human Erythropoietin is accession NM_000799.2. |
| (SEQ ID NO: 131) |
| A{tilde over (U)}{circumflex over (G)}G{circumflex over (G)}GGUGCACGAAUGUCCUGCCUGGCUGUGGCUUCUCCUGUCCCUGC |
| UGUCGCUCCCUCUGGGCCUCCCAGUCCUGGGCGCCCCACCACGCCUCAU |
| CUGUGACAGCCGAGUCCUGGAGAGGUACCUCUUGGAGGCCAAGGAGGCC |
| GAGAAUAUCACGACGGGCUGUGCUGAACACUGCAGCUUGAAUGAGAAUA |
| UCACUGUCCCAGACACCAAAGUUAAUUUCUAUGCCUGGAAGAGGAUGGA |
| GGUCGGGCAGCAGGCCGUAGAAGUCUGGCAGGGCCUGGCCCUGCUGUCG |
| GAAGCUGUCCUGCGGGGCCAGGCCCUGUUGGUCAACUCUUCCCAGCCGU |
| GGGAGCCCCUGCAGCUGCAUGUGGAUAAAGCCGUCAGUGGCCUUCGCAG |
| CCUCACCACUCUGCUUCGGGCUCUGGGAGCCCAGAAGGAAGCCAUCUCC |
| CCUCCAGAUGCGGCCUCAGCUGCUCCACUCCGAACAAUCACUGCUGACA |
| CUUUCCGCAAACUCUUCCGAGUCUACUCCAAUUUCCUCCGGGGAAAGCU |
| GAAGCUGUACACAGGGGAGGCCUGCAGGACAGGGGACAG{tilde over (A)}{tilde over (U)}{circumflex over (G)}A |
| (SEQ ID NO: 132) |
| AU{circumflex over (G)}GGGGUGCACGA{tilde over (A)}UGUCCUGCCUG{circumflex over (G)}CUGUGGCUUCU{circumflex over (C)}CUGUCCCUGC |
| U{circumflex over (G)}UCGCUCCCUCU{circumflex over (G)}GGCCUCCCAGU{circumflex over (C)}CUGGGCGCCCC{tilde over (A)}CCACGCCUCAU |
| {circumflex over (C)}UGUGACAGCCG{tilde over (A)}GUCCUGGAGAG{circumflex over (G)}UACCUCUUGGA{circumflex over (G)}GCCAAGGAGGC |
| {circumflex over (C)}GAGAAUAUCAC{circumflex over (G)}ACGGGCUGUGC{tilde over (U)}GAACACUGCAG{circumflex over (C)}UUGAAUGAGAA |
| {tilde over (U)}AUCACUGUCCC{tilde over (A)}GACACCAAAGU{tilde over (U)}AAUUUCUAUGC{circumflex over (C)}UGGAAGAGGAU |
| {circumflex over (G)}GAGGUCGGGCA{circumflex over (G)}CAGGCCGUAGA{tilde over (A)}GUCUGGCAGGG{circumflex over (C)}UUGGCCCUGCU |
| {circumflex over (G)}UCGGAAGCUGU{circumflex over (C)}CUGCGGGGCCA{circumflex over (G)}GCCCUGUUGGU{circumflex over (C)}AACUCUUCCC |
| A{circumflex over (G)}CCGUGGGAGCC{circumflex over (G)}CUGCAGCUGCA{tilde over (U)}GUGGAUAAAGC{circumflex over (C)}GUCAGUGGCC |
| U{tilde over (U)}CGCAGCCUCAC{circumflex over (C)}ACUCUGCUUCGGGCUCUGGGAGC{circumflex over (C)}CAGAAGGAAG |
| CCAUCUCCCCUCC{tilde over (A)}GAUGCGGCCUC{tilde over (A)}GCUGCUCCACU{circumflex over (C)}CGAACAAUCA |
| C{tilde over (U)}GCUGACACUUU{circumflex over (C)}CGCAAACUCUU{circumflex over (C)}CGAGUCUACUC{circumflex over (C)}AAUUUCCUCC |
| G{circumflex over (G)}GGAAAGCUGAA{circumflex over (G)}CUGUACACAGG{circumflex over (G)}GAGGCCUGCAG{circumflex over (G)}ACAGGGGAC |
| AG{tilde over (A)}UGA |
| (SEQ ID NO: 133) |
| A{tilde over (U)}GGGGG{tilde over (U)}GCACGAA{tilde over (U)}G{tilde over (U)}CC{tilde over (U)}GCC{tilde over (U)}GGC{tilde over (U)}G{tilde over (U)}GGC{tilde over (U)}{tilde over (U)}C{tilde over (U)}CC{tilde over (U)}G{tilde over (U)}CCC{tilde over (U)}GC |
| {tilde over (U)}G{tilde over (U)}CGC{tilde over (U)}CCC{tilde over (U)}C{tilde over (U)}GGGCC{tilde over (U)}CCCAG{tilde over (U)}CC{tilde over (U)}GGGCGCCCCACCACGCC{tilde over (U)}CA{tilde over (U)} |
| C{tilde over (U)}G{tilde over (U)}GACAGCCGAG{tilde over (U)}CC{tilde over (U)}GGAGAGG{tilde over (U)}ACC{tilde over (U)}C{tilde over (U)}{tilde over (U)}GGAGGCCAAGGAGGCC |
| GAGAA{tilde over (U)}A{tilde over (U)}CACGACGGGC{tilde over (U)}G{tilde over (U)}GC{tilde over (U)}GAACAC{tilde over (U)}GCAGC{tilde over (U)}{tilde over (U)}GAA{tilde over (U)}GAGAA{tilde over (U)}A |
| {tilde over (U)}CAC{tilde over (U)}G{tilde over (U)}CCCAGACACCAAAG{tilde over (U)}{tilde over (U)}AA{tilde over (U)}{tilde over (U)}{tilde over (U)}C{tilde over (U)}A{tilde over (U)}GCC{tilde over (U)}GGAAGAGGA{tilde over (U)}GGA |
| GG{tilde over (U)}CGGGCAGCAGGCCG{tilde over (U)}AGAAG{tilde over (U)}C{tilde over (U)}GGCAGGGCC{tilde over (U)}GGCCC{tilde over (U)}GC{tilde over (U)}G{tilde over (U)}CG |
| GAAGC{tilde over (U)}G{tilde over (U)}CC{tilde over (U)}GCGGGGCCAGGCCC{tilde over (U)}G{tilde over (U)}{tilde over (U)}GG{tilde over (U)}CAAC{tilde over (U)}C{tilde over (U)}{tilde over (U)}CCCAGCCG{tilde over (U)} |
| GGGAGCCCC{tilde over (U)}GCAGC{tilde over (U)}GCA{tilde over (U)}G{tilde over (U)}GGA{tilde over (U)}AAAGCCG{tilde over (U)}CAG{tilde over (U)}GGCC{tilde over (U)}{tilde over (U)}CGCAG |
| CC{tilde over (U)}CACCAC{tilde over (U)}C{tilde over (U)}GC{tilde over (U)}{tilde over (U)}CGGGC{tilde over (U)}C{tilde over (U)}GGGAGCCCAGAAGGAAGCCA{tilde over (U)}C{tilde over (U)}CC |
| CC{tilde over (U)}CCAGA{tilde over (U)}GCGGCC{tilde over (U)}CAGC{tilde over (U)}GC{tilde over (U)}CCAC{tilde over (U)}CCGAACAA{tilde over (U)}CAC{tilde over (U)}GC{tilde over (U)}GACA |
| C{tilde over (U)}{tilde over (U)}{tilde over (U)}CCGCAAAC{tilde over (U)}C{tilde over (U)}{tilde over (U)}CCGAG{tilde over (U)}C{tilde over (U)}AC{tilde over (U)}CCAA{tilde over (U)}{tilde over (U)}{tilde over (U)}CC{tilde over (U)}CCGGGGAAAGC{tilde over (U)} |
| GAAGC{tilde over (U)}G{tilde over (U)}ACACAGGGGAGGCC{tilde over (U)}GCAGGACAGGGGACAGA{tilde over (U)}GA |
In this example, the structures of mUNA molecules for use in expressing human Ornithine transcarbamylase are shown.
Ornithine transcarbamylase is associated with Ornithine transcarbamylase deficiency.
The base sequences shown below are the portion of the mUNA molecule that may correspond in functionality to the open reading frame of the native mRNA of human Ornithine transcarbamylase. The complete mUNA molecule comprises a 5′ cap (m7GpppGm), and a 5′-UTR upstream of the sequence below, and a 3′ UTR and polyA tail (SEQ ID Nos: 4 to 12) downstream of the sequence below, each of which corresponds to the structure of the native mRNA of human Ornithine transcarbamylase.
| Human Ornithine transcarbamylase is accession | |
| NM_000531.5. | |
| (SEQ ID NO: 134) | |
| AU{circumflex over (G)}CUGUUUAAUCU{circumflex over (G)}AGGAUCCUGUU{tilde over (U)}AAACAAUGCAG{circumflex over (C)}UUUUAGAAAUG{circumflex over (G)}UCACAACU | |
| UCA{tilde over (U)}GGUUCGAAAUU{tilde over (U)}UCGGUGUGGAC{tilde over (A)}ACCACUACAAA{tilde over (A)}UAAAGUGCAGC{tilde over (U)}GAAGGGC | |
| CGUG{tilde over (A)}CCUUCUCACUC{tilde over (U)}AAAAAACUUUA{circumflex over (C)}CGGAGAAGAAA{tilde over (U)}UAAAUAUAUGC{tilde over (U)}AUGGCU | |
| AUCAG{circumflex over (C)}AGAUCUGAAAU{tilde over (U)}UAGGAUAAAAC{tilde over (A)}GAAAGGAGAGU{tilde over (A)}UUUGCCUUUAU{tilde over (U)}GCAAG | |
| GGAAGU{circumflex over (C)}CUUAGGCAUGA{tilde over (U)}UUUUGAGAAAA{circumflex over (G)}AAGUACUCGAA{circumflex over (C)}AAGAUUGUCUA{circumflex over (C)}AGAA | |
| ACAGGCU{tilde over (U)}UGCACUUCUGG{circumflex over (G)}AGGACAUCCUU{circumflex over (G)}UUUUCUUACCA{circumflex over (C)}ACAAGAUAUUC{tilde over (A)}UUU | |
| GGGUGUGA{tilde over (A)}UGAAAGUCUCA{circumflex over (C)}GGACACGGCCC{circumflex over (G)}UGUAUUGUCUAGCAU{circumflex over (G)}GCAGAUG{circumflex over (C)}AG | |
| UAUUGGCUC{circumflex over (G)}AGUGUAUAAAC{tilde over (A)}AUCAGAUUUGG{tilde over (A)}CACCCUGGCUA{tilde over (A)}AGAAGCAUCCA{tilde over (U)}C | |
| CCAAUUAUCA{tilde over (A)}UGGGCUGUCAG{tilde over (A)}UUUGUACCAUC{circumflex over (C)}UAUCCAGAUCC{tilde over (U)}GGCUGAUUACC{tilde over (U)} | |
| CACGCUCCAGG{tilde over (A)}ACACUAUAGCU{circumflex over (C)}UCUGAAAGGUC{tilde over (U)}UACCCUCAGCU{circumflex over (G)}GAUCGGGGAUG | |
| {circumflex over (G)}GAACAAUAUCC{tilde over (U)}GCACUCCAUCA{tilde over (U)}GAUGAGCGCAG{circumflex over (C)}GAAAUUCGGAA{tilde over (U)}GCACCUUCAG | |
| G{circumflex over (C)}AGCUACUCCAA{tilde over (A)}GGGUUAUGAGC{circumflex over (C)}GGAUGCUAGUG{tilde over (U)}AACCAAGUUGG{circumflex over (C)}AGAGCAGUA | |
| UG{circumflex over (C)}CAAAGAGAAUG{circumflex over (G)}UACCAAGCUGU{tilde over (U)}GCUGACAAAUG{tilde over (A)}UCCAUUGGAAG{circumflex over (C)}AGCGCAUG | |
| GAG{circumflex over (G)}CAAUGUAUUAA{tilde over (U)}UACAGACACUU{circumflex over (G)}GAUAAGCAUGG{circumflex over (G)}ACAAGAAGAGG{tilde over (A)}GAAGAAA | |
| AAGC{circumflex over (G)}GCUCCAGGCUU{tilde over (U)}CCAAGGUUACC{tilde over (A)}GGUUACAAUGA{tilde over (A)}GACUGCUAAAG{tilde over (U)}UGCUGC | |
| CUCUG{tilde over (A)}CUGGACAUUUU{tilde over (U)}ACACUGCUUGC{circumflex over (C)}CAGAAAGCCAG{tilde over (A)}AGAAGUGGAUG{tilde over (A)}UGAAG | |
| UCUUUU{tilde over (A)}UUCUCCUCGAU{circumflex over (C)}ACUAGUGUUCC{circumflex over (C)}AGAGGCAGAAA{tilde over (A)}CAGAAAGUGGA{circumflex over (C)}AAUC | |
| AUGGCUG{tilde over (U)}CAUGGUGUCCC{tilde over (U)}GCUGACAGAUU{tilde over (A)}CUCACCUCAGC{tilde over (U)}CCAGAAGCCUA{tilde over (A)}AUU | |
| UU{circumflex over (G)}A | |
| (SEQ ID NO: 135) | |
| A{tilde over (U)}{circumflex over (G)}{circumflex over (C)}UGUUUAAUCUGAGGAUCCUGUUAAACAAUGCAGCUUUUAGAAAUGGUCACAACUU | |
| CAUGGUUCGAAAUUUUCGGUGUGGACAACCACUACAAAAUAAAGUGCAGCUGAAGGGCC | |
| GUGACCUUCUCACUCUAAAAAACUUUACCGGAGAAGAAAUUAAAUAUAUGCUAUGGCUA | |
| UCAGCAGAUCUGAAAUUUAGGAUAAAACAGAAAGGAGAGUAUUUGCCUUUAUUGCAAGG | |
| GAAGUCCUUAGGCAUGAUUUUUGAGAAAAGAAGUACUCGAACAAGAUUGUCUACAGAAA | |
| CAGGCUUUGCACUUCUGGGAGGACAUCCUUGUUUUCUUACCACACAAGAUAUUCAUUUG | |
| GGUGUGAAUGAAAGUCUCACGGACACGGCCCGUGUAUUGUCUAGCAUGGCAGAUGCAGU | |
| AUUGGCUCGAGUGUAUAAACAAUCAGAUUUGGACACCCUGGCUAAAGAAGCAUCCAUCC | |
| CAAUUAUCAAUGGGCUGUCAGAUUUGUACCAUCCUAUCCAGAUCCUGGCUGAUUACCUC | |
| ACGCUCCAGGAACACUAUAGCUCUCUGAAAGGUCUUACCCUCAGCUGGAUCGGGGAUGG | |
| GAACAAUAUCCUGCACUCCAUCAUGAUGAGCGCAGCGAAAUUCGGAAUGCACCUUCAGG | |
| CAGCUACUCCAAAGGGUUAUGAGCCGGAUGCUAGUGUAACCAAGUUGGCAGAGCAGUAU | |
| GCCAAAGAGAAUGGUACCAAGCUGUUGCUGACAAAUGAUCCAUUGGAAGCAGCGCAUGG | |
| AGGCAAUGUAUUAAUUACAGACACUUGGAUAAGCAUGGGACAAGAAGAGGAGAAGAAAA | |
| AGCGGCUCCAGGCUUUCCAAGGUUACCAGGUUACAAUGAAGACUGCUAAAGUUGCUGCC | |
| UCUGACUGGACAUUUUUACACUGCUUGCCCAGAAAGCCAGAAGAAGUGGAUGAUGAAGU | |
| CUUUUAUUCUCCUCGAUCACUAGUGUUCCCAGAGGCAGAAAACAGAAAGUGGACAAUCA | |
| UGGCUGUCAUGGUGUCCCUGCUGACAGAUUACUCACCUCAGCUCCAGAAGCCUAAAUU{tilde over (U)} | |
| {tilde over (U)}{circumflex over (G)}A | |
| (SEQ ID NO: 136) | |
| A{tilde over (U)}GC{tilde over (U)}G{tilde over (U)}{tilde over (U)}{tilde over (U)}AA{tilde over (U)}C{tilde over (U)}GAGGA{tilde over (U)}CC{tilde over (U)}G{tilde over (U)}{tilde over (U)}AAACAA{tilde over (U)}GCAGC{tilde over (U)}{tilde over (U)}{tilde over (U)}{tilde over (U)}AGAAA{tilde over (U)}GG{tilde over (U)}CACAAC{tilde over (U)}{tilde over (U)} | |
| CA{tilde over (U)}GG{tilde over (U)}{tilde over (U)}CGAAA{tilde over (U)}{tilde over (U)}{tilde over (U)}{tilde over (U)}CGG{tilde over (U)}G{tilde over (U)}GGACAACCAC{tilde over (U)}ACAAAA{tilde over (U)}AAAG{tilde over (U)}GCAGC{tilde over (U)}GAAGGGCC | |
| G{tilde over (U)}GACC{tilde over (U)}{tilde over (U)}C{tilde over (U)}CAC{tilde over (U)}C{tilde over (U)}AAAAAAC{tilde over (U)}{tilde over (U)}{tilde over (U)}ACCGGAGAAGAAA{tilde over (U)}{tilde over (U)}AAA{tilde over (U)}A{tilde over (U)}A{tilde over (U)}GC{tilde over (U)}A{tilde over (U)}GGC{tilde over (U)}A | |
| {tilde over (U)}CAGCAGA{tilde over (U)}C{tilde over (U)}GAAA{tilde over (U)}{tilde over (U)}{tilde over (U)}AGGA{tilde over (U)}AAAACAGAAAGGAGAG{tilde over (U)}A{tilde over (U)}{tilde over (U)}{tilde over (U)}GCC{tilde over (U)}{tilde over (U)}{tilde over (U)}A{tilde over (U)}{tilde over (U)}GCAAGG | |
| GAAG{tilde over (U)}CC{tilde over (U)}{tilde over (U)}AGGCA{tilde over (U)}GA{tilde over (U)}{tilde over (U)}{tilde over (U)}{tilde over (U)}{tilde over (U)}GAGAAAAGAAG{tilde over (U)}AC{tilde over (U)}CGAACAAGA{tilde over (U)}{tilde over (U)}G{tilde over (U)}C{tilde over (U)}ACAGAAA | |
| CAGGC{tilde over (U)}{tilde over (U)}{tilde over (U)}GCAC{tilde over (U)}{tilde over (U)}C{tilde over (U)}GGGAGGACA{tilde over (U)}CC{tilde over (U)}{tilde over (U)}G{tilde over (U)}{tilde over (U)}{tilde over (U)}{tilde over (U)}C{tilde over (U)}{tilde over (U)}ACCACACAAGA{tilde over (U)}A{tilde over (U)}{tilde over (U)}CA{tilde over (U)}{tilde over (U)}{tilde over (U)}G | |
| GG{tilde over (U)}G{tilde over (U)}GAA{tilde over (U)}GAAAG{tilde over (U)}C{tilde over (U)}CACGGACACGGCCCG{tilde over (U)}G{tilde over (U)}A{tilde over (U)}{tilde over (U)}G{tilde over (U)}C{tilde over (U)}AGCA{tilde over (U)}GGCAGA{tilde over (U)}GCAG{tilde over (U)} | |
| A{tilde over (U)}{tilde over (U)}GGC{tilde over (U)}CGAG{tilde over (U)}G{tilde over (U)}A{tilde over (U)}AAACAA{tilde over (U)}CAGA{tilde over (U)}{tilde over (U)}{tilde over (U)}GGACACCC{tilde over (U)}GGC{tilde over (U)}AAAGAAGCA{tilde over (U)}CCA{tilde over (U)}CC | |
| CAA{tilde over (U)}{tilde over (U)}A{tilde over (U)}CAA{tilde over (U)}GGGC{tilde over (U)}G{tilde over (U)}CAGA{tilde over (U)}{tilde over (U)}{tilde over (U)}G{tilde over (U)}ACCA{tilde over (U)}CC{tilde over (U)}A{tilde over (U)}CCAGA{tilde over (U)}CC{tilde over (U)}GGC{tilde over (U)}GA{tilde over (U)}{tilde over (U)}ACC{tilde over (U)}C | |
| ACGC{tilde over (U)}CCAGGAACAC{tilde over (U)}A{tilde over (U)}AGC{tilde over (U)}C{tilde over (U)}C{tilde over (U)}GAAAGG{tilde over (U)}C{tilde over (U)}{tilde over (U)}ACCC{tilde over (U)}CAGC{tilde over (U)}GGA{tilde over (U)}CGGGGA{tilde over (U)}GG | |
| GAACAA{tilde over (U)}A{tilde over (U)}CC{tilde over (U)}GCAC{tilde over (U)}CCA{tilde over (U)}CA{tilde over (U)}GA{tilde over (U)}GAGCGCAGCGAAA{tilde over (U)}{tilde over (U)}CGGAA{tilde over (U)}GCACC{tilde over (U)}{tilde over (U)}CAGG | |
| CAGC{tilde over (U)}AC{tilde over (U)}CCAAAGGG{tilde over (U)}{tilde over (U)}A{tilde over (U)}GAGCCGGA{tilde over (U)}GC{tilde over (U)}AG{tilde over (U)}G{tilde over (U)}AACCAAG{tilde over (U)}{tilde over (U)}GGCAGAGCAG{tilde over (U)}A{tilde over (U)} | |
| GCCAAAGAGAA{tilde over (U)}GG{tilde over (U)}ACCAAGC{tilde over (U)}G{tilde over (U)}{tilde over (U)}GC{tilde over (U)}GACAAA{tilde over (U)}GA{tilde over (U)}CCA{tilde over (U)}{tilde over (U)}GGAAGCAGCGCA{tilde over (U)}GG | |
| AGGCAA{tilde over (U)}G{tilde over (U)}A{tilde over (U)}{tilde over (U)}AA{tilde over (U)}{tilde over (U)}ACAGACAC{tilde over (U)}{tilde over (U)}GGA{tilde over (U)}AAGCA{tilde over (U)}GGGACAAGAAGAGGAGAAGAAAA | |
| AGCGGC{tilde over (U)}CCAGGC{tilde over (U)}{tilde over (U)}{tilde over (U)}CCAAGG{tilde over (U)}{tilde over (U)}ACCAGG{tilde over (U)}{tilde over (U)}ACAA{tilde over (U)}GAAGAC{tilde over (U)}GC{tilde over (U)}AAAG{tilde over (U)}{tilde over (U)}GC{tilde over (U)}GCC | |
| {tilde over (U)}C{tilde over (U)}GAC{tilde over (U)}GGACA{tilde over (U)}{tilde over (U)}{tilde over (U)}{tilde over (U)}{tilde over (U)}ACAC{tilde over (U)}GC{tilde over (U)}{tilde over (U)}GCCCAGAAAGCCAGAAGAAG{tilde over (U)}GGA{tilde over (U)}GA{tilde over (U)}GAAG{tilde over (U)} | |
| C{tilde over (U)}{tilde over (U)}{tilde over (U)}{tilde over (U)}A{tilde over (U)}{tilde over (U)}C{tilde over (U)}CC{tilde over (U)}CGA{tilde over (U)}CAC{tilde over (U)}AG{tilde over (U)}G{tilde over (U)}{tilde over (U)}CCCAGAGGCAGAAAACAGAAAG{tilde over (U)}GGACAA{tilde over (U)}CA | |
| {tilde over (U)}GGC{tilde over (U)}G{tilde over (U)}CA{tilde over (U)}GG{tilde over (U)}G{tilde over (U)}CCC{tilde over (U)}GC{tilde over (U)}GACAGA{tilde over (U)}{tilde over (U)}AC{tilde over (U)}CACC{tilde over (U)}CAGC{tilde over (U)}CCAGAAGCC{tilde over (U)}AAA{tilde over (U)}{tilde over (U)}{tilde over (U)} | |
| {tilde over (U)}GA |
In this example, the structures of mUNA molecules for use in expressing human beta-globin are shown.
Beta-globin may be associated with sickle-cell disease, beta thalassemia, and genetic resistance to malaria.
The base sequences shown below are the portion of the mUNA molecule that may correspond in functionality to the 3′-UTR of the native mRNA of human beta-globin. The complete mUNA molecule comprises a 5′ cap (m7GpppGm), 5′-UTR, and coding region (CDS) for human beta-globin upstream of the sequence below, and a polyA tail (SEQ ID Nos: 4 to 12) downstream of the sequence below, each of which corresponds to the structure of the native mRNA of human beta-globin.
| Human beta-globin is accession NM_000518.4. |
| (SEQ ID NO: 137) |
| G{circumflex over (C)}UCGCUUUCUUGCUGUCCAAUUUCUAUUAAAGGUUCCUUUGUUCCCUA |
| AGUCCAACUACUAAACUGGGGGAUAUUAUGAAGGGCCUUGAGCAUCUGG |
| AUUCUGCCUAAUAAAAAACAUUUAUUUUCAUUGC{tilde over (A)}A |
| (SEQ ID NO: 138) |
| G{circumflex over (C)}{tilde over (U)}{circumflex over (C)}GCUUUCUUGCUGUCCAAUUUCUAUUAAAGGUUCCUUUGUUCCCUA |
| AGUCCAACUACUAAACUGGGGGAUAUUAUGAAGGGCCUUGAGCAUCUGG |
| AUUCUGCCUAAUAAAAAACAUUUAUUUUCAUU{circumflex over (G)}{circumflex over (C)}{tilde over (A)}A |
| (SEQ ID NO: 139) |
| G{circumflex over (C)}UCGCU{tilde over (U)}UCUUG{circumflex over (C)}UGUCC{tilde over (A)}AUUUC{tilde over (U)}AUUAA{tilde over (A)}GGUUC{circumflex over (C)}UUUGU{tilde over (U)}CCCUA |
| {tilde over (A)}GUCCA{tilde over (A)}CUACU{tilde over (A)}AACUG{circumflex over (G)}GGGAU{tilde over (A)}UUAUG{tilde over (A)}AGGGC{circumflex over (C)}UUGAG{circumflex over (C)}AUCUG{circumflex over (G)} |
| AUUCU{circumflex over (G)}CCUAA{tilde over (U)}AAAAA{tilde over (A)}CAUUU{tilde over (A)}UUUUC{tilde over (A)}UUGC{tilde over (A)}A |
| (SEQ ID NO: 140) |
| G{circumflex over (C)}{tilde over (U)}CGCU{tilde over (U)}{tilde over (U)}CUUG{circumflex over (C)}{tilde over (U)}GUCC{tilde over (A)}{tilde over (A)}UUUC{tilde over (U)}{tilde over (A)}UUAA{tilde over (A)}{circumflex over (G)}GUUC{circumflex over (C)}{tilde over (U)}UUGU{tilde over (U)}{circumflex over (C)}CCU |
| A{tilde over (A)}{circumflex over (G)}UCCA{tilde over (A)}{circumflex over (C)}UACU{tilde over (A)}{tilde over (A)}ACUG{circumflex over (G)}{circumflex over (G)}GGAU{tilde over (A)}{tilde over (U)}UAUG{tilde over (A)}{tilde over (A)}GGGC{circumflex over (C)}{tilde over (U)}UGAG{circumflex over (C)}{tilde over (A)}UCU |
| G{circumflex over (G)}{tilde over (A)}UUCU{circumflex over (G)}{circumflex over (C)}CUAA{tilde over (U)}{tilde over (A)}AAAA{tilde over (A)}{circumflex over (C)}AUUU{tilde over (A)}{tilde over (U)}UUUC{tilde over (A)}{tilde over (U)}UGC{tilde over (A)}A |
| (SEQ ID NO: 141) |
| {circumflex over (G)}{circumflex over (C)}{tilde over (U)}{circumflex over (C)}{circumflex over (G)}{circumflex over (C)}{tilde over (U)}{tilde over (U)}{tilde over (U)}{circumflex over (C)}{tilde over (U)}{tilde over (U)}{circumflex over (G)}{circumflex over (C)}{tilde over (U)}{circumflex over (G)}{tilde over (U)}{circumflex over (C)}{circumflex over (C)}{tilde over (A)}{tilde over (A)}{tilde over (U)}{tilde over (U)}{tilde over (U)}{circumflex over (C)}{tilde over (U)}{tilde over (A)}{tilde over (U)}{tilde over (U)}{tilde over (A)}{tilde over (A)}{tilde over (A)}{circumflex over (G)}{circumflex over (G)}{tilde over (U)}{tilde over (U)}{circumflex over (C)}{circumflex over (C)}{tilde over (U)}{tilde over (U)}{tilde over (U)}{circumflex over (G)}{tilde over (U)}{tilde over (U)}{circumflex over (C)}{circumflex over (C)}{circumflex over (C)}{tilde over (U)} |
| {tilde over (A)}{tilde over (A)}{circumflex over (G)}{tilde over (U)}{circumflex over (C)}{circumflex over (C)}{tilde over (A)}{tilde over (A)}{circumflex over (G)}{tilde over (U)}{tilde over (A)}{circumflex over (C)}{tilde over (U)}{tilde over (A)}{tilde over (A)}{tilde over (A)}{circumflex over (C)}{tilde over (U)}{circumflex over (G)}{circumflex over (G)}{circumflex over (G)}{circumflex over (G)}{circumflex over (G)}{tilde over (A)}{tilde over (U)}{tilde over (A)}{tilde over (U)}{tilde over (U)}{tilde over (A)}{tilde over (U)}{circumflex over (G)}{tilde over (A)}{tilde over (A)}{circumflex over (G)}{circumflex over (G)}{circumflex over (G)}{circumflex over (C)}{circumflex over (C)}{tilde over (U)}{tilde over (U)}{circumflex over (G)}{tilde over (A)}{circumflex over (G)}{circumflex over (C)}{tilde over (A)}{tilde over (U)}{circumflex over (C)}{tilde over (U)} |
| {circumflex over (G)}{circumflex over (G)}{tilde over (A)}{tilde over (U)}{tilde over (U)}{circumflex over (C)}{tilde over (U)}{circumflex over (G)}{circumflex over (C)}{circumflex over (C)}{tilde over (A)}{tilde over (U)}{tilde over (A)}{tilde over (A)}{tilde over (U)}{tilde over (A)}{tilde over (A)}{tilde over (A)}{tilde over (A)}{tilde over (A)}{tilde over (A)}{circumflex over (C)}{tilde over (A)}{tilde over (U)}{tilde over (U)}{tilde over (U)}{tilde over (A)}{tilde over (U)}{tilde over (U)}{tilde over (U)}{tilde over (U)}{circumflex over (C)}{tilde over (A)}{tilde over (U)}{tilde over (U)}{circumflex over (G)}{circumflex over (C)}{tilde over (A)}{tilde over (A)} |
In this example, the structures of mUNA molecules for use in enhancing translational efficiency are shown.
The base sequences shown below are the portion of the mUNA molecule that may correspond in functionality to the 3′-UTR of Xenopus beta-globin. The complete mUNA molecule comprises a 5′ cap (m7GpppGm), 5′-UTR, and coding region (CDS) upstream of the sequence below, and a polyA tail (SEQ ID Nos: 4 to 12) downstream of the sequence below, each of which corresponds to the structure of a native human mRNA. Thus, a UNA oligomer incorprating the oligomer fragment below can have enhanced translational efficiency.
| Xenopus beta-globin is accession NM_001096347.1. |
| (SEQ ID NO: 142) |
| C{tilde over (U)}AGUGACUGACUAGGAUCUGGUUACCACUAAACCAGCCUCAAGAACACC |
| CGAAUGGAGUCUCUAAGCUACAUAAUACCAACUUACACUUACAAAAUGUU |
| GUCCCCCAAAAUGUAGCCAUUCGUAUCUGCUCCUAAUAAAAAGAAAGUUU |
| CUUCAC{tilde over (A)}U |
| (SEQ ID NO: 143) |
| C{tilde over (U)}{tilde over (A)}{circumflex over (G)}UGACUGACUAGGAUCUGGUUACCACUAAACCAGCCUCAAGAACACC |
| CGAAUGGAGUCUCUAAGCUACAUAAUACCAACUUACACUUACAAAAUGUU |
| GUCCCCCAAAAUGUAGCCAUUCGUAUCUGCUCCUAAUAAAAAGAAAGUUU |
| CUUC{tilde over (A)}{circumflex over (C)}{tilde over (A)}U |
| (SEQ ID NO: 144) |
| C{tilde over (U)}AGUGA{circumflex over (C)}UGACU{tilde over (A)}GGAUC{tilde over (U)}GGUUA{circumflex over (C)}CACUA{tilde over (A)}ACCAG{circumflex over (C)}CUCAA{circumflex over (G)}AAAC |
| {circumflex over (C)}CAAAU{circumflex over (G)}GAGUC{tilde over (U)}CUAAG{circumflex over (C)}UACAU{tilde over (A)}AUACC{tilde over (A)}ACUUA{circumflex over (C)}ACUUA{circumflex over (C)}AAAAU{circumflex over (G)}UU |
| GUC{circumflex over (C)}CCCAA{tilde over (A)}AUGUA{circumflex over (G)}CCAUU{circumflex over (C)}GUAUC{tilde over (U)}GCUCC{tilde over (U)}AAUAA{tilde over (A)}AAGAA{tilde over (A)}GUUU |
| C{tilde over (U)}UCAC{tilde over (A)}U |
| (SEQ ID NO: 145) |
| C{tilde over (U)}{tilde over (A)}GUGA{circumflex over (C)}{tilde over (U)}GACU{tilde over (A)}{circumflex over (G)}GAUC{tilde over (U)}{circumflex over (G)}GUUA{circumflex over (C)}{circumflex over (C)}ACUA{tilde over (A)}{tilde over (A)}CCAG{circumflex over (C)}{circumflex over (C)}UCAA{circumflex over (G)}{tilde over (A)}ACAC |
| {circumflex over (C)}{circumflex over (C)}GAAU{circumflex over (G)}{circumflex over (G)}AGUC{tilde over (U)}{circumflex over (C)}UAAG{circumflex over (C)}{tilde over (U)}ACAU{tilde over (A)}{tilde over (A)}UACC{tilde over (A)}{tilde over (A)}CUUA{circumflex over (C)}{tilde over (A)}CUUA{circumflex over (C)}{tilde over (A)}AAAU{circumflex over (G)}{tilde over (U)}U |
| GUC{circumflex over (C)}{circumflex over (C)}CCAA{tilde over (A)}{tilde over (A)}UGUA{circumflex over (G)}{circumflex over (C)}CAUU{circumflex over (C)}{circumflex over (G)}UAUC{tilde over (U)}{circumflex over (G)}CUCC{tilde over (U)}{tilde over (A)}AUAA{tilde over (A)}{tilde over (A)}AGAA{tilde over (A)}{circumflex over (G)}UUU |
| C{tilde over (U)}{tilde over (U)}CAC{tilde over (A)}U |
| (SEQ ID NO: 146) |
| {circumflex over (C)}{tilde over (U)}{tilde over (A)}{circumflex over (G)}{tilde over (U)}{circumflex over (G)}{tilde over (A)}{circumflex over (C)}{tilde over (U)}{circumflex over (G)}{tilde over (A)}{circumflex over (C)}{tilde over (U)}{tilde over (A)}{circumflex over (G)}{circumflex over (G)}{tilde over (A)}{tilde over (U)}{circumflex over (C)}{tilde over (U)}{circumflex over (G)}{circumflex over (G)}{tilde over (U)}{tilde over (U)}{tilde over (A)}{circumflex over (C)}{circumflex over (C)}{tilde over (A)}{circumflex over (C)}{tilde over (U)}{tilde over (A)}{tilde over (A)}{tilde over (A)}{circumflex over (C)}{circumflex over (C)}{tilde over (A)}{circumflex over (G)}{circumflex over (C)}{circumflex over (C)}{tilde over (U)}{circumflex over (C)}{tilde over (A)}{tilde over (A)}{circumflex over (G)}{tilde over (A)}{tilde over (A)}{circumflex over (C)}{tilde over (A)}{circumflex over (C)} |
| {circumflex over (C)}{circumflex over (C)}{tilde over (A)}{tilde over (A)}{tilde over (A)}{tilde over (U)}{circumflex over (G)}{circumflex over (G)}{tilde over (A)}{circumflex over (G)}{tilde over (U)}{circumflex over (C)}{tilde over (U)}{circumflex over (C)}{tilde over (U)}{tilde over (A)}{tilde over (A)}{circumflex over (G)}{circumflex over (C)}{tilde over (U)}{tilde over (A)}{circumflex over (C)}{tilde over (A)}{tilde over (U)}{tilde over (A)}{tilde over (A)}{tilde over (U)}{tilde over (A)}{circumflex over (C)}{circumflex over (C)}{tilde over (A)}{tilde over (A)}{circumflex over (C)}{tilde over (U)}{tilde over (U)}{tilde over (A)}{circumflex over (C)}{tilde over (A)}{circumflex over (C)}{tilde over (U)}{tilde over (U)}{tilde over (A)}{circumflex over (C)}{tilde over (A)}{tilde over (A)}{tilde over (A)}{tilde over (A)}{tilde over (U)}{circumflex over (G)}{tilde over (U)}{tilde over (U)} |
| {circumflex over (G)}{tilde over (U)}{circumflex over (C)}{circumflex over (C)}{circumflex over (C)}{circumflex over (C)}{circumflex over (C)}{tilde over (A)}{tilde over (A)}{tilde over (A)}{tilde over (A)}{tilde over (U)}{circumflex over (G)}{tilde over (U)}{tilde over (A)}{circumflex over (G)}{circumflex over (C)}{circumflex over (C)}{tilde over (A)}{tilde over (U)}{tilde over (U)}{circumflex over (C)}{circumflex over (G)}{tilde over (U)}{tilde over (A)}{tilde over (U)}{circumflex over (C)}{tilde over (U)}{circumflex over (G)}{circumflex over (C)}{tilde over (U)}{circumflex over (C)}{circumflex over (C)}{tilde over (U)}{tilde over (A)}{tilde over (A)}{tilde over (U)}{tilde over (A)}{tilde over (A)}{tilde over (A)}{tilde over (A)}{tilde over (A)}{circumflex over (G)}{tilde over (A)}{tilde over (A)}{tilde over (A)}{circumflex over (G)}{tilde over (U)}{tilde over (U)}{tilde over (U)} |
| {circumflex over (C)}{tilde over (U)}{tilde over (U)}{circumflex over (C)}{tilde over (A)}{circumflex over (C)}{tilde over (A)}{tilde over (U)} |
In this example, the structures of mUNA molecules for use in expressing human Thrombopoietin are shown.
Thrombopoietin is associated with liver and kidney disease.
The base sequences shown below are the portion of the mUNA molecule that may correspond in functionality to the open reading frame of the native mRNA of human Thrombopoietin. The complete mUNA molecule comprises a 5′ cap (m7GpppGm), and a 5′-UTR upstream of the sequence below, and a 3′ UTR and polyA tail (SEQ ID Nos: 4 to 12) downstream of the sequence below, each of which corresponds to the structure of the native mRNA of human Thrombopoietin.
| Human Thrombopoietin is accession NM_000460.3. |
| (SEQ ID NO: 147) |
| AU{circumflex over (G)}GAGCUGACUGAAUUGCU{circumflex over (C)}CUCGUGGUCAUGCUUCU{circumflex over (C)}CUAACUGCAA |
| GGCUAAC{circumflex over (G)}CUGUCCAGCCCGGCUCC{tilde over (U)}CCUGCUUGUGACCUCCG{tilde over (A)}GUCCU |
| CAGUAAACUGCU{tilde over (U)}CGUGACUCCCAUGUCCU{tilde over (U)}CACAGCAGACUGAGCCA{circumflex over (G)} |
| UGCCCAG AGGUUCACCC{tilde over (U)}UUGCCUACACCUGUCCU{circumflex over (G)}CUGCCUGCUGUGG |
| ACUU{tilde over (U)}AGCUUGGGAGAAUGGA{tilde over (A)}AACCCAGAUGGAGGAGA{circumflex over (C)}CAAGGCACA |
| GGACAUUC{tilde over (U)}GGGAGCAGUGACCCUUC{tilde over (U)}GCUGGAGGGAGUGAUGG{circumflex over (C)}AGCA |
| CGGGGACAACUGG{circumflex over (G)}ACCCACUUGCCUCUCAUC{circumflex over (C)}CUCCUGGGGCAGCUUU |
| C{tilde over (U)}GGACAGGUCCGUCUCCU{circumflex over (C)}CUUGGGGCCCUGCAGAG{circumflex over (C)}CUCCUUGGAAC |
| CCAGCU{tilde over (U)}CCUCCACAGGGCAGGAC{circumflex over (C)}ACAGCUCACAAGGAUCCCAAUGCC |
| AUCUUCCUGAG{circumflex over (C)}UUCCAACACCUGCUCCG{tilde over (A)}GGAAAGGUGCGUUUCCUG{tilde over (A)} |
| UGCUUGUAGGAGGGUCC{tilde over (A)}CCCUCUGCGUCAGGCGGG{circumflex over (G)}CCCCACCCACCA |
| CAGCU{circumflex over (G)}UCCCCAGCAGAACCUCU{circumflex over (C)}UAGUCCUCACACUGAAC{circumflex over (G)}AGCUCCC |
| AAACAGGACU{tilde over (U)}CUGGAUUGUUGGAGACA{tilde over (A)}ACUUCACUGCCUCAGCC{tilde over (A)}GA |
| ACUACUGGCUCUGGG{circumflex over (C)}UUCUGAAGUGGCAGCAG{circumflex over (G)}GAUUCAGAGCCAAGA |
| UU{circumflex over (C)}CUGGUCUGCUGAACCAA{tilde over (A)}CCUCCAGGUCCCUGGAC{circumflex over (C)}AAAUCCCCGG |
| AUACCUG{tilde over (A)}ACAGGAUACACGAACUC{tilde over (U)}UGAAUGGAACUCGUGGA{circumflex over (C)}UCUUU |
| CCUGGACCCUCA{circumflex over (C)}GCAGGACCCUAGGAGCC{circumflex over (C)}CGGACAUUUCCUCAGGA{tilde over (A)} |
| CAUCAGACACAGGCUCC{circumflex over (C)}UGCCACCCAACCUCCAG{circumflex over (C)}CUGGAUAUUCUCC |
| UUCC{circumflex over (C)}CAACCCAUCCUCCUACU{circumflex over (G)}GACAGUAUACGCUCUUC{circumflex over (C)}CUCUUCCA |
| CCCACCUUG{circumflex over (C)}CCACCCCUGUGGUCCAG{circumflex over (C)}UCCACCCCCUGCUUCCU{circumflex over (G)}ACC |
| CUUCUGCUCCAACG{circumflex over (C)}CCACCCCUACCAGCCCU{circumflex over (C)}UUCUAAACACAUCCUA |
| C{tilde over (A)}CCCACUCCCAGAAUCUG{tilde over (U)}CUCAGGAAGGGU{tilde over (A)}A |
| (SEQ ID NO: 148) |
| A{tilde over (U)}{circumflex over (G)}{circumflex over (G)}AGCUGACUGAAUUGCUCCUCGUGGUCAUGCUUCUCCUAACUGCAA |
| GGCUAACGCUGUCCAGCCCGGCUCCUCCUGCUUGUGACCUCCGAGUCCU |
| CAGUAAACUGCUUCGUGACUCCCAUGUCCUUCACAGCAGACUGAGCCAG |
| UGCCCAGAGGUUCACCCUUUGCCUACACCUGUCCUGCUGCCUGCUGUGG |
| ACUUUAGCUUGGGAGAAUGGAAAACCCAGAUGGAGGAGACCAAGGCACA |
| GGACAUUCUGGGAGCAGUGACCCUUCUGCUGGAGGGAGUGAUGGCAGCA |
| CGGGGACAACUGGGACCCACUUGCCUCUCAUCCCUCCUGGGGCAGCUUU |
| CUGGACAGGUCCGUCUCCUCCUUGGGGCCCUGCAGAGCCUCCUUGGAAC |
| CCAGCUUCCUCCACAGGGCAGGACCACAGCUCACAAGGAUCCCAAUGCC |
| AUCUUCCUGAGCUUCCAACACCUGCUCCGAGGAAAGGUGCGUUUCCUGA |
| UGCUUGUAGGAGGGUCCACCCUCUGCGUCAGGCGGGCCCCACCCACCAC |
| AGCUGUCCCCAGCAGAACCUCUCUAGUCCUCACACUGAACGAGCUCCCA |
| AACAGGACUUCUGGAUUGUUGGAGACAAACUUCACUGCCUCAGCCAGAA |
| CUACUGGCUCUGGGCUUCUGAAGUGGCAGCAGGGAUUCAGAGCCAAGAU |
| UCCUGGUCUGCUGAACCAAACCUCCAGGUCCCUGGACCAAAUCCCCGGA |
| UACCUGAACAGGAUACACGAACUCUUGAAUGGAACUCGUGGACUCUUUC |
| CUGGACCCUCACGCAGGACCCUAGGAGCCCCGGACAUUUCCUCAGGAAC |
| AUCAGACACAGGCUCCCUGCCACCCAACCUCCAGCCUGGAUAUUCUCCU |
| UCCCCAACCCAUCCUCCUACUGGACAGUAUACGCUCUUCCCUCUUCCAC |
| CCACCUUGCCCACCCCUGUGGUCCAGCUCCACCCCCUGCUUCCUGACCC |
| UUCUGCUCCAACGCCCACCCCUACCAGCCCUCUUCUAAACACAUCCUAC |
| ACCCACUCCCAGAAUCUGUCUCAGGAAGG{circumflex over (G)}{tilde over (U)}{tilde over (A)}A |
| (SEQ ID NO: 149) |
| A{tilde over (U)}GGAGC{tilde over (U)}GAC{tilde over (U)}GAA{tilde over (U)}{tilde over (U)}GC{tilde over (U)}CC{tilde over (U)}CG{tilde over (U)}GG{tilde over (U)}CA{tilde over (U)}GC{tilde over (U)}{tilde over (U)}C{tilde over (U)}CC{tilde over (U)}AAC{tilde over (U)}GC |
| AAGGC{tilde over (U)}AACGC{tilde over (U)}G{tilde over (U)}CCAGCCCGGC{tilde over (U)}CC{tilde over (U)}CC{tilde over (U)}GC{tilde over (U)}G{tilde over (U)}GACC{tilde over (U)}CCGA |
| G{tilde over (U)}CC{tilde over (U)}CAG{tilde over (U)}AAAC{tilde over (U)}GC{tilde over (U)}{tilde over (U)}CG{tilde over (U)}GAC{tilde over (U)}CCCA{tilde over (U)}GCC{tilde over (U)}{tilde over (U)}CACAGCAGA |
| C{tilde over (U)}GAGCCAG{tilde over (U)}GCCCAGAGG{tilde over (U)}{tilde over (U)}CACCC{tilde over (U)}{tilde over (U)}{tilde over (U)}GCC{tilde over (U)}ACACC{tilde over (U)}G{tilde over (U)}CC{tilde over (U)}G |
| C{tilde over (U)}GCC{tilde over (U)}GC{tilde over (U)}G{tilde over (U)}GGAC{tilde over (U)}{tilde over (U)}{tilde over (U)}AGC{tilde over (U)}{tilde over (U)}GGGAGAA{tilde over (U)}GGAAAACCCAGA{tilde over (U)}G |
| GAGGAGACCAAGGCACAGGACA{tilde over (U)}{tilde over (U)}C{tilde over (U)}GGGAGCAG{tilde over (U)}GACCC{tilde over (U)}C{tilde over (U)}GC{tilde over (U)} |
| GGAGGGAG{tilde over (U)}GA{tilde over (U)}GGCAGCACGGGGACAAC{tilde over (U)}GGGACCCAC{tilde over (U)}{tilde over (U)}GCC{tilde over (U)}C{tilde over (U)} |
| CA{tilde over (U)}CCC{tilde over (U)}CC{tilde over (U)}GGGGCAGC{tilde over (U)}{tilde over (U)}{tilde over (U)}C{tilde over (U)}GGACAGG{tilde over (U)}CCG{tilde over (U)}C{tilde over (U)}CC{tilde over (U)}CC{tilde over (U)}{tilde over (U)}GG |
| GGCCC{tilde over (U)}GCAGAGCC{tilde over (U)}CC{tilde over (U)}{tilde over (U)}GGAACCCAGC{tilde over (U)}{tilde over (U)}CC{tilde over (U)}CCACAGGGCAGGA |
| CCACAGC{tilde over (U)}CACAAGGA{tilde over (U)}CCCAA{tilde over (U)}GCCA{tilde over (U)}C{tilde over (U)}{tilde over (U)}CC{tilde over (U)}GAGC{tilde over (U)}{tilde over (U)}CCAACAC |
| C{tilde over (U)}GC{tilde over (U)}CCGAGGAAAGG{tilde over (U)}GCG{tilde over (U)}{tilde over (U)}{tilde over (U)}CC{tilde over (U)}GA{tilde over (U)}GC{tilde over (U)}{tilde over (U)}G{tilde over (U)}AGGAGGG{tilde over (U)}CCAC |
| CC{tilde over (U)}C{tilde over (U)}GCG{tilde over (U)}CAGGCGGGCCCCACCCACCACAGC{tilde over (U)}G{tilde over (U)}CCCCAGCAGAAC |
| C{tilde over (U)}C{tilde over (U)}C{tilde over (U)}AG{tilde over (U)}CC{tilde over (U)}CACAC{tilde over (U)}GAACGAGC{tilde over (U)}CCCAAACAGGAC{tilde over (U)}{tilde over (U)}C{tilde over (U)}GG |
| A{tilde over (U)}{tilde over (U)}G{tilde over (U)}{tilde over (U)}GGAGACAAAC{tilde over (U)}{tilde over (U)}CAC{tilde over (U)}GCC{tilde over (U)}CAGCCAGAAC{tilde over (U)}AC{tilde over (U)}GGC{tilde over (U)}C{tilde over (U)}G |
| GGC{tilde over (U)}C{tilde over (U)}GAAG{tilde over (U)}GGCAGCAGGGA{tilde over (U)}{tilde over (U)}CAGAGCCAAGA{tilde over (U)}{tilde over (U)}CC{tilde over (U)}GG{tilde over (U)}C{tilde over (U)}G |
| C{tilde over (U)}GAACCAAACC{tilde over (U)}CCAGG{tilde over (U)}CCC{tilde over (U)}GGACCAAA{tilde over (U)}CCCCGGA{tilde over (U)}ACC{tilde over (U)}GAACA |
| GGA{tilde over (U)}ACACGAAC{tilde over (U)}C{tilde over (U)}{tilde over (U)}GAA{tilde over (U)}GGAAC{tilde over (U)}CG{tilde over (U)}GGAC{tilde over (U)}C{tilde over (U)}{tilde over (U)}{tilde over (U)}CC{tilde over (U)}GGACC |
| C{tilde over (U)}CACGCAGGACCC{tilde over (U)}AGGAGCCCCGGACA{tilde over (U)}{tilde over (U)}{tilde over (U)}CC{tilde over (U)}CAGGAACA{tilde over (U)}CAG |
| ACACAGGC{tilde over (U)}CCC{tilde over (U)}GCCACCCAACC{tilde over (U)}CCAGCC{tilde over (U)}GGA{tilde over (U)}A{tilde over (U)}{tilde over (U)}C{tilde over (U)}CC{tilde over (U)}{tilde over (U)}CC |
| CCAACCCA{tilde over (U)}CC{tilde over (U)}CC{tilde over (U)}AC{tilde over (U)}GGACAG{tilde over (U)}A{tilde over (U)}ACGC{tilde over (U)}C{tilde over (U)}{tilde over (U)}CCC{tilde over (U)}C{tilde over (U)}{tilde over (U)}CCACCC |
| ACC{tilde over (U)}{tilde over (U)}GCCCACCCC{tilde over (U)}G{tilde over (U)}GG{tilde over (U)}CCAGC{tilde over (U)}CCACCCCC{tilde over (U)}GC{tilde over (U)}{tilde over (U)}CC{tilde over (U)}GACCC |
| {tilde over (U)}{tilde over (U)}C{tilde over (U)}GC{tilde over (U)}CCAACGCCCACCCC{tilde over (U)}ACCAGCCC{tilde over (U)}C{tilde over (U)}{tilde over (U)}C{tilde over (U)}AAACACA{tilde over (U)}CC{tilde over (U)} |
| ACACCCAC{tilde over (U)}CCCAGAA{tilde over (U)}C{tilde over (U)}G{tilde over (U)}C{tilde over (U)}CAGGAAGGG{tilde over (U)}AA |
In this example, the structures of mUNA molecules for use in expressing human amylo-alpha-1, 6-glucosidase, 4-alpha-glucanotransferase (AGL) are shown.
AGL is associated with glycogen storage disease.
The base sequences shown below are the portion of the mUNA molecule that may correspond in functionality to the open reading frame of the native mRNA of human AGL. The complete mUNA molecule comprises a 5′ cap (m7GpppGm), and a 5′-UTR upstream of the sequence below, and a 3′ UTR and polyA tail (SEQ ID Nos: 4 to 12) downstream of the sequence below, each of which corresponds to the structure of the native mRNA of human AGL.
| Human AGL is accession NM_000642.2. |
| (SEQ ID NO: 150) |
| A{tilde over (U)}{circumflex over (G)}{circumflex over (G)}GACACAGUAAACAGAUUCGAAUUUUACUUCUGAACGAAAUGGAGA |
| AACUGGAAAAGACCCUCUUCAGACUUGAACAAGGGUAUGAGCUACAGUU |
| CCGAUUAGGCCCAACUUUACAGGGAAAAGCAGUUACCGUGUAUACAAAU |
| UACCCAUUUCCUGGAGAAACAUUUAAUAGAGAAAAAUUCCGUUCUCUGG |
| AUUGGGAAAAUCCAACAGAAAGAGAAGAUGAUUCUGAUAAAUACUGUAA |
| ACUUAAUCUGCAACAAUCUGGUUCAUUUCAGUAUUAUUUCCUUCAAGGA |
| AAUGAGAAAAGUGGUGGAGGUUACAUAGUUGUGGACCCCAUUUUACGUG |
| UUGGUGCUGAUAAUCAUGUGCUACCCUUGGACUGUGUUACUCUUCAGAC |
| AUUUUUAGCUAAGUGUUUGGGACCUUUUGAUGAAUGGGAAAGCAGACUU |
| AGGGUUGCAAAAGAAUCAGGCUACAACAUGAUUCAUUUUACCCCAUUGC |
| AGACUCUUGGACUAUCUAGGUCAUGCUACUCCCUUGCCAAUCAGUUAGA |
| AUUAAAUCCUGACUUUUCAAGACCUAAUAGAAAGUAUACCUGGAAUGAU |
| GUUGGACAGCUAGUGGAAAAAUUAAAAAAGGAAUGGAAUGUUAUUUGUA |
| UUACUGAUGUUGUCUACAAUCAUACUGCUGCUAAUAGUAAAUGGAUCCA |
| GGAACAUCCAGAAUGUGCCUAUAAUCUUGUGAAUUCUCCACACUUAAAA |
| CCUGCCUGGGUCUUAGACAGAGCACUUUGGCGUUUCUCCUGUGAUGUUG |
| CAGAAGGGAAAUACAAAGAAAAGGGAAUACCUGCUUUGAUUGAAAAUGA |
| UCACCAUAUGAAUUCCAUCCGAAAAAUAAUUUGGGAGGAUAUUUUUCCA |
| AAGCUUAAACUCUGGGAAUUUUUCCAAGUAGAUGUCAACAAAGCGGUUG |
| AGCAAUUUAGAAGACUUCUUACACAAGAAAAUAGGCGAGUAACCAAGUC |
| UGAUCCAAACCAACACCUUACGAUUAUUCAAGAUCCUGAAUACAGACGG |
| UUUGGCUGUACUGUAGAUAUGAACAUUGCACUAACGACUUUCAUACCAC |
| AUGACAAGGGGCCAGCAGCAAUUGAAGAAUGCUGUAAUUGGUUUCAUAA |
| AAGAAUGGAGGAAUUAAAUUCAGAGAAGCAUCGACUCAUUAACUAUCAU |
| CAGGAACAGGCAGUUAAUUGCCUUUUGGGAAAUGUGUUUUAUGAACGAC |
| UGGCUGGCCAUGGUCCAAAACUAGGACCUGUCACUAGAAAGCAUCCUUU |
| AGUUACCAGGUAUUUUACUUUCCCAUUUGAAGAGAUAGACUUCUCCAUG |
| GAAGAAUCUAUGAUUCAUCUGCCAAAUAAAGCUUGUUUUCUGAUGGCAC |
| ACAAUGGAUGGGUAAUGGGAGAUGAUCCUCUUCGAAACUUUGCUGAACC |
| GGGUUCAGAAGUUUACCUAAGGAGAGAACUUAUUUGCUGGGGAGACAGU |
| GUUAAAUUACGCUAUGGGAAUAAACCAGAGGACUGUCCUUAUCUCUGGG |
| CACACAUGAAAAAAUACACUGAAAUAACUGCAACUUAUUUCCAGGGAGU |
| ACGUCUUGAUAACUGCCACUCAACACCUCUUCACGUAGCUGAGUACAUG |
| UUGGAUGCUGCUAGGAAUUUGCAACCCAAUUUAUAUGUAGUAGCUGAAC |
| UGUUCACAGGAAGUGAAGAUCUGGACAAUGUCUUUGUUACUAGACUGGG |
| CAUUAGUUCCUUAAUAAGAGAGGCAAUGAGUGCAUAUAAUAGUCAUGAA |
| GAGGGCAGAUUAGUUUACCGAUAUGGAGGAGAACCUGUUGGAUCCUUUG |
| UUCAGCCCUGUUUGAGGCCUUUAAUGCCAGCUAUUGCACAUGCCCUGUU |
| UAUGGAUAUUACGCAUGAUAAUGAGUGUCCUAUUGUGCAUAGAUCAGCG |
| UAUGAUGCUCUUCCAAGUACUACAAUUGUUUCUAUGGCAUGUUGUGCUA |
| GUGGAAGUACAAGAGGCUAUGAUGAAUUAGUGCCUCAUCAGAUUUCAGU |
| GGUUUCUGAAGAACGGUUUUACACUAAGUGGAAUCCUGAAGCAUUGCCU |
| UCAAACACAGGUGAAGUUAAUUUCCAAAGCGGCAUUAUUGCAGCCAGGU |
| GUGCUAUCAGUAAACUUCAUCAGGAGCUUGGAGCCAAGGGUUUUAUUCA |
| GGUGUAUGUGGAUCAAGUUGAUGAAGACAUAGUGGCAGUAACAAGACAC |
| UCACCUAGCAUCCAUCAGUCUGUUGUGGCUGUAUCUAGAACUGCUUUCA |
| GGAAUCCCAAGACUUCAUUUUACAGCAAGGAAGUGCCUCAAAUGUGCAU |
| CCCUGGCAAAAUUGAAGAAGUAGUUCUUGAAGCUAGAACUAUUGAGAGA |
| AACACGAAACCUUAUAGGAAGGAUGAGAAUUCAAUCAAUGGAACACCAG |
| AUAUCACAGUAGAAAUUAGAGAACAUAUUCAGCUUAAUGAAAGUAAAAU |
| UGUUAAACAAGCUGGAGUUGCCACAAAAGGGCCCAAUGAAUAUAUUCAA |
| GAAAUAGAAUUUGAAAACUUGUCUCCAGGAAGUGUUAUUAUAUUCAGAG |
| UUAGUCUUGAUCCACAUGCACAAGUCGCUGUUGGAAUUCUUCGAAAUCA |
| UCUGACACAAUUCAGUCCUCACUUUAAAUCUGGCAGCCUAGCUGUUGAC |
| AAUGCAGAUCCUAUAUUAAAAAUUCCUUUUGCUUCUCUUGCCUCCAGAU |
| UAACUUUGGCUGAGCUAAAUCAGAUCCUUUACCGAUGUGAAUCAGAAGA |
| AAAGGAAGAUGGUGGAGGGUGCUAUGACAUACCAAACUGGUCAGCCCUU |
| AAAUAUGCAGGUCUUCAAGGUUUAAUGUCUGUAUUGGCAGAAAUAAGAC |
| CAAAGAAUGACUUGGGGCAUCCUUUUUGUAAUAAUUUGAGAUCUGGAGA |
| UUGGAUGAUUGACUAUGUCAGUAACCGGCUUAUUUCACGAUCAGGAACU |
| AUUGCUGAAGUUGGUAAAUGGUUGCAGGCUAUGUUCUUCUACCUGAAGC |
| AGAUCCCACGUUACCUUAUCCCAUGUUACUUUGAUGCUAUAUUAAUUGG |
| UGCAUAUACCACUCUUCUGGAUACAGCAUGGAAGCAGAUGUCAAGCUUU |
| GUUCAGAAUGGUUCAACCUUUGUGAAACACCUUUCAUUGGGUUCAGUUC |
| AACUGUGUGGAGUAGGAAAAUUCCCUUCCCUGCCAAUUCUUUCACCUGC |
| CCUAAUGGAUGUACCUUAUAGGUUAAAUGAGAUCACAAAAGAAAAGGAG |
| CAAUGUUGUGUUUCUCUAGCUGCAGGCUUACCUCAUUUUUCUUCUGGUA |
| UUUUCCGCUGCUGGGGAAGGGAUACUUUUAUUGCACUUAGAGGUAUACU |
| GCUGAUUACUGGACGCUAUGUAGAAGCCAGGAAUAUUAUUUUAGCAUUU |
| GCGGGUACCCUGAGGCAUGGUCUCAUUCCUAAUCUACUGGGUGAAGGAA |
| UUUAUGCCAGAUACAAUUGUCGGGAUGCUGUGUGGUGGUGGCUGCAGUG |
| UAUCCAGGAUUACUGUAAAAUGGUUCCAAAUGGUCUAGACAUUCUCAAG |
| UGCCCAGUUUCCAGAAUGUAUCCUACAGAUGAUUCUGCUCCUUUGCCUG |
| CUGGCACACUGGAUCAGCCAUUGUUUGAAGUCAUACAGGAAGCAAUGCA |
| AAAACACAUGCAGGGCAUACAGUUCCGAGAAAGGAAUGCUGGUCCCCAG |
| AUAGAUCGAAACAUGAAGGACGAAGGUUUUAAUAUAACUGCAGGAGUUG |
| AUGAAGAAACAGGAUUUGUUUAUGGAGGAAAUCGUUUCAAUUGUGGCAC |
| AUGGAUGGAUAAAAUGGGAGAAAGUGACAGAGCUAGAAACAGAGGAAUC |
| CCAGCCACACCAAGAGAUGGGUCUGCUGUGGAAAUUGUGGGCCUGAGUA |
| AAUCUGCUGUUCGCUGGUUGCUGGAAUUAUCCAAAAAAAAUAUUUUCCC |
| UUAUCAUGAAGUCACAGUAAAAAGACAUGGAAAGGCUAUAAAGGUCUCA |
| UAUGAUGAGUGGAACAGAAAAAUACAAGACAACUUUGAAAAGCUAUUUC |
| AUGUUUCCGAAGACCCUUCAGAUUUAAAUGAAAAGCAUCCAAAUCUGGU |
| UCACAAACGUGGCAUAUACAAAGAUAGUUAUGGAGCUUCAAGUCCUUGG |
| UGUGACUAUCAGCUCAGGCCUAAUUUUACCAUAGCAAUGGUUGUGGCCC |
| CUGAGCUCUUUACUACAGAAAAAGCAUGGAAAGCUUUGGAGAUUGCAGA |
| AAAAAAAUUGCUUGGUCCCCUUGGCAUGAAAACUUUAGAUCCAGAUGAU |
| AUGGUUUACUGUGGAAUUUAUGACAAUGCAUUAGACAAUGACAACUACA |
| AUCUUGCUAAAGGUUUCAAUUAUCACCAAGGACCUGAGUGGCUGUGGCC |
| UAUUGGGUAUUUUCUUCGUGCAAAAUUAUAUUUUUCCAGAUUGAUGGGC |
| CCGGAGACUACUGCAAAGACUAUAGUUUUGGUUAAAAAUGUUCUUUCCC |
| GACAUUAUGUUCAUCUUGAGAGAUCCCCUUGGAAAGGACUUCCAGAACU |
| GACCAAUGAGAAUGCCCAGUACUGUCCUUUCAGCUGUGAAACACAAGCC |
| UGGUCAAUUGCUACUAUUCUUGAGACACUUUAUGAUUU{tilde over (A)}{tilde over (U)}{tilde over (A)}G |
| (SEQ ID NO: 151) |
| AŨGGGACACAGŨAAACAGAŨŨCGAAŨŨACŨŨCŨGAACGAAAŨGGAGAA |
| ACŨGGAAAAGACCCŨCŨŨCAGACŨŨGAACAAGGGŨAŨGAGCŨACAGŨŨ |
| CCGAŨŨAGGCCCAACŨŨŨACAGGGAAAAGCAGŨŨACCGŨGŨAŨACAA |
| AŨŨACCCAŨŨŨCCŨGGAGAAACAŨŨŨAAŨAGAGAAAAAŨŨCCGŨŨCŨ |
| CŨGGAŨŨGGGAAAAŨCCAACAGAAAGAGAAGAŨGAŨŨCŨGAŨAAAŨA |
| CŨGŨAAACŨŨAAŨCŨGCAACAAŨCŨGGŨŨCAŨŨŨCAGŨAŨŨAŨŨŨC |
| CŨŨCAAGGAAAŨGAGAAAAGŨGGŨGGAGGŨŨACAŨAGŨŨGŨGGACCCCA |
| ŨŨŨŨACGŨGŨŨGGŨGCŨGAŨAAŨCAŨGŨGCŨACCCŨŨGGACŨGŨG |
| ŨŨACŨCŨŨCAGACAŨŨŨŨŨAGCŨAAGŨGŨŨŨGGGACCŨŨŨŨGAŨGAA |
| ŨGGGAAAGCAGACŨŨAGGGŨŨGCAAAAGAAŨCAGGCŨACAACAŨGA |
| ŨŨCAŨŨŨŨACCCCAŨŨGCAGACŨCŨŨGGACŨAŨCŨAGGŨCAŨGCŨAC |
| ŨCCCŨŨGCCAAŨCAGŨŨAGAAŨŨAAAŨCCŨGACŨŨŨŨCAAGACCŨAA |
| ŨAGAAAGŨAŨACCŨGGAAŨGAŨGŨŨGGACAGCŨAGŨGGAAAAAŨŨAAA |
| AAAGGAAŨGGAAŨGŨŨAŨŨGŨAŨŨACŨGAŨGŨŨGŨCŨACAAŨCAŨAC |
| ŨGCŨGCŨAAŨAGŨAAAŨGGAŨCCAGGAACAŨCCAGAAŨGŨGCCŨAŨAA |
| ŨCUŨGŨGAANCŨCCACACŨŨAAAACCŨGCCŨGGGŨCŨŨAGACAGAGCA |
| CŨŨŨGGCGŨŨŨŨŨCCŨGŨGAŨGŨŨGCAGAAGGGAAAŨACAAAGAAAA |
| GGGAAŨACCŨGCŨŨŨGAŨŨGAAAAŨGAŨCACCAŨAŨGAAŨŨCCAŨCC |
| GAAAAAŨAAŨŨŨGGGAGGAŨAŨŨŨŨŨCCAAAGCŨŨAAACŨCŨGGGA |
| AŨŨŨŨŨCCAAGŨAGAŨGŨCAACAAAGCGGŨŨGAGCAŨŨŨŨAGAAGAC |
| ŨŨCŨŨACACAAGAAAAŨAGGCGAGŨAACCAAGŨCŨGAŨCCAAACCAA |
| CACCŨŨACGAŨŨAŨŨCAAGAŨCCŨGAAŨACAGACGGŨŨŨGGCŨGŨAC |
| ŨGŨAGAŨAŨGAACAŨŨGCACŨAACGACŨCAŨACCACAŨGACAAGGGG |
| CCAGCAGCAAŨŨGAAGAAŨGCŨGŨAAŨŨGGŨŨŨCAŨAAAAGAAŨGGA |
| GGAAŨŨAAAŨŨCAGAGAAGCAŨCGACŨCAŨŨAACŨAŨCAŨCAGGAACA |
| GGCAGŨŨAAŨŨGCCŨŨŨŨGGGAAAŨGŨGŨŨŨŨAŨGAACGACŨGGCŨG |
| GCCAŨGGŨCCAAAACŨAGGACCŨGŨCACŨAGAAAGCAŨCCŨŨŨAGŨŨA |
| CCAGGŨAŨŨŨŨACŨŨŨCCCAŨŨŨGAAGAGAŨAGACŨŨCŨCCAŨGGAA |
| GAAŨCŨAŨGAŨŨCAŨCŨGCCAAAŨAAAGCŨŨGŨŨŨCŨGAŨGGCACACA |
| AŨGGAŨGGGŨAAŨGGGAGAŨGAŨCCŨCŨŨCGAAACŨŨŨGCŨGAACCGG |
| GŨŨCAGAAGŨŨŨACCŨAAGGAGAGAACŨŨAŨŨŨGCŨGGGGAGACAGŨ |
| GŨŨAAAŨŨACGCŨAŨGGGAAŨAAACCAGAGGACŨGŨCCŨŨAŨCŨCŨGG |
| GCACACAŨGAAAAAAŨACACŨGAAAŨAACŨGCAACŨŨAŨŨŨCCAGGGA |
| GŨACGŨCŨŨGAŨAACŨGCCACŨCAACACCŨCŨŨCACGŨAGCŨGAGŨAC |
| AŨGŨŨGGAŨGCŨGCŨAGGAAŨŨŨGCAACCCAAŨŨŨAŨAŨGŨAGŨAGC |
| ŨGAACŨGŨŨCACAGGAAGŨGAAGAŨCŨGGACAAŨGŨCŨŨŨGŨŨACŨA |
| GACŨGGGCAŨŨAGŨŨCCŨŨAAŨAAGAGAGGCAAŨGAGŨGCAŨAŨAAŨ |
| AGŨCAŨGAAGAGGGCAGAŨŨAGŨŨŨACCGAŨAŨGGAGGAGAACCŨGŨ |
| ŨGGAŨCCŨŨŨGŨŨCAGCCCŨGŨŨŨGAGGCCŨŨŨAAŨGCCAGCŨAŨŨG |
| CACAŨGCCCŨGŨŨŨAŨGGAŨAŨŨACGCAŨGAŨAAŨGAGŨGŨCCŨAŨŨ |
| GŨGCAŨAGAŨCAGCGŨAŨGAŨGCŨCŨŨCCAAGŨACŨACAAŨŨGŨŨŨC |
| ŨAŨGGCAŨGŨŨGŨGCŨAGŨGGAAGŨACAAGAGGCŨAŨGAŨGAAŨŨAG |
| ŨGCCŨCAŨCAGAŨŨŨCAGŨGGŨŨŨCŨGAAGAACGGŨŨŨŨACACŨAAG |
| ŨGGAAŨCCŨGAAGCAŨGCCŨŨCAAACACAGGŨGAAGŨŨAAŨŨŨCCAAA |
| GCGGCAŨŨAŨŨGCAGCCAGGŨGŨGCŨAŨCAGŨAAACŨŨCAŨCAGGAGC |
| ŨŨGGAGCCAAGGGŨŨŨŨAŨŨCAGGŨGŨAŨGŨGGAŨCAAGŨŨGAŨG |
| AAGACAŨAGŨGGCAGŨAACAAGACACŨCACCŨAGCAŨCCAŨCAGŨC |
| ŨGŨŨGŨGGCŨGŨAŨCŨAGAACŨGCŨŨŨCAGGAAŨCCCAAGACŨŨCA |
| ŨŨŨŨACAGCAAGGAAGŨGCCŨCAAAŨGŨGCAŨCCCŨGGCAAAAŨŨ |
| GAAGAAGŨAGŨŨCŨŨGAAGCŨAGAACŨAŨŨGAGAGAAACACGAAAC |
| CŨŨAŨAGGAAGGAŨGAGAAŨŨCAAŨCAAŨGGAACACCAGAŨAŨCAC |
| AGŨAGAAAŨŨAGAGAACAŨAŨŨCAGCŨŨAAŨGAAAGŨAAAAŨŨGŨŨA |
| AACAAGCŨGGAGŨŨGCCACAAAAGGGCCCAAŨGAAŨAŨAŨŨCAAGAA |
| AŨAGAAŨŨŨGAAAACŨŨGŨCŨCCAGGAAGŨGŨŨAŨŨAŨAŨŨCAGAGŨŨ |
| AGŨCŨŨGAŨCCACAŨGCACAAGŨCGCŨGŨŨGGAAŨŨCŨŨCGAAAŨCAŨ |
| CŨGACACAAŨŨCAGŨCCŨCACŨŨŨAAAŨCŨGGCAGCCŨAGCŨGŨŨ |
| GACAAŨGCAGAŨCCŨAŨAŨŨAAAAAŨŨCCŨŨŨGCŨŨCŨCŨŨGCCŨCC |
| AGAŨŨAACŨŨŨGGCŨGAGCŨAAAŨCAGAŨCCŨŨŨACCGAŨGŨGAAŨC |
| AGAAGAAAAGGAAGAŨGGŨGGAGGGŨGCŨAŨGACAŨACCAAACŨGGŨ |
| CAGCCCŨŨAAAŨAŨGCAGGŨCŨŨCAAGGŨŨŨAAŨGŨCŨGŨAŨŨGGC |
| AGAAAŨAAGACCAAAGAAŨGACŨŨGGGGCAŨCCŨŨŨŨŨGŨAAŨAA |
| ŨŨŨGAGAŨCŨGGAGAŨŨGGAŨGAŨŨGACŨAŨGŨCAGŨAACCGGC |
| ŨŨAŨŨŨCACGAŨCAGGAACŨAŨŨGCŨGAAGŨŨGGŨAAAŨGGŨŨGCAG |
| GCŨAŨGŨŨCŨŨCŨACCŨGAAGCAGAŨCCCACGŨŨACCŨŨAŨCCCAŨG |
| ŨŨACŨŨŨGAŨGCŨAŨAŨŨAAŨŨGGŨGCAŨAŨACCACŨCŨŨCŨGGAŨA |
| CAGCAŨGGAAGCAGAŨGŨCAAGCŨŨŨGŨŨCAGAAŨGGŨŨCAACCŨŨŨ |
| GŨGAAACACCŨŨŨCAŨŨGGGŨŨCAGŨŨCAACŨGŨGŨGGAGŨAGGAAAA |
| ŨŨCCCŨŨCCCŨGCCAAŨŨCŨŨŨCACCŨGCCCŨAAŨGGAŨGŨACCŨŨAŨ |
| AGGŨŨAAAŨGAGAŨCACAAAAGAAAAGGAGCAAŨGŨŨGŨGŨŨŨŨCŨAG |
| CŨGCAGGCŨŨACCŨCAŨŨŨŨŨCŨŨCŨGGŨAŨŨŨŨCCGCŨGCŨGGGGA |
| AGGGAŨACŨŨŨAŨŨGCACŨŨAGAGGŨAŨACŨGCŨGAŨŨACŨGGACGC |
| ŨAŨGŨAGAAGCCAGGAAŨAŨŨAŨŨŨŨAGCAŨŨŨGCGGGŨACCCŨGAGG |
| CAŨGGŨCŨCAŨŨCCŨAAŨCŨACŨGGGŨGAAGGAŨŨŨŨAŨGCCAGAŨA |
| CAAŨŨGŨCGGGAŨGCŨGŨGŨGGŨGGŨGGCŨGCAGŨGŨAŨCCAGGA |
| ŨŨACŨGŨAAAAŨGGŨŨCCAAAŨGGŨCŨAGACAŨŨCŨCAAGŨGCCCA |
| GŨŨŨCCAGAAŨGŨAŨCCŨACAGAŨGAŨŨCŨGCŨCCŨŨŨGCCŨGCŨG |
| GCACACŨGGAŨCAGCCAŨŨGŨŨŨGAAGŨCAŨACAGGAAGCAAŨGCAA |
| AAACACAŨGCAGGGCAŨACAGŨŨCCGAGAAAGGAAŨGCŨGGŨCCCCAG |
| AŨAGAŨCGAAACAŨGAAGGACGAAGGŨŨŨAAŨAŨAACŨGCAGGAGŨŨ |
| GAŨGAAGAAACAGGAŨŨŨGŨŨŨAŨGGAGGAAAŨCGŨŨŨCAAŨŨGŨGGC |
| ACAŨGGAŨGGAŨAAAAŨGGGAGAAAGŨGACAGAGCŨAGAAACAGAGGAA |
| ŨCCCAGCCACACCAAGAGAŨGGGŨCŨGCŨGŨGGAAAŨŨGŨGGGCCŨGA |
| GŨAAAŨCŨGCŨGŨŨCGCŨGGŨŨGCŨGGAAŨŨAŨCCAAAAAAAAŨŨŨŨŨ |
| ŨCCCŨŨAŨCAŨGAAGŨCACAGŨAAAAAGACAŨGGAAAGGCŨAŨAAA |
| GGŨCŨCAŨAŨGAŨGAGŨGGAACAGAAAAAŨACAAGACAACŨŨŨGAAAA |
| GCŨAŨŨŨCAŨGŨŨŨCCGAAGACCCŨŨCAGAŨŨŨAAAŨGAAAAGCAŨCC |
| AAAŨCŨGGŨŨCACAAACGŨGGCAŨAŨACAAAGAŨAGŨŨAŨGGAGCŨŨ |
| CAAGŨCCŨŨGGŨGŨGACŨAŨCAGCŨCAGGCCŨAAŨŨŨŨACCAŨAGCAA |
| ŨGGŨGŨGGCCCCŨGAGCŨCŨŨŨACŨACAGAAAAAGCAŨGGAAAGC |
| ŨŨŨGGAGAŨŨGCAGAAAAAAAAŨŨGCŨŨGGŨCCCCŨŨGGCAŨGAAA |
| ACŨŨŨAGAŨCCAGAŨGAŨAŨGGŨŨŨACŨGŨGGAŨŨŨŨAŨGACAAŨG |
| CAŨŨAGACAAŨGACAACŨACAAŨCŨŨGCŨAAAGGŨŨŨCAAŨŨAŨCACC |
| AAGGACCŨGAGŨGGCŨGŨGGCCŨAŨŨGGGŨAŨŨŨŨŨŨCGŨGCAAAAŨŨ |
| AŨAŨŨŨŨCCAGAŨŨGAŨGGGCCCGGAGACŨACŨGCAAAGACŨAŨAGŨŨ |
| ŨŨGGŨŨAAAAAŨGŨŨCŨŨŨCCCGACAŨŨAŨGŨŨCAŨCŨŨGAGAGAŨC |
| CCCŨŨGGAAAGGACŨŨCCAGAACŨGACCAAŨGAGAAŨGCCCAGŨACŨGŨ |
| CCŨŨŨCAGCŨGŨGAAACACAAGCCŨGGŨCAAŨŨGCŨACŨAŨŨCŨŨGAG |
| ACACŨŨŨAŨGAŨŨŨAŨAG |
In this example, the structures of mUNA molecules for use in expressing human protein S (alpha) (PROS1) are shown.
Human protein S (alpha) is associated with Protein S deficiency, thrombosis, and arterial occlusive disease.
The base sequences shown below are the portion of the mUNA molecule that may correspond in functionality to the open reading frame of the native mRNA of human protein S (alpha). The complete mUNA molecule comprises a 5′ cap (m7GpppGm), and a 5′-UTR upstream of the sequence below, and a 3′ UTR and polyA tail (SEQ ID Nos: 4 to 12) downstream of the sequence below, each of which corresponds to the structure of the native mRNA of human protein S (alpha).
| Human protein S (alpha) is accession |
| NM_001314077.1. |
| (SEQ ID NO: 152) |
| A{tilde over (U)}{circumflex over (G)}{tilde over (A)}GGGUCCUGGGUGGGCGCUGCGGGGCGCUGCUGGCGUGUCUCCUC |
| CUAGUGCUUCCCGUCUCAGAGGCAAACUUUUGUUUAUAUUUUAGAAAUG |
| AUUUUAUAUACAACCGUGCAUGCAUUUCUGUAUUGGUCGGCUUAUCUGG |
| AUGCAAUCUUUUUUCUAUUCUAUAUGCUUUUUGAAAGCAACAGGCUUCA |
| CAAGUCCUGGUUAGGAAGCGUCGUGCAAAUUCUUUACUUGAAGAAACCA |
| AACAGGGUAAUCUUGAAAGAGAAUGCAUCGAAGAACUGUGCAAUAAAGA |
| AGAAGCCAGGGAGGUCUUUGAAAAUGACCCGGAAACGGAUUAUUUUUAU |
| CCAAAAUACUUAGUUUGUCUUCGCUCUUUUCAAACUGGGUUAUUCACUG |
| CUGCACGUCAGUCAACUAAUGCUUAUCCUGACCUAAGAAGCUGUGUCAA |
| UGCCAUUCCAGACCAGUGUAGUCCUCUGCCAUGCAAUGAAGAUGGAUAU |
| AUGAGCUGCAAAGAUGGAAAAGCUUCUUUUACUUGCACUUGUAAACCAG |
| GUUGGCAAGGAGAAAAGUGUGAAUUUGACAUAAAUGAAUGCAAAGAUCC |
| CUCAAAUAUAAAUGGAGGUUGCAGUCAAAUUUGUGAUAAUACACCUGGA |
| AGUUACCACUGUUCCUGUAAAAAUGGUUUUGUUAUGCUUUCAAAUAAGA |
| AAGAUUGUAAAGAUGUGGAUGAAUGCUCUUUGAAGCCAAGCAUUUGUGG |
| CACAGCUGUGUGCAAGAACAUCCCAGGAGAUUUUGAAUGUGAAUGCCCC |
| GAAGGCUACAGAUAUAAUCUCAAAUCAAAGUCUUGUGAAGAUAUAGAUG |
| AAUGCUCUGAGAACAUGUGUGCUCAGCUUUGUGUCAAUUACCCUGGAGG |
| UUACACUUGCUAUUGUGAUGGGAAGAAAGGAUUCAAACUUGCCCAAGAU |
| CAGAAGAGUUGUGAGGUUGUUUCAGUGUGCCUUCCCUUGAACCUUGACA |
| CAAAGUAUGAAUUACUUUACUUGGCGGAGCAGUUUGCAGGGGUUGUUUU |
| AUAUUUAAAAUUUCGUUUGCCAGAAAUCAGCAGAUUUUCAGCAGAAUUU |
| GAUUUCCGGACAUAUGAUUCAGAAGGCGUGAUACUGUACGCAGAAUCUA |
| UCGAUCACUCAGCGUGGCUCCUGAUUGCACUUCGUGGUGGAAAGAUUGA |
| AGUUCAGCUUAAGAAUGAACAUACAUCCAAAAUCACAACUGGAGGUGAU |
| GUUAUUAAUAAUGGUCUAUGGAAUAUGGUGUCUGUGGAAGAAUUAGAAC |
| AUAGUAUUAGCAUUAAAAUAGCUAAAGAAGCUGUGAUGGAUAUAAAUAA |
| ACCUGGACCCCUUUUUAAGCCGGAAAAUGGAUUGCUGGAAACCAAAGUA |
| UACUUUGCAGGAUUCCCUCGGAAAGUGGAAAGUGAACUCAUUAAACCGA |
| UUAACCCUCGUCUAGAUGGAUGUAUACGAAGCUGGAAUUUGAUGAAGCA |
| AGGAGCUUCUGGAAUAAAGGAAAUUAUUCAAGAAAAACAAAAUAAGCAU |
| UGCCUGGUUACUGUGGAGAAGGGCUCCUACUAUCCUGGUUCUGGAAUUG |
| CUCAAUUUCACAUAGAUUAUAAUAAUGUAUCCAGUGCUGAGGGUUGGCA |
| UGUAAAUGUGACCUUGAAUAUUCGUCCAUCCACGGGCACUGGUGUUAUG |
| CUUGCCUUGGUUUCUGGUAACAACACAGUGCCCUUUGCUGUGUCCUUGG |
| UGGACUCCACCUCUGAAAAAUCACAGGAUAUUCUGUUAUCUGUUGAAAA |
| UACUGUAAUAUAUCGGAUACAGGCCCUAAGUCUAUGUUCCGAUCAACAA |
| UCUCAUCUGGAAUUUAGAGUCAACAGAAACAAUCUGGAGUUGUCGACAC |
| CACUUAAAAUAGAAACCAUCUCCCAUGAAGACCUUCAAAGACAACUUGC |
| CGUCUUGGACAAAGCAAUGAAAGCAAAAGUGGCCACAUACCUGGGUGGC |
| CUUCCAGAUGUUCCAUUCAGUGCCACACCAGUGAAUGCCUUUUAUAAUG |
| GCUGCAUGGAAGUGAAUAUUAAUGGUGUACAGUUGGAUCUGGAUGAAGC |
| CAUUUCUAAACAUAAUGAUAUUAGAGCUCACUC |
| AUGUCCAUCAGUUUGGAAAAAGACAAAGAAUUCU{tilde over (U)}{tilde over (U)}{tilde over (A)}A |
| (SEQ ID NO: 153) |
| AŨGAGGGŨCCŨGGGŨGGGCGCŨGCGGGGCGCŨGCŨGGCGŨGŨCŨCCŨ |
| CCŨAGŨGCŨŨCCCGŨCŨCAGAGGCAAACŨŨŨGŨŨŨAŨAŨŨŨŨAGAAA |
| ŨGAŨŨŨŨAŨAŨACAACCGŨGCAŨGCAŨŨŨCŨGŨAŨŨGGŨCGGCŨŨA |
| ŨCŨGGAŨGCAAŨŨŨŨŨŨCŨAŨŨCŨAŨAŨGCŨŨŨŨŨGŨCAAAGCAACA |
| GGCŨŨCACAAGŨCCŨGGŨŨAGGAAGCGŨCGŨGCAAAŨŨCŨŨŨACŨŨG |
| AAGAAACCAAACAGGGŨAAŨCŨŨGAAAGAGAAŨGCAŨCGAAGAACŨGŨG |
| CAAŨAAAGAAGAAGCCAGGGAGGŨCŨŨŨGAAAAŨGACCCGGAAACGGA |
| ŨŨAŨŨŨŨŨAŨCCAAAAŨACŨŨAGŨŨŨGŨCŨŨCGCŨCŨŨŨŨCAAACŨ |
| GGGŨŨAŨŨCACŨGCŨGCACGŨCAGŨCAACŨAAŨGCŨŨAŨCCŨGACCŨA |
| AGAAGCŨGŨGŨCAAŨGCCAŨŨCCAGACCAGŨGŨAGŨCCŨCŨGCCAŨGC |
| AAŨGAAGAŨGGAŨAŨAŨGAGCŨGCAAAGAŨGGAAAAGCŨŨCŨŨŨŨACŨŨ |
| GCACŨŨGŨAAACCAGGŨŨGGCAAGGAGAAAAGŨGŨGAAŨŨŨGACAŨAAA |
| ŨGAAŨGCAAAGAŨCCCŨCAAAŨAŨAAAŨGGAGGŨŨGCAGŨCAAAŨŨŨG |
| ŨGAŨAAŨACACCŨGGAAGŨACCACŨGŨŨCCŨGŨAAAAAŨGGŨŨŨŨGŨ |
| ŨAŨGCŨŨŨCAAAŨAAGAAAGAŨŨGŨAAAGAŨGŨGGAŨGAAŨGCŨCŨŨŨ |
| GAAGCCAAGCAŨŨŨGŨGGCACAGCŨGŨGŨGCAAGAACAŨCCCAGGAGA |
| ŨŨŨŨGAAŨGŨGAAŨGCCCCGAAGGCŨACAGAŨAŨAAŨCŨCAAAŨCAAAG |
| ŨCŨŨGŨGAAGAŨAŨAGAŨGAAŨGCŨCŨGAGAACAŨGŨGŨGCŨCAGCŨ |
| NGŨGŨCAAŨŨACCCŨGGAGGŨŨACACŨŨGCŨAŨŨGŨGAŨGGGAAGAAA |
| GGAŨŨCAAACŨŨGCCCAAGAŨCAGAAGAGŨŨGŨGAGGŨŨGŨŨŨCAGŨG |
| ŨGCCŨŨCCCŨŨGAACCŨŨGACACAAAGŨAŨGAAŨŨACŨŨŨACŨŨGGC |
| GGAGCAGŨŨŨGCAGGGGŨŨGŨŨŨŨAŨŨŨŨŨAAAAŨŨŨCGŨŨŨGCCAGA |
| AAŨCAGCAGAŨŨŨŨCAGCAGAAŨŨŨGAŨŨŨCCGGACAŨAŨGAŨŨCAGA |
| AGGCGŨGAŨACŨGŨACGCAGAAŨCŨAŨCGAŨCACŨCAGCGŨŨGGCŨC |
| CŨGAŨŨGCACŨŨCGŨGGŨGGAAAGAŨŨGAAGŨŨCAGCŨŨAAGAAŨGAA |
| CAŨACAŨCCAAAAŨCACAACŨGGAGGŨGAŨGŨŨAŨŨAAŨAAŨGGŨ |
| CŨAŨGGAAŨAŨGGŨGŨCŨGŨGGAAGAAŨŨAGAACAŨAGŨAŨŨAGCA |
| ŨŨAAAAŨAGCŨAAAGAAGCŨGŨGAŨGGAŨAŨAAAŨAAACCŨGGACCCC |
| ŨŨŨŨŨAAGCCGGAAAAŨGGAŨŨGCŨGGAAACCAAAGŨAŨACŨŨŨGCAGG |
| AŨŨCCCŨCGGAAAGŨGGAAAGŨGAACŨCAŨŨAAACCGAŨŨAACCCŨC |
| GŨCŨAGAŨGGAŨGŨAŨACGAAGCŨGGAAŨŨŨGAŨGAAGCAAGGAGCŨ |
| ŨŨŨGGAAŨAAAGGAAAŨŨAŨŨCAAGAAAAACAAAAŨAAGCAŨŨGCCŨG |
| GŨŨACŨGŨGGAGAAGGGCŨCCŨACŨAŨCCŨGGŨŨCŨGGAAŨŨGCŨCAA |
| ŨŨŨCACAŨAGAŨŨAŨAAŨAAŨGŨAŨCCAGŨGCŨGAGGGŨŨGGCAŨG |
| ŨAAAŨGŨGACCŨŨGAAŨAŨŨCGŨCCAŨCCACGGGCACŨGGŨGŨŨAŨG |
| CŨŨGCCŨŨGGŨŨŨCŨGGŨAACAACACAGŨGCCCŨŨŨGCŨGŨGŨCCŨŨ |
| GGŨGGACŨCCACCŨCŨGAAAAAŨCACAGGAŨAŨŨCŨGŨŨAŨCŨGŨŨGAA |
| AAŨACŨGŨAAŨAŨAŨCGGAŨACAGGCCCŨAAGŨCŨAŨGŨŨCCGAŨCAAC |
| AAŨCŨCAŨCŨGGAAŨŨŨAGAGŨCAACAGAAACAAŨCŨGGAGŨŨGŨCGA |
| CACCACŨŨAAAAŨAGAAACCAŨCŨCCCAŨGAAGACCŨŨCAAAGACAAC |
| ŨŨGCCGŨCŨŨGGACAAAGCAAŨGAAAGCAAAAGŨGGCCACAŨACCŨGGG |
| ŨGGCCŨŨCCAGAŨGŨŨCCAŨŨCAGŨGCCACACCAGŨGAAŨGCCŨŨŨŨA |
| ŨAAŨGGCŨGCAŨGGAAGŨGAAŨAŨŨAAŨGGŨGŨACAGŨŨGGAŨCŨGGAŨ |
| GAAGCCAŨŨŨCŨAAACAŨAAŨGAŨAŨŨAGAGCŨCACŨCAŨGŨCCAŨCA |
| GŨŨŨGGAAAAAGACAAAGAAŨŨCŨŨAA |
In this example, the structures of mUNA molecules for use in expressing human pyruvate kinase, liver and RBC (PKLR) are shown.
Human pyruvate kinase, liver and RBC (PKLR) is associated with chronic hereditary nonspherocytic hemolytic anemia.
The base sequences shown below are the portion of the mUNA molecule that may correspond in functionality to the open reading frame of the native mRNA of human pyruvate kinase, liver and RBC (PKLR). The complete mUNA molecule comprises a 5′ cap (m7GpppGm), and a 5′-UTR upstream of the sequence below, and a 3′ UTR and polyA tail (SEQ ID Nos: 4 to 12) downstream of the sequence below, each of which corresponds to the structure of the native mRNA of human pyruvate kinase, liver and RBC (PKLR).
| Human pyruvate kinase, liver and RBC (PKLR) is | |
| accession NM_000298.5. | |
| (SEQ ID NO: 154) | |
| A{tilde over (U)}{circumflex over (G)}{tilde over (U)}CGAUCCAGGAGAACAUAUCAUCCCUGCAGCUUCGGUCAUGGGUC | |
| UCUAAGUCCCAAAGAGACUUAGCAAAGUCCAUCCUGAUUGGGGCUCCA | |
| GGAGGGCCAGCGGGGUAUCUGCGGCGGGCCAGUGUGGCCCAACUGACC | |
| CAGGAGCUGGGCACUGCCUUCUUCCAGCAGCAGCAGCUGCCAGCUGCU | |
| AUGGCAGACACCUUCCUGGAACACCUCUGCCUACUGGACAUUGACUCC | |
| GAGCCCGUGGCUGCUCGCAGUACCAGCAUCAUUGCCACCAUCGGGCCA | |
| GCAUCUCGCUCCGUGGAGCGCCUCAAGGAGAUGAUCAAGGCCGGGAUG | |
| AACAUUGCGCGACUCAACUUCUCCCACGGCUCCCACGAGUACCAUGCU | |
| GAGUCCAUCGCCAACGUCCGGGAGGCGGUGGAGAGCUUUGCAGGUUCC | |
| CCACUCAGCUACCGGCCCGUGGCCAUCGCCCUGGACACCAAGGGACCG | |
| GAGAUCCGCACUGGGAUCCUGCAGGGGGGUCCAGAGUCGGAAGUGGAG | |
| CUGGUGAAGGGCUCCCAGGUGCUGGUGACUGUGGACCCCGCGUUCCGG | |
| ACGCGGGGGAACGCGAACACCGUGUGGGUGGACUACCCCAAUAUUGUC | |
| CGGGUCGUGCCGGUGGGGGGCCGCAUCUACAUUGACGACGGGCUCAUC | |
| UCCCUAGUGGUCCAGAAAAUCGGCCCAGAGGGACUGGUGACCCAAGUG | |
| GAGAACGGCGGCGUCCUGGGCAGCCGGAAGGGCGUGAACUUGCCAGGG | |
| GCCCAGGUGGACUUGCCCGGGCUGUCCGAGCAGGACGUCCGAGACCUG | |
| CGCUUCGGGGUGGAGCAUGGGGUGGACAUCGUCUUUGCCUCCUUUGUG | |
| CGGAAAGCCAGCGACGUGGCUGCCGUCAGGGCUGCUCUGGGUCCGGAA | |
| GGACACGGCAUCAAGAUCAUCAGCAAAAUUGAGAACCACGAAGGCGUG | |
| AAGAGGUUUGAUGAAAUCCUGGAGGUGAGCGACGGCAUCAUGGUGGCA | |
| CGGGGGGACCUAGGCAUCGAGAUCCCAGCAGAGAAGGUUUUCCUGGCU | |
| CAGAAGAUGAUGAUUGGGCGCUGCAACUUGGCGGGCAAGCCUGUUGUC | |
| UGUGCCACACAGAUGCUGGAGAGCAUGAUUACCAAGCCCCGGCCAACG | |
| AGGGCAGAGACAAGCGAUGUCGCCAAUGCUGUGCUGGAUGGGGCUGAC | |
| UGCAUCAUGCUGUCAGGGGAGACUGCCAAGGGCAACUUCCCUGUGGAA | |
| GCGGUGAAGAUGCAGCAUGCGAUUGCCCGGGAGGCAGAGGCCGCAGUG | |
| UACCACCGGCAGCUGUUUGAGGAGCUACGUCGGGCAGCGCCACUAAGC | |
| CGUGAUCCCACUGAGGUCACCGCCAUUGGUGCUGUGGAGGCUGCCUUC | |
| AAGUGCUGUGCUGCUGCCAUCAUUGUGCUGACCACAACUGGCCGCUCA | |
| GCCCAGCUUCUGUCUCGGUACCGACCUCGGGCAGCAGUCAUUGCUGUC | |
| ACCCGCUCUGCCCAGGCUGCCCGCCAGGUCCACUUAUGCCGAGGAGUC | |
| UUCCCCUUGCUUUACCGUGAACCUCCAGAAGCCAUCUGGGCAGAUGAU | |
| GUAGAUCGCCGGGUGCAAUUUGGCAUUGAAAGUGGAAAGCUCCGUGGC | |
| UUCCUCCGUGUUGGAGACCUGGUGAUUGUGGUGACAGGCUGGCGACCU | |
| GGCUCCGGCUACACCAACAUCAUGCGGGUGCUAAGCAUAUC{circumflex over (C)}{tilde over (U)}{circumflex over (G)}A | |
| (SEQ ID NO: 155) | |
| AŨGŨCGAŨCCAGGAGAACAŨAŨCAŨCCCŨGCAGCŨŨCGGŨCAŨGGGŨCŨCŨAAGŨCCCA | |
| AAGAGACŨŨAGCAAAGŨCCAŨCCŨGAŨŨGGGGCŨCCAGGAGGGCCAGCGGGGŨAŨCŨGC | |
| GGCGGGCCAGŨGŨGGCCCAACŨGACCCAGGAGCŨGGGCACŨGCCŨŨCŨŨCCAGCAGCAG | |
| CAGCŨGCCAGCŨGCŨAŨGGCAGACACCŨŨCCŨGGAACACCŨCŨGCCŨACŨGGACAŨŨGA | |
| CŨCCGAGCCCGŨGGCŨGCŨCGCAGŨACCAGCAŨCAŨŨGCCACCAŨCGGGCCAGCAŨCŨC | |
| GCŨCCGŨGGAGCGCCŨCAAGGAGAŨGAŨCAAGGCCGGGAŨGAACAŨŨGCGCGACŨCAAC | |
| ŨŨCŨCCCACGGCŨCCCACGAGŨACCAŨGCŨGAGŨCCAŨCGCCAACGŨCCGGGAGGCGGŨ | |
| GGAGAGCŨŨŨGCAGGŨŨCCCCACŨCAGCŨACCGGCCCGŨGGCCAŨCGCCCŨGGACACCA | |
| AGGGACCGGAGAŨCCGCACŨGGGAŨCCŨGCAGGGGGGŨCCAGAGŨCGGAAGŨGGAGCŨG | |
| GŨGAAGGGCŨCCCAGGŨGCŨGGŨGACŨGŨGGACCCCGCGŨŨCCGGACGCGGGGGAACGC | |
| GAACACCGŨGŨGGGŨGGACŨACCCCAAŨAŨŨGŨCCGGGŨCGŨGCCGGŨGGGGGGCCGCA | |
| ŨCŨACAŨŨGACGACGGGCŨCAŨCŨCCCŨAGŨGGŨCCAGAAAAŨCGGCCCAGAGGGACŨG | |
| GŨGACCCAAGŨGGAGAACGGCGGCGŨCCŨGGGCAGCCGGAAGGGCGŨGAACŨŨGCCAGG | |
| GGCCCAGGŨGGACŨŨGCCCGGGCŨGŨCCGAGCAGGACGŨCCGAGACCŨGCGCŨŨCGGGG | |
| ŨGGAGCAŨGGGGŨGGACAŨCGŨCŨŨŨGCCŨCCŨŨŨGŨGCGGAAAGCCAGCGACGŨGGCŨ | |
| GCCGŨCAGGGCŨGCŨCŨGGGŨCCGGAAGGACACGGCAŨCAAGAŨCAŨCAGCAAAAŨŨGA | |
| GAACCACGAAGGCGŨGAAGAGGŨŨŨGAŨGAAAŨCCŨGGAGGŨGAGCGACGGCAŨCAŨGG | |
| ŨGGCACGGGGGGACCŨAGGCAŨCGAGAŨCCCAGCAGAGAAGGŨŨŨŨCCŨGGCŨCAGAAG | |
| AŨGAŨGAŨŨGGGCGCŨGCAACŨŨGGCGGGCAAGCCŨGŨŨGŨCŨGŨGCCACACAGAŨGCŨ | |
| GGAGAGCAŨGAŨŨACCAAGCCCCGGCCAACGAGGGCAGAGACAAGCGAŨGŨCGCCAAŨG | |
| CŨGŨGCŨGGAŨGGGGCŨGACŨGCAŨCAŨGCŨGŨCAGGGGAGACŨGCCAAGGGCAACŨŨC | |
| CCŨGŨGGAAGCGGŨGAAGAŨGCAGCAŨGCGAŨŨGCCCGGGAGGCAGAGGCCGCAGŨGŨA | |
| CCACCGGCAGCŨGŨŨŨGAGGAGCŨACGŨCGGGCAGCGCCACŨAAGCCGŨGAŨCCCACŨG | |
| AGGŨCACCGCCAŨŨGGŨGCŨGŨGGAGGCŨGCCŨŨCAAGŨGCŨGŨGCŨGCŨGCCAŨCAŨŨ | |
| GŨGCŨGACCACAACŨGGCCGCŨCAGCCCAGCŨŨCŨGŨCŨCGGŨACCGACCŨCGGGCAGC | |
| AGŨCAŨŨGCŨGŨCACCCGCŨCŨGCCCAGGCŨGCCCGCCAGGŨCCACŨŨAŨGCCGAGGAG | |
| ŨCŨŨCCCCŨŨGCŨŨŨACCGŨGAACCŨCCAGAAGCCAŨCŨGGGCAGAŨGAŨGŨAGAŨCGC | |
| CGGGŨGCAAŨŨŨGGCAŨŨGAAAGŨGGAAAGCŨCCGŨGGCŨŨCCŨCCGŨGŨŨGGAGACCŨ | |
| GGŨGAŨŨGŨGGŨGACAGGCŨGGCGACCŨGGCŨCCGGCŨACACCAACAŨCAŨGCGGGŨGC | |
| ŨAAGCAŨAŨCCŨGA |
In this example, the structures of mUNA molecules for use in expressing human phenylalanine hydroxylase are shown.
Human phenylalanine hydroxylase is associated with phenylketonuria.
The base sequences shown below are the portion of the mUNA molecule that may correspond in functionality to the open reading frame of the native mRNA of human phenylalanine hydroxylase. The complete mUNA molecule comprises a 5′ cap (m7GpppGm), and a 5′-UTR upstream of the sequence below, and a 3′ UTR and polyA tail (SEQ ID NOs: 4 to 12) downstream of the sequence below, each of which corresponds to the structure of the native mRNA of human phenylalanine hydroxylase.
| Human phenylalanine hydroxylase is accession NM_000277.1. | |
| (SEQ ID NO: 156) | |
| A{tilde over (U)}{circumflex over (G)}{tilde over (U)}CCACUGCGGUCCUGGAAAACCCAGGCUUGGGCAGGAAACUCUCUGACUUUGGACA | |
| GGAAACAAGCUAUAUUGAAGACAACUGCAAUCAAAAUGGUGCCAUAUCACUGAUCUUCU | |
| CACUCAAAGAAGAAGUUGGUGCAUUGGCCAAAGUAUUGCGCUUAUUUGAGGAGAAUGAU | |
| GUAAACCUGACCCACAUUGAAUCUAGACCUUCUCGUUUAAAGAAAGAUGAGUAUGAAUU | |
| UUUCACCCAUUUGGAUAAACGUAGCCUGCCUGCUCUGACAAACAUCAUCAAGAUCUUGA | |
| GGCAUGACAUUGGUGCCACUGUCCAUGAGCUUUCACGAGAUAAGAAGAAAGACACAGUG | |
| CCCUGGUUCCCAAGAACCAUUCAAGAGCUGGACAGAUUUGCCAAUCAGAUUCUCAGCUA | |
| UGGAGCGGAACUGGAUGCUGACCACCCUGGUUUUAAAGAUCCUGUGUACCGUGCAAGAC | |
| GGAAGCAGUUUGCUGACAUUGCCUACAACUACCGCCAUGGGCAGCCCAUCCCUCGAGUG | |
| GAAUACAUGGAGGAAGAAAAGAAAACAUGGGGCACAGUGUUCAAGACUCUGAAGUCCUU | |
| GUAUAAAACCCAUGCUUGCUAUGAGUACAAUCACAUUUUUCCACUUCUUGAAAAGUACU | |
| GUGGCUUCCAUGAAGAUAACAUUCCCCAGCUGGAAGACGUUUCUCAAUUCCUGCAGACU | |
| UGCACUGGUUUCCGCCUCCGACCUGUGGCUGGCCUGCUUUCCUCUCGGGAUUUCUUGGG | |
| UGGCCUGGCCUUCCGAGUCUUCCACUGCACACAGUACAUCAGACAUGGAUCCAAGCCCA | |
| UGUAUACCCCCGAACCUGACAUCUGCCAUGAGCUGUUGGGACAUGUGCCCUUGUUUUCA | |
| GAUCGCAGCUUUGCCCAGUUUUCCCAGGAAAUUGGCCUUGCCUCUCUGGGUGCACCUGA | |
| UGAAUACAUUGAAAAGCUCGCCACAAUUUACUGGUUUACUGUGGAGUUUGGGCUCUGCA | |
| AACAAGGAGACUCCAUAAAGGCAUAUGGUGCUGGGCUCCUGUCAUCCUUUGGUGAAUUA | |
| CAGUACUGCUUAUCAGAGAAGCCAAAGCUUCUCCCCCUGGAGCUGGAGAAGACAGCCAU | |
| CCAAAAUUACACUGUCACGGAGUUCCAGCCCCUGUAUUACGUGGCAGAGAGUUUUAAUG | |
| AUGCCAAGGAGAAAGUAAGGAACUUUGCUGCCACAAUACCUCGGCCCUUCUCAGUUCGC | |
| UACGACCCAUACACCCAAAGGAUUGAGGUCUUGGACAAUACCCAGCAGCUUAAGAUUUU | |
| GGCUGAUUCCAUUAACAGUGAAAUUGGAAUCCUUUGCAGUGCCCUCCAGAAAAUAAA{circumflex over (G)}{tilde over (U)} | |
| {tilde over (A)}A | |
| (SEQ ID NO: 157) | |
| AU{circumflex over (G)}UCCACUGCGGUCCUGGA{tilde over (A)}AACCCAGGCUUGGGCAG{circumflex over (G)}AAACUCUCUGACUUUGG{tilde over (A)}CA | |
| GGAAACAAGCUAUAUUGAAGACAACUGCAAUCA{tilde over (A)}AAUGGUGCCAUAUCACU{circumflex over (G)}AUCUUCU | |
| CACUCAAAGA{tilde over (A)}GAAGUUGGUGCAUUGGC{circumflex over (C)}AAAGUAUUGCGCUUAUU{tilde over (U)}GAGGAGAAUGAU | |
| GUAAA{circumflex over (C)}CUGACCCACAUUGAAUC{tilde over (U)}AGACCUUCUCGUUUAAA{circumflex over (G)}AAAGAUGAGUAUGAAUU | |
| {tilde over (U)}UUCACCCAUUUGGAUAA{tilde over (A)}CGUAGCCUGCCU{circumflex over (G)}CUCUGACAAACAUCAUCAAGAU{circumflex over (C)}UUGA | |
| GGCAUGACAUUGG{tilde over (U)}GCCACUGUCCAUGAGCU{tilde over (U)}UCACGAGAUAAGAAGAA{tilde over (A)}GACACAGUG | |
| CCCUGGUU{circumflex over (C)}CCAAGAACCAUUCAAGA{circumflex over (G)}CUGGACAGAUUUGCCAA{tilde over (U)}CAGAUUCUCAGCUA | |
| UGG{tilde over (A)}GCGGAACUGGAUGCUGA{circumflex over (C)}CACCCUGGUUUUAAAGA{tilde over (U)}CCUGUGUACCGUGCAAG{tilde over (A)}C | |
| GGAAGCAGUUUGCUGA{circumflex over (C)}AUUGCCUACAACUACCG{circumflex over (C)}CAUGGGCAGCCCAUCCC{tilde over (U)}CGAGUG | |
| GAAUACAUGGAGGAAGAAAAGAAAACAUGGGGCACAGUGUUCAAGAC{tilde over (U)}CUGAAGUCCUU | |
| GUAUAA{tilde over (A)}ACCCAUGCUUGCUAUGA{circumflex over (G)}UACAAUCACAUUUUUCC{tilde over (A)}CUUCUUGAAAAGUACU | |
| G{tilde over (U)}GGCUUCCAUGAAGAUAA{circumflex over (C)}AUUCCCCAGCUGGAAGA{circumflex over (C)}GUUUCUCAAUUCCUGCA{circumflex over (G)}ACU | |
| UGCACUGGUUUCCG{circumflex over (C)}CUCCGACCUGUGGCUGG{circumflex over (C)}CUGCUUUCCUCUCGGGA{tilde over (U)}UUCUUGGG | |
| UGGCCUGGC{circumflex over (C)}UUCCGAGUCUUCCACUG{circumflex over (C)}ACACAGUACAUCAGACA{tilde over (U)}GGAUCCAAGCCCA | |
| UGUA{tilde over (U)}ACCCCCGAACCUGACAU{circumflex over (C)}UGCCAUGAGCUGUUGGG{tilde over (A)}CAUGUGCCCUUGUUUUC{tilde over (A)} | |
| GAUCGCAGCUUUGCCCA{circumflex over (G)}UUUUCCCAGGAAAUUGG{circumflex over (C)}CUUGCCUCUCUGGGUGC{tilde over (A)}CCUGA | |
| UGAAUACAUUGA{tilde over (A)}AAGCUCGCCACAAUUUA{circumflex over (C)}UGGUUUACUGUGGAGUU{tilde over (U)}GGGCUCUGCA | |
| AACAAGG{tilde over (A)}GACUCCAUAAAGGCAUA{tilde over (U)}GGUGCUGGGCUCCUGUC{tilde over (A)}UCCUUUGGUGAAUUA | |
| CA{circumflex over (G)}UACUGCUUAUCAGAGAA{circumflex over (G)}CCAAAGCUUCUCCCCCU{circumflex over (G)}GAGCUGGAGAAGACAGC{circumflex over (C)}AU | |
| CCAAAAUUACACUGU{circumflex over (C)}ACGGAGUUCCAGCCCCU{circumflex over (G)}UAUUACGUGGCAGAGAG{tilde over (U)}UUUAAUG | |
| AUGCCAAGGA{circumflex over (G)}GAAAGUAAGGAACUUUG{circumflex over (C)}UGCCACAAUACCUCGGC{circumflex over (C)}CUUCUCAGUUCG | |
| CUACG{tilde over (A)}CCCAUACACCCAAAGGA{tilde over (U)}UGAGGUCUUGGACAAUA{circumflex over (C)}CCAGCAGCUUAAGAUUU | |
| {tilde over (U)}GGCUGAUUCCAUUAACA{circumflex over (G)}UGAAAUUGGAAUCCUUU{circumflex over (G)}CAGUGCCCUCCAGAAAA{tilde over (U)}AAAG | |
| UAA | |
| (SEQ ID NO: 158) | |
| AŨGŨCCACŨGCGGŨCCŨGGAAAACCCAGGCŨŨGGGCAGGAAACŨCŨCŨGACŨŨŨGGACA | |
| GGAAACAAGCŨAŨAŨŨGAAGACAACŨGCAAŨCAAAAŨGGŨGCCAŨAŨCACŨGAŨCŨŨCŨ | |
| CACŨCAAAGAAGAAGŨŨGGŨGCAŨŨGGCCAAAGŨAŨŨGCGCŨŨAŨŨŨGAGGAGAAŨGAŨ | |
| GŨAAACCŨGACCCACAŨŨGAAŨCŨAGACCŨŨCŨCGŨŨŨAAAGAAAGAŨGAGŨAŨGAAŨŨ | |
| ŨŨŨCACCCAŨŨŨGGAŨAAACGŨAGCCŨGCCŨGCŨCŨGACAAACAŨCAŨCAAGAŨCŨŨGA | |
| GGCAŨGACAŨŨGGŨGCCACŨGŨCCAŨGAGCŨŨŨCACGAGAŨAAGAAGAAAGACACAGŨG | |
| CCCŨGGŨŨCCCAAGAACCAŨŨCAAGAGCŨGGACAGAŨŨŨGCCAAŨCAGAŨŨCŨCAGCŨA | |
| ŨGGAGCGGAACŨGGAŨGCŨGACCACCCŨGGŨŨŨŨAAAGAŨCCŨGŨGŨACCGŨGCAAGAC | |
| GGAAGCAGŨŨŨGCŨGACAŨŨGCCŨACAACŨACCGCCAŨGGGCAGCCCAŨCCCŨCGAGŨG | |
| GAAŨACAŨGGAGGAAGAAAAGAAAACAŨGGGGCACAGŨGŨŨCAAGACŨCŨGAAGŨCCŨŨ | |
| GŨAŨAAAACCCAŨGCŨŨGCŨAŨGAGŨACAAŨCACAŨŨŨŨŨCCACŨŨCŨŨGAAAAGŨACŨ | |
| GŨGGCŨŨCCAŨGAAGAŨAACAŨŨCCCCAGCŨGGAAGACGŨŨŨCŨCAAŨŨCCŨGCAGACŨ | |
| ŨGCACŨGGŨŨŨCCGCCŨCCGACCŨGŨGGCŨGGCCŨGCŨŨŨCCŨCŨCGGGAŨŨŨCŨŨGGG | |
| ŨGGCCŨGGCCŨŨCCGAGŨCŨŨCCACŨGCACACAGŨACAŨCAGACAŨGGAŨCCAAGCCCA | |
| ŨGŨAŨACCCCCGAACCŨGACAŨCŨGCCAŨGAGCŨGŨŨGGGACAŨGŨGCCCŨŨGŨŨŨŨCA | |
| GAŨCGCAGCŨŨŨGCCCAGŨŨŨŨCCCAGGAAAŨŨGGCCŨŨGCCŨCŨCŨGGGŨGCACCŨGA | |
| ŨGAAŨACAŨŨGAAAAGCŨCGCCACAAŨŨŨACŨGGŨŨŨACŨGŨGGAGŨŨŨGGGCŨCŨGCA | |
| AACAAGGAGACŨCCAŨAAAGGCAŨAŨGGŨGCŨGGGCŨCCŨGŨCAŨCCŨŨŨGGŨGAAŨŨA | |
| CAGŨACŨGCŨŨAŨCAGAGAAGCCAAAGCŨŨCŨCCCCCŨGGAGCŨGGAGAAGACAGCCAŨ | |
| CCAAAAŨŨACACŨGŨCACGGAGŨŨCCAGCCCCŨGŨAŨŨACGŨGGCAGAGAGŨŨŨŨAAŨG | |
| AŨGCCAAGGAGAAAGŨAAGGAACŨŨŨGCŨGCCACAAŨACCŨCGGCCCŨŨCŨCAGŨŨCGC | |
| ŨACGACCCAŨACACCCAAAGGAŨŨGAGGŨCŨŨGGACAAŨACCCAGCAGCŨŨAAGAŨŨŨŨ | |
| GGCŨGAŨŨCCAŨŨAACAGŨGAAAŨŨGGAAŨCCŨŨŨGCAGŨGCCCŨCCAGAAAAŨAAAGŨ | |
| AA |
In this example, the structures of mUNA molecules for enhancing translational efficiency are shown.
The 5′-UTR of tobacco etch virus (TEV) is as follows:
| (SEQ ID NO: 159) |
| UCAACACAACAUAUACAAAAACAAACGAAUCUCAAGCAAUCAAGCAUU |
| CUACUUCUAUUGCAGCAAUUUAAAUCAUUUCUUUUAAAGCAAAAGCAA |
| UUUUCUGAAAAUUUUCACCAUUUACGAACGAUAGCC |
The base sequences shown below are the portion of the mUNA molecule that may correspond in functionality to the 5′-UTR of tobacco etch virus (TEV). The complete mUNA molecule comprises a 5′ cap upstream of the sequence below (m7GpppGm), and a coding region (CDS) of a protein of interest, a 3′-UTR, and a polyA tail (SEQ ID Nos: 4 to 12) downstream of the sequence below, each of which corresponds to the structure of any native human mRNA. Thus, a UNA oligomer incorprating the oligomer fragment below can have enhanced translational efficiency.
The translation enhancer is placed upstream of the AUG translation start site, and the enhancer region is not translated into the therapeutic protein.
| (SEQ ID NO: 160) |
| U{circumflex over (C)}AAC{tilde over (A)}CAA{circumflex over (C)}AUA{tilde over (U)}ACAA{tilde over (A)}AACAAAC{circumflex over (G)}AAU{circumflex over (C)}UCA{tilde over (A)}GCA{tilde over (A)}UCA{tilde over (A)}GCA{tilde over (U)}UC |
| U{tilde over (A)}CUU{circumflex over (C)}UAU{tilde over (U)}GCA{circumflex over (G)}CAA{tilde over (U)}UUA{tilde over (A)}AU{circumflex over (C)}AUUU{circumflex over (C)}UUUUAAA{circumflex over (G)}CAA{tilde over (A)}AGC{tilde over (A)}AUU |
| {tilde over (U)}UCU{circumflex over (G)}AAA{tilde over (A)}UUU{tilde over (U)}CAC{circumflex over (C)}AUU{tilde over (U)}ACG{tilde over (A)}ACG{tilde over (A)}UAGCC |
| (SEQ ID NO: 161) |
| U{circumflex over (C)}AACACAACAUAUACAAAACAAACGAAUCU{circumflex over (C)}AAGCAAUCAAGCAUUCU |
| ACUUCUAUUGCA{circumflex over (G)}CAAUUUAAAUCAUUUCUUUUAAAGCAAAA{circumflex over (G)}CAAUUU |
| UCUGAAAAUUUUCACCAUUUACGAACGAUAGC{circumflex over (C)}C |
| (SEQ ID NO: 162) |
| U{circumflex over (C)}{tilde over (A)}{tilde over (A)}CACAACAUAUACAAAACAAACGAAUCUCAAGCAAUCAAGCAUUCU |
| ACUUCUAUUGCAGCAAUUUAAAUCAUUUCUUUUAAAGCAAAAGCAAUUU |
| UCUGAAAAUUUUCACCAUUUACGAACGAU{tilde over (A)}{circumflex over (G)}{circumflex over (C)}CC |
| (SEQ ID NO: 163) |
| {tilde over (U)}CAACACAACA{tilde over (U)}A{tilde over (U)}ACAAAACAAACGAA{tilde over (U)}C{tilde over (U)}CAAGCAA{tilde over (U)}CAAGCA{tilde over (U)}{tilde over (U)}C{tilde over (U)} |
| AC{tilde over (U)}{tilde over (U)}C{tilde over (U)}A{tilde over (U)}{tilde over (U)}GCAGCAA{tilde over (U)}{tilde over (U)}{tilde over (U)}AAA{tilde over (U)}CA{tilde over (U)}{tilde over (U)}{tilde over (U)}C{tilde over (U)}{tilde over (U)}{tilde over (U)}{tilde over (U)}AAAGCAAAAGCAA{tilde over (U)}{tilde over (U)}{tilde over (U)} |
| {tilde over (U)}C{tilde over (U)}GAAAA{tilde over (U)}{tilde over (U)}{tilde over (U)}{tilde over (U)}CACCA{tilde over (U)}{tilde over (U)}{tilde over (U)}ACGAACGA{tilde over (U)}AGCCC |
| (SEQ ID NO: 164) |
| {tilde over (U)}{circumflex over (C)}{tilde over (A)}{tilde over (U)}{circumflex over (C)}{tilde over (A)}{circumflex over (C)}{tilde over (A)}{tilde over (A)}{circumflex over (C)}{tilde over (A)}{tilde over (U)}{tilde over (A)}{tilde over (U)}{tilde over (A)}{circumflex over (C)}{tilde over (A)}{tilde over (A)}{tilde over (A)}{tilde over (A)}{circumflex over (C)}{tilde over (A)}{tilde over (A)}{tilde over (A)}{circumflex over (C)}{circumflex over (G)}{tilde over (A)}{tilde over (A)}{tilde over (U)}{circumflex over (C)}{tilde over (U)}{circumflex over (C)}{tilde over (A)}{tilde over (A)}{circumflex over (G)}{circumflex over (C)}{tilde over (A)}{tilde over (A)}{tilde over (U)}{circumflex over (C)}{tilde over (A)}{tilde over (A)}{circumflex over (G)}{circumflex over (C)}{tilde over (A)}{tilde over (U)}{tilde over (U)}{circumflex over (C)}{tilde over (U)} |
| {tilde over (A)}{circumflex over (C)}{tilde over (U)}{tilde over (U)}{circumflex over (C)}{tilde over (U)}{tilde over (A)}{tilde over (U)}{tilde over (U)}{circumflex over (G)}{circumflex over (C)}{tilde over (A)}{circumflex over (G)}{circumflex over (C)}{tilde over (A)}{tilde over (A)}{tilde over (U)}{tilde over (U)}{tilde over (U)}{tilde over (A)}{tilde over (A)}{tilde over (A)}{tilde over (U)}{circumflex over (C)}{tilde over (A)}{tilde over (U)}{tilde over (U)}{tilde over (U)}{circumflex over (C)}{tilde over (U)}{tilde over (U)}{tilde over (U)}{tilde over (U)}{tilde over (A)}{tilde over (A)}{tilde over (A)}{circumflex over (G)}{circumflex over (C)}{tilde over (A)}{tilde over (A)}{tilde over (A)}{tilde over (A)}{circumflex over (G)}{circumflex over (C)}{tilde over (A)}{tilde over (A)}{tilde over (U)}{tilde over (U)}{tilde over (U)} |
| {tilde over (U)}{circumflex over (C)}{tilde over (U)}{circumflex over (G)}{tilde over (A)}{tilde over (A)}{tilde over (A)}{tilde over (A)}{tilde over (U)}{tilde over (U)}{tilde over (U)}{tilde over (U)}{circumflex over (C)}{tilde over (A)}{circumflex over (C)}{circumflex over (C)}{tilde over (A)}{tilde over (U)}{tilde over (U)}{tilde over (U)}{tilde over (A)}{circumflex over (C)}{circumflex over (G)}{tilde over (A)}{tilde over (A)}{circumflex over (C)}{circumflex over (G)}{tilde over (A)}{tilde over (U)}{tilde over (A)}{circumflex over (G)}{circumflex over (C)}{circumflex over (C)}{circumflex over (C)} |
An nGFP transcript having a polyA tail of 30 monomers in length is ligated to a donor polyà tail of 30 UNA Monomers in length to give an UNA-nGFP mRNA product having a polyA30Ã30 tail of 60 monomers in length. The UNA-nGFP has an increased lifetime and markedly increased translational activity in fibroblasts.
An mRNA encoding HIV-1 gag antigen having a polyA tail of 30 monomers in length is ligated to a donor polyà tail of 20 UNA Monomers in length to give an UNA-HIV-1 gag antigen mRNA product having a polyA30Ã20 tail of 50 monomers in length. The UNA-HIV-1 gag antigen mRNA has an increased lifetime and markedly increased translational activity in fibroblasts.
An mRNA encoding antigens overexpressed in lung cancers having a polyA tail of 30 monomers in length is ligated to a donor polyà tail of 10 UNA Monomers in length to give an UNA-mRNA product having a polyA30Ã10 tail of 40 monomers in length. The UNA-mRNA has an increased lifetime and markedly increased translational activity in fibroblasts.
An mRNA encoding malarial P. falciparum reticulocyte-binding protein homologue 5 (PfRH5) having a polyA tail of 30 monomers in length is ligated to a donor polyà tail of 10 UNA Monomers in length to give an UNA-mRNA product having a polyA30Ã10 tail of 40 monomers in length. The UNA-mRNA has an increased lifetime and markedly increased translational activity in fibroblasts. The UNA-mRNA is found to induce an antibody response in an animal model.
An mRNA encoding malarial Plasmodium falciparum PfSEA-1, a 244 KD malaria antigen expressed in schizont-infected RBCs, having a polyA tail of 30 monomers in length is ligated to a donor polyà tail of 10 UNA Monomers in length to give an UNA-mRNA product having a polyA30Ã10 tail of 40 monomers in length. The UNA-mRNA has an increased lifetime and markedly increased translational activity in fibroblasts. The UNA-mRNA is found to induce an antibody response in an animal model.
FIG. 7 shows the primary structure of a functional mRNA transcript in the cytoplasm. The mRNA includes a 5′ methylguanosine cap, a protein coding sequence flanked by untranslated regions (UTRs), and a polyadenosine (polyA) tail bound by polyA binding proteins (PABPs).
FIG. 8 shows the 5′ cap and PABPs cooperatively interacting with proteins involved in translation to facilitate the recruitment and recycling of ribosome complexes.
DNA splint oligomers were made for splint-mediated ligation of of a donor oligomer to an acceptor RNA. As shown in the scheme of FIG. 8, a short mRNA acceptor oligomer and a 5′-monophosphate-bearing polyA donor oligomer can be ligated in the presence of a DNA splint oligomer.
FIG. 9 shows the splint-mediated ligation scheme, in which an acceptor RNA with a 30-monomer stub polyA tail (A(30)) was ligated to a 30-monomer donor oligomer (A(30)). The splint-mediated ligation used a DNA oligomer splint which was complementary to the 3′ UTR sequence upstream of the stub polyA tail, and included a 60-monomer oligo(dT) 5′ heel (T(60)) to splint the ligation. The anchoring region of the splint was complementary to the UTR sequence to ensure that a 5′ dT30 overhang was presented upon hybridization to the acceptor. This brings the donor oligomer into juxtaposition with the 3′ terminus of the stub tail, dramatically improving the kinetics of ligation.
FIG. 10 shows the results of ligation using 2 ug of a 120-monomer acceptor with an A30 stub tail that was ligated to a 5′-phosphorylated A30 RNA donor oligomer using T4 RNA Ligase 2. The reaction was incubated overnight at 37° C. The ligation and a mock reaction done without enzyme were purified, treated with DNAse I for 1 hour to degrade and detach the splint oligomers, and re-purified in a volume of 30 uL. The ligation efficiency was nearly 100%. The absence of a size shift in the mock-reaction prep shows that the acceptor and donor were truly ligated and not simply held together by undigested splint oligomers.
Following the same protocol with a short incubation period, high efficiency ligation of the short acceptor mRNA proceeded to nearly 100% completion. FIG. 11 shows the results of splint-mediated ligation using an acceptor RNA with a 30-monomer stub polyA tail (A(30)). The ligation reactions were performed with three different donor oligomer species: A(30), A(60), and A(120). Based on the gel shifts, the ligations attained nearly 100% efficiency.
A protocol used for a 100 ul splint-mediated ligation reaction included the following materials, reagents, and steps.
100 pmol UNA-PolyA UNA Oligomer donor.
100 pmol TAIL-60 splint oligomer.
50 pmol purified RNA acceptor.
10 uL T4 RNA Ligase 2 10× Buffer.
2 uL T4 RNA Ligase 2.
Nuclease-free Water to 100 uL.
Mix and incubate for 1-2 hours at 37 degrees, then purify the RNA in a total of ˜90 uL RNAse-free water.
Add 10 uL 10× DNase buffer to eluent and 2 ul DNase I, mix and incubate for 1 hour at 37 degrees to digest splint DNA.
Repurify the RNA using RNeasy spin columns, eluting in water or TE pH 7.0.
Reagents.
NEB M0239 T4 RNA Ligase 2.
NEB M0303 DNase I (RNase-free).
Qiagen 74104RNeasy Mini Kit.
TAIL-60 splint oligomer sequence:
| (SEQ ID NO: 165) |
| CTTCCTACTCAGGCTTTATTCAAAGACCA. |
Notes:
(a) The splint oligomer sequence includes an anchor that is specific to the 3′ UTR used for making mRNA.
(b) This protocol requires an mRNA transcript with a pre-incorporated 30-nt polyA tail.
A full-length synthetic mRNA acceptor and a 5′-monophosphate-bearing polyA donor were ligated in the presence of a DNA splint oligomer. On ligating a 30-monomer length tail to a ˜1 Kb nGFP transcript, a size shift was apparent on a 2% agarose gel, providing a direct indication that bulk ligation was achieved. FIG. 12 shows the results of one-hour splint-mediated ligations that were performed on nGFP-A30 transcripts. The resulting ligation products were compared to untreated transcripts and native nGFP-A60 IVT products. The native nGFP-A60 and the ligated products were up-shifted on the gel relative to the untreated nGFP-A30 transcripts and mock-ligated material.
A UNA-PolyA UNA Oligomer donor was made having the following structure:
| (SEQ ID NO: 166) |
| 5′-(rAp)-AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA |
| ÃÃÃÃÃ-(3′-C3 Spacer), |
| wherein 5′-(rAp) is 5′-Phosphorylation and à is |
| UNA-A. |
An nGFP transcript with a polyA tail of 30-monomers in length (untreated A30 mRNA) was ligated to a donor polyA tail of 30-monomers in length to give an mRNA product having a polyA tail of 60-monomers in length (A60-bearing ligation product) by splint-mediated ligation.
FIG. 13 shows increased lifetime and translational activity for the nGFP-A60 ligation product. As shown in FIG. 13, nuclearized transcripts were transfected into fibroblasts for comparison of nGFP-A30, mock-ligated nGFP-A30, and an nGFP-A60 ligation product (FIG. 13, left to right). The significantly higher fluorescence signal observed for the nGFP-A60 ligation product shows that it has markedly increased translational activity.
A wild-type T4 RNA ligase was used to ligate a donor 5′ phosphorylated oligomer to a short IVT transcript. Short synthetic RNAs were generated by IVT, and the outcome of ligation reactions was evaluated on high-resolution 4% agarose gels. The increase in transcript size from ligation of a synthetic oligomer 30 monomers in length to a full-sized mRNA of 1-2 Kb is too small to clearly visualize on a gel. Thus, short synthetic RNAs of 100-180 monomers were generated by IVT. The 3′ terminal sequence of these short synthetic RNAs was identical to that in the 3′ UTRs of synthetic mRNAs.
A synthetic oligomer having an adenylated 5′ end was prepared. The adenylated 5′ end, normally formed as a catalytic intermediate by the ligase, pre-activated the synthetic oligomer for ligation. Use of the pre-adenylated synthetic oligomer obviated the need for ATP in the reactions, and allowed the use of a mutant ligase that was active exclusively on adenylated substrates. Pre-adenylation of the synthetic oligomer increased ligation efficiency and minimized side-product formation.
A KQ mutant variant of T4 RNA Ligase 2 was used to ligate a pre-adenylated donor oligomer to a short IVT transcript.
FIG. 14 shows the results of a ligation performed with a 100-monomer acceptor RNA that was treated for 3 hours at room temperature with T4 RNA Ligase 2 (truncated KQ mutant) using a 10 uM concentration of a polyA tail 30-monomer donor oligomer. 15% PEG 8000 was included in the reaction as a volume excluder to promote efficient ligation. The ligation reaction showed that a high molecular weight product was formed, having a size in between the 100-monomer acceptor RNA and a 180-monomer RNA transcript included as a size standard. These results show that the ligation reaction produced a predominant product having high molecular weight with nearly 100% ligation of the donor to the acceptor. Additional experiments performed with concentrations of the polyA tail at 10 uM, 20 uM , and 40 uM showed that at least half of the acceptor RNA was ligated in all cases.
All publications, patents and literature specifically mentioned herein are incorporated by reference for all purposes.
It is understood that this invention is not limited to the particular methodology, protocols, materials, and reagents described, as these may vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to limit the scope of the present invention, which will be encompassed by the appended claims.
It must be noted that as used herein and in the appended claims, the singular forms “a”, “an”, and “the” include plural reference unless the context clearly dictates otherwise. As well, the terms “a” (or “an”), “one or more” and “at least one” can be used interchangeably herein. It is also to be noted that the terms “comprises,” “comprising”, “containing,” “including”, and “having” can be used interchangeably.
Without further elaboration, it is believed that one skilled in the art can, based on the above description, utilize the present invention to its fullest extent. The following specific embodiments are, therefore, to be construed as merely illustrative, and not limitative of the remainder of the disclosure in any way whatsoever.
All of the features disclosed in this specification may be combined in any combination. Each feature disclosed in this specification may be replaced by an alternative feature serving the same, equivalent, or similar purpose.
1. A mUNA molecule, comprising one or more UNA monomers, and comprising nucleic acid monomers, wherein the mUNA molecule is translatable to express a polypeptide or protein.
2. The molecule of claim 1, wherein the molecule comprises from 200 to 12,000 monomers.
3. The molecule of claim 1, wherein the molecule comprises from 200 to 4,000 monomers.
4. The molecule of claim 1, wherein the molecule comprises from 1 to 8,000 UNA monomers.
5. The molecule of claim 1, wherein the molecule comprises from 1 to 100 UNA monomers.
6. The molecule of claim 1, wherein the molecule comprises from 1 to 20 UNA monomers.
7. The molecule of claim 1, wherein the molecule comprises one or more modified nucleic acid nucleotides, or one or more chemically-modified nucleic acid nucleotides.
8. The molecule of claim 1, wherein the molecule comprises a 5′ cap, a 5′ untranslated region of monomers, a coding region of monomers, a 3′ untranslated region of monomers, and a tail region of monomers.
9. The molecule of claim 8, wherein the molecule comprises a translation enhancer in a 5′ or 3′ untranslated region.
10. The molecule of claim 1, wherein the molecule is translatable in vivo.
11. The molecule of claim 1, wherein the molecule is translatable in vitro.
12. The molecule of claim 1, wherein the molecule is translatable in a mammalian cell.
13. The molecule of claim 1, wherein the molecule is translatable in a human in vivo.
14. The molecule of claim 1, wherein a translation product of the molecule is an active peptide or protein.
15. The molecule of claim 1, wherein a translation product of the molecule is human EPO, human Factor IX, human alpha-1-antitrypsin, human CFTR, human ASL, human PAH, human NIS, or human hepcidin.
16. The molecule of claim 1, wherein the molecule exhibits at least 2-fold increased translation efficiency in vivo as compared to a native mRNA that encodes the same translation product.
17. The molecule of claim 1, wherein the molecule exhibits at least 3-fold increased translation efficiency in vivo as compared to a native mRNA that encodes the same translation product.
18. The molecule of claim 1, wherein the molecule exhibits at least 5-fold increased translation efficiency in vivo as compared to a native mRNA that encodes the same translation product.
19. The molecule of claim 1, wherein the molecule exhibits at least 10-fold increased translation efficiency in vivo as compared to a native mRNA that encodes the same translation product.
20. The molecule of claim 1, wherein the molecule has a cytoplasmic half-life in a cell at least 2-fold greater than a native mRNA of the cell that encodes the same translation product.
21. The molecule of claim 1, wherein the molecule is a therapeutic agent for a rare disease, a liver disease, or a cancer.
22. The molecule of claim 1, wherein the molecule is an immunization agent or vaccine component for a rare disease, a liver disease, or a cancer.
23. The molecule of claim 1, wherein the molecule comprises a sequence selected from SEQ ID NOs: 1-164.
24. A composition comprising a mUNA molecule of claim 1 and a pharmaceutically acceptable carrier.
25. A vaccine or immunization composition comprising a mUNA molecule of claim 1.
26. The composition of claim 24, wherein the carrier is a nanoparticle or liposome.
27. A method for ameliorating, preventing or treating a disease or condition in a subject comprising administering to the subject a composition of claim 24.
28. The method of claim 27, wherein the disease or condition is a rare disease, liver disease, or cancer.
29. The method of claim 27, wherein the disease or condition is described in Table 1.
30. A method for producing a polypeptide or protein in vivo, the method comprising administering to a mammal a composition of claim 24.
31. The method of claim 30, wherein the polypeptide or protein is deficient in a disease or condition described in Table 1.
32. The method of claim 30, wherein the protein is human EPO, human Factor IX, human alpha-1-antitrypsin, human CFTR, human ASL, human PAH, human NIS, or human hepcidin.
33. A method for producing a polypeptide or protein in vitro, the method comprising transfecting a cell with a mUNA molecule of claim 1.
34. The method of claim 33, wherein the transfecting is done with a transfection reagent.
35. The method of claim 33, wherein the polypeptide or protein is deficient in a disease or condition described in Table 1.
36. The method of claim 33, wherein the protein is human EPO, human Factor IX, human alpha-1-antitrypsin, human CFTR, human ASL, human PAH, human NIS, or human hepcidin.
37. A method for ameliorating, preventing or treating a rare disease or condition in a subject associated with a deficiency in a peptide or protein, the method comprising administering to the subject a mUNA molecule encoding the peptide or protein.
38. The method of claim 37, wherein the disease or condition described in Table 1.
39. A method for producing a polypeptide or protein in vivo, the method comprising administering to a mammal a mUNA molecule encoding the polypeptide or protein.
40. The method of claim 39, wherein the polypeptide or protein is human EPO, human Factor IX, human alpha-1-antitrypsin, human CFTR, human ASL, human PAH, human NIS, or human hepcidin.