Patent application title:

COMPOSITIONS AND METHODS FOR INHIBITING GENE EXPRESSION OF LPA

Publication number:

US20200263179A1

Publication date:
Application number:

16/867,925

Filed date:

2020-05-06

Abstract:

RNA interference (RNAi) agents and RNAi agent conjugates for inhibiting the expression of the LPA (apo(a)) gene are described. Pharmaceutical compositions comprising one or more LPA RNAi agents optionally with one or more additional therapeutics are also described. Delivery of the described LPA RNAi agents to liver cells in vivo provides for inhibition of LPA gene expression and treatment of cardiovascular and cardiovascular-related diseases.

Inventors:

Interested in similar patents?

Get notified when new applications in this technology area are published.

Classification:

C12N15/1137 »  CPC further

Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor; Recombinant DNA-technology; DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides against enzymes

C12Y304/21 »  CPC further

Hydrolases acting on peptide bonds, i.e. peptidases (3.4) Serine endopeptidases (3.4.21)

C12N2310/3517 »  CPC further

Structure or type of the nucleic acid; Chemical structure; Nature of the modification; Conjugate Marker; Tag

C12N2310/351 »  CPC further

Structure or type of the nucleic acid; Chemical structure; Nature of the modification Conjugate

C12N2310/315 »  CPC further

Structure or type of the nucleic acid; Chemical structure of the backbone Phosphorothioates

C12N2310/31 »  CPC further

Structure or type of the nucleic acid; Chemical structure of the backbone

C12N2310/14 »  CPC further

Structure or type of the nucleic acid; Type of nucleic acid interfering N.A.

C12N2310/321 »  CPC further

Structure or type of the nucleic acid; Chemical structure of the sugar 2'-O-R Modification

C12N15/113 »  CPC main

Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor; Recombinant DNA-technology; DNA or RNA fragments; Modified forms thereof Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides

Description

CROSS-REFERENCE TO RELATED APPLICATIONS

This application is a continuation of U.S. application Ser. No. 15/901,810, filed Feb. 21, 2018. U.S. application Ser. No. 15/901,810, is a continuation of U.S. application Ser. No. 15/281,309, filed Sep. 30, 2016, now U.S. Pat. No. 9,932,586, which claims the benefit of U.S. Provisional Application No. 62/383,221, filed Sep. 2, 2016; U.S. Provisional Application No. 62/346,304, filed Jun. 6, 2016; and U.S. Provisional Application No. 62/235,816, filed Oct. 1, 2015, all of which are hereby incorporated by reference in their entireties.

DESCRIPTION OF THE TEXT FILE SUBMITTED ELECTRONICALLY

The present application contains a Sequence Listing, which has been submitted electronically in ASCII format and is hereby incorporated by reference in its entirety. The computer readable format copy of the Sequence Listing, which was created on May 6, 2020, is named A-2132-US-CNT2_SeqList.txt and is 610 kilobytes in size.

BACKGROUND

Lipoprotein(a) [Lp(a)] is a heterogeneous low density lipoprotein (LDL)-like particle containing a lipid core and apolipoprotein B (apoB-100) with a unique constituent, apolipoprotein (a) (apo(a)), that is attached to apoB-100 through a disulfide bond.

The apo(a) gene (LPA) is expressed predominantly in the liver and expression is restricted to human and non-human primates. Lp(a) levels in humans are genetically defined and do not change significantly with diet, exercise, or other lifestyle changes. LPA varies in length depending upon the number of Kringle KIV2 domains present and its expression is inversely correlated with the number of domains present. Normal Lp(a) levels range from 0.1-25 mg/d1, with about 25% of the population in the United States of America having Lp(a) levels of 30 mg/dl or higher.

Analysis of Lp(a) levels in multiple studies have implicated high Lp(a) levels as an independent risk factor for cardiovascular disease, stroke, and other related disorders including atherosclerotic stenosis. In addition, genome-wide association analyses have also implicated LPA as a genetic risk factor for diseases such as atherosclerotic stenosis.

When therapeutic lipoprotein apheresis is used to lower both Lp(a) and LDL levels in hyperlipidemic patients, significant reductions of cardiovascular events have been observed. Therefore there exists a need for therapeutics and treatments related to these and other LPA-related diseases.

SUMMARY

Described herein are LPA (also termed apo(a)) RNA interference (RNAi) agents (also termed RNAi trigger, or trigger) and compositions containing LPA RNAi agents for selectively and efficiently inhibiting expression of the LPA gene. LPA is the name of the gene which encodes apolipoprotein (a) (apo(a)), a key component of the lipoprotein (a) particle (Lp(a)). The LPA RNAi agents described herein can be used in the prevention or treatment or the preparation of a medicament for the prevention or treatment of diseases including, but not limited to: Berger's disease, peripheral artery disease, coronary artery disease, metabolic syndrome, acute coronary syndrome, aortic valve stenosis, aortic valve regurgitation, aortic dissection, retinal artery occlusion, cerebrovascular disease, mesenteric ischemia, superior mesenteric artery occlusion, renal artery stenosis, stable/unstable angina, acute coronary syndrome, heterozygous or homozygous familial hypercholesterolemia, hyperapobetalipoproteinemia, cerebrovascular atherosclerosis, cerebrovascular disease, and venous thrombosis.

Each LPA RNAi agent includes at least a sense strand and an antisense strand. The sense strand and the antisense strand can be partially, substantially, or fully complementary to each other. The length of the RNAi agent sense and antisense strands described herein each can be 17 to 30 nucleotides in length. In some embodiments, the sense and antisense strands are independently 17 to 26 nucleotides in length. The sense and antisense strands can be either the same length or different lengths. The RNAi agents described herein, upon delivery to a cell expressing the LPA gene, inhibit the expression of the LPA gene in vitro or in vivo.

A sense strand of an LPA RNAi agent comprises a nucleotide sequence having at least 90% identity over a core stretch of at least 17 consecutive nucleotides to a sequence in an LPA mRNA. In some embodiments, the sense strand nucleotide sequence having at least 90% identity to a sequence in the LPA mRNA is 17, 18, 19, 20, 21, 22, or 23 nucleotides in length. An antisense strand of an LPA RNAi agent comprises a nucleotide sequence having at least 90% complementary over a core stretch of at least 16 consecutive nucleotides to a sequence in the LPA mRNA and the corresponding sense strand. In some embodiments, the antisense strand nucleotide sequence having at least 90% complementarity to a sequence in the LPA mRNA or the corresponding sense strand is 17, 18, 19, 20, 21, 22, or 23 nucleotides in length.

In some embodiments, one or more LPA RNAi agents are delivered to target cells or tissues using any oligonucleotide delivery technology known in the art. Nucleic acid delivery methods include, but are not limited to, by encapsulation in liposomes, by iontophoresis, or by incorporation into other vehicles, such as hydrogels, cyclodextrins, biodegradable nanocapsules, and bioadhesive microspheres, proteinaceous vectors or Dynamic Polyconjugates™ (DPCs (see, for example WO 2000/053722, WO 2008/0022309, WO 2011/104169, and WO 2012/083185, each of which is incorporated herein by reference). In some embodiments, an LPA RNAi agent is conjugated to a targeting group. In some embodiments, the targeting group can include a cell receptor ligand, such as a galactose cluster, including a galactose cluster comprising an N-acetyl-galactosamine trimer.

In some embodiments are described pharmaceutical compositions comprising one or more LPA RNAi agents. In some embodiments, an LPA RNAi agent is optionally combined with one or more additional (i.e., second, third, etc.) therapeutics. An additional therapeutic can be another LPA RNAi agent (e.g., an LPA RNAi agent which targets a different sequence within the LPA target). An additional therapeutic can also be a small molecule drug, antibody, antibody fragment, and/or vaccine. The LPA RNAi agents, with or without the one or more additional therapeutics, can be combined with one or more excipients to form pharmaceutical compositions.

In some embodiments, compositions for delivering an LPA RNAi agent to a liver cell, particularly hepatocytes, in vivo are described, comprising: an LPA RNAi agent conjugated to a targeting group. In some embodiments, the targeting group is a asialoglycoprotein ligand.

Also described are methods of treating a human subject having a pathological state or at risk of developing a pathological state mediated at least in part by LPA expression, the methods comprising the step(s) of administering to the subject a therapeutically effective amount of an LPA RNAi agent or LPA RNAi agent-containing composition. The method of treating a subject with an LPA RNAi agent or LPA RNAi agent-containing composition can optionally be combined with one or more steps of administering one or more additional (i.e., second) therapeutics or treatments. The LPA RNAi agent and additional therapeutics can be administered in a single composition or they may be administered separately. Examples of additional therapeutics include, but are not limited to, HMg Co-A reductase inhibitors (statins), ezetimibe, PCSK-9 inhibitors, CTEP inhibitors, therapies targeting ANGPTL3, therapies targeting APOC3, and niacin.

Use of the described LPA RNAi agents can be used in methods for therapeutic prevention or treatment of diseases including, but not limited to: Berger's disease, peripheral artery disease, coronary artery disease, metabolic syndrome, acute coronary syndrome, aortic valve stenosis, aortic valve regurgitation, aortic dissection, retinal artery occlusion, cerebrovascular disease, mesenteric ischemia, superior mesenteric artery occlusion, renal artery stenosis, stable/unstable angina, acute coronary syndrome, heterozygous or homozygous familial hypercholesterolemia, hyperapobetalipoproteinemia, cerebrovascular atherosclerosis, cerebrovascular disease, and venous thrombosis. Such methods comprise administration of an LPA RNAi agent as described herein to a subject, e.g., a human or animal subject.

The pharmaceutical compositions can be administered in a number of ways depending upon whether local or systemic treatment is desired and upon the area to be treated. Administration can be made by any way commonly known in the art, such as, but not limited to, topical (e.g., by a transdermal patch), pulmonary (e.g., by inhalation or insufflation of powders or aerosols, including by nebulizer, intratracheal, intranasal), epidermal, transdermal, oral or parenteral. Parenteral administration includes, but is not limited to, intravenous, intraarterial, subcutaneous, intraperitoneal or intramuscular injection or infusion; subdermal (e.g., via an implanted device), intracranial, intraparenchymal, intrathecal, and intraventricular, administration. In some embodiments, the pharmaceutical compositions described herein are administered by subcutaneous injection.

The described LPA RNAi agents and/or compositions can be used in methods for therapeutic treatment of diseases, including but not limited to: Berger's disease, peripheral artery disease, coronary artery disease, metabolic syndrome, acute coronary syndrome, aortic valve stenosis, aortic valve regurgitation, aortic dissection, retinal artery occlusion, cerebrovascular disease, mesenteric ischemia, superior mesenteric artery occlusion, renal artery stenosis, stable/unstable angina, acute coronary syndrome, heterozygous or homozygous familial hypercholesterolemia, hyperapobetalipoproteinemia, cerebrovascular atherosclerosis, cerebrovascular disease, and venous thrombosis. Such methods comprise administration of an LPA RNAi agent as described herein to a subject, e.g., a human or animal subject.

Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, suitable methods and materials are described below. All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, the present specification, including definitions, will control. In addition, the materials, methods, and examples are illustrative only and not intended to be limiting.

Other features and advantages of the invention will be apparent from the following detailed description, and from the claims.

BRIEF DESCRIPTION OF THE FIGURES

FIG. 1. Graph illustrating serum Lp(a) protein levels in Lp(a) transgenic (Tg) mice following a single subcutaneous administration of 0.5 mg/kg (dashed line) or 2 mg/kg (solid line) of indicated LPA RNAi agent. Lp(a) levels were normalized to day 1 and saline control.

FIG. 2. Graph illustrating serum Lp(a) protein levels in Lp(a) Tg mice following administration of three subcutaneous doses of 1 mg/kg (dashed line) or 3 mg/kg (solid line) of indicated LPA RNAi agent, administered once a week for three weeks (dose on days 1, 8, and 15). Lp(a) levels were normalized to day 1 and saline control.

FIG. 3. Graph illustrating Lp(a) particle levels in Cynomolgus monkey serum following administration of a single 2 mg/kg AD01196 LPA RNAi agent dosed 1:1 (wt/wt) with delivery polymer on day 1. Lp(a) levels were normalized to two pre-dose values (shown as day 0).

FIG. 4. Graph illustrating Lp(a) particle levels in Cynomolgus monkey serum following administration of 4 mg/kg or 6 mg/kg LPA RNAi agent dosed 1:1 (wt/wt) with delivery polymer on day 1 and day 71. Lp(a) levels were normalized to two pre-dose values (shown as day 0). 4 mg/kg dose=black circles; 6 mg/kg dose=gray squares.

FIG. 5. Graph illustrating Lp(a) particle levels in Cynomolgus monkey serum following three weekly subcutaneous doses of 3 mg/kg of AD02819 LPA RNAi agent on days 1, 8, and 15. Lp(a) levels were normalized to three pre-dose values (shown as day 0).

FIG. 6. Graph illustrating Lp(a) particle levels in Cynomolgus monkey serum following a single subcutaneous administration of 3 mg/kg of LPA RNAi agent on day 1. AD03460 and AD03536 groups received an additional 1 mg/kg dose of LPA RNAi agent on day 48. Lp(a) levels were normalized to three pre-dose values (shown as day 0).

DETAILED DESCRIPTION

Described herein are RNAi agents for inhibiting expression of the LPA gene (referred to herein as LPA RNAi agents). The RNAi agents described herein, upon delivery to a cell expressing the LPA gene, inhibit or knockdown expression of LPA in vitro and/or in vivo through the biological process of RNA interference (RNAi). As used herein, unless specifically noted otherwise, LPA may refer to an LPA gene, an LPA mRNA, or an LP(a) protein, as appropriate.

An LPA RNAi agent comprises a sense strand and an antisense strand. The sense strand and antisense strand each contain a core sequence 17-23 nucleobases in length. An antisense strand core sequence is 100% (perfectly) complementary or at least 90% (substantially) complementary to a nucleotide sequence (sometimes referred to, e.g., as a target sequence) present in an LPA mRNA. A sense strand core sequence is 100% (perfectly) complementary or at least 90% (substantially) complementary to a sequence in the antisense strand and thus the sense strand core sequence is perfectly identical or at least 90% identical to a nucleotide sequence (target sequence) present in the LPA mRNA. A sense strand core sequence can be the same length as a corresponding antisense core sequence or it can be a different length. In some embodiments, the antisense strand core sequence is 17, 18, 19, 20, 21, 22, or 23 nucleotides in length. In some embodiments, the sense strand core sequence is 17, 18, 19, 20, 21, 22, or 23 nucleotides in length.

LPA RNAi agent sense and antisense strands anneal to form a duplex. A sense strand and an antisense strand of an LPA RNAi agent are partially, substantially, or fully complementary to each other. Within the complementary duplex region, the sense strand core sequence is at least 90% complementary or 100% complementary to the antisense core sequence. In some embodiments, the sense strand core sequence contains a sequence of at least 17, at least 18, at least 19, at least 20, or at least 21 nucleotides that is at least 90% or 100% complementary to a corresponding 17, 18, 19, 20, or 21 nucleotide sequence of the antisense strand core sequence (i.e., the sense strand and antisense core sequences of an LPA RNAi agent have a region of at least 17, at least 18, at least 19, at least 20, or at least 21 nucleotides that is at least 90% base paired or 100% base paired.)

As used herein, and unless otherwise indicated, the term “complementary,” when used to describe a first nucleotide sequence (e.g., RNAi agent sense strand or LPA mRNA) in relation to a second nucleotide sequence (e.g., RNAi agent antisense strand), refers to the ability of an oligonucleotide or polynucleotide comprising the first nucleotide sequence to hybridize (form base pair hydrogen bonds) and form a duplex or double helical structure under certain conditions with an oligonucleotide or polynucleotide comprising the second nucleotide sequence. Complementary sequences include Watson-Crick base pairs or non-Watson-Crick base pairs and include natural or modified nucleotides or nucleotide mimics as long as the above requirements with respect to their ability to hybridize are fulfilled. “Perfectly complementary” or “fully complementary” means that all (100%) of the bases in a contiguous sequence of a first polynucleotide will hybridize with the same number of bases in a contiguous sequence of a second polynucleotide. The contiguous sequence may comprise all or a part of a first or second nucleotide sequence. As used herein, “partial complementary” means that in a hybridized pair of nucleobase sequences, at least 70% of the bases in a contiguous sequence of a first polynucleotide will hybridize with the same number of bases in a contiguous sequence of a second polynucleotide. As used herein, “substantial complementary” means that in a hybridized pair of nucleobase sequences, at least 85% of the bases in a contiguous sequence of a first polynucleotide will hybridize with the same number of bases in a contiguous sequence of a second polynucleotide. The terms “complementary”, “fully complementary” and “substantially complementary” as used herein may be used with respect to the base matching between the sense strand and the antisense strand of an RNAi agent, or between the antisense strand of an RNAi agent and a sequence of an LPA mRNA. Sequence identity or complementarity is independent of modification. For the purposes of determining identity or complementarity, for example, a and Af are complementary to U (or T) and identical to A.

The length of the LPA RNAi agent sense and antisense strands described herein are independently 17 to 30 nucleotides in length. In some embodiments, the sense and antisense strands are independently 17 to 26 nucleotides in length. In some embodiments, the sense and antisense strands are 19-26 nucleotides in length. In some embodiments, the described RNAi agent sense and antisense strands are independently 17, 18, 19, 20, 21, 22, 23, 24, 25, or 26 nucleotides in length. The sense and antisense strands can be either the same length or they can be different lengths. In some embodiments, a sense strand and an antisense strand are each 26 nucleotides in length. In some embodiments, a sense strand is 23 nucleotides in length and an antisense strand is 21 nucleotides in length. In some embodiments, a sense strand is 22 nucleotides in length and an antisense strand is 21 nucleotides in length. In some embodiments, a sense strand is 21 nucleotides in length and an antisense strand is 21 nucleotides in length. In some embodiments, a sense strand is 19 nucleotides in length and an antisense strand is 21 nucleotides in length.

The sense strand and/or the antisense strand may optionally and independently contain an additional 1, 2, 3, 4, 5, or 6 nucleotides (extension) at the 3′ end, the 5′ end, or both the 3′ and 5′ ends of the core sequences. The antisense strand additional nucleotides, if present, may or may not be complementary to the corresponding sequence in the LPA mRNA. The sense strand additional nucleotides, if present, may or may not be identical to the corresponding sequence in the LPA mRNA. The antisense strand additional nucleotides, if present, may or may not be complementary to the corresponding sense strand's additional nucleotides, if present.

As used herein, an extension comprises 1, 2, 3, 4, 5, or 6 nucleotides at the 5′ and/or 3′ end of the sense strand core sequence and/or antisense strand core sequence. The extension nucleotides on a sense strand may or may not be complementary to nucleotides, either core sequence nucleotides or extension nucleotides, in the corresponding antisense strand. Conversely, the extension nucleotides on an antisense strand may or may not be complementary to nucleotides, either core sequence nucleotides or extension nucleotides, in the corresponding sense strand. In some embodiments, both the sense strand and the antisense strand of an RNAi agent contain 3′ and 5′ extensions. In some embodiments, one or more of the 3′ extension nucleotides of one strand base pairs with one or more 5′ extension nucleotides of the other strand. In other embodiments, one or more of 3′ extension nucleotides of one strand do not base pair with one or more 5′ extension nucleotides of the other strand. In some embodiments, an LPA RNAi agent has an antisense strand having a 3′ extension and a sense strand having a 5′ extension.

In some embodiments an LPA RNAi agent comprises an antisense strand having a 3′ extension of 1, 2, 3, 4, 5, or 6 nucleotides in length. In other embodiments, an LPA RNAi agent comprises an antisense strand having a 3′ extension of 1, 2, or 3 nucleotides in length. In some embodiments, one or more of the antisense strand extension nucleotides comprise uracil or thymidine nucleotides or nucleotides which are complementary to the corresponding LPA mRNA sequence. In some embodiments, a 3′ antisense strand extension includes or consists of, but is not limited to: Ab, AbAb, AUA, UGCUU, CUG, UG, UGCC, CUGCC, CGU, CUU, UGCCUA, CUGCCU, UGCCU, UGAUU, GCCUAU, T, TT (each listed 5′ to 3′).

In some embodiments, an LPA RNAi agent comprises an antisense strand having a 5′ extension of 1, 2, 3, 4, or 5 nucleotides in length. In other embodiments, an LPA RNAi agent comprises an antisense strand having a 5′ extension of 1 or 2 nucleotides in length. In some embodiments, one or more of the antisense strand extension nucleotides comprises uracil or thymidine nucleotides or nucleotides which are complementary to the corresponding LPA mRNA sequence. In some embodiments, the 5′ antisense strand extension includes or consists of, but is no limited to, UA, TU, U, T, CUC (each listed 5′ to 3′). An antisense strand may have any of the 3′ extensions described above in combination with any of the 5′ antisense strand extensions described, if present.

In some embodiments, an LPA RNAi agent comprises a sense strand having a 3′ extension of 1, 2, 3, 4, or 5 nucleotides in length. In some embodiments, one or more of the sense strand extension nucleotides comprises adenosine, uracil, or thymidine nucleotides, AT dinucleotide, or nucleotides which correspond to nucleotides in the LPA mRNA sequence. In some embodiments, the 3′ sense strand extension includes or consists of, but is no limited to: T, UUAb, UAb, Ab, UT, TT, UUT, TTT, or TTTT (each listed 5′ to 3′).

In some embodiments, an LPA RNAi agent comprises a sense strand having a 5′ extension of 1, 2, 3, 4, 5, or 6 nucleotides in length. In some embodiments, one or more of the sense strand extension nucleotides comprise uracil or adenosine nucleotides or nucleotides which correspond to nucleotides in the LPA mRNA sequence. In some embodiments, the sense strand 5′ extension can be, but is not limited to: CA, AUAGGC, AUAGG, AUAG, AUA, A, AA, AC, GCA, GGCA, GGC, UAUCA, UAUC, Ab, UCA, UAU (each listed 5′ to 3′). A sense strand may have a 3′ extension and/or a 5′ extension.

Examples of nucleotide sequences used in forming LPA RNAi agents are provided in Tables 1, 2A, 2B, 3A, and 3B. As used herein, the term “sequence” or “nucleotide sequence” refers to a succession or order of nucleobases, nucleotides, and/or nucleosides, whether modified or unmodified, described with a succession of letters using the standard nucleotide nomenclature and the key for modified nucleotides described herein.

RNAi agents include, but are not limited to: short interfering RNAs (siRNAs), double-strand RNAs (dsRNA), micro RNAs (miRNAs), short hairpin RNAs (shRNA), and dicer substrates (e.g., U.S. Pat. Nos. 8,084,599, 8,349,809, and 8,513,207).

Unmodified LPA RNAi agent sense strand and antisense strand sequences are provided in Table 1. In forming LPA RNAi agents, each of the nucleotides in each of the sequences listed in Table 1 may be a modified nucleotide.

TABLE 1
Unmodified LPA RNAi agent antisense strand
and sense strand sequences.
Antisense strand base SEQ Sense strand base SEQ
sequence 5′→3′ ID NO. sequence 5′→3′ ID NO.
TCGGCAGUCCCUUCUGCGUTT    1 ACGCAGAAGGGACUGCCGAT  190
TGUAGCACUCCUGCACCCCTT    2 GGGGUGCAGGAGUGCUACAT  191
TAAUAAGGGGCUGCCACAGTT    3 CUGUGGCAGCCCCUUAUUAT  192
TUAACAAUAAGGGGCUGCCTT    4 GGCAGCCCCUUAUUGUUAAT  193
TGUAUAACAAUAAGGGGCUTT    5 AGCCCCUUAUUGUUAUACAT  194
TCGUAUAACAAUAAGGGGCTT    6 GCCCCUUAUUGUUAUACGAT  195
TCGUCUGAGCAUUGUGUCATT    7 UGACACAAUGCUCAGACGAT  196
TGCGUCUGAGCAUUGUGUCTT    8 GACACAAUGCUCAGACGCAT  197
TUGCGUCUGAGCAUUGUGUTT    9 ACACAAUGCUCAGACGCAAT  198
TUCUGCGUCUGAGCAUUGUTT   10 ACAAUGCUCAGACGCAGAAT  199
TGGAUCUGGAUUUCGGCAGTT   11 CUGCCGAAAUCCAGAUCCAT  200
TCAGGAUCUGGAUUUCGGCTT   12 GCCGAAAUCCAGAUCCUGAT  201
TCAUCUGAGCAUCGUGUCATT   13 UGACACGAUGCUCAGAUGAT  202
TGCAUCUGAGCAUCGUGUCTT   14 GACACGAUGCUCAGAUGCAT  203
TUGCAUCUGAGCAUCGUGUTT   15 ACACGAUGCUCAGAUGCAAT  204
TUCUGCAUCUGAGCAUCGUTT   16 ACGAUGCUCAGAUGCAGAAT  205
TAAAGCCUCUAGGCUUGGATT   17 UCCAAGCCUAGAGGCUUUAT  206
TGUACCCCGGGGGUUUCCUTT   18 AGGAAACCCCCGGGGUACAT  207
TUGUACCCCGGGGGUUUCCTT   19 GGAAACCCCCGGGGUACAAT  208
TCUGUACCCCGGGGGUUUCTT   20 GAAACCCCCGGGGUACAGAT  209
TUCCAUAAUGGUAGUAGCATT   21 UGCUACUACCAUUAUGGAAT  210
TGUCCAUAAUGGUAGUAGCTT   22 GCUACUACCAUUAUGGACAT  211
TCUCUGUCCAUAAUGGUAGTT   23 CUACCAUUAUGGACAGAGAT  212
TCGACUAUGCUGGUGUGGUTT   24 ACCACACCAGCAUAGUCGAT  213
TCCGACUAUGCUGGUGUGGTT   25 CCACACCAGCAUAGUCGGAT  214
TUCCGACUAUGCUGGUGUGTT   26 CACACCAGCAUAGUCGGAAT  215
TGGUCCGACUAUGCUGGUGTT   27 CACCAGCAUAGUCGGACCAT  216
TUUUCUGGGGUCCGACUAUTT   28 AUAGUCGGACCCCAGAAAAT  217
TUUUUCUGGGGUCCGACUATT   29 UAGUCGGACCCCAGAAAAAT  218
TGCGAAUCUCAGCAUCUGGTT   30 CCAGAUGCUGAGAUUCGCAT  219
TCCAAGGGCGAAUCUCAGCTT   31 GCUGAGAUUCGCCCUUGGAT  220
TACCAAGGGCGAAUCUCAGTT   32 CUGAGAUUCGCCCUUGGUAT  221
TCACCAAGGGCGAAUCUCATT   33 UGAGAUUCGCCCUUGGUGAT  222
TACACCAAGGGCGAAUCUCTT   34 GAGAUUCGCCCUUGGUGUAT  223
TCCUGACACUGGGAUCCAUTT   35 AUGGAUCCCAGUGUCAGGAT  224
TUGCAAGGACACUUGAUUCTT   36 GAAUCAAGUGUCCUUGCAAT  225
TUUGCAAGGACACUUGAUUTT   37 AAUCAAGUGUCCUUGCAAAT  226
TUUGCUCCGUUGGUGCUUCTT   38 GAAGCACCAACGGAGCAAAT  227
TAAUGAGCCUCGAUAACUCTT   39 GAGUUAUCGAGGCUCAUUAT  228
TGAAUGAGCCUCGAUAACUTT   40 AGUUAUCGAGGCUCAUUCAT  229
TGGAUAAUAUUCUGUUGUCTT   41 GACAACAGAAUAUUAUCCAT  230
TCCAUGGUAUAACACCAAGTT   42 CUUGGUGUUAUACCAUGGAT  231
TGAUCCAUGGUAUAACACCTT   43 GGUGUUAUACCAUGGAUCAT  232
TAUUGGGAUCCAUGGUAUATT   44 UAUACCAUGGAUCCCAAUAT  233
TCAUUGGGAUCCAUGGUAUTT   45 AUACCAUGGAUCCCAAUGAT  234
TACAUUGGGAUCCAUGGUATT   46 UACCAUGGAUCCCAAUGUAT  235
TGACAUUGGGAUCCAUGGUTT   47 ACCAUGGAUCCCAAUGUCAT  236
TGACAUUGUGUCAGGUUGCTT   48 GCAACCUGACACAAUGUCAT  237
TCACUGGACAUUGUGUCAGTT   49 CUGACACAAUGUCCAGUGAT  238
TACUUGAUUCUGUCACUGGTT   50 CCAGUGACAGAAUCAAGUAT  239
TGAGAAUGAGCCUCGAUAATT   51 UUAUCGAGGCUCAUUCUCAT  240
TCCAUUUGGGUAGUAUUCUTT   52 AGAAUACUACCCAAAUGGAT  241
TCACCAUUUGGGUAGUAUUTT   53 AAUACUACCCAAAUGGUGAT  242
TCCACCAUUUGGGUAGUAUTT   54 AUACUACCCAAAUGGUGGAT  243
TAUAACACCAAGGGCGAAUTT   55 AUUCGCCCUUGGUGUUAUAT  244
TACUGGGAUCCAUGGUAUATT   56 UAUACCAUGGAUCCCAGUAT  245
TCACUGGGAUCCAUGGUAUTT   57 AUACCAUGGAUCCCAGUGAT  246
TACCACCGUGGGAGUUGUGTT   58 CACAACUCCCACGGUGGUAT  247
TCAAGACUGACAUGUUCUUTT   59 AAGAACAUGUCAGUCUUGAT  248
TGGGAGUUGUGAGGACACUTT   60 AGUGUCCUCACAACUCCCAT  249
TUCUCAGGUGGUGCUUGUUTT   61 AACAAGCACCACCUGAGAAT  250
TCACAGGGCUUUUCUCAGGTT   62 CCUGAGAAAAGCCCUGUGAT  251
TGAUGCCAGUGUGGUAUCATT   63 UGAUACCACACUGGCAUCAT  252
TUGAUGCCAGUGUGGUAUCTT   64 GAUACCACACUGGCAUCAAT  253
TGACACCUGAUUCUGUUUCTT   65 GAAACAGAAUCAGGUGUCAT  254
TGGACACCUGAUUCUGUUUTT   66 AAACAGAAUCAGGUGUCCAT  255
TCUAGGACACCUGAUUCUGTT   67 CAGAAUCAGGUGUCCUAGAT  256
TAUAAGGGGCUGCCACAGGTT   68 CCUGUGGCAGCCCCUUAUAT  257
TAACAAUAAGGGGCUGCCATT   69 UGGCAGCCCCUUAUUGUUAT  258
TGUCCGACUAUGCUGGUGUTT   70 ACACCAGCAUAGUCGGACAT  259
TUCUCAGCAUCUGGAUUCCTT   71 GGAAUCCAGAUGCUGAGAAT  260
TCGAAUCUCAGCAUCUGGATT   72 UCCAGAUGCUGAGAUUCGAT  261
TAAGGGCGAAUCUCAGCAUTT   73 AUGCUGAGAUUCGCCCUUAT  262
TUGACACUGGGAUCCAUGGTT   74 CCAUGGAUCCCAGUGUCAAT  263
TCCGUUGGUGCUUCUUCAGTT   75 CUGAAGAAGCACCAACGGAT  264
TCUUGAUUCUGUCACUGGATT   76 UCCAGUGACAGAAUCAAGAT  265
TCACCGUGGGAGUUGUGAGTT   77 CUCACAACUCCCACGGUGAT  266
TUCUAGGACACCUGAUUCUTT   78 AGAAUCAGGUGUCCUAGAAT  267
TAGUCUCUAGGACACCUGATT   79 UCAGGUGUCCUAGAGACUAT  268
TCAAUAAGGGGCUGCCACATT   80 UAUAGCCCCUUAUUGUUAUACAT  269
TCUGCGUCUGAGCAUUGUGTT   81 UAUGCCCCUUAUUGUUAUACGAT  270
TACAGGAUCUGGAUUUCGGTT   82 UAUGACACAAUGCUCAGACGCAT  271
TCCGGGGGUUUCCUCAGUCTT   83 UAUACACAAUGCUCAGACGCAAT  272
TUGUCCAUAAUGGUAGUAGTT   84 UAUUUAUCGAGGCUCAUUCUCAT  273
TUCUGUCCAUAAUGGUAGUTT   85 UAUGAAACAGAAUCAGGUGUCAT  274
TACUCUGUCCAUAAUGGUATT   86 UAUACACCAGCAUAGUCGGACAT  275
TAACUCUGUCCAUAAUGGUTT   87 UAUUCCAGAUGCUGAGAUUCGAT  276
TGGGCGAAUCUCAGCAUCUTT   88 UAUAUGCUGAGAUUCGCCCUUAT  277
TAGGGCGAAUCUCAGCAUCTT   89 UAUCCAUGGAUCCCAGUGUCAAT  278
TAACACCAAGGGCGAAUCUTT   90 UGUGGCAGCCCCUUAUUGAT  279
TAGGACACUUGAUUCUGUCTT   91 CACAAUGCUCAGACGCAGAT  280
TGGACCAAGACUGACAUGUTT   92 CCGAAAUCCAGAUCCUGUAT  281
TGGUCAGGCCACCAUUUGGTT   93 GACUGAGGAAACCCCCGGAT  282
TAUCCAUGGUAUAACACCATT   94 CUACUACCAUUAUGGACAAT  283
TGGGAUCCAUGGUAUAACATT   95 ACUACCAUUAUGGACAGAAT  284
TUGGACAUUGUGUCAGGUUTT   96 UACCAUUAUGGACAGAGUAT  285
TAUUCUGUCACUGGACAUUTT   97 ACCAUUAUGGACAGAGUUAT  286
TGGUGCUUGUUCAGAAACATT   98 AGAUGCUGAGAUUCGCCCAT  287
TGGAGAAUGAGCCUCGAUATT   99 GAUGCUGAGAUUCGCCCUAT  288
TGUGGAGAAUGAGCCUCGATT  100 AGAUUCGCCCUUGGUGUUAT  289
TCCGUGGGAGUUGUGAGGATT  101 GACAGAAUCAAGUGUCCUAT  290
TGGACCACCGUGGGAGUUGTT  102 ACAUGUCAGUCUUGGUCCAT  291
TUGCUUGUUCAGAAGGAGCTT  103 CCAAAUGGUGGCCUGACCAT  292
TCUGAUGCCAGUGUGGUAUTT  104 UGGUGUUAUACCAUGGAUAT  293
TUAGGACACCUGAUUCUGUTT  105 UGUUAUACCAUGGAUCCCAT  294
TCUCUAGGACACCUGAUUCTT  106 AACCUGACACAAUGUCCAAT  295
TUCUCUAGGACACCUGAUUTT  107 AAUGUCCAGUGACAGAAUAT  296
TGUCUCUAGGACACCUGAUTT  108 UGUUUCUGAACAAGCACCAT  297
TGAGAAUGAGCCUCGAUAACUCUUAU  109 UAUCGAGGCUCAUUCUCCAT  298
TGACACCUGAUUCUGUUUCUGAGUAU  110 UCGAGGCUCAUUCUCCACAT  299
TCGUAUAACAAUAAGGGGCUGCCUAU  111 UCCUCACAACUCCCACGGAT  300
TGCGUCUGAGCAUUGUGUCAGGUUAU  112 CAACUCCCACGGUGGUCCAT  301
TUGCGUCUGAGCAUUGUGUCAGGUAU  113 GCUCCUUCUGAACAAGCAAT  302
TAAGGGCGAAUCUCAGCAUCUGGUAU  114 AUACCACACUGGCAUCAGAT  303
UUAACAAUAAGGGGCUGCAb  115 ACAGAAUCAGGUGUCCUAAT  304
UGUAUAACAAUAAGGGGCAb  116 GAAUCAGGUGUCCUAGAGAT  305
UCGUAUAACAAUAAGGGGAb  117 AAUCAGGUGUCCUAGAGAAT  306
UGCGUCUGAGCAUUGUGUAb  118 AUCAGGUGUCCUAGAGACAT  307
UUGCGUCUGAGCAUUGUGAb  119 UAUAUAGUUAUCGAGGCUCAUUCUCA  308
UCAGGAUCUGGAUUUCGGAb  120 UAUAUCAGAAACAGAAUCAGGUGUCA  309
UUGCAUCUGAGCAUCGUGAb  121 UAUAUCAGCCCCUUAUUGUUAUACGA  310
UCGACUAUGCUGGUGUGGAb  122 UAUAUCUGACACAAUGCUCAGACGCA  311
UUUUCUGGGGUCCGACUAAb  123 UAUAUUGACACAAUGCUCAGACGCAA  312
UGCGAAUCUCAGCAUCUGAb  124 UAUAUAGAUGCUGAGAUUCGCCCUUA  313
UUGCAAGGACACUUGAUUAb  125 GCAGCCCCUUAUUGUUAA  314
UAAUGAGCCUCGAUAACUAb  126 GCCCCUUAUUGUUAUACA  315
UGAAUGAGCCUCGAUAACAb  127 CCCCUUAUUGUUAUACGA  316
UGACAUUGUGUCAGGUUGAb  128 ACACAAUGCUCAGACGCA  317
UGAGAAUGAGCCUCGAUAAb  129 CACAAUGCUCAGACGCAA  318
UCCAUUUGGGUAGUAUUCAb  130 CCGAAAUCCAGAUCCUGA  319
UCACCAUUUGGGUAGUAUAb  131 CACGAUGCUCAGAUGCAA  320
UGACACCUGAUUCUGUUUAb  132 CCACACCAGCAUAGUCGA  321
UGGACACCUGAUUCUGUUAb  133 UAGUCGGACCCCAGAAAA  322
UUAACAAUAAGGGGCUGAbAb  134 CAGAUGCUGAGAUUCGCA  323
UGUAUAACAAUAAGGGGAbAb  135 AAUCAAGUGUCCUUGCAA  324
UCGUAUAACAAUAAGGGAbAb  136 AGUUAUCGAGGCUCAUUA  325
UGCGUCUGAGCAUUGUGAbAb  137 GUUAUCGAGGCUCAUUCA  326
UUGCGUCUGAGCAUUGUAbAb  138 CAACCUGACACAAUGUCA  327
UCAGGAUCUGGAUUUCGAbAb  139 UAUCGAGGCUCAUUCUCA  328
UUGCAUCUGAGCAUCGUAbAb  140 GAAUACUACCCAAAUGGA  329
UCGACUAUGCUGGUGUGAbAb  141 AUACUACCCAAAUGGUGA  330
UUUUCUGGGGUCCGACUAbAb  142 AAACAGAAUCAGGUGUCA  331
UGCGAAUCUCAGCAUCUAbAb  143 AACAGAAUCAGGUGUCCA  332
UUGCAAGGACACUUGAUAbAb  144 CAGCCCCUUAUUGUUAA  333
UAAUGAGCCUCGAUAACAbAb  145 CCCCUUAUUGUUAUACA  334
UGAAUGAGCCUCGAUAAAbAb  146 CCCUUAUUGUUAUACGA  335
UGACAUUGUGUCAGGUUAbAb  147 CACAAUGCUCAGACGCA  336
UGAGAAUGAGCCUCGAUAbAb  148 ACAAUGCUCAGACGCAA  337
UCCAUUUGGGUAGUAUUAbAb  149 CGAAAUCCAGAUCCUGA  338
UCACCAUUUGGGUAGUAAbAb  150 ACGAUGCUCAGAUGCAA  339
UGACACCUGAUUCUGUUAbAb  151 CACACCAGCAUAGUCGA  340
UGGACACCUGAUUCUGUAbAb  152 AGUCGGACCCCAGAAAA  341
UGAGAAUGAGCCUCGAUAACUCUUAU  153 AGAUGCUGAGAUUCGCA  342
UGACACCUGAUUCUGUUUCUGAGUAU  154 AUCAAGUGUCCUUGCAA  343
UGAGAAUGAGCCUCGAUAACUCTUAU  155 GUUAUCGAGGCUCAUUA  344
UCGUAUAACAAUAAGGGGCUGCCUAU  156 UUAUCGAGGCUCAUUCA  345
UGAGAAUGAGCCUCGAUAATT  157 AACCUGACACAAUGUCA  346
UCGUAUAACAAUAAGGCGCUGCCUAU  158 AUCGAGGCUCAUUCUCA  347
UGAGAAUGAGCCUCGATAbAb  159 AAUACUACCCAAAUGGA  348
UGACACCUGAUUCUGTTAbAb  160 UACUACCCAAAUGGUGA  349
UCGUAUAACAAUAAGGGGCUGAUU  161 AACAGAAUCAGGUGUCA  350
UCGUAUAACAAUAAGGGGCUGCUU  162 ACAGAAUCAGGUGUCCA  351
UGAGAAUGAGCCUCGAUAACUCUU  163 UAUAUCAGCGCCUUAUUGUUAUACGA  352
UCGUAUAACAAUAAGGGGCUU  164 ATCGAGGCUCAUUCUCA  353
UGUAUAACAAUAAGGGG  165 UCAGCCCCUUAUUGUUAUACGAUUAb  354
UCGUAUAACAAUAAGGG  166 UcAGccccuuAuuGuuAuAcGAAb  355
UGAGAAUGAGCCUCGAT  167 UAGUUAUCGAGGCUCAUUCUCAUUAb  356
UGACACCUGAUUCUGTT  168 AbGCCCCUUAUUGUUAUACGAUUAb  357
TUCGUAUAACAAUAAGGGGCUGCCUA  169 AUAUCAGCCCCUUAUUGUUAUACGAT  358
UAUCGUAUAACAAUAAGGGGCUGCCU  170 UAUCAGCCCCUUAUUGUUAUACGAUT  359
TCCGUAUAACAAUAAGGGGCUGCCUA  171 AUAUAGUUAUCGAGGCUCAUUCUCAT  360
CUCCGUAUAACAAUAAGGGGCUGCCU  172 UAUAGUUAUCGAGGCUCAUUCUCAUT  361
TUGAGAAUGAGCCUCGAUAACUCUUA  173 AbUUAUCGAGGCUCAUUCUCAUUAb  362
UAUGAGAAUGAGCCUCGAUAACUCUU  174 UAUAUAAUUAUCGAGGCUCAUUCUCAAb  363
TGGAGAAUGAGCCUCGAUAACUCUUA  175 GGCAGCCCCUUAUUGUUAUACGATT  364
GUGGAGAAUGAGCCUCGAUAACUCUU  176 GGCAGCCCCUUAUUGUUAUACGAUUT  365
UGAGAAUGAGCCUCGAUAAUU  177 CAGCCCCUUAUUGUUAUACGATTTT  366
TCGUAUAACAAUAAGGGGCUU  178 GCGAUAGUUAUCGAGGCUCAUUCUCA  367
UGAGAAUGAGCCUCGAUAAUUAUAUA  179 UGAAUAGUUAUCGAGGCUCAUUCUCA  368
UCGUAUAACAAUAAGGGGCUGCC  180 AUCGUAGUUAUCGAGGCUCAUUCUCA  369
TUCGUAUAACAAUAAGGGGCUGCC  181 UAUAAAGUUAUCGAGGCUCAUUCUCA  370
TUCGUAUAACAAUAAGGGGCUG  182 AGCCCCUUAUUGUUAUACGAAb  371
UGAGAAUGAGCCUCGAUAACUAUCGC  183 AAGCCCCUUAUUGUUAUACGAAb  372
UGAGAAUGAGCCUCGAUAACUAUUCA  184 GCAGCCCCUUAUUGUUAUACGAAb  373
UGAGAAUGAGCCUCGAUAACUACGAU  185 UAUAUAGUUAUCGAGGCUCAUUCUCAAb  374
UCGUAUAACAAUAAGGGGCGU  186 ACGCCCCUUAUUGUUAUACGAAb  375
UCGUAUAACAAUAAGGGGCUGCCU  187 GccccuuAuuGuuAuAcGAuuAb  376
UCGUAUAACAAUAAGGGGCUG  188 AGCCCCUUAUUGUUAUACGAUUAb  377
TCGUAUAACAAUAAGGGGCUGCUU  189 AAGccccuuAuuGuuAuAcGAuuAb  378
TCGUAUAACAAUAAGGGGC 1242 UAUCAGCCCCUUAUUGUUAUACGA  379
UCGUAUAACAAUAAGGGG 1244 UAGCAGCCCCUUAUUGUUAUACGA  380
UCGUAUAACAAUAAGGG 1246 GCAGCCCCUUAUUGUUAUACGA  381
TGAGAAUGAGCCUCGAUAA 1248 AUAAGAGUUAUCGAGGCUCAUUCUCA  382
UGAGAAUGAGCCUCGAUA 1250 AUAGGCAGCCCCUUAUUGUUAUACGA  383
UGAGAAUGAGCCUCGAU 1252 CAGCCCCUUAUUGUUAUACGA  384
UGUAUAACAAUAAGGGG 1254 UAUAUCAGCCCCTUAUUGUUAUACGA  385
CGUAUAACAAUAAGGGGC 1280 AbGCCCCTUAUUGUUAUACGAUUAb 1241
GAGAAUGAGCCUCGAUAA 1281 GCCCCUUAUUGUUAUACGA 1243
UCGUAUAACAAUAAGGGGC 1282 CCCCUUAUUGUUAUACGA 1245
UGAGAAUGAGCCUCGAUAA 1283 CCCUUAUUGUUAUACGA 1247
UUAUCGAGGCUCAUUCUCA 1249
UAUCGAGGCUCAUUCUCA 1251
AUCGAGGCUCAUUCUCA 1253
CCCCUUAUUGUUAUACA 1255
UUAUCGAGGCUCAUUCUCA 1258
GCCCCUUAUUGUUAUACGA 1259
ACAGCCCCUUAUUGUUAUACGA 1260
AAAGCCCCUUAUUGUUAUACGA 1261
GCCCCUUAUUGUUAUACG 1284
UUAUCGAGGCUCAUUCUC 1285
Ab = abasic nucleotide

The LPA RNAi agents described herein are formed by annealing an antisense strand with a sense strand. A sense strand containing a sequence listed in Table 1 or Table 2B can be hybridized to any antisense strand containing a sequence listed in Table 1 or Table 2A provided the two sequences have a region of at least 90% complementarity over a contiguous 16, 17, 18, 19, 20, or 21 nucleotide sequence.

In some embodiments, an LPA RNAi agent antisense strand comprises a nucleotide sequence of any of the sequences in Table 1. In some embodiments, an LPA RNAi agent antisense strand comprises the sequence of nucleotides 1-17, 2-17, 1-18, 2-18, 1-19, 2-19, 1-20, 2-20, 1-21, 2-21, 1-22, 2-22, 1-23, 2-23, 1-24, 2-24, 1-25, 2-25, 1-26, or 2-26 of any of the sequences in Table 1. In some embodiments, an LPA RNAi agent sense strand comprises the nucleotide sequence of any of the sequences in Tables 1. In some embodiments, an LPA RNAi agent sense strand comprises the sequence of nucleotides 1-17, 2-17, 1-18, 2-18, 1-19, 2-19, 1-20, 2-20, 1-21, 2-21, 1-22, 2-22, 1-23, 2-23, 1-24, 2-24, 1-25, 2-25, 1-26, or 2-26 of any of the sequences in Table 1.

In some embodiments, the sense and antisense strands of the RNAi agents described herein contain the same number of nucleotides. In some embodiments the sense and antisense strands of the RNAi agents described herein contain different numbers of nucleotides. In some embodiments, the sense strand 5′ end and the antisense strand 3′ end of an RNAi agent form a blunt end. In some embodiments, the sense strand 3′ end and the antisense strand 5′ end of an RNAi agent form a blunt end. In some embodiments, both ends of an RNAi agent form blunt ends. In some embodiments, neither end of an RNAi agent is blunt-ended. As used herein a blunt end refers to an end of a double stranded RNAi agent in which the terminal nucleotides of the two annealed strands are complementary (form a complementary base-pair). In some embodiments, the sense strand 5′ end and the antisense strand 3′ end of an RNAi agent form a frayed end. In some embodiments, the sense strand 3′ end and the antisense strand 5′ end of an RNAi agent form a frayed end. In some embodiments, both ends of an RNAi agent form a frayed end. In some embodiments, neither end of an RNAi agent is a frayed end. As used herein a frayed end refers to an end of a double stranded RNAi agent in which the terminal nucleotides of the two annealed strands from a pair (i.e. do not form an overhang) but are not complementary (i.e. form a non-complementary pair). As used herein, an overhang is a stretch of one or more unpaired nucleotides at the end of one strand of a double stranded RNAi agent.

The unpaired nucleotides may be on the sense strand or the antisense strand, creating either 3′ or 5′ overhangs. In some embodiments the RNAi agent contains: a blunt end and a frayed end, a blunt end and 5′ overhang end, a blunt end and a 3′ overhang end, a frayed end and a 5′ overhang end, a frayed end and a 3′ overhang end, two 5′ overhang ends, two 3′ overhang ends, a 5′ overhang end and a 3′ overhang end, two frayed ends, or two blunt ends.

A nucleotide base (or nucleobase) is a heterocyclic pyrimidine or purine compound which is a constituent of all nucleic acids and includes adenine (A), guanine (G), cytosine (C), thymine (T), and uracil (U). As used herein, the term “nucleotide” can include a modified nucleotide or nucleotide mimic, abasic site (Ab or X), or a surrogate replacement moiety.

In some embodiments, an LPA RNAi agent is prepared or provided as a salt, mixed salt, or a free-acid.

Modified Nucleotides

In some embodiments, an LPA RNAi agent contains one or more modified nucleotides. As used herein, a “modified nucleotide” is a nucleotide other than a ribonucleotide (2′-hydroxyl nucleotide). In some embodiments, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or 100% of the nucleotides are modified. Modified nucleotides include, but are not limited to, deoxynucleotides, nucleotide mimics, abasic nucleotides (represented herein as X, Ab), 2′-modified nucleotides, 3′ to 3′ linkages (inverted) nucleotides (represented herein as invdN, invN, invn, invX, invAb, non-natural base-comprising nucleotides, bridged nucleotides, peptide nucleic acids (PNAs), 2′,3′-seco nucleotide mimics (unlocked nucleobase analogues, represented herein as NUNA or NUNA), locked nucleotides (represented herein as NLNA or NLNA), 3′-O-Methoxy (2′ internucleoside linked) nucleotides (represented herein as 3′-OMen), 2′-F-Arabino nucleotides (represented herein as NfANA or NfANA), 5′-Me,2′-fluoro nucleotide (represented herein as 5Me-Ne, morpholino nucleotides, vinyl phosphonate deoxyribonucleotides (represented herein as vpdN), vinyl phosphonate containing nucleotides, and cyclopropyl phosphonate containing nucleotides (cPrpN). 2′-modified nucleotides (i.e. a nucleotide with a group other than a hydroxyl group at the 2′ position of the five-membered sugar ring) include, but are not limited to, 2′-O-methyl nucleotides (represented herein as a lower case letter ‘n’ in a nucleotide sequence), 2′-deoxy-2′-fluoro nucleotides (represented herein as Nf, also represented herein as 2′-fluoro nucleotide), 2′-deoxy nucleotides (represented herein as dN), 2′-methoxyethyl (2′-O-2-methoxylethyl) nucleotides (represented herein as NM or 2′-MOE), 2′-amino nucleotides, and 2′-alkyl nucleotides. It is not necessary for all positions in a given compound to be uniformly modified. Conversely, more than one modification may be incorporated in a single LPA RNAi agent or even in a single nucleotide thereof. The LPA RNAi agent sense strands and antisense strands may be synthesized and/or modified by methods known in the art. Modification at one nucleotide is independent of modification at another nucleotide.

Modified nucleotides also include nucleotides having modified nucleobases. Modified nucleobases include, but are not limited to, synthetic and natural nucleobases, 5-substituted pyrimidines, 6-azapyrimidines and N-2, N-6 and 0-6 substituted purines, including 2-aminopropyladenine, 5-propynyluracil and 5-propynylcytosine, 5-methylcytosine (5-me-C), 5-hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-halouracil and cytosine, 5-propynyl uracil and cytosine, 6-azo uracil, cytosine and thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl and other 8-substituted adenines and guanines, 5-halo particularly 5-bromo, 5-trifluoromethyl and other 5-substituted uracils and cytosines, 7-methylguanine and 7-methyladenine, 8-azaguanine and 8-azaadenine, 7-deazaguanine and 7-deazaadenine and 3-deazaguanine and 3-deazaadenine.

Modified Internucleoside Linkages

In some embodiments, one or more nucleotides of an LPA RNAi agent are linked by non-standard linkages or backbones (i.e. modified internucleoside linkages or modified backbones). In some embodiments, a modified internucleoside linkage is a non-phosphate-containing covalent internucleoside linkage. Modified internucleoside linkages or backbones include, but are not limited to, 5′-phosphorothioate group (represented herein as a lower case ‘s’ before a nucleotide, as in sN, sn, sNf, or sdN), chiral phosphorothioates, thiophosphate, phosphorodithioates, phosphotriesters, aminoalkyl-phosphotriesters, methyl and other alkyl phosphonates including 3′-alkylene phosphonates and chiral phosphonates, phosphinates, phosphoramidates including 3′-amino phosphoramidate and aminoalkylphosphoramidates, thionophosphoramidates, thionoalkyl-phosphonates, thionoalkylphosphotriesters, morpholino linkages, and boranophosphates having normal 3′-5′ linkages, 2′-5′ linked analogs of these, and those having inverted polarity wherein the adjacent pairs of nucleoside units are linked 3′-5′ to 5′-3′ or 2′-5′ to 5′-2′. In other embodiments, a modified internucleoside linkage or backbone lacks a phosphorus atom. Modified internucleoside linkages lacking a phosphorus atom include, but are not limited to, short chain alkyl or cycloalkyl inter-sugar linkages, mixed heteroatom and alkyl or cycloalkyl inter-sugar linkages, or one or more short chain heteroatomic or heterocyclic inter-sugar linkages. In some embodiments, modified internucleoside backbones include, but are not limited to, siloxane backbones, sulfide, sulfoxide and sulfone backbones; formacetyl and thioformacetyl backbones, methylene formacetyl and thioformacetyl backbones, alkene containing backbones, sulfamate backbones, methyleneimino and methylenehydrazino backbones, sulfonate and sulfonamide backbones, amide backbones; and others having mixed N, O, S, and CH2 component parts.

In some embodiments, a sense strand of an LPA RNAi agent can contain 1, 2, 3, 4 phosphorothioate linkages, an antisense strand of an LPA RNAi agent can contain 1, 2, 3, or 4 phosphorothioate linkages, or both the sense strand and the antisense strand independently can contain 1, 2, 3, or 4 phosphorothioate linkages.

In some embodiments, an LPA RNAi agent sense strand contains two phosphorothioate internucleoside linkages. In some embodiments, the two phosphorothioate internucleoside linkages are between the nucleotides at positions 1-3 from the 3′ end of the sense strand. In some embodiments, the two phosphorothioate internucleoside linkages are between the nucleotides at positions 1-3, 2-4, 3-5, 4-6, 4-5, or 6-8 from the 5′ end of the sense strand. In some embodiments, an LPA RNAi agent antisense strand contains four phosphorothioate internucleoside linkages. In some embodiments, the four phosphorothioate internucleoside linkages are between the nucleotides at positions 1-3 from the 5′ end of the sense strand and between the nucleotides at positions 19-21, 20-22, 21-23, 22-24, 23-25, or 24-26 from the 5′ end. In some embodiments, an LPA RNAi agent contains two phosphorothioate internucleoside linkages in the sense strand and four phosphorothioate internucleoside linkages in the antisense strand.

In some embodiments, an LPA RNAi agent contains one or more modified nucleotides and one or more modified internucleoside linkages. In some embodiments, a 2′-modified nucleotide is combined with modified internucleoside linkage.

LPA RNAi Agents Having Modified Nucleotides

Examples of antisense strands containing modified nucleotides are provided in Table 2A. Examples of sense strands containing modified nucleotides are provided in Table 2B. In Tables 2A and 2B, the following notations are used to indicate modified nucleotides:

    • N=2′-OH (unmodified) ribonucleotide (capital letter without f or d indication)
    • n=2′-OMe modified nucleotide
    • Nf=2′-fluoro modified nucleotide
    • dN=2′-deoxy nucleotides
    • NUNA=2′,3′-seco nucleotide mimics (unlocked nucleobase analogs)
    • NINA=locked nucleotide
    • NfANA=2′-F-Arabino nucleotide
    • NM=2′-methoxyethyl nucleotide
    • Ab=abasic ribose
    • (invdN)=inverted deoxyribonucleotide (3′-3′ linked nucleotide)
    • (invAb)=inverted abasic nucleotide
    • (invn)=inverted 2′-OMe nucleotide
    • s=phosphorothioate linked nucleotide
    • p=phosphate
    • vpdN=vinyl phosphonate deoxyribonucleotide
    • (3′OMen)=3′-OMe nucleotide
    • (5Me-Nf)=5′-Me, 2′-fluoro nucleotide
    • cPrp=cyclopropyl phosphonate
    • epTcPr=see Table 4
    • epTM=see Table 4

In addition the following targeting groups and linking groups are listed in Tables 2A and 2B: (Alk-PEG5-C6), (C11-PEG5-NAG5), (C12), (C6-PEG4-NAG3), (C6-SS-Alk-Me), (Chol-TEG), (Dy540), (NAG13), (NAG18), (NAG24), (NAG25), (NAG26), (NAG27), (NAG28), (NAG29), (NAG30), (NAG31), (NAG32), (NAG33), (NAG34), (NAG35), (NAG36), (NAG37), (NAG4), (PAZ), (Sp18), (Steryl), (Alk-SMPT-C6). Each sense strand and/or antisense strand can have any of the above indicated targeting groups or linking groups, as well as other targeting or linking groups, conjugated to the 5′ and or 3′ end of the sequence. The chemical structures for these groups are provided in Table 4.

TABLE 2A
LPA RNAi agent antisense strands having modified nucleotides.
Antisense SEQ SEQ
Strand ID Antisense strand sequence 5′→3′ ID NO. ID NO.
AM01240-AS dTCfgGfcAfgUfcCfcUfuCfuGfcGfudTsdT  386   1
AM01241-AS dTGfuAfgCfaCfuCfcUfgCfaCfcCfcdTsdT  387   2
AM01242-AS dTAfaUfaAfgGfgGfcUfgCfcAfcAfgdTsdT  388   3
AM01243-AS dTUfaAfcAfaUfaAfgGfgGfcUfgCfcdTsdT  389   4
AM01244-AS dTGfuAfuAfaCfaAfuAfaGfgGfgCfudTsdT  390   5
AM01245-AS dTCfgUfaUfaAfcAfaUfaAfgGfgGfcdTsdT  391   6
AM01246-AS dTCfgUfcUfgAfgCfaUfuGfuGfuCfadTsdT  392   7
AM01247-AS dTGfcGfuCfuGfaGfcAfuUfgUfgUfcdTsdT  393   8
AM01248-AS dTUfgCfgUfcUfgAfgCfaUfuGfuGfudTsdT  394   9
AM01249-AS dTUfcUfgCfgUfcUfgAfgCfaUfuGfudTsdT  395  10
AM01250-AS dTGfgAfuCfuGfgAfuUfuCfgGfcAfgdTsdT  396  11
AM01251-AS dTCfaGfgAfuCfuGfgAfuUfuCfgGfcdTsdT  397  12
AM01252-AS dTCfaUfcUfgAfgCfaUfcGfuGfuCfadTsdT  398  13
AM01253-AS dTGfcAfuCfuGfaGfcAfuCfgUfgUfcdTsdT  399  14
AM01254-AS dTUfgCfaUfcUfgAfgCfaUfcGfuGfudTsdT  400  15
AM01255-AS dTUfcUfgCfaUfcUfgAfgCfaUfcGfudTsdT  401  16
AM01256-AS dTAfaAfgCfcUfcUfaGfgCfuUfgGfadTsdT  402  17
AM01257-AS dTGfuAfcCfcCfgGfgGfgUfuUfcCfudTsdT  403  18
AM01258-AS dTUfgUfaCfcCfcGfgGfgGfuUfuCfcdTsdT  404  19
AM01259-AS dTCfuGfuAfcCfcCfgGfgGfgUfuUfcdTsdT  405  20
AM01260-AS dTUfcCfaUfaAfuGfgUfaGfuAfgCfadTsdT  406  21
AM01261-AS dTGfuCfcAfuAfaUfgGfuAfgUfaGfcdTsdT  407  22
AM01262-AS dTCfuCfuGfuCfcAfuAfaUfgGfuAfgdTsdT  408  23
AM01263-AS dTCfgAfcUfaUfgCfuGfgUfgUfgGfudTsdT  409  24
AM01264-AS dTCfcGfaCfuAfuGfcUfgGfuGfuGfgdTsdT  410  25
AM01265-AS dTUfcCfgAfcUfaUfgCfuGfgUfgUfgdTsdT  411  26
AM01266-AS dTGfgUfcCfgAfcUfaUfgCfuGfgUfgdTsdT  412  27
AM01267-AS dTUfuUfcUfgGfgGfuCfcGfaCfuAfudTsdT  413  28
AM01268-AS dTUfuUfuCfuGfgGfgUfcCfgAfcUfadTsdT  414  29
AM01269-AS dTGfcGfaAfuCfuCfaGfcAfuCfuGfgdTsdT  415  30
AM01270-AS dTCfcAfaGfgGfcGfaAfuCfuCfaGfcdTsdT  416  31
AM01271-AS dTAfcCfaAfgGfgCfgAfaUfcUfcAfgdTsdT  417  32
AM01272-AS dTCfaCfcAfaGfgGfcGfaAfuCfuCfadTsdT  418  33
AM01273-AS dTAfcAfcCfaAfgGfgCfgAfaUfcUfcdTsdT  419  34
AM01274-AS dTCfcUfgAfcAfcUfgGfgAfuCfcAfudTsdT  420  35
AM01275-AS dTUfgCfaAfgGfaCfaCfuUfgAfuUfcdTsdT  421  36
AM01276-AS dTUfuGfcAfaGfgAfcAfcUfuGfaUfudTsdT  422  37
AM01277-AS dTUfuGfcUfcCfgUfuGfgUfgCfuUfcdTsdT  423  38
AM01278-AS dTAfaUfgAfgCfcUfcGfaUfaAfcUfcdTsdT  424  39
AM01279-AS dTGfaAfuGfaGfcCfuCfgAfuAfaCfudTsdT  425  40
AM01280-AS dTGfgAfuAfaUfaUfuCfuGfuUfgUfcdTsdT  426  41
AM01281-AS dTCfcAfuGfgUfaUfaAfcAfcCfaAfgdTsdT  427  42
AM01282-AS dTGfaUfcCfaUfgGfuAfuAfaCfaCfcdTsdT  428  43
AM01283-AS dTAfuUfgGfgAfuCfcAfuGfgUfaUfadTsdT  429  44
AM01284-AS dTCfaUfuGfgGfaUfcCfaUfgGfuAfudTsdT  430  45
AM01285-AS dTAfcAfuUfgGfgAfuCfcAfuGfgUfadTsdT  431  46
AM01286-AS dTGfaCfaUfuGfgGfaUfcCfaUfgGfudTsdT  432  47
AM01287-AS dTGfaCfaUfuGfuGfuCfaGfgUfuGfcdTsdT  433  48
AM01288-AS dTCfaCfuGfgAfcAfuUfgUfgUfcAfgdTsdT  434  49
AM01289-AS dTAfcUfuGfaUfuCfuGfuCfaCfuGfgdTsdT  435  50
AM01290-AS dTGfaGfaAfuGfaGfcCfuCfgAfuAfadTsdT  436  51
AM01291-AS dTCfcAfuUfuGfgGfuAfgUfaUfuCfudTsdT  437  52
AM01292-AS dTCfaCfcAfuUfuGfgGfuAfgUfaUfudTsdT  438  53
AM01293-AS dTCfcAfcCfaUfuUfgGfgUfaGfuAfudTsdT  439  54
AM01294-AS dTAfuAfaCfaCfcAfaGfgGfcGfaAfudTsdT  440  55
AM01295-AS dTAfcUfgGfgAfuCfcAfuGfgUfaUfadTsdT  441  56
AM01296-AS dTCfaCfuGfgGfaUfcCfaUfgGfuAfudTsdT  442  57
AM01297-AS dTAfcCfaCfcGfuGfgGfaGfuUfgUfgdTsdT  443  58
AM01298-AS dTCfaAfgAfcUfgAfcAfuGfuUfcUfudTsdT  444  59
AM01299-AS dTGfgGfaGfuUfgUfgAfgGfaCfaCfudTsdT  445  60
AM01300-AS dTUfcUfcAfgGfuGfgUfgCfuUfgUfudTsdT  446  61
AM01301-AS dTCfaCfaGfgGfcUfuUfuCfuCfaGfgdTsdT  447  62
AM01302-AS dTGfaUfgCfcAfgUfgUfgGfuAfuCfadTsdT  448  63
AM01303-AS dTUfgAfuGfcCfaGfuGfuGfgUfaUfcdTsdT  449  64
AM01304-AS dTGfaCfaCfcUfgAfuUfcUfgUfuUfcdTsdT  450  65
AM01305-AS dTGfgAfcAfcCfuGfaUfuCfuGfuUfudTsdT  451  66
AM01306-AS dTCfuAfgGfaCfaCfcUfgAfuUfcUfgdTsdT  452  67
AM01796-AS dTAfuAfaGfgGfgCfuGfcCfaCfaGfgdTsdT  453  68
AM01798-AS dTAfaCfaAfuAfaGfgGfgCfuGfcCfadTsdT  454  69
AM01800-AS dTGfuCfcGfaCfuAfuGfcUfgGfuGfudTsdT  455  70
AM01802-AS dTUfcUfcAfgCfaUfcUfgGfaUfuCfcdTsdT  456  71
AM01804-AS dTCfgAfaUfcUfcAfgCfaUfcUfgGfadTsdT  457  72
AM01806-AS dTAfaGfgGfcGfaAfuCfuCfaGfcAfudTsdT  458  73
AM01808-AS dTUfgAfcAfcUfgGfgAfuCfcAfuGfgdTsdT  459  74
AM01810-AS dTCfcGfuUfgGfuGfcUfuCfuUfcAfgdTsdT  460  75
AM01812-AS dTCfuUfgAfuUfcUfgUfcAfcUfgGfadTsdT  461  76
AM01814-AS dTCfaCfcGfuGfgGfaGfuUfgUfgAfgdTsdT  462  77
AM01816-AS dTUfcUfaGfgAfcAfcCfuGfaUfuCfudTsdT  463  78
AM01818-AS dTAfgUfcUfcUfaGfgAfcAfcCfuGfadTsdT  464  79
AM02003-AS dTGfuAfuAfaCfaAfuaaGfgGfgCfudTsdT  465 5
AM02004-AS dTGfuAfuAUNAaCfaAfuaaGfgGfgCfudTsdT  466 5
AM02005-AS dTGfuAfuAfAUNACfaAfuaaGfgGfgCfudTsdT  467 5
AM02007-AS dTCfgUfaUfaAfcAfauaAfgGfgGfcdTsdT  468 6
AM02008-AS dTCfgUfaUUNAaAfcAfauaAfgGfgGfcdTsdT  469 6
AM02009-AS dTCfgUfaUfAUNAAfcAfauaAfgGfgGfcdTsdT  470 6
AM02011-AS dTGfcGfuCfuGfaGfcauUfgUfgUfcdTsdT  471 8
AM02012-AS dTGfcGfuCUNAuGfaGfcauUfgUfgUfcdTsdT  472 8
AM02013-AS dTGfcGfuCfUUNAGfaGfcauUfgUfgUfcdTsdT  473 8
AM02015-AS dTUfgCfgUfcUfgAfgcaUfuGfuGfudTsdT  474 9
AM02016-AS dTUfgCfgUUNAcUfgAfgcaUfuGfuGfudTsdT  475 9
AM02017-AS dTUfgCfgUfCUNAUfgAfgcaUfuGfuGfudTsdT  476 9
AM02019-AS dTGfaGfaAfuGfaGfccuCfgAfuAfadTsdT  477  51
AM02020-AS dTGfaGfaAUNAuGfaGfccuCfgAfuAfadTsdT  478  51
AM02021-AS dTGfaGfaAfUUNAGfaGfccuCfgAfuAfadTsdT  479  51
AM02023-AS dTGfaCfaCfcUfgAfuucUfgUfuUfcdTsdT  480  65
AM02024-AS dTGfaCfaCUNAcUfgAfuucUfgUfuUfcdTsdT  481  65
AM02025-AS dTGfaCfaCfCUNAUfgAfuucUfgUfuUfcdTsdT  482  65
AM02027-AS dTGfuCfcGfaCfuAfugcUfgGfuGfudTsdT  483  70
AM02028-AS dTGfuCfcGUNAaCfuAfugcUfgGfuGfudTsdT  484  70
AM02029-AS dTGfuCfcGfAUNACfuAfugcUfgGfuGfudTsdT  485  70
AM02031-AS dTCfgAfaUfcUfcAfgcaUfcUfgGfadTsdT  486  72
AM02032-AS dTCfgAfaUUNAcUfcAfgcaUfcUfgGfadTsdT  487  72
AM02033-AS dTCfgAfaUfCUNAUfcAfgcaUfcUfgGfadTsdT  488  72
AM02035-AS dTAfaGfgGfcGfaAfucuCfaGfcAfudTsdT  489  73
AM02036-AS dTAfaGfgGUNAcGfaAfucuCfaGfcAfudTsdT  490  73
AM02037-AS dTAfaGfgGfCUNAGfaAfucuCfaGfcAfudTsdT  491  73
AM02039-AS dTUfgAfcAfcUfgGfgauCfcAfuGfgdTsdT  492  74
AM02040-AS dTUfgAfcAUNAcUfgGfgauCfcAfuGfgdTsdT  493  74
AM02041-AS dTUfgAfcAfCUNAUfgGfgauCfcAfuGfgdTsdT  494  74
AM02240-AS dTCfaAfuAfaGfgGfgcuGfcCfaCfadTsdT  495  80
AM02241-AS dTCfuGfcGfuCfuGfagcAfuUfgUfgdTsdT  496  81
AM02242-AS dTAfcAfgGfaUfcUfggaUfuUfcGfgdTsdT  497  82
AM02243-AS dTCfcGfgGfgGfuUfuccUfcAfgUfcdTsdT  498  83
AM02244-AS dTUfgUfcCfaUfaAfuggUfaGfuAfgdTsdT  499  84
AM02245-AS dTUfcUfgUfcCfaUfaauGfgUfaGfudTsdT  500  85
AM02246-AS dTAfcUfcUfgUfcCfauaAfuGfgUfadTsdT  501  86
AM02247-AS dTAfaCfuCfuGfuCfcauAfaUfgGfudTsdT  502  87
AM02248-AS dTGfgGfcGfaAfuCfucaGfcAfuCfudTsdT  503  88
AM02249-AS dTAfgGfgCfgAfaUfcucAfgCfaUfcdTsdT  504  89
AM02250-AS dTAfaCfaCfcAfaGfggcGfaAfuCfudTsdT  505  90
AM02251-AS dTAfgGfaCfaCfuUfgauUfcUfgUfcdTsdT  506  91
AM02252-AS dTGfgAfcCfaAfgAfcugAfcAfuGfudTsdT  507  92
AM02253-AS dTGfgUfcAfgGfcCfaccAfuUfuGfgdTsdT  508  93
AM02254-AS dTAfuCfcAfuGfgUfauaAfcAfcCfadTsdT  509  94
AM02255-AS dTGfgGfaUfcCfaUfgguAfuAfaCfadTsdT  510  95
AM02256-AS dTUfgGfaCfaUfuGfuguCfaGfgUfudTsdT  511  96
AM02257-AS dTAfuUfcUfgUfcAfcugGfaCfaUfudTsdT  512  97
AM02258-AS dTGfgUfgCfuUfgUfucaGfaAfaCfadTsdT  513  98
AM02259-AS dTGfgAfgAfaUfgAfgccUfcGfaUfadTsdT  514  99
AM02260-AS dTGfuGfgAfgAfaUfgagCfcUfcGfadTsdT  515 100
AM02261-AS dTCfcGfuGfgGfaGfuugUfgAfgGfadTsdT  516 101
AM02262-AS dTGfgAfcCfaCfcGfuggGfaGfuUfgdTsdT  517 102
AM02263-AS dTUfgCfuUfgUfuCfagaAfgGfaGfcdTsdT  518 103
AM02264-AS dTCfuGfaUfgCfcAfgugUfgGfuAfudTsdT  519 104
AM02265-AS dTUfaGfgAfcAfcCfugaUfuCfuGfudTsdT  520 105
AM02266-AS dTCfuCfuAfgGfaCfaccUfgAfuUfcdTsdT  521 106
AM02267-AS dTUfcUfcUfaGfgAfcacCfuGfaUfudTsdT  522 107
AM02268-AS dTGfuCfuCfuAfgGfacaCfcUfgAfudTsdT  523 108
AM02404-AS dTsGfsaGfaAfuGfaGfcCfuCfgAfuAfaCfuCfsusuAu  524 109
AM02406-AS dTsGfsaGfaAfuGfaGfccUfCfgAfuAfaCfuCfsusuAu  525 109
AM02408-AS dTsGfsaGfaAfuGfaGfccUfcgAfuAfaCfuCfsusuAu  526 109
AM02410-AS dTsGfsaGfaAfuGfaGfcCfUfcGfaUfaAfcUfcsUfsuAu  527 109
AM02412-AS dTsGfsaCfaCfcUfgAfuUfcUfgUfuUfcUfgAfsgsuAu  528 110
AM02414-AS dTsGfsaCfaCfcUfgAfuuCfUfgUfuUfcUfgAfsgsuAu  529 110
AM02416-AS dTsGfsaCfaCfcUfgAfuuCfugUfuUfcUfgAfsgsuAu  530 110
AM02418-AS dTsGfsaCfaCfcUfgAfuUfCfuGfuUfuCfuGfasGfsuAu  531 110
AM02531-AS dTsCfsgUfaUfaAfcAfauaAfgGfgGfcUfgCfscsuAu  532 111
AM02532-AS dTsGfscGfuCfuGfaGfcauUfgUfgUfcAfgGfsusuAu  533 112
AM02533-AS dTsUfsgCfgUfcUfgAfgcaUfuGfuGfuCfaGfsgsuAu  534 113
AM02534-AS dTsGfsaGfaAfuGfaGfccuCfgAfuAfaCfuCfsusuAu  535 109
1532-AS00
AM02535-AS dTsGfsaCfaCfcUfgAfuucUfgUfuUfcUfgAfsgsuAu  536 110
1533-AS00
AM02536-AS dTsAfsaGfgGfcGfaAfucuCfaGfcAfuCfuGfsgsuAu  537 114
AM02755-AS usUfsaAfcAfaUfaAfgGfgGfcUfgCfAbs(PAZ)  538 115
AM02756-AS usGfsuAfuAfaCfaAfuAfaGfgGfgCfAbs(PAZ)  539 116
AM02757-AS usCfsgUfaUfaAfcAfaUfaAfgGfgGfAbs(PAZ)  540 117
AM02758-AS usGfscGfuCfuGfaGfcAfuUfgUfgUfAbs(PAZ)  541 118
AM02759-AS usUfsgCfgUfcUfgAfgCfaUfuGfuGfAbs(PAZ)  542 119
AM02760-AS usCfsaGfgAfuCfuGfgAfuUfuCfgGfAbs(PAZ)  543 120
AM02761-AS usUfsgCfaUfcUfgAfgCfaUfcGfuGfAbs(PAZ)  544 121
AM02762-AS usCfsgAfcUfaUfgCfuGfgUfgUfgGfAbs(PAZ)  545 122
AM02763-AS usUfsuUfcUfgGfgGfuCfcGfaCfuAfAbs(PAZ)  546 123
AM02764-AS usGfscGfaAfuCfuCfaGfcAfuCfuGfAbs(PAZ)  547 124
AM02765-AS usUfsgCfaAfgGfaCfaCfuUfgAfuUfAbs(PAZ)  548 125
AM02766-AS usAfsaUfgAfgCfcUfcGfaUfaAfcUfAbs(PAZ)  549 126
AM02767-AS usGfsaAfuGfaGfcCfuCfgAfuAfaCfAbs(PAZ)  550 127
AM02768-AS usGfsaCfaUfuGfuGfuCfaGfgUfuGfAbs(PAZ)  551 128
AM02769-AS usGfsaGfaAfuGfaGfcCfuCfgAfuAfAbs(PAZ)  552 129
AM02770-AS usCfscAfuUfuGfgGfuAfgUfaUfuCfAbs(PAZ)  553 130
AM02771-AS usCfsaCfcAfuUfuGfgGfuAfgUfaUfAbs(PAZ)  554 131
AM02772-AS usGfsaCfaCfcUfgAfuUfcUfgUfuUfAbs(PAZ)  555 132
AM02773-AS usGfsgAfcAfcCfuGfaUfuCfuGfuUfAbs(PAZ)  556 133
AM02774-AS usUfsaAfcAfaUfaAfgGfgGfcUfgAbAbs(PAZ)  557 134
AM02775-AS usGfsuAfuAfaCfaAfuAfaGfgGfgAbAbs(PAZ)  558 135
AM02776-AS usCfsgUfaUfaAfcAfaUfaAfgGfgAbAbs(PAZ)  559 136
AM02777-AS usGfscGfuCfuGfaGfcAfuUfgUfgAbAbs(PAZ)  560 137
AM02778-AS usUfsgCfgUfcUfgAfgCfaUfuGfuAbAbs(PAZ)  561 138
AM02779-AS usCfsaGfgAfuCfuGfgAfuUfuCfgAbAbs(PAZ)  562 139
AM02780-AS usUfsgCfaUfcUfgAfgCfaUfcGfuAbAbs(PAZ)  563 140
AM02781-AS usCfsgAfcUfaUfgCfuGfgUfgUfgAbAbs(PAZ)  564 141
AM02782-AS usUfsuUfcUfgGfgGfuCfcGfaCfuAbAbs(PAZ)  565 142
AM02783-AS usGfscGfaAfuCfuCfaGfcAfuCfuAbAbs(PAZ)  566 143
AM02784-AS usUfsgCfaAfgGfaCfaCfuUfgAfuAbAbs(PAZ)  567 144
AM02785-AS usAfsaUfgAfgCfcUfcGfaUfaAfcAbAbs(PAZ)  568 145
AM02786-AS usGfsaAfuGfaGfcCfuCfgAfuAfaAbAbs(PAZ)  569 146
AM02787-AS usGfsaCfaUfuGfuGfuCfaGfgUfuAbAbs(PAZ)  570 147
AM02788-AS usGfsaGfaAfuGfaGfcCfuCfgAfuAbAbs(PAZ)  571 148
AM02789-AS usCfscAfuUfuGfgGfuAfgUfaUfuAbAbs(PAZ)  572 149
AM02790-AS usCfsaCfcAfuUfuGfgGfuAfgUfaAbAbs(PAZ)  573 150
AM02791-AS usGfsaCfaCfcUfgAfuUfcUfgUfuAbAbs(PAZ)  574 151
AM02792-AS usGfsgAfcAfcCfuGfaUfuCfuGfuAbAbs(PAZ)  575 152
AM02857-AS usGfsaGfaAfuGfaGfccuCfgAfuAfaCfuCfsusuAu  576 153
1532-AS14
AM02858-AS usgsaGfaAfuGfaGfccuCfgAfuAfaCfuCfsusuAu  577 153
AM02859-AS usgsaGfaAfuGfaGfccuCfgAfuAfaCfucsusuAu  578 153
AM02860-AS usGfsaGfaAfuGfaGfccuCfgAfuAfaCfucsusuAu  579 153
AM02863-AS usGfsaCfaCfcUfgAfuucUfgUfuUfcUfgAfsgsuAu  580 154
1533-AS15
AM02864-AS usgsaCfaCfcUfgAfuucUfgUfuUfcUfgAfsgsuAu  581 154
AM02865-AS usgsaCfaCfcUfgAfuucUfgUfuUfcUfgasgsuAu  582 154
AM02866-AS usGfsaCfaCfcUfgAfuucUfgUfuUfcUfgasgsuAu  583 154
AM02943-AS usgsagaAfugaGfccuCfgAfuaaCfuCfsusuAu  584 153
AM02944-AS usgsagaauGfagccuCfgauAfaCfuCfsusuAu  585 153
AM02945-AS usgsagaauGfagccuCfgauAfacucsusuAu  586 153
AM02950-AS usgsaCfaCfcUfgAfuucUfgUfuucUfgasgsuAu  587 154
AM02951-AS usgsaCfaCfcUfgAfuucUfguuUfcugasgsuAu  588 154
AM02952-AS usgsacaccugAfuucUfgUfuucUfgasgsuAu  589 154
AM03040-AS usGfsAfcAfcCfUfgAfuucUfgUfuUfcUfgAfsgsuAu  590 154
AM03041-AS usGfsAfcAfccUfgAfuucUfgUfuUfcUfgAfsgsuAu  591 154
AM03043-AS usGfsaCfaCfCfUfgAfuucUfgUfuUfcUfgAfsgsuAu  592 154
AM03065-AS dTsGfsaCfaCfcugauucUfgUfuUfcUfgAfsgsuAu  593 110
1533-AS18
AM03066-AS usGfsaCfaCfcugauucUfgUfuUfcUfgAfsgsuAu  594 154
1533-AS03
AM03067-AS dTsGfsaCfaCfcugauucUfgUfuucugasgsuAu  595 110
AM03068-AS usGfsaCfaCfcugauucUfgUfuucugasgsuAu  596 154
AM03069-AS dTsGfsaCfaCfcUfgAfuucUfgUfuucugasgsuAu  597 110
1533-AS14
AM03070-AS usGfsaCfaCfcUfgAfuucUfgUfuucugasgsuAu  598 154
1533-AS29
AM03107-AS usCfsgUfaUfaAfcAfauaAfgGfgGfcUfgCfscsuAu  599 156
AM03108-AS usCfsgUfaUfaAfcAfauaAfgGfgGfcUfgcscsuAu  600 156
AM03119-AS usGfsaGfaAfuGfaGfccuCfgAfuAfaCfuCMsTMsuAu  601 155
AM03120-AS usGfsaGfaAfuGfaGfccuCfgAfuAfaCfuCMTMuAu  602 155
AM03121-AS usGfsaGfaAfuGfaGfccuCfgAfuAfaCfucuuAu  603 153
AM03127-AS usCfsgUfaUfaAfCfAfauaAfgGfgGfcUfgCfscsuAu  604 156
AM03129-AS usCfsgUfaUfaAfCfAfauaAfgGfgGfcUfgcscsuAu  605 156
AM03130-AS usGfsaGfaAfuGfaGfCfcuCfgAfuAfaCfuCfsusuAu  606 153
AM03131-AS usGfsaGfaAfuGfaGfCfCfuCfgAfuAfaCfuCfsusuAu  607 153
AM03149-AS usGfsagaAfugaGfccuCfgAfuaaCfuCfsusuAu  608 153
AM03150-AS usGfsagaauGfagccuCfgauAfaCfuCfsusuAu  609 153
AM03151-AS usGfsagaauGfagccuCfgauAfacucsusuAu  610 153
AM03255-AS usGfsaGfaAfugaGfccuCfgauaaCfuCfsusuAu  611 153
1532-AA26
AM03256-AS usGfsagaaugagccuCfgauaaCfuCfsusuAu  612 153
AM03257-AS usGfsagaaugagccuCfgauaacuCfsusuAu  613 153
AM03258-AS usGfsagaaugagccuCfgauaaCfucsusuAu  614 153
AM03259-AS usGfsagaaugagccuCfgauaacucsusuAu  615 153
AM03260-AS usGfsaGfaAfugaGfccUfCfgauaaCfuCfsusuAu  616 153
AM03261-AS usGfsagaaugagccUfCfgauaaCfuCfsusuAu  617 153
AM03262-AS usGfsagaaugagccUfCfgauaacuCfsusuAu  618 153
AM03263-AS usGfsagaaugagccUfCfgauaaCfucsusuAu  619 153
AM03264-AS usGfsagaaugagccUfCfgauaacucsusuAu  620 153
AM03265-AS usGfsaGfaAfugaGfcCfuCfgauaaCfuCfsusuAu  621 153
AM03266-AS usGfsagaaugagcCfuCfgauaaCfuCfsusuAu  622 153
AM03267-AS usGfsagaaugagcCfuCfgauaacuCfsusuAu  623 153
AM03268-AS usGfsagaaugagcCfuCfgauaaCfucsusuAu  624 153
AM03269-AS usGfsagaaugagcCfuCfgauaacucsusuAu  625 153
AM03270-AS usGfsaGfaAfugaGfCfcuCfgauaaCfuCfsusuAu  626 153
AM03271-AS usGfsagaaugagCfcuCfgauaaCfuCfsusuAu  627 153
AM03272-AS usGfsagaaugagCfcuCfgauaacuCfsusuAu  628 153
AM03273-AS usGfsagaaugagCfcuCfgauaaCfucsusuAu  629 153
AM03274-AS usGfsagaaugagCfcuCfgauaacucsusuAu  630 153
AM03279-AS usCfsgUfaUfaacaauaAfgGfgGfcUfgCfscsuAu  631 156
AM03280-AS usCfsgUfaUfaAfcAfauaAfggggcUfgCfscsuAu  632 156
AM03281-AS usCfsguauaAfcAfauaAfgGfgGfcUfgCfscsuAu  633 156
AM03282-AS usCfsgUfaUfaAfcAfauaAfgGfgGfcugcscsuAu  634 156
AM03283-AS usCfsgUfaUfaacaauaAfgGfgGfcugcscsuAu  635 156
AM03284-AS usCfsguauaAfcAfauaAfggggcUfgCfscsuAu  636 156
AM03300-AS usCfsgUfaUfaacaaUfaAfgGfgGfcUfgCfscsuAu  637 156
AM03301-AS usCfsguauaAfcAfaUfaAfggggcUfgCfscsuAu  638 156
AM03331-AS usGfsaGfaAfuGfaGfcCfuCfgAfuAfasdTsdT  639 157
AM03375-AS usCfsguauaAfcAfauaAfggggcugcscsuAu  640 156
AM03376-AS usCfsguauaacaauaAfggggcugcscsuAu  641 156
AM03377-AS usGfsagaauGfaGfccuCfgauaacucsusuAu  642 153
AM03427-AS dTsGfaGfaAfuGfaGfccuCfgAfuAfaCfuCfuuAu  643 109
AM03486-AS vpdTGfsaGfaAfuGfaGfccuCfgAfuAfaCfucsusuAu  644 109
AM03487-AS vpdTsGfsaGfaAfuGfaGfccuCfgAfuAfaCfucsusuAu  645 109
AM03488-AS dTsGfsaGfaAfuGfaGfccuCfgAfuAfaCfucsusuAu  646 109
AM03490-AS vpdTCfsgUfaUfaAfcAfauaAfgGfgGfcUfgCfscsuAu  647 111
AM03491-AS vpdTsCfsgUfaUfaAfcAfauaAfgGfgGfcUfgCfscsuAu  648 111
AM03655-AS usGfsAfgaaugagccuCfgauaacucsusuAu  649 153
AM03656-AS usGfsaGfaaugagccuCfgauaacucsusuAu  650 153
AM03657-AS usGfsagAfaugagccuCfgauaacucsusuAu  651 153
AM03658-AS usGfsagaAfugagccuCfgauaacucsusuAu  652 153
AM03659-AS usGfsagaaUfgagccuCfgauaacucsusuAu  653 153
AM03660-AS usGfsagaauGfagccuCfgauaacucsusuAu  654 153
AM03661-AS usGfsagaaugaGfccuCfgauaacucsusuAu  655 153
AM03671-AS usCfsgUfaUfaAfcAfauaAfgGfcGfcUfgCfscsuAu  656 158
AM03672-AS usCfsgUfaUfaAfcAfauaAfggggCfugCfscsuAu  657 156
AM03673-AS usCfsgUfaUfaAfcAfauaAfggggcugcscsuAu  658 156
AM03674-AS usCfsGfuauaAfcAfauaAfggggcugcscsuAu  659 156
AM03675-AS usCfsgUfaUfaAfcaauaAfggggcugcscsuAu  660 156
AM03676-AS usCfsgUfaUfaaCfaauaAfggggcugcscsuAu  661 156
AM03677-AS usCfsGfuauAfaCfaauaAfggggcugcscsuAu  662 156
AM03678-AS usGfsaGfaAfuGfaGfccuCfgauaacucsusuAu  663 153
AM03679-AS usGfsAfgaAfuGfaGfccuCfgauaacucsusuAu  664 153
AM03680-AS usGfsAfgAfauGfaGfcCfuCfgauaacucsusuAu  665 153
AM03681-AS usGfsAfgAfauGfagCfCfuCfgauaacucsusuAu  666 153
AM03682-AS usGfsaGfaAfuGfagccuCfgauaacucsusuAu  667 153
AM03744-AS usGfsuauaaCfaAfuaaGfgggAbAbs(PAZ)  668 135
AM03745-AS usGfsuAfuAfaCfaAfuAfaGfgGMGMAbAbs(PAZ)  669 135
AM03749-AS usCfsguauaAfcAfauaAfgggAbAbs(PAZ)  670 136
AM03750-AS usCfsgUfaUfaAfcAfaUfaAfgGMGMAbAbs(PAZ)  671 136
AM03754-AS usGfsagaauGfaGfccuCfgauAbAbs(PAZ)  672 148
AM03755-AS usGfsagaaugagcCfuCfgauAbAbs(PAZ)  673 148
AM03756-AS usGfsaGfaAfuGfaGfcCfuCfgAMTMAbAbs(PAZ)  674 159
AM03760-AS usGfsacaccUfgAfuucUfguuAbAbs(PAZ)  675 151
AM03761-AS usGfsaCfaCfcugauucUfguuAbAbs(PAZ)  676 151
AM03762-AS usGfsaCfaCfcUfgAfuUfcUfgTMTMAbAbs(PAZ)  677 160
AM03823-AS usCfANAsgUfaUfaAfCfAfauaAfgGfgGfcUfgcscsuAu  678 156
AM03824-AS usCfsgUfANAaUfaAfCfAfauaAfgGfgGfcUfgcscsuAu  679 156
AM03825-AS usCfsgUfaUfANAaAfCfAfauaAfgGfgGfcUfgcscsuAu  680 156
AM03826-AS usCfsgUfaUfaAfANACfAfauaAfgGfgGfcUfgcscsuAu  681 156
AM03827-AS usGfANAsagaauGfaGfccuCfgauaacucsusuAu  682 153
AM03828-AS usGfsagaauGfANAaGfccuCfgauaacucsusuAu  683 153
AM03856-AS TMsGfsagaauGfaGfccuCfgauaacucsusuAu  684 109
AM03857-AS TMsCfsgUfaUfaAfCfAfauaAfgGfgGfcUfgcscsuAu  685 111
AM03862-AS TMsGfsagaaugagccuCfgauaacucsusuAu  686 109
AM03866-AS usCfsgUfaUfaacaauaAfggggcugcscsuAu  687 156
AM03867-AS usCfsgUfauaAfcaauaAfggggcugcscsuAu  688 156
AM03868-AS usCfsgUfauaacAfauaAfggggcugcscsuAu  689 156
AM03869-AS usCfsgUfauaacaaUfaAfggggcugcscsuAu  690 156
AM03870-AS usCfsguaUfaAfcaauaAfggggcugcscsuAu  691 156
AM03871-AS usCfsguaUfaacAfauaAfggggcugcscsuAu  692 156
AM03872-AS usCfsguaUfaacaaUfaAfggggcugcscsuAu  693 156
AM03873-AS usCfsguauaAfcaaUfaAfggggcugcscsuAu  694 156
AM03874-AS usCfsguauaacAfaUfaAfggggcugcscsuAu  695 156
AM03875-AS usCfsgUfaUfaAfcAfaUfaAfgggGfcUfgCfscsuAu  696 156
AM03876-AS usCfsgUfaUfaAfcAfaUfaAfgGfggcUfgCfscsuAu  697 156
AM03877-AS usCfsgUfaUfaAfcAfaUfaAfgGfgGfcugCfscsuAu  698 156
AM03878-AS usCfsgUfaUfaAfcAfaUfaAfgGfgGfcUfgcscsuAu  699 156
AM03883-AS vpusCfsgsUfaUfaAfCfAfauaAfgGfgGfcUfgasusu  700 161
AM03884-AS vpusCfsgsUfaUfaAfCfAfauaAfgGfgGfcUfgcsusu  701 162
AM03885-AS vpusGfsasgaauGfaGfccuCfgauaacucsusu  702 163
AM03929-AS usCfsguaUfaAfcaauaAfgGfggcugcscsuAu  703 156
AM03930-AS usCfsguaUfaAfCfaauaAfgGfggcugcscsuAu  704 156
AM03932-AS usGfsagaAfuGfagccuCfgAfuaacucsusuAu  705 153
AM03933-AS usGfsagaAfuGfAfgccuCfgAfuaacucsusuAu  706 153
AM03969-AS vpusCfsgUfaUfaAfCfAfauaAfgGfgGfcUfgcscsuAu  707 156
AM03971-AS vpusCfsgsUfaUfaAfCfAfauaAfgGfgGfcusu  708 164
AM03972-AS usCfsgsUfaUfaAfCfAfauaAfgGfgGfcusu  709 164
AM03973-AS UUNAsCfsgsUfaUfaAfCfAfauaAfgGfgGfcusu  710 164
AM04132-AS usGfsaGfaAfuGfaGfccuCfgAfuAfaCfucsusuau  711 153
AM04133-AS usGfsagaauGfaGfccuCfgauaacucsusuau  712 153
AM04134-AS usGfsaGfaAfuGfAfGfccuCfgAfuAfaCfucsusuau  713 153
AM04135-AS usGfsagaauGfAfGfccuCfgauaacucsusuau  714 153
AM04136-AS usGfsaGfaAfuGfAfgccuCfgAfuAfaCfucsusuau  715 153
AM04137-AS usGfsagaauGfAfgccuCfgauaacucsusuau  716 153
AM04150-AS usGfsagaauGfaGfccuCfgauaacucsusuau(Dy540)  717 153
AM04215-AS usCfsgUfaUfaaCfaaUfaAfgGfgGfcUfgCfscsuAu  718 156
AM04216-AS usCfsguauaAfcaaUfaAfggggcugCfscsuAu  719 156
AM04217-AS usCfsguauaaCfaaUfaAfggggcugCfscsuAu  720 156
AM04218-AS usCfsguauaaCfaaUfaAfggggCfugCfscsuAu  721 156
AM04219-AS usCfsguaUfaaCfaaUfaAfggggCfugCfscsuAu  722 156
AM04250-AS usGfsuAfuAfaCfaAfuAfaGfgGMGMsAbsAbs(PAZ)  723 135
AM04251-AS usGfsuAfuAfaCfaAfuAfaGfgGMGM(Sp18)s(PAZ)  724 165
AM04252-AS usGfsuAfuAfaCfaAfuAfaGfgGMGM(C12)s(PAZ)  725 165
AM04253-AS usCfsgUfaUfaAfcAfaUfaAfgGMGMsAbsAbs(PAZ)  726 136
AM04254-AS usCfsgUfaUfaAfcAfaUfaAfgGMGM(Sp18)s(PAZ)  727 166
AM04255-AS usCfsgUfaUfaAfcAfaUfaAfgGMGM(C12)s(PAZ)  728 166
AM04256-AS usGfsaGfaAfuGfaGfcCfuCfgAMTMsAbsAbs(PAZ)  729 159
AM04257-AS usGfsaGfaAfuGfaGfcCfuCfgAMTM(Sp18)s(PAZ)  730 167
AM04258-AS usGfsaGfaAfuGfaGfcCfuCfgAMTM(C12)s(PAZ)  731 167
AM04259-AS usGfsaCfaCfcUfgAfuUfcUfgTMTMsAbsAbs(PAZ)  732 160
AM04260-AS usGfsaCfaCfcUfgAfuUfcUfgTMTM(Sp18)s(PAZ)  733 168
AM04261-AS usGfsaCfaCfcUfgAfuUfcUfgTMTM(C12)s(PAZ)  734 168
AM04377-AS dTusCfsgUfaUfaacaaUfaAfgGfgGfcUfgCfscsua  735 169
AM04378-AS uAusCfsgUfaUfaacaaUfaAfgGfgGfcUfgCfscsu  736 170
AM04379-AS dTcsCfsgUfaUfaacaaUfaAfgGfgGfcUfgCfscsua  737 171
AM04380-AS cUcsCfsgUfaUfaacaaUfaAfgGfgGfcUfgCfscsu  738 172
AM04383-AS dTusGfsaGfaAfuGfaGfccuCfgAfuAfaCfucsusua  739 173
AM04384-AS uAusGfsaGfaAfuGfaGfccuCfgAfuAfaCfucsusu  740 174
AM04385-AS dTgsGfsaGfaAfuGfaGfccuCfgAfuAfaCfucsusua  741 175
AM04386-AS gUgsGfsaGfaAfuGfaGfccuCfgAfuAfaCfucsusu  742 176
AM04387-AS dTusGfsagaauGfaGfccuCfgauaacucsusua  743 173
AM04388-AS uAusGfsagaauGfaGfccuCfgauaacucsusu  744 174
AM04389-AS dTgsGfsagaauGfaGfccuCfgauaacucsusua  745 175
AM04390-AS gUgsGfsagaauGfaGfccuCfgauaacucsusu  746 176
AM04413-AS usCfsgsUfaUfaacaaUfaAfgGfgGfcusu  747 164
AM04415-AS usGfsasGfaAfuGfaGfccuCfgAfuAfausu  748 177
AM04437-AS usGfsuAfuAfaCfaAfuAfaGfgGMGMs(C12)s(PAZ)  749 165
AM04438-AS usCfsgUfaUfaAfcAfaUfaAfgGMGMs(C12)s(PAZ)  750 166
AM04439-AS usGfsaGfaAfuGfaGfcCfuCfgAMTMs(C12)s(PAZ)  751 167
AM04440-AS usGfsaCfaCfcUfgAfuUfcUfgTMTMs(C12)s(PAZ)  752 168
AM04501-AS cPrpTMsCfsgsUfaUfaAfCfAfauaAfgGfgGfcusu  753 178
AM04507-AS usGfsasGfaAfuGfaGfccuCfgAfuAfausuAUAUA  754 179
AM04539-AS usCfsgUfaUfaacaaUfaAfgGfgGfcUfgsCfscuAu  755 156
AM04540-AS usCfsgUfaUfaacaaUfaAfgGfgGfcUfgsCfcuAu  756 156
AM04541-AS usGfsaGfaAfuGfaGfccuCfgAfuAfaCfuscsuuAu  757 153
AM04542-AS usGfsaGfaAfuGfaGfccuCfgAfuAfaCfuscuuAu  758 153
AM04544-AS usCfsgsUfaUfaAfCfAfauaAfgGfgGfcUfgcsusu  759 162
AM04545-AS usCfsgsUfaUfaAfCfAfauaagGfgGfcusu  760 164
AM04546-AS usCfsgsUfaUfaAfCfAfaUfaagGfgGfcusu  761 164
AM04582-AS usCfsgUfaUfaacaaUfaAfgGfgGfcUfgsCfsc  762 180
AM04583-AS dTusCfsgUfaUfaacaaUfaAfgGfgGfcUfgsCfsc  763 181
AM04584-AS dTusCfsgUfaUfaacaaUfaAfgGfgGfcUfgscsc  764 181
AM04585-AS dTusCfsgsUfaUfaacaaUfaAfgGfgGfcUfgscsc  765 181
AM04586-AS dTusCfsgsUfaUfaacaaUfaAfgGfgGfcUfgcsc  766 181
AM04587-AS dTusCfsgsUfaUfaacaaUfaAfgGfgGfcusg  767 182
AM04609-AS epTcPrsCfsgsUfaUfaAfCfAfauaAfgGfgGfcusu  768 178
AM04610-AS epTMsCfsgsUfaUfaAfCfAfauaAfgGfgGfcusu  769 178
AM04677-AS usGfsaGfaAfuGfaGfccuCfgAfuAfaCfsuscuuAu  770 153
AM04678-AS usGfsaGfaAfuGfaGfccuCfgAfuAfasCfsucuuAu  771 153
AM04679-AS usGfsaGfaAfuGfaGfccuCfgAfuAfaCfuasuscGc  772 183
AM04680-AS usGfsaGfaAfuGfaGfccuCfgAfuAfaCfuasusuCa  773 184
AM04681-AS usGfsaGfaAfuGfaGfccuCfgAfuAfaCfuascsgAu  774 185
AM04733-AS us(5Me-Gf)saGfaAfuGfaGfccuCfgAfuAfaCfucsusuAu  775 153
AM04734-AS usGfsa(5Me-Gf)aAfuGfaGfccuCfgAfuAfaCfucsusuAu  776 153
AM04735-AS usGfsaGfaAfu(5Me-Gf)aGfccuCfgAfuAfaCfucsusuAu  777 153
AM04736-AS usGfsaGfaAfuGfa(5Me-Gf)ccuCfgAfuAfaCfucsusuAu  778 153
AM04805-AS vpusCfsgsUfaUfaAfCfAfauaAfgGfgGfcgsu  779 186
AM04821-AS usCfsgUfaUfaacaaUfaAfgGfgGfcUfgCfscsu  780 187
AM04822-AS usCfsgUfaUfaacaaUfaAfgGfgGfcUfgCfsusu  781 162
AM04823-AS vpusCfsgUfaUfaacaaUfaAfgGfgGfcUfgCfscsu  782 187
AM04824-AS vpusCfsgUfaUfaacaaUfaAfgGfgGfcUfgCfsusu  783 162
AM04871-AS usGfsaGfaAfuGfAfgccuCfgAfuAfaCfusCfsuuAu  784 153
AM04872-AS cPrpusGfsaGfaAfuGfaGfccuCfgAfuAfaCfucsusuAu  785 153
AM04873-AS cPrpusCfsgUfaUfaacaaUfaAfgGfgGfcUfgCfscsuAu  786 156
AM04874-AS usCfsgUfaUfaacaaUfaAfgGfgGfcsusu  787 164
AM04875-AS cPrpusCfsgUfaUfaacaaUfaAfgGfgGfcsusu  788 164
AM04876-AS usCfsgUfaUfaacaaUfaAfgGfgGfcsusg  789 188
AM04877-AS usCfsgUfaUfaacaaUfaAfgGfgGfcsUfsg  790 188
AM04878-AS cPrpusCfsgUfaUfaacaaUfaAfgGfgGfcUfgCfsusu  791 162
AM04879-AS usGfsaGfaAfuGfaGfcCfuCfgAfuAfaCfucsusuAu  792 153
AM04880-AS cPrpusGfsaGfaAfuGfaGfcCfuCfgAfuAfaCfucsusuAu  793 153
AM04969-AS cPrpTMsGfsaGfaAfuGfaGfcCfuCfgAfuAfaCfucsusuAu  794 109
AM04970-AS cPrpTMsCfsgUfaUfaacaaUfaAfgGfgGfcUfgCfscsuAu  795 111
AM04971-AS cPrpTMsCfsgUfaUfaacaaUfaAfgGfgGfcsusu  796 178
AM04972-AS cPrpTMsCfsgUfaUfaacaaUfaAfgGfgGfcUfgCfsusu  797 189
AM04979-AS usCfsgsUfaUfaAfcAfaUfaAfgGfgGfcusu  798 164
1532-AS01 usgsagaaugaGfccuCfgAfuAfaCfuCfsusuAu  799 153
1532-AS02 usgsagaauGfagccuCfgAfuAfaCfuCfsusuAu  800 153
1532-AS03 usgsagaAfugagccuCfgAfuAfaCfuCfsusuAu  801 153
1532-AS04 usgsaGfaaugagccuCfgAfuAfaCfuCfsusuAu  802 153
1532-AS05 usGfsagaaugagccuCfgAfuAfaCfuCfsusuAu  803 153
1532-AS06 dTsgsagaaugagccuCfgAfuAfaCfuCfsusuAu  804 109
1532-AS07 dTsGfsaGfaAfugagccuCfgAfuAfaCfuCfsusuAu  805 109
1532-AS08 dTsGfsaGfaAfugaGfccuCfgauAfaCfuCfsusuAu  806 109
1532-AS09 dTsGfsaGfaAfuGfagccuCfgauAfaCfuCfsusuAu  807 109
1532-AS10 dTsGfsaGfaAfugagccuCfgauAfaCfuCfsusuAu  808 109
1532-AS11 dTsGfsaGfaAfugagccuCfgAfuaaCfuCfsusuAu  809 109
1532-AS12 dTsGfsaGfaAfugaGfccuCfgauaaCfuCfsusuAu  810 109
1532-AS13 dTsGfsaGfaAfuGfagccuCfgauaaCfuCfsusuAu  811 109
1532-AS15 dTsgsagaaugaGfccuCfgAfuAfaCfuCfsusuAu  812 109
1532-AS16 dTsgsagaauGfagccuCfgAfuAfaCfuCfsusuAu  813 109
1532-AS17 dTsgsagaAfugagccuCfgAfuAfaCfuCfsusuAu  814 109
1532-AS18 dTsgsaGfaaugagccuCfgAfuAfaCfuCfsusuAu  815 109
1532-AS19 dTsGfsagaaugagccuCfgAfuAfaCfuCfsusuAu  816 109
1532-AS20 usgsagaaugagccuCfgAfuAfaCfuCfsusuAu  817 153
1532-AS21 usGfsaGfaAfugagccuCfgAfuAfaCfuCfsusuAu  818 153
1532-AS22 usGfsaGfaAfugaGfccuCfgauAfaCfuCfsusuAu  819 153
1532-AS23 usGfsaGfaAfuGfagccuCfgauAfaCfuCfsusuAu  820 153
1532-AS24 usGfsaGfaAfugagccuCfgauAfaCfuCfsusuAu  821 153
1532-AS25 usGfsaGfaAfugagccuCfgAfuaaCfuCfsusuAu  822 153
1532-AS27 usGfsaGfaAfuGfagccuCfgauaaCfuCfsusuAu  823 153
1533-AS01 usgsaCfaCfcugAfuucUfgUfuUfcUfgAfsgsuAu  824 154
1533-AS02 usgsaCfaCfcUfgauucUfgUfuUfcUfgAfsgsuAu  825 154
1533-AS04 dTsgsaCfaCfcugauucUfgUfuUfcUfgAfsgsuAu  826 110
1533-AS05 dTsGfsaCfaCfcugAfuucUfguuUfcUfgAfsgsuAu  827 110
1533-AS06 dTsGfsaCfaCfcUfgauucUfguuUfcUfgAfsgsuAu  828 110
1533-AS07 dTsGfsaCfaCfcUfgauucUfgUfuucUfgAfsgsuAu  829 110
1533-AS08 dTsGfsaCfaCfcUfgAfuucUfguuucUfgAfsgsuAu  830 110
1533-AS09 dTsGfsaCfaCfcUfgAfuucUfguuUfcugAfsgsuAu  831 110
1533-AS10 dTsGfsaCfaCfcUfgAfuucUfgUfuucugAfsgsuAu  832 110
1533-AS11 dTsGfsaCfaCfcUfgAfuucUfguuucugAfsgsuAu  833 110
1533-AS12 dTsGfsaCfaCfcUfgAfuucUfguuucUfgasgsuAu  834 110
1533-AS13 dTsGfsaCfaCfcUfgAfuucUfguuUfcugasgsuAu  835 110
1533-AS16 dTsgsaCfaCfcugAfuucUfgUfuUfcUfgAfsgsuAu  836 110
1533-AS17 dTsgsaCfaCfcUfgauucUfgUfuUfcUfgAfsgsuAu  837 110
1533-AS19 usgsaCfaCfcugauucUfgUfuUfcUfgAfsgsuAu  838 154
1533-AS20 usGfsaCfaCfcugAfuucUfguuUfcUfgAfsgsuAu  839 154
1533-AS21 usGfsaCfaCfcUfgauucUfguuUfcUfgAfsgsuAu  840 154
1533-AS22 usGfsaCfaCfcUfgauucUfgUfuucUfgAfsgsuAu  841 154
1533-AS23 usGfsaCfaCfcUfgAfuucUfguuucUfgAfsgsuAu  842 154
1533-AS24 usGfsaCfaCfcUfgAfuucUfguuUfcugAfsgsuAu  843 154
1533-AS25 usGfsaCfaCfcUfgAfuucUfgUfuucugAfsgsuAu  844 154
1533-AS26 usGfsaCfaCfcUfgAfuucUfguuucugAfsgsuAu  845 154
1533-AS27 usGfsaCfaCfcUfgAfuucUfguuucUfgasgsuAu  846 154
1533-AS28 usGfsaCfaCfcUfgAfuucUfguuUfcugasgsuAu  847 154
1533-CfinAS dTsGfsacaccUfgAfuucUfgUfuUfcUfgAfsgsuAu  848 110
AM05490-AS usGfsasGfaAfuGfaGfcCfuCfgAfuAfausu 1262 177
AM05492-AS cPrpTMsCfsgsUfaUfaAfCfAfaUfaAfgGfgGfcusu 1263 178
AM05493-AS cPrpTMsCfsgsUfaUfaAfcAfaUfaAfgGfgGfcusu 1264 178
AM05495-AS usCfsguauaaCfaaUfaAfgggGfcugCfscsuAu 1265 156
AM05496-AS usCfsguaUfaaCfaaUfaAfgggGfcugCfscsuAu 1266 156
AM05497-AS usCfsgUfaUfaacaaUfaAfgGfgGfcsUfsu 1267 164
AM05498-AS usCfsgsUfaUfaAfCfAfaUfaAfgGfgGfcusu 1268 164

TABLE 2A
LPA RNAi agent sense strands havingmodified nucleotides.
Sense SEQ SEQ
Strand ID SS Sequence 5′-3′ ID NO. ID NO.
AM01173-SS AfcGfcAfgAfaGfgGfaCfuGfcCfgAf(invdT)  849  190
AM01174-SS GfgGfgUfgCfaGfgAfgUfgCfuAfcAf(invdT)  850  191
AM01175-SS CfuGfuGfgCfaGfcCfcCfuUfaUfuAf(invdT)  851  192
AM01176-SS GfgCfaGfcCfcCfuUfaUfuGfuUfaAf(invdT)  852  193
AM01177-SS AfgCfcCfcUfuAfuUfgUfuAfuAfcAf(invdT)  853  194
AM01178-SS GfcCfcCfuUfaUfuGfuUfaUfaCfgAf(invdT)  854  195
AM01179-SS UfgAfcAfcAfaUfgCfuCfaGfaCfgAf(invdT)  855  196
AM01180-SS GfaCfaCfaAfuGfcUfcAfgAfcGfcAf(invdT)  856  197
AM01181-SS AfcAfcAfaUfgCfuCfaGfaCfgCfaAf(invdT)  857  198
AM01182-SS AfcAfaUfgCfuCfaGfaCggCfaGfaAf(invdT)  858  199
AM01183-SS CfuGfcCfgAfaAfuCfvAfgAfuCfcAf(invdT)  859  200
AM01184-SS GfcCfgAfaAfuCfcAfgAfuCfcUfgAf(invdT)  860  201
AM01185-SS UfgAfcAfcGfaUfgCfuCfaGfaUfgAf(invdT)  861  202
AM01186-SS GfaCfaCfgAfuGfcUfcAfgAfuGfcAf(invdT)  862  203
AM01187-SS AfcAfcGfaUfgCfuCfaGfaUfgCfaAf(invdT)  863  204
AM01188-SS AfcGfaUfgCfuCfaGfaUfgCfaGfaAf(invdT)  864  205
AM01189-SS UfcCfaAfgCfcUfaGfaGfgCfuUfuAf(invdT)  865  206
AM01190-SS AfgGfaAfaCfcCfvCfgGfgGfuAfcAf(invdT)  866  207
AM01191-SS GfgAfaAfcCfcCfcGfgGfgUfaCfaAf(invdT)  867  208
AM01192-SS GfaAfaCfcCfcCfgGfgGfuAfcAfgAf(invdT)  868  209
AM01193-SS UfgCfuAfcUfaCfcAfuUfaUfgGfaAf(invdT)  869  210
AM01194-SS GfcUfaCfuAfcCfaUfuAfuGfgAfcAf(invdT)  870  211
AM01195-SS CfuAfcCfaUfuAfuGfgAfcAfgAfgAf(invdT)  871  212
AM01196-SS AfcCfaCfaCfcAfgCfaUfaGfuCfgAf(invdT)  872  213
AM01197-SS CfcAfcAfcCfaGfcAfuAfgUfcGfgAf(invdT)  873  214
AM01198-SS CfaCfaCfcAfgCdaUfaGfuCfgGfaAf(invdT)  874  215
AM01199-SS CfaCfcAfgCfaUfaGfuCfgGfaCfcAf(invdT)  875  216
AM01200-SS AfuAfgUfcGfgAfcCfvCfaGfaAfaAf(invdT)  876  217
AM01201-SS UfaGfuCfgGfaCfcCfcAfgAfaAfaAf(invdT)  877  218
AM01202-SS CfcAfgAfuGfcUfgAfgAfuUfcGfcAf(invdT)  878  219
AM01203-SS GfcUfgAfgAfuUfcGfcCfcUfuGfgAf(invdT)  879  220
AM01204-SS CfuGfaGfaUfuCfgCfcCfuUfgGfuAf(invdT)  880  221
AM01205-SS UfgAfgAfuUfcGfcCfcUfuGfgUfgAf(invdT)  881  222
AM01206-SS GfaGfaUfuCfgCfvCfuUfgGfuGfuAf(invdT)  882  223
AM01207-SS AfuGfgAfuCfvCfaGfuGfuCfaGfgAf(invdT)  883  224
AM01208-SS GfaAfuCfaAfgUfgUfcCfuUfgCfaAf(invdT)  884  225
AM01209-SS AfaUfcAfaGfuGfuCfcUfuGfcAfaAf(invdT)  885  226
AM01210-SS GfaAfgCfaCfcAfaCfgGfaGfcAfaAf(invdT)  886  227
AM01211-SS GfaGfuUfaUfcGfaGfgCfuCfaUfuAf(invdT)  887  228
AM01212-SS AfgUfuAfuCfgAfgGfcUfcAfuUfcAf(invdT)  888  229
AM01213-SS GfaCfaAfcAfgAfaUfaUfuAfuCfcAf(invdT)  889  230
AM01214-SS CfuUfgGfuGfuUfaUfaCfcAfuGfgAf(invdT)  890  231
AM01215-SS GfgUfgUfuAfuAfcCfaUfgGfaUfcAf(invdT)  891  232
AM01216-SS UfaUfaCfcAfuGfgAfuCfvCfaAfuAf(invdT)  892  233
AM01217-SS AfuAfcCfaUfgGfaUfcCfcAfaUfgAf(invdT)  893  234
AM01218-SS UfaCfcAfuGfgAfuCfcCfaAfuGfuAf(invdT)  894  235
AM01219-SS AfcCfaUfgGfaUfcCfcAfaUfgUfcAf(invdT)  895  236
AM01220-SS GfcAfaCfcUfgAfcAfcAfaUfgUfcAf(invdT)  896  237
AM01221-SS CfuGfaCfaCfaAfuGfuCfcAfgUfgAf(invdT)  897  238
AM01222-SS CfcAfgUfgAfcAfgAfaUfcAfaGfuAf(invdT)  898  239
AM01223-SS UfuAfuCfgAfgGfcUfcAfuUfcUfcAf(invdT)  899  240
AM01224-SS AfgAfaUfaCfuAfcCfcAfaAfuGfgAf(invdT)  900  241
AM01225-SS AfaUfaCfuAfcCfcAfaAfuGfgUfgAf(invdT)  901  242
AM01226-SS AfuAfcUfaCfcCfaAfaUfgGfuGfgAf(invdT)  902  243
AM01227-SS AfuUfcGfcCfcUfuGfgUfgUfuAfuAf(invdT)  903  244
AM01228-SS UfaUfaCfcAfuGfgAfuCfcCfaGfuAf(invdT)  904  245
AM01229-SS AfuAfcCfaUfgGfaUfcCfcAfgUfgAf(invdT)  905  246
AM01230-SS CfaCfaAfcUfcCfcAfcGfgUfgGfuAf(invdT)  906  247
AM01231-SS AfaGfaAfcAfuGfuCfaGfuCfuUfgAf(invdT)  907  248
AM01232-SS AfgUfgUfcCfuCfaCfaAfcUfcCfcAf(invdT)  908  249
AM01233-SS AfaCfaAfgCfaCfcAfcCfuGfaGfaAf(invdT)  909  250
AM01234-SS CfcUfgAfgAfaAfaGfcCfcUfgUfgAf(invdT)  910  251
AM01235-SS UfgAfuAfcCfaCfaCfuGfgCfaUfcAf(invdT)  911  252
AM01236-SS GfaUfaCfcAfcAfcUfgGfcAfuCfaAf(invdT)  912  253
AM01237-SS GfaAfaCfaGfaAfuCfaGfgUfgUfcAf(invdT)  913  254
AM01238-SS AfaAfcAfgAfaUfcAfgGfuGfuCfcAf(invdT)  914  255
AM01239-SS CfaGfaAfuCfaGfgUfgUfcCfuAfgAf(invdT)  915  256
AM01795-SS CfcUfgUfgGfcAfgCfcCfcUfuAfuAf(invdT)  916  257
AM01797-SS UfgGfcAfgCfcCfcUfuAfuUfgUfuAf(invdT)  917  258
AM01799-SS AfcAfcCfaGfcAfuAfgUfcGfgAfcAf(invdT)  918  259
AM01801-SS GfgAfaUfcCfaGfaUfgCfuGfaGfaAf(invdT)  919  260
AM01803-SS UfcCfaGfaUfgCfuGfaGfaUfuCfgAf(invdT)  920  261
AM01805-SS AfuGfcUfgAfgAfuUfcGfcCfcUfuAf(invdT)  921  262
AM01807-SS CfcAfuGfgAfuCfcCfaGfuGfuCfaAf(invdT)  922  263
AM01809-SS CfuGfaAfgAfaGfcAfcCfaAfcGfgAf(invdT)  923  264
AM01811-SS UfcCfaGfuGfaCfaGfaAfuCfaAfgAf(invdT)  924  265
AM01813-SS CfuCfaCfaAfcUfcCfcAfcGfgUfgAf(invdT)  925  266
AM01815-SS AfgAfaUfcAfgGfuGfuCfcUfaGfaAf(invdT)  926  267
AM01817-SS UfcAfgGfuGfuCfcUfaGfaGfaCfuAf(invdT)  927  268
AM02006-SS (Chol-TEG)uAuAfgCfcCfcUfUfAfuUfgUfuAfuAfcAf(invdT)  928  269
AM02010-SS (Chol-TEG)uAuGfcCfcCfuUfAfUfuGfuUfaUfaCfgAf(invdT)  929  270
AM02014-SS (Chol-TEG)uAuGfaCfaCfaAfUfGfcUfcAfgAfcGfcAf(invdT)  930  271
AM02018-SS (Chol-TEG)uAuAfcAfcAfaUfGfCfuCfaGfaCfgCfaAf(invdT)  931  272
AM02022-SS (Chol-TEG)uAuUfuAfuCfgAfGfGfcUfcAfuUfcUfcAf(invdT)  932  273
AM02026-SS (Chol-TEG)uAuGfaAfaCfaGfAfAfuCfaGfgUfgUfcAf(invdT)  933  274
AM02030-SS (Chol-TEG)uAuAfcAfcCfaGfCfAfuAfgUfcGfgAfcAf(invdT)  934  275
AM02034-SS (Chol-TEG)uAuUfcCfaGfaUfGfCfuGfaGfaUfuCfgAf(invdT)  935  276
AM02038-SS (Chol-TEG)uAuAfuGfcUfgAfgAfuUfcGfcCfcUfuAf(invdT)  936  277
AM02042-SS (Chol-TEG)uAuCfcAfuGfgAfUfCfcCfaGfuGfuCfaAf(invdT)  937  278
AM02211-SS UfgUfgGfcAfGfCfcCfcUfuAfuUfgAf(invdT)  938  279
AM02212-SS CfaCfaAfuGfCfUfcAfgAfcGfcAfgAf(invdT)  939  280
AM02213-SS CfcGfaAfaUfCfCfaGfaUfcCfuGfuAf(invdT)  940  281
AM02214-SS GfaCfuGfaGfGfAfaAfcCfcCfcGfgAf(invdT)  941  282
AM02215-SS CfuAfcUfaCfCfAfuUfaUfgGfaCfaAf(invdT)  942  283
AM02216-SS AfcUfaCfcAfUfUfaUfgGfaCfaGfaAf(invdT)  943  284
AM02217-SS UfaCfcAfuUfAfUfgGfaCfaGfaGfuAf(invdT)  944  285
AM02218-SS AfcCfaUfuAfUfGfgAfcAfgAfgUfuAf(invdT)  945  286
AM02219-SS AfgAfuGfcUfGfAfgAfuUfcGfcCfcAf(invdT)  946  287
AM02220-SS GfaUfgCfuGfAfGfaUfuCfgCfcCfuAf(invdT)  947  288
AM02221-SS AfgAfuUfcGfCfCfcUfuGfgUfgUfuAf(invdT)  948  289
AM02222-SS GfaCfaGfaAfUfCfaAfgUfgUfcCfuAf(invdT)  949  290
AM02223-SS AfcAfuGfuCfAfGfuCfuUfgGfuCfcAf(invdT)  950  291
AM02224-SS CfcAfaAfuGfGfUfgGfcCfuGfaCfcAf(invdT)  951  292
AM02225-SS UfgGfuGfuUfAfUfaCfcAfuGfgAfuAf(invdT)  952  293
AM02226-SS UfgUfuAfuAfCfCfaUfgGfaUfcCfcAf(invdT)  953  294
AM02227-SS AfaCfcUfgAfCfAfcAfaUfgUfcCfaAf(invdT)  954  295
AM02228-SS AfaUfgUfcCfAfGfuGfaCfaGfaAfuAf(invdT)  955  296
AM02229-SS UfgUfuUfcUfGfAfaCfaAfgCfaCfcAf(invdT)  956  297
AM02230-SS UfaUfcGfaGfGfCfuCfaUfuCfuCfcAf(invdT)  957  298
AM02231-SS UfcGfaGfgCfUfCfaUfuCfuCfcAfcAf(invdT)  958  299
AM02232-SS UfcCfuCfaCfAfAfcUfcCfcAfcGfgAf(invdT)  959  300
AM02233-SS CfaAfcUfcCfCfAfcGfgUfgGfuCfcAf(invdT)  960  301
AM02234-SS GfcUfcCfuUfCfUfgAfaCfaAfgCfaAf(invdT)  961  302
AM02235-SS AfuAfcCfaCfAfCfuGfgCfaUfcAfgAf(invdT)  962  303
AM02236-SS AfcAfgAfaUfCfAfgGfuGfuCfcUfaAf(invdT)  963  304
AM02237-SS GfaAfuCfaGfGfUfgUfcCfuAfgAfgAf(invdT)  964  305
AM02238-SS AfaUfcAfgGfUfGfuCfcUfaGfaGfaAf(invdT)  965  306
AM02239-SS AfuCfaGfgUfGfUfcCfuAfgAfgAfcAf(invdT)  966  307
AM02441-SS uAuAusAfsgUfuAfuCfgAfgGfcUfcAfuUfcUfcAf(C6-SS-Alk-Me)  967  308
AM02442-SS uAuAusAfsgUfuAfuCfgaGfGfcUfcAfuUfcUfcAf(C6-SS-Alk-Me)  968  308
AM02443-SS uAuAusAfsgUfuAfuCfGfaGfGfcUfcAfuUfcUfcAf(C6-SS-Alk-Me)  969  308
AM02444-SS uAuAusasGfuUfaUfcGfaGfGfcUfcAfuUfcUfcAf(C6-SS-Alk-Me)  970  308
AM02445-SS uAuAusCfsaGfaAfaCfaGfaAfuCfaGfgUfgUfcAf(C6-SS-Alk-Me)  971  309
AM02446-SS uAuAusCfsaGfaAfaCfagAfAfuCfaGfgUfgUfcAf(C6-SS-Alk-Me)  972  309
AM02447-SS uAuAusCfsaGfaAfaCfAfgAfAfuCfaGfgUfgUfcAf(C6-SS-Alk-Me)  973  309
AM02448-SS uAuAuscsAfgAfaAfcAfgAfAfuCfaGfgUfgUfcAf(C6-SS-Alk-Me)  974  309
AM02537-SS uAuAusCfsaGfcCfcCfuUfAfUfuGfuUfaUfaCfgAf(C11-PEG3-NAG3)  975  310
AM02538-SS uAuAusCfsuGfaCfaCfaAfUfGfcUfcAfgAfcGfcAf(C11-PEG3-NAG3)  976  311
AM02539-SS uAuAusUfsgAfcAfcAfaUfGfCfuCfaGfaCfgCfaAf(C11-PEG3-NAG3)  977  312
AM02540-SS uAuAusAfsgUfuAfuCfgAfGfGfcUfcAfuUfcUfcAf(C11-PEG3-NAG3)  978  308
AM02541-SS uAuAusCfsaGfaAfaCfaGfAfAfuCfaGfgUfgUfcAf(C11-PEG3-NAG3)  979  309
AM02542-SS uAuAusAfsgAfuGfcUfgAfGfAfuUfcGfcCfcUfuAf(C11-PEG3-NAG3)  980  313
AM02793-SS gsCfsaGfcCfcCfuUfaUfuGfuUfa(invdA)  981  314
AM02794-SS gsCfscCfcUfuAfuUfgUfuAfuAfc(invdA)  982  315
AM02795-SS csCfscCfuUfaUfuGfuUfaUfaCfg(invdA)  983  316
AM02796-SS asCfsaCfaAfuGfcUfcAfgAfcGfc(invdA)  984  317
AM02797-SS csAfscAfaUfgCfuCfaGfaCfgCfa(invdA)  985  318
AM02798-SS csCfsgAfaAfuCfcAfgAfuCfcUfg(invdA)  986  319
AM02799-SS csAfscGfaUfgCfuCfaGfaUfgCfa(invdA)  987  320
AM02800-SS csCfsaCfaCfcAfgCfaUfaGfuCfg(invdA)  988  321
AM02801-SS usAfsgUfcGfgAfcCfcCfaGfaAfa(invdA)  989  322
AM02802-SS csAfsgAfuGfcUfgAfgAfuUfcGfc(invdA)  990  323
AM02803-SS asAfsuCfaAfgUfgUfcCfuUfgCfa(invdA)  991  324
AM02804-SS asGfsuUfaUfcGfaGfgCfuCfaUfu(invdA)  992  325
AM02805-SS gsUfsuAfuCfgAfgGfcUfcAfuUfc(invdA)  993  326
AM02806-SS csAfsaCfcUfgAfcAfcAfaUfgUfc(invdA)  994  327
AM02807-SS usAfsuCfgAfgGfcUfcAfuUfcUfc(invdA)  995  328
AM02808-SS gsAfsaUfaCfuAfcCfcAfaAfuGfg(invdA)  996  329
AM02809-SS asUfsaCfuAfcCfcAfaAfuGfgUfg(invdA)  997  330
AM02810-SS asAfsaCfaGfaAfuCfaGfgUfgUfc(invdA)  998  331
AM02811-SS asAfscAfgAfaUfcAfgGfuGfuCfc(invdA)  999  332
AM02812-SS CfsasGfcCfcCfuUfaUfuGfuUfa(invdA) 1000  333
AM02813-SS CfscsCfcUfuAfuUfgUfuAfuAfc(invdA) 1001  334
AM02814-SS CfscsCfuUfaUfuGfuUfaUfaCfg(invdA) 1002  335
AM02815-SS CfsasCfaAfuGfcUfcAfgAfcGfc(invdA) 1003  336
AM02816-SS AfscsAfaUfgCfuCfaGfaCfgCfa(invdA) 1004  337
AM02817-SS CfsgsAfaAfuCfcAfgAfuCfcUfg(invdA) 1005  338
AM02818-SS AfscsGfaUfgCfuCfaGfaUfgCfa(invdA) 1006  339
AM02819-SS CfsasCfaCfcAfgCfaUfaGfuCfg(invdA) 1007  340
AM02820-SS AfsgsUfcGfgAfcCfcCfaGfaAfa(invdA) 1008  341
AM02821-SS AfsgsAfuGfcUfgAfgAfuUfcGfc(invdA) 1009  342
AM02822-SS AfsusCfaAfgUfgUfcCfuUfgCfa(invdA) 1010  343
AM02823-SS GfsusUfaUfcGfaGfgCfuCfaUfu(invdA) 1011  344
AM02824-SS UfsusAfuCfgAfgGfcUfcAfuUfc(invdA) 1012  345
AM02825-SS AfsasCfcUfgAfcAfcAfaUfgUfc(invdA) 1013  346
AM02826-SS AfsusCfgAfgGfcUfcAfuUfcUfc(invdA) 1014  347
AM02827-SS AfsasUfaCfuAfcCfcAfaAfuGfg(invdA) 1015  348
AM02828-SS UfsasCfuAfcCfcAfaAfuGfgUfg(invdA) 1016  349
AM02829-SS AfsasCfaGfaAfuCfaGfgUfgUfc(invdA) 1017  350
AM02830-SS AfscsAfgAfaUfcAfgGfuGfuCfc(invdA) 1018  351
AM02861-SS uAuAusAfsgUfuauCfgAfGfGfcUfcAfuUfcUfcAf(C11-PEG3-NAG3) 1019  308
AM02941-SS uAuAusasguuaucgAfgGfcucauucuca(C11-PEG3-NAG3) 1020  308
AM02942-SS uAuAusasguuaucgaGfGfcucauucuca(C11-PEG3-NAG3) 1021  308
AM02946-SS uAuAuscsagaaaCfagAfAfuCfagguguca(C11-PEG3-NAG3) 1022  309
AM02947-SS uAuAuscsagaaaCfaGfaAfuCfagguguca(C11-PEG3-NAG3) 1023  309
AM02948-SS uAuAuscsagaaacaGfaAfucagguguca(C11-PEG3-NAG3) 1024  309
AM02949-SS uAuAuscsagaaacagAfAfucagguguca(C11-PEG3-NAG3) 1025  309
AM03030-SS (Stearyl)uAuAusCfsaGfaAfaCfaGfAfAfuCfaGfgUfgUfcAf(C11-PEG3-NAG3) 1026  309
AM03036-SS uAuAusCfsagaAfaCfaGfAfAfuCfaGfgUfgUfcAf(C11-PEG3-NAG3) 1027  309
AM03037-SS uAuAusCfsagaaaCfaGfAfAfuCfaGfgUfgUfcAf(C11-PEG3-NAG3) 1028  309
AM03038-SS uAuAusCfsagaaaCfagaAfuCfaggUfgUfcAf(C11-PEG3-NAG3) 1029  309
AM03039-SS uAuAusCfsaGfaAfaCfaGfAfAfuCfagGfuGfucAf(C11-PEG3-NAG3) 1030  309
AM03042-SS uAuAusCfsaGfaAfaCfaGfAfAfucagguguca(C11-PEG3-NAG3) 1031  309
AM03060-SS uAuAusCfsaGfaAfaCfaGfAfAfuCfaggugUfca(C11-PEG3-NAG3) 1032  309
AM03061-SS uAuAusCfsaGfaAfaCfaGfAfAfuCfagguguca(C11-PEG3-NAG3) 1033  309
AM03062-SS uAuAusCfsagaaaCfaGfAfAfuCfaggugUfca(C11-PEG3-NAG3) 1034  309
AM03064-SS uAuAusCfsaGfaAfaCfaGfaAfuCfaGfgugucAf(C11-PEG3-NAG3) 1035  309
AM03122-SS uAuAusAfsgUfuAfuCfgAfGfGfcUfcAfuUfcUfCMAM(C11-PEG3-NAG3) 1036  308
AM03123-SS uAuAUuNAAfsgsUfuAfuCfgAfGfGfcUfcAfuUfcUfcAf(C11-PEG3-NAG3) 1037  308
AM03124-SS uAuAuAfsgsUfuAfuCfgAfGfGfcUfcAfuUfcUfcAf(C11-PEG3-NAG3) 1038  308
AM03125-SS uAuAusCfsaGfcCfcCfuUfAfUfuGfuUfaUfaCfga(C11-PEG3-NAG3) 1039  310
AM03126-SS uAuAuscsaGfcCfcCfuUfAfUfuGfuUfaUfaCfgAf(C11-PEG3-NAG3) 1040  310
AM03128-SS uAuAuscsaGfcCfcCfuUfAfUfuGfuUfaUfaCfga(C11-PEG3-NAG3) 1041  310
AM03144-SS uAuAusAfsgUfuAfuCfgAfGfGfcUfcAfuUfcUfcAf(C6-PEG4-NAG3) 1042  308
AM03220-SS uAuAusAfsgUfuAfuCfgAfGfGfcUfcauucuca 1043  308
1532-SS01
AM03221-SS uAuAusAfsgUfuAfuCfgAfGfGfcucauucuca 1044  308
AM03222-SS uAuAusAfsguuauCfgAfGfGfcUfcauucuca 1045  308
AM03223-SS uAuAusAfsguuauCfgAfGfGfcucauucuca 1046  308
AM03224-SS uAuAusasguuauCfgAfGfGfcucauucuca 1047  308
AM03225-SS uAuAusasguuaucgAfGfGfcucauucuca 1048  308
AM03226-SS uAuAusAfsgUfuAfuCfgAfGfdGcUfcauucuca 1049  308
AM03227-SS uAuAusAfsgUfuAfuCfgAfGfdGcucauucuca 1050  308
AM03228-SS uAuAusAfsguuauCfgAfGfdGcUfcauucuca 1051  308
AM03229-SS uAuAusAfsguuauCfgAfGfdGcucauucuca 1052  308
AM03230-SS uAuAusasguuauCfgAfGfdGcucauucuca 1053  308
AM03231-SS uAuAusasguuaucgAfGfdGcucauucuca 1054  308
AM03232-SS uAuAusAfsgUfuAfuCfgaGfGfcUfcauucuca 1055  308
AM03233-SS uAuAusAfsgUfuAfuCfgaGfGfcucauucuca 1056  308
AM03234-SS uAuAusAfsguuauCfgaGfGfcUfcauucuca 1057  308
AM03235-SS uAuAusAfsguuauCfgaGfGfcucauucuca 1058  308
AM03236-SS uAuAusasguuauCfgaGfGfcucauucuca 1059  308
AM03237-SS uAuAusasguuaucgaGfGfcucauucuca 1060  308
AM03238-SS uAuAusAfsgUfuAfuCfgAfGfGfcUfcauucuca(C11-PEG3-NAG3) 1061  308
AM03240-SS uAuAusAfsguuauCfgAfGfGfcUfcauucuca(C11-PEG3-NAG3) 1062  308
AM03330-SS uAuAusAfsgUfuAfuCfgAfGfGfcUfcAfuUfcUfcAf 1063  308
1532-SS00
AM03291-SS uAuAusCfsaGfcCfcCfuUfAf UfuGfuUfaUfaCfgAf 1064  310
AM03292-SS uAuAusCfsagcCfcCfuUfaUfuguUfaUfaCfga 1065  310
AM03293-SS uAuAusCfsagcCfcCfuUfaUfuguuauaCfga 1066  310
AM03294-SS uAuAuscsagccccuUfaUfuguuauacga 1067  310
AM03295-SS uAuAuscsagccccuuAfUfuguuauacga 1068  310
AM03296-SS uAuAusCfsagcCfcCfuUfAfUfuguUfaUfaCfga 1069  310
AM03297-SS uAuAusCfsagcCfcCfuUfAfUfuguuauaCfga 1070  310
AM03298-SS uAuAuscsagccccuUfAfUfuguuauacga 1071  310
AM03299-SS uAuAusCfsagcCfcCfuuAfUfuguuauaCfga 1072  310
AM03277-SS uAuAuscsagccccuUfaUfuguuauacga(C11-PEG3-NAG3) 1073  310
AM03275-SS uAuAusCfsagcCfcCfuUfaUfuguUfaUfaCfga(C11-PEG3-NAG3) 1074  310
AM03276-SS uAuAusCfsagcCfcCfuUfaUfuguuauaCfga(C11-PEG3-NAG3) 1075  310
AM03278-SS uAuAuscsagccccuuAfUfuguuauacga(C11-PEG3-NAG3) 1076  310
AM03287-SS uAuAusCfsagcCfcCfuUfAfUfuguUfaUfaCfga(C11-PEG3-NAG3) 1077  310
AM03288-SS uAuAusCfsagcCfcCfuUfAfUfuguuauaCfga(C11-PEG3-NAG3) 1078  310
AM03289-SS uAuAuscsagccccuUfAfUfuguuauacga(C11-PEG3-NAG3) 1079  310
AM03290-SS uAuAusCfsagcCfcCfuuAfUfuguuauaCfga(C11-PEG3-NAG3) 1080  310
AM03243-SS uAuAusasguuaucgAfGfGfcucauucuca(C11-PEG3-NAG3) 1081  308
AM03424-SS (Chol-TEG)uAuAusasguuaucgaGfGfcucauucuc(invdA) 1082  308
AM03425-SS (Chol-TEG)uAuAusasguuaucgaGfGfcucauucuca 1083  308
AM03426-SS (Chol-TEG)uAuAusAfgUfuAfuCfgAfGfGfcUfcAfuUfcUfc(invdA) 1084  308
AM03457-SS CfscsCfcUfuAfuUfgUfuAfuAfca(NAG13) 1085  334
AM03458-SS CfscsCfuUfaUfuGfuUfaUfaCfga(NAG13) 1086  335
AM03459-SS AfsgsAfuGfcUfgAfgAfuUfcGfca(NAG13) 1087  342
AM03460-SS GfsusUfaUfcGfaGfgCfuCfaUfua(NAG13) 1088  344
AM03461-SS AfsusCfgAfgGfcUfcAfuUfcUfca(NAG13) 1089  347
AM03462-SS AfsasCfaGfaAfuCfaGfgUfgUfca(NAG13) 1090  350
AM03489-SS uAuAusasguuaucgaGfGfcucauucuca(NAG13) 1091  308
AM03492-SS uAuAusCfsaGfcCfcCfuUfAfUfuGfuUfaUfaCfga(NAG13) 1092  310
AM03544-SS uAuAuscsagcccCfuUfaUfuguuauacga(NAG13) 1093  310
AM03545-SS uAuAuscsagccccuuAfUfuGfuuauacga(NAG13) 1094  310
AM03546-SS uAuAuscsagccccuUfAfUfuguuauacga(NAG13) 1095  310
AM03547-SS uAuAusAfsgUfuAfuCfgAfGfGfcUfcAfuUfcUfcAf(NAG13) 1096  308
AM03650-SS uAuAusasguuaucgAfGfGfcucauucuca(NAG13) 1097  308
AM03651-SS uAuAuscsaGfcCfcCfuUfAfUfuGfuUfaUfaCfga(NAG13) 1098  310
AM03670-SS uAuAuscsagcgccuUfAfUfuguuauacga(NAG13) 1099  352
AM03683-SS uAuAuscsaGfcCfcCfuUfAfUfuGfuUfaUfaCfga 1100  310
AM03741-SS cscsccUfUfAfuuguuauaca(NAG13) 1101  334
AM03742-SS cscsccUfUfAfuuguuauaCMAM(NAG13) 1102  334
AM03743-SS CMsCMsccUfUfAfuuguuauaCMAM(NAG13) 1103  334
AM03746-SS cscscuUfAfUfuguuauacga(NAG13) 1104  335
AM03747-SS cscscuUfAfUfuguuauacGMAM(NAG13) 1105  335
AM03748-SS CMsCMscuUfAfUfuguuauacGMAM(NAG13) 1106  335
AM03751-SS asuscgAfGfGfcucauucuca(NAG13) 1107  347
AM03752-SS asuscgAfGfGfcucauucuCMAM(NAG13) 1108  347
AM03753-SS AMsTMscgAfGfGfcucauucuCMAM(NAG13) 1109  353
AM03757-SS asascaGfAfAfucagguguca(NAG13) 1110  350
AM03758-SS asascaGfAfAfucagguguCMAM(NAG13) 1111  350
AM03759-SS AMsAMscaGfAfAfucagguguCMAM(NAG13) 1112  350
AM03859-SS (NAG18)uauausasguuaucgAfGfGfcucauucuc(invdA) 1113  308
AM03861-SS (NAG18)uauauscsaGfcCfcCfuUfAfUfuGfuUfaUfaCfg(invdA) 1114  310
AM03879-SS (NAG4)uscaGfcCfcCfuUfAfUfuGfuUfaUfaCfgausu(invAb) 1115  354
AM03880-SS (NAG4)uscaGfcCfcCfuUfAfUfuGfuUfaUfaCfgsa(invAb) 1116  355
AM03881-SS (NAG24)uscaGfcCfcCfuUfAfUfuGfuUfaUfaCfgausu(invAb) 1117  354
AM03882-SS (NAG4)usaguuaucgAfGfGfcucauucucausu(invAb) 1118  356
AM03928-SS uAuAuscsagcccCfuUfAfUfuguuauacga(NAG13) 1119  310
AM03931-SS uAuAusasguuauCfgAfGfGfcucauucuca(NAG13) 1120  308
AM03968-SS (NAG4)uauauscaGfcCfcCfuUfAfUfuGfuUfaUfaCfgs(invdA) 1121  310
AM03970-SS (NAG4)(invAb)GfcCfcCfuUfAfUfuGfuUfaUfaCfgausu(invAb) 1122  357
AM04138-SS (NAG25)uauausasguuaucgAfGfGfcucauucuc(invdA) 1123  308
AM04152-SS (Alk-PEG5-C6)uauausasguuaucgAfGfGfcucauucuCM(invdA) 1124  308
AM04214-SS (Alk-SMPT-C6)uauausasguuaucgAfGfGfcucauucuCM(invdA) 1125  308
AM04233-SS (NAG26)uauausasguuaucgAfGfGfcucauucuCM(invdA) 1126  308
AM04372-SS (NAG27)uauausasguuaucgAfGfGfcucauucuCM(invdA) 1127  308
AM04381-SS (NAG25)auauscsagccccuUfAfUfuguuauacga(invdT) 1128  358
AM04382-SS (NAG25)uauscsagccccuUfAfUfuguuauacgau(invdT) 1129  359
AM04391-SS (NAG25)auausasguuaucgAfGfGfcucauucuca(invdT) 1130  360
AM04392-SS (NAG25)uausasguuaucgAfGfGfcucauucucau(invdT) 1131  361
AM04412-SS (NAG25)uauauscsagccccuUfAfUfuguuauacg(invdA) 1132  310
AM04414-SS (NAG25)(invAb)gccccuUfAfUfuguuauacgauus(invAb) 1133  357
AM04416-SS (NAG25)(invAb)uuaucgAfGfGfcucauucucausu(invAb) 1134  362
AM04496-SS (NAG25)(invAb)GfcCfcCfuUfAfUfuGfuUfaUfaCfgausu(invAb) 1135  357
AM04497-SS (NAG29)uauausasguuaucgAfGfGfcucauucuc(invdA) 1136  308
AM04499-SS (NAG28)(invAb)GfcCfcCfuUfAfUfuGfuUfaUfaCfgausu(invAb) 1137  357
AM04498-SS (NAG29)uauauaasuuaucgaGfGfcucauucucsa(invAb) 1138  363
AM04500-SS (NAG30)(invAb)GfcCfcCfuUfAfUfuGfuUfaUfaCfgausu(invAb) 1139  357
AM04502-SS (NAG25)uauauaasuuaucgaGfGfcucauucucsa(invAb) 1140  363
AM04535-SS (NAG25)uauaucsasgccccuUfAfUfuguuauacg(invdA) 1141  310
AM04536-SS (NAG25)uauaucasgccccuUfAfUfuguuauacg(invdA) 1142  310
AM04537-SS (NAG25)uauauasgsuuaucgAfGfGfcucauucuc(invdA) 1143  308
AM04538-SS (NAG25)uauauagsuuaucgAfGfGfcucauucuc(invdA) 1144  308
AM04543-SS (NAG30)uscaGfcCfcCfuUfAfUfuGfuUfaUfaCfgsa(invAb) 1145  355
AM04578-SS (NAG25)ggcsagccccuUfAfUfuguuauacgAMs(invdT)dT 1146  364
AM04588-SS (NAG25)ggcsagccccuUfAfUfuguuauacgAMsuu(invdT) 1147  365
AM04579-SS (NAG25)GuNAgcsagccccuUfAfUfuguuauacgAMs(invdT)dT 1148  364
AM04580-SS (NAG25)ggcs(invdA)gccccuUfAfUfuguuauacgAMs(invdT)dT 1149  364
AM04581-SS (NAG25)csagccccuUfAfUfuguuauacgAMs(invdT)dTdTdT 1150  366
AM04611-SS (NAG31)(invAb)GfcCfcCfuUfAfUfuGfuUfaUfaCfgausu(invAb) 1151  357
AM04612-SS (NAG32)(invAb)GfcCfcCfuUfAfUfuGfuUfaUfaCfgausu(invAb) 1152  357
AM04669-SS (NAG25)uauauagsusuaucgAfGfGfcucauucuc(invdA) 1153  308
AM04670-SS (NAG25)uauauagususaucgAfGfGfcucauucuc(invdA) 1154  308
AM04671-SS (NAG25)gcgausasguuaucgAfGfGfcucauucuc(invdA) 1155  367
AM04672-SS (NAG25)ugaausasguuaucgAfGfGfcucauucuc(invdA) 1156  368
AM04673-SS (NAG25)aucgusasguuaucgAfGfGfcucauucuc(invdA) 1157  369
AM04674-SS (NAG25)u(invdA)uausasguuaucgAfGfGfcucauucuc(invdA) 1158  308
AM04675-SS (NAG25)uaua(invdA)sasguuaucgAfGfGfcucauucuc(invdA) 1159  370
AM04676-SS (NAG25)uauaus(invdA)sguuaucgAfGfGfcucauucuc(invdA) 1160  308
AM04726-SS (NAG30)aGfcCfcCfuUfAfUfuGfuUfaUfaCfgsa(invAb) 1161  371
AM04727-SS (NAG30)aaGfcCfcCfuUfAfUfuGfuUfaUfaCfgsa(invAb) 1162  372
AM04728-SS (NAG30)sasGfcCfcCfuUfAfUfuGfuUfaUfaCfgas(invAb) 1163  371
AM04729-SS (NAG30)gscaGfcCfcCfuUfAfUfuGfuUfaUfaCfgsa(invAb) 1164  373
AM04737-SS (NAG25)uauauagsuuaucgaGfGfcucauucucsa(invAb) 1165  374
AM04741-SS (NAG30)sgscaGfcCfcCfuUfAfUfuGfuUfaUfaCfgsa(invAb) 1166  373
AM04742-SS (NAG33)(invAb)GfcCfcCfuUfAfUfuGfuUfaUfaCfgausu(invAb) 1167  357
AM04743-SS (NAG34)(invAb)GfcCfcCfuUfAfUfuGfuUfaUfaCfgausu(invAb) 1168  357
AM04744-SS (NAG35)(invAb)GfcCfcCfuUfAfUfuGfuUfaUfaCfgausu(invAb) 1169  357
AM04803-SS (NAG30)acGfcCfcCfuUfAfUfuGfuUfaUfaCfgsa(invAb) 1170  375
AM04804-SS (NAG30)sasaGfcCfcCfuUfAfUfuGfuUfaUfaCfgas(invAb) 1171  372
AM04807-SS (NAG30)sascGfcCfcCfuUfAfUfuGfuUfaUfaCfgas(invAb) 1172  375
AM04806-SS (NAG30)sgscaGfcCfcCfuUfAfUfuGfuUfaUfaCfgas(invAb) 1173  373
AM04808-SS (NAG31)sGfcCfcCfuUfAfUfuGfuUfaUfaCfgausu(invAb) 1174  376
AM04809-SS (NAG31)saGfcCfcCfuUfAfUfuGfuUfaUfaCfgausu(invAb) 1175  377
AM04810-SS (NAG31)sasaGfcCfcCfuUfAfUfuGfuUfaUfaCfgas(invAb) 1176  372
AM04811-SS (NAG31)sasaGfcCfcCfuUfAfUfuGfuUfaUfaCfgausu(invAb) 1177  378
AM04812-SS (NAG31)sasaGfcCfcCfuUfAfUfuGfuUfaUfaCfg(invdA)usu(invAb) 1178  378
AM04813-SS (NAG31)uauausasguuaucgAfGfGfcucauucuc(invdA) 1179  308
AM04816-SS (NAG31)uauscsagccccuUfAfUfuguuauacgs(invdA) 1180  379
AM04817-SS (NAG31)uagscsagccccuUfAfUfuguuauacgs(invdA) 1181  380
AM04835-SS (NAG31)uaucagccccuUfAfUfuguuauacgs(invdA) 1182  379
AM04819-SS (NAG31)sgscagccccuUfAfUfuguuauacgs(invdA) 1183  381
AM04820-SS (NAG31)sgscagccccuUfAfUfuguuauacgsa(invAb) 1184  373
AM04862-SS (NAG25)auaagasguuaucgAfGfGfcucauucuc(invdA) 1185  382
AM04863-SS (NAG25)auaagsasguuaucgAfGfGfcucauucuc(invdA) 1186  382
AM04864-SS (NAG25)auaggcsagccccuUfAfUfuguuauacg(invdA) 1187  383
AM04865-SS (NAG25)auaggscsagccccuUfAfUfuguuauacg(invdA) 1188  383
AM04866-SS (NAG25)scsagccccuUfAfUfuguuauacgs(invdA) 1189  384
AM04867-SS (NAG31)scsagccccuUfAfUfuguuauacgs(invdA) 1190  384
AM04868-SS (NAG25)sgsccccuUfAfUfuguuauacgauus(invAb) 1191  376
AM04869-SS (NAG31)sgsccccuUfAfUfuguuauacgauus(invAb) 1192  376
AM04870-SS (NAG25)sGfsccccuUfAfUfuguuauacgauus(invAb) 1193  376
AM04978-SS (NAG31)sGfscCfcCfuUfAfUfuGfuUfaUfaCfgauus(invAb) 1194  376
AM05070-SS (NAG25)uauauscsagcccc(NOTA-dT)UfAfUfuguuauacg(invdA) 1195  385
AM05072-SS (NAG25)(invAb)GfcCfcCf(NOTA-dT)UfAfUfuGfuUfaUfaCfgausu(invAb) 1196 1241
1532-SS02 uAuAusAfsgUfuAfuCfgAfGfGfcucAfuucuca 1197  308
1532-SS03 uAuAusAfsgUfuAfuCfgAfGfGfcucauUfcuca 1198  308
1532-SS04 uAuAusAfsgUfuAfuCfgAfGfGfcucauucUfca 1199  308
1532-SS05 uAuAusAfsgUfuAfuCfgAfGfGfcucauucucAf 1200  308
1532-SS06 uAuAusAfsgUfuAfuCfgAfgGfcUfcauucucAf 1201  308
1532-SS07 uAuAusAfsgUfuAfuCfgAfgGfcucAfuucucAf 1202  308
1532-SS08 uAuAusAfsgUfuAfuCfgAfgGfcucauUfcucAf 1203  308
1532-SS09 uAuAusAfsgUfuAfuCfgAfgGfcucauucUfcAf 1204  308
1532-SS10 uAuAusAfsgUfuAfuCfgAfgGfcucauucucAf 1205  308
1532-SS11 uAuAusAfsgUfuAfuCfgaGfGfcucauucucAf 1206  308
1532-SS12 uAuAusAfsgUfuAfuCfgagGfcUfcauucucAf 1207  308
1532-SS13 uAuAusAfsgUfuAfuCfgagGfcucAfuucucAf 1208  308
1532-SS14 uAuAusAfsgUfuAfuCfgagGfcucauUfcucAf 1209  308
1532-SS15 uAuAusAfsgUfuAfuCfgagGfcucauucUfcAf 1210  308
1532-SS16 uAuAusAfsgUfuAfuCfgagGfcucauUfcUfcAf 1211  308
1532-SS17 uAuAusAfsgUfuauCfgAfgGfcucauUfcUfcAf 1212  308
1532-SS18 uAuAusAfsgUfuauCfgaGfGfcucauUfcUfcAf 1213  308
1532-SS19 uAuAusAfsgUfuauCfgagGfcUfcauUfcUfcAf 1214  308
1532-SS20 uAuAusAfsgUfuauCfgagGfcucAfuUfcUfcAf 1215  308
1532-SS21 uAuAusAfsgUfuauCfgagGfcUfcAfuUfcUfcAf 1216  308
1532-SS22 uAuAusAfsguuAfuCfgagGfcUfcAfuUfcUfcAf 1217  308
1532-SS23 uAuAusAfsguuauCfgAfgGfcUfcAfuUfcUfcAf 1218  308
1532-SS24 uAuAusAfsguuauCfgaGfGfcUfcAfuUfcUfcAf 1219  308
1533-CfinSS uAuAuscsaGfaAfacaGfAfAfucaGfgUfgUfcAf 1220  309
1533-SS00 uAuAusCfsaGfaAfaCfaGfAfAfuCfaGfgUfgUfcAf 1221  309
1533-SS01 uAuAusCfsaGfaAfaCfaGfAfAfuCfaGfguguca 1222  309
1533-SS02 uAuAusCfsaGfaAfaCfaGfAfAfuCfaggugUfca 1223  309
1533-SS03 uAuAusCfsaGfaAfaCfaGfAfAfuCfaggugucAf 1224  309
1533-SS04 uAuAusCfsaGfaAfaCfaGfAfAfuCfaggUfguca 1225  309
1533-SS05 uAuAusCfsaGfaAfaCfaGfaAfuCfaGfgugucAf 1226  309
1533-SS06 uAuAusCfsaGfaAfaCfaGfaAfuCfaggugUfcAf 1227  309
1533-SS07 uAuAusCfsaGfaAfaCfaGfaAfuCfaggUfgucAf 1228  309
1533-SS08 uAuAusCfsaGfaAfaCfagAfAfuCfaggugUfcAf 1229  309
1533-SS09 uAuAusCfsaGfaAfaCfagaAfuCfaggUfgUfcAf 1230  309
1533-SS10 uAuAusCfsaGfaAfaCfagaAfuCfaGfgugUfcAf 1231  309
1533-SS11 uAuAusCfsaGfaaaCfagAfAfuCfaGfgUfgUfcAf 1232  309
1533-SS20
1533-SS12 uAuAusCfsaGfaaaCfaGfaAfuCfaGfgUfgUfcAf 1233  309
1533-SS13 uAuAusCfsaGfaAfaCfagaAfuCfaGfgUfgUfcAf 1234  309
1533-SS14 uAuAusCfsaGfaaaCfagaAfuCfaGfgUfgUfcAf 1235  309
1533-SS15 uAuAusCfsagaAfaCfagaAfuCfaGfgUfgUfcAf 1236  309
1533-SS16 uAuAusCfsagaaaCfagAfAfuCfaGfgUfgUfcAf 1237  309
1533-SS17 uAuAusCfsagaaaCfaGfaAfuCfaGfgUfgUfcAf 1238  309
1533-SS18 uAuAusCfsagaaaCfaGfAfAfuCfaGfgUfgUfcAf 1239  309
1533-SS19 uAuAusCfsagaAfaCfagAfAfuCfaGfgUfgUfcAf 1240  309
AM05341-SS (NAG37)(invAb)GfcCfcCfuUfAfUfuGfuUfaUfaCfgausu(invAb) 1256  357
AM05342-SS (NAG37)scsagccccuUfAfUfuguuauacgs(invdA) 1257  381
AM05489-SS (NAG25)uauausasguuaucgAfGfGfcucauucucas(invAb) 1269  308
AM05491-SS (NAG25)(invAb)uuaucgAfGfGfcucauucucas(invAb) 1270 1258
AM05494-SS (NAG25)(invAb)GfcCfcCfuUfAfUfuGfuUfaUfaCfgas(invAb) 1271 1259
AM05499-SS (NAG25)(invAb)gccccuUfAfUfuguuauacgausu(invAb) 1272  357
AM05500-SS (NAG25)uauauscsagccccuUfAfUfuguuauacgas(invAb) 1273  310
AM05501-SS (NAG25)(invAb)gccccuUfAfUfuguuauacgas(invAb) 1274 1259
AM05502-SS (NAG25)sasagccccuUfAfUfuguuauacgs(invdA) 1275 1261
AM05503-SS (NAG25)scsagccccuUfAfUfuguuauacgas(invAb) 1276 1260
AM05504-SS (NAG25)sgsccccuUfAfUfuguuauacgas(invAb) 1277  371
AM05505-SS (NAG25)sgsccccuUfAfUfuguuauacgs(invdA) 1278  371
AM05506-SS (NAG25)sasagccccuUfAfUfuguuauacgas(invAb) 1279 1261

A sense strand containing a sequence listed in Table 2B can be hybridized to any antisense strand containing a sequence listed in Table 2A provided the two sequences have a region of at least 90% complementarity over a contiguous 16, 17, 18, 19, 20, or 21 nucleotide sequence. Representative LPA RNAi agents are represented by the Duplex ID Nos. shown in Tables 3A and 3B.

In some embodiments an LPA RNAi agent comprises of any of the Duplex ID Nos. presented herein. In some embodiments an LPA RNAi agent consists of any of the Duplex ID Nos. presented herein. In some embodiments, an LPA RNAi agent comprises the sense strand and antisense strand nucleotide sequences of any of the Duplex ID Nos. presented herein. In some embodiments, an LPA RNAi agent comprises the sense strand and antisense strand nucleotide sequences of any of the Duplex ID Nos. presented herein and a targeting group and/or linking group wherein the targeting group and/or linking group is covalently linked (i.e. conjugated) to the sense strand or the antisense strand. In some embodiments, an LPA RNAi agent comprises the sense strand and antisense strand modified nucleotide sequences of any of the Duplex ID Nos. presented herein. In some embodiments, an LPA RNAi agent comprises the sense strand and antisense strand modified nucleotide sequences of any of the Duplex ID Nos. presented herein and a targeting group and/or linking group wherein the targeting group and/or linking group is covalently linked to the sense strand or the antisense strand.

TABLE 3A
LPA RNAi agent duplexes with Duplex ID numbers.
Antisense Sense Strand Antisense Sense Strand Antisense Sense Strand
Duplex ID Strand ID ID Duplex ID Strand ID ID Duplex ID Strand ID ID
AD00571 AM01240-AS AM01173-SS AD02120 AM03257-AS AM03229-SS AD02500 AM03107-AS AM03295-SS
AD00572 AM01241-AS AM01174-SS AD02121 AM03257-AS AM03230-SS AD02501 AM03279-AS AM03295-SS
AD00573 AM01242-AS AM01175-SS AD02122 AM03257-AS AM03231-SS AD02502 AM03280-AS AM03295-SS
AD00574 AM01243-AS AM01176-SS AD02123 AM03257-AS AM03232-SS AD02503 AM03281-AS AM03295-SS
AD00575 AM01244-AS AM01177-SS AD02124 AM03257-AS AM03233-SS AD02504 AM03282-AS AM03295-SS
AD00576 AM01245-AS AM01178-SS AD02125 AM03257-AS AM03234-SS AD02505 AM03283-AS AM03295-SS
AD00577 AM01246-AS AM01179-SS AD02126 AM03257-AS AM03235-SS AD02506 AM03284-AS AM03295-SS
AD00578 AM01247-AS AM01180-SS AD02127 AM03257-AS AM03236-SS AD02507 AM03300-AS AM03295-SS
AD00579 AM01248-AS AM01181-SS AD02128 AM03257-AS AM03237-SS AD02508 AM03301-AS AM03295-SS
AD00580 AM01249-AS AM01182-SS AD02129 AM03258-AS AM03220-SS AD02509 AM03107-AS AM03296-SS
AD00581 AM01250-AS AM01183-SS AD02130 AM03258-AS AM03221-SS AD02510 AM03279-AS AM03296-SS
AD00582 AM01251-AS AM01184-SS AD02131 AM03258-AS AM03222-SS AD02511 AM03280-AS AM03296-SS
AD00583 AM01252-AS AM01185-SS AD02132 AM03258-AS AM03223-SS AD02512 AM03281-AS AM03296-SS
AD00584 AM01253-AS AM01186-SS AD02133 AM03258-AS AM03224-SS AD02513 AM03282-AS AM03296-SS
AD00585 AM01254-AS AM01187-SS AD02134 AM03258-AS AM03225-SS AD02514 AM03283-AS AM03296-SS
AD00586 AM01255-AS AM01188-SS AD02135 AM03258-AS AM03226-SS AD02515 AM03284-AS AM03296-SS
AD00587 AM01256-AS AM01189-SS AD02136 AM03258-AS AM03227-SS AD02516 AM03300-AS AM03296-SS
AD00588 AM01257-AS AM01190-SS AD02137 AM03258-AS AM03228-SS AD02517 AM03301-AS AM03296-SS
AD00589 AM01258-AS AM01191-SS AD02138 AM03258-AS AM03229-SS AD02518 AM03107-AS AM03297-SS
AD00590 AM01259-AS AM01192-SS AD02139 AM03258-AS AM03230-SS AD02519 AM03279-AS AM03297-SS
AD00591 AM01260-AS AM01193-SS AD02140 AM03258-AS AM03231-SS AD02520 AM03280-AS AM03297-SS
AD00592 AM01261-AS AM01194-SS AD02141 AM03258-AS AM03232-SS AD02521 AM03281-AS AM03297-SS
AD00593 AM01262-AS AM01195-SS AD02142 AM03258-AS AM03233-SS AD02522 AM03282-AS AM03297-SS
AD00594 AM01263-AS AM01196-SS AD02143 AM03258-AS AM03234-SS AD02523 AM03283-AS AM03297-SS
AD00595 AM01264-AS AM01197-SS AD02144 AM03258-AS AM03235-SS AD02524 AM03284-AS AM03297-SS
AD00596 AM01265-AS AM01198-SS AD02145 AM03258-AS AM03236-SS AD02525 AM03300-AS AM03297-SS
AD00597 AM01266-AS AM01199-SS AD02146 AM03258-AS AM03237-SS AD02526 AM03301-AS AM03297-SS
AD00598 AM01267-AS AM01200-SS AD02147 AM03259-AS AM03220-SS AD02527 AM03107-AS AM03298-SS
AD00599 AM01268-AS AM01201-SS AD02148 AM03259-AS AM03221-SS AD02528 AM03279-AS AM03298-SS
AD00600 AM01269-AS AM01202-SS AD02149 AM03259-AS AM03222-SS AD02529 AM03280-AS AM03298-SS
AD00601 AM01270-AS AM01203-SS AD02150 AM03259-AS AM03223-SS AD02530 AM03281-AS AM03298-SS
AD00602 AM01271-AS AM01204-SS AD02151 AM03259-AS AM03224-SS AD02531 AM03282-AS AM03298-SS
AD00603 AM01272-AS AM01205-SS AD02152 AM03259-AS AM03225-SS AD02532 AM03283-AS AM03298-SS
AD00604 AM01273-AS AM01206-SS AD02153 AM03259-AS AM03226-SS AD02533 AM03284-AS AM03298-SS
AD00605 AM01274-AS AM01207-SS AD02154 AM03259-AS AM03227-SS AD02534 AM03300-AS AM03298-SS
AD00606 AM01275-AS AM01208-SS AD02155 AM03259-AS AM03228-SS AD02535 AM03301-AS AM03298-SS
AD00607 AM01276-AS AM01209-SS AD02156 AM03259-AS AM03229-SS AD02536 AM03107-AS AM03299-SS
AD00608 AM01277-AS AM01210-SS AD02157 AM03259-AS AM03230-SS AD02537 AM03279-AS AM03299-SS
AD00609 AM01278-AS AM01211-SS AD02158 AM03259-AS AM03231-SS AD02538 AM03280-AS AM03299-SS
AD00610 AM01279-AS AM01212-SS AD02159 AM03259-AS AM03232-SS AD02539 AM03281-AS AM03299-SS
AD00611 AM01280-AS AM01213-SS AD02160 AM03259-AS AM03233-SS AD02540 AM03282-AS AM03299-SS
AD00612 AM01281-AS AM01214-SS AD02161 AM03259-AS AM03234-SS AD02541 AM03283-AS AM03299-SS
AD00613 AM01282-AS AM01215-SS AD02162 AM03259-AS AM03235-SS AD02542 AM03284-AS AM03299-SS
AD00614 AM01283-AS AM01216-SS AD02163 AM03259-AS AM03236-SS AD02543 AM03300-AS AM03299-SS
AD00615 AM01284-AS AM01217-SS AD02164 AM03259-AS AM03237-SS AD02544 AM03301-AS AM03299-SS
AD00616 AM01285-AS AM01218-SS AD02165 AM03260-AS AM03220-SS AD02545 AM03301-AS AM03277-SS
AD00617 AM01286-AS AM01219-SS AD02166 AM03260-AS AM03221-SS AD02546 AM03107-AS AM03275-SS
AD00618 AM01287-AS AM01220-SS AD02167 AM03260-AS AM03222-SS AD02547 AM03107-AS AM03276-SS
AD00619 AM01288-AS AM01221-SS AD02168 AM03260-AS AM03223-SS AD02548 AM03107-AS AM03277-SS
AD00620 AM01289-AS AM01222-SS AD02169 AM03260-AS AM03224-SS AD02549 AM03107-AS AM03278-SS
AD00621 AM01290-AS AM01223-SS AD02170 AM03260-AS AM03225-SS AD02550 AM03107-AS AM03287-SS
AD00622 AM01291-AS AM01224-SS AD02171 AM03260-AS AM03226-SS AD02551 AM03107-AS AM03288-SS
AD00623 AM01292-AS AM01225-SS AD02172 AM03260-AS AM03227-SS AD02552 AM03107-AS AM03289-SS
AD00624 AM01293-AS AM01226-SS AD02173 AM03260-AS AM03228-SS AD02553 AM03107-AS AM03290-SS
AD00625 AM01294-AS AM01227-SS AD02174 AM03260-AS AM03229-SS AD02554 AM03279-AS AM02537-SS
AD00626 AM01295-AS AM01228-SS AD02175 AM03260-AS AM03230-SS AD02555 AM03280-AS AM02537-SS
AD00627 AM01296-AS AM01229-SS AD02176 AM03260-AS AM03231-SS AD02556 AM03281-AS AM02537-SS
AD00628 AM01297-AS AM01230-SS AD02177 AM03260-AS AM03232-SS AD02557 AM03282-AS AM02537-SS
AD00629 AM01298-AS AM01231-SS AD02178 AM03260-AS AM03233-SS AD02558 AM03283-AS AM02537-SS
AD00630 AM01299-AS AM01232-SS AD02179 AM03260-AS AM03234-SS AD02559 AM03284-AS AM02537-SS
AD00631 AM01300-AS AM01233-SS AD02180 AM03260-AS AM03235-SS AD02560 AM03300-AS AM02537-SS
AD00632 AM01301-AS AM01234-SS AD02181 AM03260-AS AM03236-SS AD02561 AM03301-AS AM02537-SS
AD00633 AM01302-AS AM01235-SS AD02182 AM03260-AS AM03237-SS AD02609 AM03375-AS AM03277-SS
AD00634 AM01303-AS AM01236-SS AD02183 AM03261-AS AM03220-SS AD02610 AM03376-AS AM03277-SS
AD00635 AM01304-AS AM01237-SS AD02184 AM03261-AS AM03221-SS AD02611 AM03375-AS AM03278-SS
AD00636 AM01305-AS AM01238-SS AD02185 AM03261-AS AM03222-SS AD02612 AM03376-AS AM03278-SS
AD00637 AM01306-AS AM01239-SS AD02186 AM03261-AS AM03223-SS AD02613 AM03375-AS AM03289-SS
AD01068 AM01796-AS AM01795-SS AD02187 AM03261-AS AM03224-SS AD02614 AM03376-AS AM03289-SS
AD01069 AM01798-AS AM01797-SS AD02188 AM03261-AS AM03225-SS AD02615 AM03377-AS AM02941-SS
AD01070 AM01800-AS AM01799-SS AD02189 AM03261-AS AM03226-SS AD02616 AM03259-AS AM02941-SS
AD01071 AM01802-AS AM01801-SS AD02190 AM03261-AS AM03227-SS AD02617 AM03377-AS AM02942-SS
AD01072 AM01804-AS AM01803-SS AD02191 AM03261-AS AM03228-SS AD02618 AM03259-AS AM02942-SS
AD01073 AM01806-AS AM01805-SS AD02192 AM03261-AS AM03229-SS AD02619 AM03377-AS AM03243-SS
AD01074 AM01808-AS AM01807-SS AD02193 AM03261-AS AM03230-SS AD02620 AM03259-AS AM03243-SS
AD01075 AM01810-AS AM01809-SS AD02194 AM03261-AS AM03231-SS AD02662 AM02860-AS AM03424-SS
AD01076 AM01812-AS AM01811-SS AD02195 AM03261-AS AM03232-SS AD02663 AM02860-AS AM03425-SS
AD01077 AM01814-AS AM01813-SS AD02196 AM03261-AS AM03233-SS AD02664 AM03427-AS AM03426-SS
AD01078 AM01816-AS AM01815-SS AD02197 AM03261-AS AM03234-SS AD02682 AM02775-AS AM03457-SS
AD01079 AM01818-AS AM01817-SS AD02198 AM03261-AS AM03235-SS AD02683 AM02776-AS AM03458-SS
AD01184 AM02003-AS AM02006-SS AD02199 AM03261-AS AM03236-SS AD02684 AM02783-AS AM03459-SS
AD01185 AM02004-AS AM02006-SS AD02200 AM03261-AS AM03237-SS AD02685 AM02785-AS AM03460-SS
AD01186 AM02005-AS AM02006-SS AD02201 AM03262-AS AM03220-SS AD02686 AM02788-AS AM03461-SS
AD01187 AM02007-AS AM02010-SS AD02202 AM03262-AS AM03221-SS AD02687 AM02791-AS AM03462-SS
AD01188 AM02008-AS AM02010-SS AD02203 AM03262-AS AM03222-SS AD02696 AM02860-AS AM03243-SS
AD01189 AM02009-AS AM02010-SS AD02204 AM03262-AS AM03223-SS AD02697 AM03107-AS AM03277-SS
AD01190 AM02011-AS AM02014-SS AD02205 AM03262-AS AM03224-SS AD02698 AM03107-AS AM03278-SS
AD01191 AM02012-AS AM02014-SS AD02206 AM03262-AS AM03225-SS AD02699 AM03107-AS AM03289-SS
AD01192 AM02013-AS AM02014-SS AD02207 AM03262-AS AM03226-SS AD02710 AM03486-AS AM03489-SS
AD01193 AM02015-AS AM02018-SS AD02208 AM03262-AS AM03227-SS AD02711 AM03487-AS AM03489-SS
AD01194 AM02016-AS AM02018-SS AD02209 AM03262-AS AM03228-SS AD02712 AM03488-AS AM03489-SS
AD01195 AM02017-AS AM02018-SS AD02210 AM03262-AS AM03229-SS AD02713 AM02860-AS AM03489-SS
AD01196 AM02019-AS AM02022-SS AD02211 AM03262-AS AM03230-SS AD02714 AM03490-AS AM03492-SS
AD01197 AM02020-AS AM02022-SS AD02212 AM03262-AS AM03231-SS AD02715 AM03491-AS AM03492-SS
AD01198 AM02021-AS AM02022-SS AD02213 AM03262-AS AM03232-SS AD02716 AM02531-AS AM03492-SS
AD01199 AM02023-AS AM02026-SS AD02214 AM03262-AS AM03233-SS AD02717 AM03107-AS AM03492-SS
AD01200 AM02024-AS AM02026-SS AD02215 AM03262-AS AM03234-SS AD02745 AM03107-AS AM03544-SS
AD01201 AM02025-AS AM02026-SS AD02216 AM03262-AS AM03235-SS AD02746 AM03283-AS AM03544-SS
AD01202 AM02027-AS AM02030-SS AD02217 AM03262-AS AM03236-SS AD02747 AM03300-AS AM03544-SS
AD01203 AM02028-AS AM02030-SS AD02218 AM03262-AS AM03237-SS AD02748 AM03107-AS AM03545-SS
AD01204 AM02029-AS AM02030-SS AD02219 AM03263-AS AM03220-SS AD02749 AM03283-AS AM03545-SS
AD01205 AM02031-AS AM02034-SS AD02220 AM03263-AS AM03221-SS AD02750 AM03300-AS AM03545-SS
AD01206 AM02032-AS AM02034-SS AD02221 AM03263-AS AM03222-SS AD02751 AM03107-AS AM03546-SS
AD01207 AM02033-AS AM02034-SS AD02222 AM03263-AS AM03223-SS AD02752 AM03283-AS AM03546-SS
AD01208 AM02035-AS AM02038-SS AD02223 AM03263-AS AM03224-SS AD02753 AM03300-AS AM03546-SS
AD01209 AM02036-AS AM02038-SS AD02224 AM03263-AS AM03225-SS AD02754 AM02534-AS AM03547-SS
AD01210 AM02037-AS AM02038-SS AD02225 AM03263-AS AM03226-SS AD02755 AM02857-AS AM03547-SS
AD01211 AM02039-AS AM02042-SS AD02226 AM03263-AS AM03227-SS AD02819 AM03377-AS AM03650-SS
AD01212 AM02040-AS AM02042-SS AD02227 AM03263-AS AM03228-SS AD02820 AM03259-AS AM03650-SS
AD01213 AM02041-AS AM02042-SS AD02228 AM03263-AS AM03229-SS AD02821 AM03129-AS AM03651-SS
AD01328 AM02240-AS AM02211-SS AD02229 AM03263-AS AM03230-SS AD02825 AM03655-AS AM03650-SS
AD01329 AM02241-AS AM02212-SS AD02230 AM03263-AS AM03231-SS AD02826 AM03656-AS AM03650-SS
AD01330 AM02242-AS AM02213-SS AD02231 AM03263-AS AM03232-SS AD02827 AM03657-AS AM03650-SS
AD01331 AM02243-AS AM02214-SS AD02232 AM03263-AS AM03233-SS AD02828 AM03658-AS AM03650-SS
AD01332 AM02244-AS AM02215-SS AD02233 AM03263-AS AM03234-SS AD02829 AM03659-AS AM03650-SS
AD01333 AM02245-AS AM02216-SS AD02234 AM03263-AS AM03235-SS AD02830 AM03660-AS AM03650-SS
AD01334 AM02246-AS AM02217-SS AD02235 AM03263-AS AM03236-SS AD02831 AM03661-AS AM03650-SS
AD01335 AM02247-AS AM02218-SS AD02236 AM03263-AS AM03237-SS AD02832 AM03269-AS AM03650-SS
AD01336 AM02248-AS AM02219-SS AD02237 AM03264-AS AM03220-SS AD02841 AM03671-AS AM03670-SS
AD01337 AM02249-AS AM02220-SS AD02238 AM03264-AS AM03221-SS AD02842 AM03672-AS AM03546-SS
AD01338 AM02250-AS AM02221-SS AD02239 AM03264-AS AM03222-SS AD02843 AM03673-AS AM03546-SS
AD01339 AM02251-AS AM02222-SS AD02240 AM03264-AS AM03223-SS AD02844 AM03674-AS AM03546-SS
AD01340 AM02252-AS AM02223-SS AD02241 AM03264-AS AM03224-SS AD02845 AM03675-AS AM03546-SS
AD01341 AM02253-AS AM02224-SS AD02242 AM03264-AS AM03225-SS AD02846 AM03676-AS AM03546-SS
AD01342 AM02254-AS AM02225-SS AD02243 AM03264-AS AM03226-SS AD02847 AM03677-AS AM03546-SS
AD01343 AM02255-AS AM02226-SS AD02244 AM03264-AS AM03227-SS AD02848 AM03678-AS AM03650-SS
AD01344 AM02256-AS AM02227-SS AD02245 AM03264-AS AM03228-SS AD02849 AM03679-AS AM03650-SS
AD01345 AM02257-AS AM02228-SS AD02246 AM03264-AS AM03229-SS AD02850 AM03680-AS AM03650-SS
AD01346 AM02258-AS AM02229-SS AD02247 AM03264-AS AM03230-SS AD02851 AM03681-AS AM03650-SS
AD01347 AM02259-AS AM02230-SS AD02248 AM03264-AS AM03231-SS AD02852 AM03682-AS AM03650-SS
AD01348 AM02260-AS AM02231-SS AD02249 AM03264-AS AM03232-SS AD02853 AM02860-AS AM03237-SS
AD01349 AM02261-AS AM02232-SS AD02250 AM03264-AS AM03233-SS AD02854 AM03377-AS AM03225-SS
AD01350 AM02262-AS AM02233-SS AD02251 AM03264-AS AM03234-SS AD02855 AM03129-AS AM03683-SS
AD01351 AM02263-AS AM02234-SS AD02252 AM03264-AS AM03235-SS AD02907 AM02775-AS AM03741-SS
AD01352 AM02264-AS AM02235-SS AD02253 AM03264-AS AM03236-SS AD02908 AM02775-AS AM03742-SS
AD01353 AM02265-AS AM02236-SS AD02254 AM03264-AS AM03237-SS AD02909 AM02775-AS AM03743-SS
AD01354 AM02266-AS AM02237-SS AD02255 AM03265-AS AM03220-SS AD02910 AM03744-AS AM03457-SS
AD01355 AM02267-AS AM02238-SS AD02256 AM03265-AS AM03221-SS AD02911 AM03745-AS AM03457-SS
AD01356 AM02268-AS AM02239-SS AD02257 AM03265-AS AM03222-SS AD02912 AM03745-AS AM03742-SS
AD01462 AM02404-AS AM02441-SS AD02258 AM03265-AS AM03223-SS AD02913 AM02776-AS AM03746-SS
AD01463 AM02406-AS AM02442-SS AD02259 AM03265-AS AM03224-SS AD02914 AM02776-AS AM03747-SS
AD01464 AM02408-AS AM02443-SS AD02260 AM03265-AS AM03225-SS AD02915 AM02776-AS AM03748-SS
AD01465 AM02410-AS AM02444-SS AD02261 AM03265-AS AM03226-SS AD02916 AM03749-AS AM03458-SS
AD01466 AM02412-AS AM02445-SS AD02262 AM03265-AS AM03227-SS AD02917 AM03750-AS AM03458-SS
AD01467 AM02414-AS AM02446-SS AD02263 AM03265-AS AM03228-SS AD02918 AM03750-AS AM03747-SS
AD01468 AM02416-AS AM02447-SS AD02264 AM03265-AS AM03229-SS AD02919 AM02788-AS AM03751-SS
AD01469 AM02418-AS AM02448-SS AD02265 AM03265-AS AM03230-SS AD02920 AM02788-AS AM03752-SS
AD01529 AM02531-AS AM02537-SS AD02266 AM03265-AS AM03231-SS AD02921 AM02788-AS AM03753-SS
AD01530 AM02532-AS AM02538-SS AD02267 AM03265-AS AM03232-SS AD02922 AM03754-AS AM03461-SS
AD01531 AM02533-AS AM02539-SS AD02268 AM03265-AS AM03233-SS AD02923 AM03755-AS AM03461-SS
AD01532 AM02534-AS AM02540-SS AD02269 AM03265-AS AM03234-SS AD02924 AM03756-AS AM03461-SS
AD01533 AM02535-AS AM02541-SS AD02270 AM03265-AS AM03235-SS AD02925 AM03756-AS AM03752-SS
AD01534 AM02536-AS AM02542-SS AD02271 AM03265-AS AM03236-SS AD02926 AM02791-AS AM03757-SS
AD01708 AM02755-AS AM02793-SS AD02272 AM03265-AS AM03237-SS AD02927 AM02791-AS AM03758-SS
AD01709 AM02756-AS AM02794-SS AD02273 AM03266-AS AM03220-SS AD02928 AM02791-AS AM03759-SS
AD01710 AM02757-AS AM02795-SS AD02274 AM03266-AS AM03221-SS AD02929 AM03760-AS AM03462-SS
AD01711 AM02758-AS AM02796-SS AD02275 AM03266-AS AM03222-SS AD02930 AM03761-AS AM03462-SS
AD01712 AM02759-AS AM02797-SS AD02276 AM03266-AS AM03223-SS AD02931 AM03762-AS AM03462-SS
AD01713 AM02760-AS AM02798-SS AD02277 AM03266-AS AM03224-SS AD02932 AM03762-AS AM03758-SS
AD01714 AM02761-AS AM02799-SS AD02278 AM03266-AS AM03225-SS AD03049 AM03856-AS AM03650-SS
AD01715 AM02762-AS AM02800-SS AD02279 AM03266-AS AM03226-SS AD03050 AM03857-AS AM03651-SS
AD01716 AM02763-AS AM02801-SS AD02280 AM03266-AS AM03227-SS AD03051 AM03377-AS AM03859-SS
AD01717 AM02764-AS AM02802-SS AD02281 AM03266-AS AM03228-SS AD03052 AM03129-AS AM03861-SS
AD01718 AM02765-AS AM02803-SS AD02282 AM03266-AS AM03229-SS AD03053 AM03862-AS AM03650-SS
AD01719 AM02766-AS AM02804-SS AD02283 AM03266-AS AM03230-SS AD03054 AM03259-AS AM03859-SS
AD01720 AM02767-AS AM02805-SS AD02284 AM03266-AS AM03231-SS AD03058 AM03866-AS AM03546-SS
AD01721 AM02768-AS AM02806-SS AD02285 AM03266-AS AM03232-SS AD03059 AM03867-AS AM03546-SS
AD01722 AM02769-AS AM02807-SS AD02286 AM03266-AS AM03233-SS AD03060 AM03868-AS AM03546-SS
AD01723 AM02770-AS AM02808-SS AD02287 AM03266-AS AM03234-SS AD03061 AM03869-AS AM03546-SS
AD01724 AM02771-AS AM02809-SS AD02288 AM03266-AS AM03235-SS AD03062 AM03870-AS AM03546-SS
AD01725 AM02772-AS AM02810-SS AD02289 AM03266-AS AM03236-SS AD03063 AM03871-AS AM03546-SS
AD01726 AM02773-AS AM02811-SS AD02290 AM03266-AS AM03237-SS AD03064 AM03872-AS AM03546-SS
AD01727 AM02774-AS AM02793-SS AD02291 AM03267-AS AM03220-SS AD03065 AM03873-AS AM03546-SS
AD01728 AM02775-AS AM02794-SS AD02292 AM03267-AS AM03221-SS AD03066 AM03874-AS AM03546-SS
AD01729 AM02776-AS AM02795-SS AD02293 AM03267-AS AM03222-SS AD03067 AM03875-AS AM03546-SS
AD01730 AM02777-AS AM02796-SS AD02294 AM03267-AS AM03223-SS AD03068 AM03876-AS AM03546-SS
AD01731 AM02778-AS AM02797-SS AD02295 AM03267-AS AM03224-SS AD03069 AM03877-AS AM03546-SS
AD01732 AM02779-AS AM02798-SS AD02296 AM03267-AS AM03225-SS AD03070 AM03878-AS AM03546-SS
AD01733 AM02780-AS AM02799-SS AD02297 AM03267-AS AM03226-SS AD03071 AM03883-AS AM03879-SS
AD01734 AM02781-AS AM02800-SS AD02298 AM03267-AS AM03227-SS AD03072 AM03884-AS AM03880-SS
AD01735 AM02782-AS AM02801-SS AD02299 AM03267-AS AM03228-SS AD03073 AM03883-AS AM03881-SS
AD01736 AM02783-AS AM02802-SS AD02300 AM03267-AS AM03229-SS AD03074 AM03885-AS AM03882-SS
AD01737 AM02784-AS AM02803-SS AD02301 AM03267-AS AM03230-SS AD03075 AM03129-AS AM03546-SS
AD01738 AM02785-AS AM02804-SS AD02302 AM03267-AS AM03231-SS AD03114 AM03929-AS AM03651-SS
AD01739 AM02786-AS AM02805-SS AD02303 AM03267-AS AM03232-SS AD03115 AM03930-AS AM03651-SS
AD01740 AM02787-AS AM02806-SS AD02304 AM03267-AS AM03233-SS AD03116 AM03129-AS AM03928-SS
AD01741 AM02788-AS AM02807-SS AD02305 AM03267-AS AM03234-SS AD03117 AM03929-AS AM03928-SS
AD01742 AM02789-AS AM02808-SS AD02306 AM03267-AS AM03235-SS AD03118 AM03930-AS AM03928-SS
AD01743 AM02790-AS AM02809-SS AD02307 AM03267-AS AM03236-SS AD03119 AM03932-AS AM03650-SS
AD01744 AM02791-AS AM02810-SS AD02308 AM03267-AS AM03237-SS AD03120 AM03933-AS AM03650-SS
AD01745 AM02792-AS AM02811-SS AD02309 AM03268-AS AM03220-SS AD03121 AM03377-AS AM03931-SS
AD01746 AM02774-AS AM02812-SS AD02310 AM03268-AS AM03221-SS AD03122 AM03932-AS AM03931-SS
AD01747 AM02775-AS AM02813-SS AD02311 AM03268-AS AM03222-SS AD03123 AM03933-AS AM03931-SS
AD01748 AM02776-AS AM02814-SS AD02312 AM03268-AS AM03223-SS AD03156 AM03969-AS AM03968-SS
AD01749 AM02777-AS AM02815-SS AD02313 AM03268-AS AM03224-SS AD03157 AM03971-AS AM03970-SS
AD01750 AM02778-AS AM02816-SS AD02314 AM03268-AS AM03225-SS AD03158 AM03972-AS AM03970-SS
AD01751 AM02779-AS AM02817-SS AD02315 AM03268-AS AM03226-SS AD03159 AM03973-AS AM03970-SS
AD01752 AM02780-AS AM02818-SS AD02316 AM03268-AS AM03227-SS AD03170 AM03823-AS AM03651-SS
AD01753 AM02781-AS AM02819-SS AD02317 AM03268-AS AM03228-SS AD03171 AM03824-AS AM03651-SS
AD01754 AM02782-AS AM02820-SS AD02318 AM03268-AS AM03229-SS AD03172 AM03825-AS AM03651-SS
AD01755 AM02783-AS AM02821-SS AD02319 AM03268-AS AM03230-SS AD03173 AM03826-AS AM03651-SS
AD01756 AM02784-AS AM02822-SS AD02320 AM03268-AS AM03231-SS AD03174 AM03827-AS AM03650-SS
AD01757 AM02785-AS AM02823-SS AD02321 AM03268-AS AM03232-SS AD03175 AM03828-AS AM03650-SS
AD01758 AM02786-AS AM02824-SS AD02322 AM03268-AS AM03233-SS AD03272 AM02860-AS AM04138-SS
AD01759 AM02787-AS AM02825-SS AD02323 AM03268-AS AM03234-SS AD03273 AM03377-AS AM04138-SS
AD01760 AM02788-AS AM02826-SS AD02324 AM03268-AS AM03235-SS AD03274 AM04132-AS AM04138-SS
AD01761 AM02789-AS AM02827-SS AD02325 AM03268-AS AM03236-SS AD03275 AM04133-AS AM04138-SS
AD01762 AM02790-AS AM02828-SS AD02326 AM03268-AS AM03237-SS AD03276 AM04134-AS AM04138-SS
AD01763 AM02791-AS AM02829-SS AD02327 AM03269-AS AM03220-SS AD03277 AM04135-AS AM04138-SS
AD01764 AM02792-AS AM02830-SS AD02328 AM03269-AS AM03221-SS AD03278 AM04136-AS AM04138-SS
AD01765 AM02857-AS AM02540-SS AD02329 AM03269-AS AM03222-SS AD03279 AM04137-AS AM04138-SS
AD01766 AM02858-AS AM02540-SS AD02330 AM03269-AS AM03223-SS AD03291 AM04150-AS AM04152-SS
AD01767 AM02859-AS AM02540-SS AD02331 AM03269-AS AM03224-SS AD03327 AM04150-AS AM04214-SS
AD01768 AM02860-AS AM02540-SS AD02332 AM03269-AS AM03225-SS AD03341 AM04133-AS AM04233-SS
AD01769 AM02859-AS AM02861-SS AD02333 AM03269-AS AM03226-SS AD03351 AM04250-AS AM03742-SS
AD01770 AM02860-AS AM02861-SS AD02334 AM03269-AS AM03227-SS AD03352 AM04251-AS AM03742-SS
AD01772 AM02863-AS AM02541-SS AD02335 AM03269-AS AM03228-SS AD03353 AM04252-AS AM03742-SS
AD01773 AM02864-AS AM02541-SS AD02336 AM03269-AS AM03229-SS AD03354 AM04253-AS AM03747-SS
AD01774 AM02865-AS AM02541-SS AD02337 AM03269-AS AM03230-SS AD03355 AM04254-AS AM03747-SS
AD01780 AM02866-AS AM02541-SS AD02338 AM03269-AS AM03231-SS AD03356 AM04255-AS AM03747-SS
AD01803 AM02534-AS AM02941-SS AD02339 AM03269-AS AM03232-SS AD03357 AM04256-AS AM03752-SS
AD01804 AM02534-AS AM02942-SS AD02340 AM03269-AS AM03233-SS AD03358 AM04257-AS AM03752-SS
AD01805 AM02943-AS AM02540-SS AD02341 AM03269-AS AM03234-SS AD03359 AM04258-AS AM03752-SS
AD01806 AM02943-AS AM02941-SS AD02342 AM03269-AS AM03235-SS AD03360 AM04259-AS AM03758-SS
AD01807 AM02943-AS AM02942-SS AD02343 AM03269-AS AM03236-SS AD03361 AM04260-AS AM03758-SS
AD01808 AM02944-AS AM02540-SS AD02344 AM03269-AS AM03237-SS AD03362 AM04261-AS AM03758-SS
AD01809 AM02944-AS AM02941-SS AD02345 AM03270-AS AM03220-SS AD03421 AM04133-AS AM04372-SS
AD01810 AM02944-AS AM02942-SS AD02346 AM03270-AS AM03221-SS AD03424 AM04215-AS AM03546-SS
AD01811 AM02945-AS AM02540-SS AD02347 AM03270-AS AM03222-SS AD03425 AM04216-AS AM03546-SS
AD01812 AM02945-AS AM02941-SS AD02348 AM03270-AS AM03223-SS AD03426 AM04217-AS AM03546-SS
AD01813 AM02945-AS AM02942-SS AD02349 AM03270-AS AM03224-SS AD03427 AM04218-AS AM03546-SS
AD01814 AM02535-AS AM02946-SS AD02350 AM03270-AS AM03225-SS AD03428 AM04219-AS AM03546-SS
AD01815 AM02535-AS AM02947-SS AD02351 AM03270-AS AM03226-SS AD03430 AM04377-AS AM04381-SS
AD01816 AM02535-AS AM02948-SS AD02352 AM03270-AS AM03227-SS AD03431 AM04378-AS AM04382-SS
AD01817 AM02535-AS AM02949-SS AD02353 AM03270-AS AM03228-SS AD03432 AM04379-AS AM04381-SS
AD01818 AM02950-AS AM02541-SS AD02354 AM03270-AS AM03229-SS AD03433 AM04380-AS AM04382-SS
AD01819 AM02950-AS AM02946-SS AD02355 AM03270-AS AM03230-SS AD03434 AM04383-AS AM04391-SS
AD01820 AM02950-AS AM02947-SS AD02356 AM03270-AS AM03231-SS AD03435 AM04384-AS AM04392-SS
AD01821 AM02950-AS AM02948-SS AD02357 AM03270-AS AM03232-SS AD03436 AM04385-AS AM04391-SS
AD01822 AM02950-AS AM02949-SS AD02358 AM03270-AS AM03233-SS AD03437 AM04386-AS AM04392-SS
AD01823 AM02951-AS AM02541-SS AD02359 AM03270-AS AM03234-SS AD03438 AM04387-AS AM04391-SS
AD01824 AM02951-AS AM02946-SS AD02360 AM03270-AS AM03235-SS AD03439 AM04388-AS AM04392-SS
AD01825 AM02951-AS AM02947-SS AD02361 AM03270-AS AM03236-SS AD03440 AM04389-AS AM04391-SS
AD01826 AM02951-AS AM02948-SS AD02362 AM03270-AS AM03237-SS AD03441 AM04390-AS AM04392-SS
AD01827 AM02951-AS AM02949-SS AD02363 AM03271-AS AM03220-SS AD03460 AM03300-AS AM04412-SS
AD01828 AM02952-AS AM02541-SS AD02364 AM03271-AS AM03221-SS AD03461 AM04413-AS AM04414-SS
AD01829 AM02952-AS AM02946-SS AD02365 AM03271-AS AM03222-SS AD03462 AM04415-AS AM04416-SS
AD01830 AM02952-AS AM02947-SS AD02366 AM03271-AS AM03223-SS AD03463 AM04417-AS AM04412-SS
AD01831 AM02952-AS AM02948-SS AD02367 AM03271-AS AM03224-SS AD03494 AM04437-AS AM03742-SS
AD01832 AM02952-AS AM02949-SS AD02368 AM03271-AS AM03225-SS AD03495 AM04438-AS AM03747-SS
AD01895 AM02863-AS AM03030-SS AD02369 AM03271-AS AM03226-SS AD03496 AM04439-AS AM03752-SS
AD01896 AM02865-AS AM03036-SS AD02370 AM03271-AS AM03227-SS AD03497 AM04440-AS AM03758-SS
AD01897 AM02865-AS AM03037-SS AD02371 AM03271-AS AM03228-SS AD03536 AM03972-AS AM04496-SS
AD01898 AM02865-AS AM03038-SS AD02372 AM03271-AS AM03229-SS AD03537 AM02860-AS AM04497-SS
AD01899 AM03040-AS AM03039-SS AD02373 AM03271-AS AM03230-SS AD03538 AM03972-AS AM04499-SS
AD01900 AM03041-AS AM03039-SS AD02374 AM03271-AS AM03231-SS AD03539 AM04415-AS AM04498-SS
AD01901 AM03041-AS AM03042-SS AD02375 AM03271-AS AM03232-SS AD03540 AM03972-AS AM04500-SS
AD01902 AM02863-AS AM03042-SS AD02376 AM03271-AS AM03233-SS AD03541 AM04501-AS AM03970-SS
AD01903 AM03043-AS AM03042-SS AD02377 AM03271-AS AM03234-SS AD03542 AM02860-AS AM04502-SS
AD01912 AM03065-AS AM03060-SS AD02378 AM03271-AS AM03235-SS AD03547 AM04507-AS AM04498-SS
AD01913 AM03066-AS AM03060-SS AD02379 AM03271-AS AM03236-SS AD03548 AM02860-AS AM04498-SS
AD01914 AM03067-AS AM03060-SS AD02380 AM03271-AS AM03237-SS AD03549 AM04507-AS AM04502-SS
AD01915 AM03068-AS AM03060-SS AD02381 AM03272-AS AM03220-SS AD03573 AM04539-AS AM04535-SS
AD01916 AM03069-AS AM03060-SS AD02382 AM03272-AS AM03221-SS AD03574 AM04540-AS AM04536-SS
AD01917 AM03070-AS AM03060-SS AD02383 AM03272-AS AM03222-SS AD03575 AM04541-AS AM04537-SS
AD01918 AM03065-AS AM03061-SS AD02384 AM03272-AS AM03223-SS AD03576 AM04542-AS AM04538-SS
AD01919 AM03066-AS AM03061-SS AD02385 AM03272-AS AM03224-SS AD03577 AM04544-AS AM04543-SS
AD01920 AM03067-AS AM03061-SS AD02386 AM03272-AS AM03225-SS AD03578 AM04545-AS AM04500-SS
AD01921 AM03068-AS AM03061-SS AD02387 AM03272-AS AM03226-SS AD03579 AM04546-AS AM04500-SS
AD01922 AM03069-AS AM03061-SS AD02388 AM03272-AS AM03227-SS AD03603 AM04582-AS AM04578-SS
AD01923 AM03070-AS AM03061-SS AD02389 AM03272-AS AM03228-SS AD03604 AM04583-AS AM04578-SS
AD01924 AM03065-AS AM03062-SS AD02390 AM03272-AS AM03229-SS AD03605 AM04584-AS AM04578-SS
AD01925 AM03066-AS AM03062-SS AD02391 AM03272-AS AM03230-SS AD03606 AM04585-AS AM04578-SS
AD01926 AM03067-AS AM03062-SS AD02392 AM03272-AS AM03231-SS AD03607 AM04586-AS AM04578-SS
AD01927 AM03068-AS AM03062-SS AD02393 AM03272-AS AM03232-SS AD03608 AM04587-AS AM04578-SS
AD01928 AM03069-AS AM03062-SS AD02394 AM03272-AS AM03233-SS AD03609 AM04584-AS AM04588-SS
AD01929 AM03070-AS AM03062-SS AD02395 AM03272-AS AM03234-SS AD03610 AM04584-AS AM04579-SS
AD01930 AM03065-AS AM03037-SS AD02396 AM03272-AS AM03235-SS AD03611 AM04584-AS AM04580-SS
AD01931 AM03066-AS AM03037-SS AD02397 AM03272-AS AM03236-SS AD03612 AM04584-AS AM04581-SS
AD01932 AM03067-AS AM03037-SS AD02398 AM03272-AS AM03237-SS AD03627 AM04609-AS AM03970-SS
AD01933 AM03068-AS AM03037-SS AD02399 AM03273-AS AM03220-SS AD03628 AM04610-AS AM03970-SS
AD01934 AM03069-AS AM03037-SS AD02400 AM03273-AS AM03221-SS AD03629 AM03972-AS AM04611-SS
AD01935 AM03070-AS AM03037-SS AD02401 AM03273-AS AM03222-SS AD03630 AM03972-AS AM04612-SS
AD01936 AM03065-AS AM03064-SS AD02402 AM03273-AS AM03223-SS AD03668 AM04501-AS AM04500-SS
AD01937 AM03066-AS AM03064-SS AD02403 AM03273-AS AM03224-SS AD03671 AM04677-AS AM04669-SS
AD01938 AM03067-AS AM03064-SS AD02404 AM03273-AS AM03225-SS AD03672 AM04678-AS AM04670-SS
AD01939 AM03068-AS AM03064-SS AD02405 AM03273-AS AM03226-SS AD03673 AM04679-AS AM04671-SS
AD01940 AM03069-AS AM03064-SS AD02406 AM03273-AS AM03227-SS AD03674 AM04680-AS AM04672-SS
AD01941 AM03070-AS AM03064-SS AD02407 AM03273-AS AM03228-SS AD03675 AM04681-AS AM04673-SS
AD01976 AM03119-AS AM02540-SS AD02408 AM03273-AS AM03229-SS AD03676 AM02860-AS AM04674-SS
AD01977 AM03120-AS AM02540-SS AD02409 AM03273-AS AM03230-SS AD03677 AM02860-AS AM04675-SS
AD01978 AM03121-AS AM02540-SS AD02410 AM03273-AS AM03231-SS AD03678 AM02860-AS AM04676-SS
AD01979 AM02857-AS AM03122-SS AD02411 AM03273-AS AM03232-SS AD03705 AM04501-AS AM04726-SS
AD01980 AM02857-AS AM03123-SS AD02412 AM03273-AS AM03233-SS AD03706 AM04501-AS AM04727-SS
AD01981 AM03119-AS AM03122-SS AD02413 AM03273-AS AM03234-SS AD03707 AM04501-AS AM04728-SS
AD01982 AM02857-AS AM03124-SS AD02414 AM03273-AS AM03235-SS AD03708 AM04544-AS AM04729-SS
AD01983 AM03107-AS AM02537-SS AD02415 AM03273-AS AM03236-SS AD03713 AM04733-AS AM04138-SS
AD01984 AM03108-AS AM02537-SS AD02416 AM03273-AS AM03237-SS AD03714 AM04734-AS AM04138-SS
AD01985 AM03107-AS AM03125-SS AD02417 AM03274-AS AM03220-SS AD03715 AM04735-AS AM04138-SS
AD01986 AM03107-AS AM03126-SS AD02418 AM03274-AS AM03221-SS AD03716 AM04736-AS AM04138-SS
AD01987 AM03127-AS AM02537-SS AD02419 AM03274-AS AM03222-SS AD03717 AM02860-AS AM04737-SS
AD01988 AM03129-AS AM03128-SS AD02420 AM03274-AS AM03223-SS AD03720 AM03884-AS AM04741-SS
AD01989 AM03130-AS AM02540-SS AD02421 AM03274-AS AM03224-SS AD03721 AM03972-AS AM04742-SS
AD01990 AM03131-AS AM02540-SS AD02422 AM03274-AS AM03225-SS AD03722 AM03972-AS AM04743-SS
AD02001 AM02860-AS AM02942-SS AD02423 AM03274-AS AM03226-SS AD03723 AM03972-AS AM04744-SS
AD02002 AM02857-AS AM03144-SS AD02424 AM03274-AS AM03227-SS AD03760 AM04805-AS AM04803-SS
AD02003 AM03149-AS AM02540-SS AD02425 AM03274-AS AM03228-SS AD03761 AM04501-AS AM04804-SS
AD02004 AM03149-AS AM02941-SS AD02426 AM03274-AS AM03229-SS AD03762 AM04805-AS AM04807-SS
AD02005 AM03149-AS AM02942-SS AD02427 AM03274-AS AM03230-SS AD03763 AM03884-AS AM04729-SS
AD02006 AM03150-AS AM02540-SS AD02428 AM03274-AS AM03231-SS AD03764 AM03884-AS AM04806-SS
AD02007 AM03150-AS AM02941-SS AD02429 AM03274-AS AM03232-SS AD03765 AM04501-AS AM04611-SS
AD02008 AM03150-AS AM02942-SS AD02430 AM03274-AS AM03233-SS AD03766 AM04501-AS AM04808-SS
AD02009 AM03151-AS AM02540-SS AD02431 AM03274-AS AM03234-SS AD03767 AM04501-AS AM04809-SS
AD02010 AM03151-AS AM02941-SS AD02432 AM03274-AS AM03235-SS AD03768 AM04501-AS AM04810-SS
AD02011 AM03151-AS AM02942-SS AD02433 AM03274-AS AM03236-SS AD03769 AM04501-AS AM04811-SS
AD02075 AM03255-AS AM03220-SS AD02434 AM03274-AS AM03237-SS AD03770 AM04501-AS AM04812-SS
AD02076 AM03255-AS AM03221-SS AD02435 AM03255-AS AM03238-SS AD03771 AM02860-AS AM04813-SS
AD02077 AM03255-AS AM03222-SS AD02436 AM03256-AS AM03238-SS AD03801 AM04821-AS AM04816-SS
AD02078 AM03255-AS AM03223-SS AD02437 AM03255-AS AM03240-SS AD03802 AM04822-AS AM04817-SS
AD02079 AM03255-AS AM03224-SS AD02438 AM03256-AS AM03240-SS AD03803 AM04823-AS AM04816-SS
AD02080 AM03255-AS AM03225-SS AD02439 AM03255-AS AM02942-SS AD03804 AM04821-AS AM04835-SS
AD02081 AM03255-AS AM03226-SS AD02440 AM03256-AS AM02942-SS AD03805 AM04824-AS AM04819-SS
AD02082 AM03255-AS AM03227-SS AD02462 AM02857-AS AM03330-SS AD03806 AM04824-AS AM04820-SS
AD02083 AM03255-AS AM03228-SS AD02463 AM03331-AS AM01223-SS AD03841 AM04871-AS AM04862-SS
AD02084 AM03255-AS AM03229-SS AD02464 AM03107-AS AM03291-SS AD03842 AM02860-AS AM04863-SS
AD02085 AM03255-AS AM03230-SS AD02465 AM03279-AS AM03291-SS AD03843 AM04872-AS AM04138-SS
AD02086 AM03255-AS AM03231-SS AD02466 AM03280-AS AM03291-SS AD03844 AM04539-AS AM04864-SS
AD02087 AM03255-AS AM03232-SS AD02467 AM03281-AS AM03291-SS AD03845 AM03300-AS AM04865-SS
AD02088 AM03255-AS AM03233-SS AD02468 AM03282-AS AM03291-SS AD03846 AM04873-AS AM04412-SS
AD02089 AM03255-AS AM03234-SS AD02469 AM03283-AS AM03291-SS AD03847 AM04874-AS AM04866-SS
AD02090 AM03255-AS AM03235-SS AD02470 AM03284-AS AM03291-SS AD03848 AM04874-AS AM04867-SS
AD02091 AM03255-AS AM03236-SS AD02471 AM03300-AS AM03291-SS AD03849 AM04875-AS AM04867-SS
AD02092 AM03255-AS AM03237-SS AD02472 AM03301-AS AM03291-SS AD03850 AM04876-AS AM04866-SS
AD02093 AM03256-AS AM03220-SS AD02473 AM03107-AS AM03292-SS AD03851 AM04877-AS AM04866-SS
AD02094 AM03256-AS AM03221-SS AD02474 AM03279-AS AM03292-SS AD03852 AM04877-AS AM04867-SS
AD02095 AM03256-AS AM03222-SS AD02475 AM03280-AS AM03292-SS AD03853 AM04874-AS AM04868-SS
AD02096 AM03256-AS AM03223-SS AD02476 AM03281-AS AM03292-SS AD03854 AM04874-AS AM04869-SS
AD02097 AM03256-AS AM03224-SS AD02477 AM03282-AS AM03292-SS AD03855 AM04875-AS AM04869-SS
AD02098 AM03256-AS AM03225-SS AD02478 AM03283-AS AM03292-SS AD03856 AM04874-AS AM04870-SS
AD02099 AM03256-AS AM03226-SS AD02479 AM03284-AS AM03292-SS AD03857 AM03972-AS AM04808-SS
AD02100 AM03256-AS AM03227-SS AD02480 AM03300-AS AM03292-SS AD03858 AM03972-AS AM04811-SS
AD02101 AM03256-AS AM03228-SS AD02481 AM03301-AS AM03292-SS AD03859 AM04822-AS AM04819-SS
AD02102 AM03256-AS AM03229-SS AD02482 AM03107-AS AM03293-SS AD03860 AM04878-AS AM04819-SS
AD02103 AM03256-AS AM03230-SS AD02483 AM03279-AS AM03293-SS AD03861 AM04878-AS AM04820-SS
AD02104 AM03256-AS AM03231-SS AD02484 AM03280-AS AM03293-SS AD03862 AM04879-AS AM04138-SS
AD02105 AM03256-AS AM03232-SS AD02485 AM03281-AS AM03293-SS AD03863 AM04879-AS AM04863-SS
AD02106 AM03256-AS AM03233-SS AD02486 AM03282-AS AM03293-SS AD03864 AM04880-AS AM04138-SS
AD02107 AM03256-AS AM03234-SS AD02487 AM03283-AS AM03293-SS AD03920 AM04969-AS AM04138-SS
AD02108 AM03256-AS AM03235-SS AD02488 AM03284-AS AM03293-SS AD03921 AM04970-AS AM04412-SS
AD02109 AM03256-AS AM03236-SS AD02489 AM03300-AS AM03293-SS AD03922 AM04971-AS AM04867-SS
AD02110 AM03256-AS AM03237-SS AD02490 AM03301-AS AM03293-SS AD03923 AM04971-AS AM04869-SS
AD02111 AM03257-AS AM03220-SS AD02491 AM03107-AS AM03294-SS AD03924 AM04972-AS AM04820-SS
AD02112 AM03257-AS AM03221-SS AD02492 AM03279-AS AM03294-SS AD03925 AM04972-AS AM04819-SS
AD02113 AM03257-AS AM03222-SS AD02493 AM03280-AS AM03294-SS AD03931 AM04979-AS AM04978-SS
AD02114 AM03257-AS AM03223-SS AD02494 AM03281-AS AM03294-SS AD03932 AM04979-AS AM04811-SS
AD02115 AM03257-AS AM03224-SS AD02495 AM03282-AS AM03294-SS AD03933 AM04979-AS AM04869-SS
AD02116 AM03257-AS AM03225-SS AD02496 AM03283-AS AM03294-SS AD04017 AM03300-AS AM05070-SS
AD02117 AM03257-AS AM03226-SS AD02497 AM03284-AS AM03294-SS AD04018 AM03972-AS AM05072-SS
AD02118 AM03257-AS AM03227-SS AD02498 AM03300-AS AM03294-SS AD04017 AM03300-AS AM05070-SS
AD02119 AM03257-AS AM03228-SS AD02499 AM03301-AS AM03294-SS AD04018 AM03972-AS AM05072-SS
AD04170 AM03972-AS AM05341-SS AD04171 AM04877-AS AM05342-SS AD04110 AM04875-AS AM04866-SS
AD04263 AM04879-AS AM05489-SS AD04272 AM04979-AS AM05499-SS AD04281 AM05496-AS AM04412-SS
AD04264 AM05490-AS AM04416-SS AD04273 AM03972-AS AM05494-SS AD04282 AM04874-AS AM05503-SS
AD04265 AM05490-AS AM05491-SS AD04274 AM05498-AS AM05494-SS AD04283 AM04874-AS AM05502-SS
AD04266 AM05492-AS AM04496-SS AD04275 AM04979-AS AM05494-SS AD04284 AM04874-AS AM05506-SS
AD04267 AM05493-AS AM04496-SS AD04276 AM03972-AS AM05501-SS AD04285 AM04877-AS AM05503-SS
AD04268 AM05498-AS AM04496-SS AD04277 AM05498-AS AM05501-SS AD04286 AM05497-AS AM05502-SS
AD04269 AM04979-AS AM04496-SS AD04278 AM04979-AS AM05501-SS AD04287 AM05497-AS AM05506-SS
AD04270 AM03972-AS AM05499-SS AD04279 AM03300-AS AM05500-SS AD04288 AM04874-AS AM05504-SS
AD04271 AM05498-AS AM05499-SS AD04280 AM05495-AS AM04412-SS AD04289 AM04874-AS AM05505-SS

TABLE 3B
LPA RNAi agent duplexes with Duplex ID numbers.
Antisense Sense Strand
Duplex ID Strand ID ID
SD0001 1533-AS00 1533-SS00
SD0002 1533-AS01 1533-SS00
SD0003 1533-AS02 1533-SS00
SD0004 1533-AS03 1533-SS00
SD0005 1533-AS04 1533-SS00
SD0006 1533-AS05 1533-SS00
SD0007 1533-AS06 1533-SS00
SD0008 1533-AS07 1533-SS00
SD0009 1533-AS08 1533-SS00
SD0010 1533-AS09 1533-SS00
SD0011 1533-AS10 1533-SS00
SD0012 1533-AS11 1533-SS00
SD0013 1533-AS12 1533-SS00
SD0014 1533-AS13 1533-SS00
SD0015 1533-AS14 1533-SS00
SD0016 1533-AS00 1533-SS01
SD0017 1533-AS01 1533-SS01
SD0018 1533-AS02 1533-SS01
SD0019 1533-AS03 1533-SS01
SD0020 1533-AS04 1533-SS01
SD0021 1533-AS05 1533-SS01
SD0022 1533-AS06 1533-SS01
SD0023 1533-AS07 1533-SS01
SD0024 1533-AS08 1533-SS01
SD0025 1533-AS09 1533-SS01
SD0026 1533-AS10 1533-SS01
SD0027 1533-AS11 1533-SS01
SD0028 1533-AS12 1533-SS01
SD0029 1533-AS13 1533-SS01
SD0030 1533-AS14 1533-SS01
SD0031 1533-AS00 1533-SS02
SD0032 1533-AS01 1533-SS02
SD0033 1533-AS02 1533-SS02
SD0034 1533-AS03 1533-SS02
SD0035 1533-AS04 1533-SS02
SD0036 1533-AS05 1533-SS02
SD0037 1533-AS06 1533-SS02
SD0038 1533-AS07 1533-SS02
SD0039 1533-AS08 1533-SS02
SD0040 1533-AS09 1533-SS02
SD0041 1533-AS10 1533-SS02
SD0042 1533-AS11 1533-SS02
SD0043 1533-AS12 1533-SS02
SD0044 1533-AS13 1533-SS02
SD0045 1533-AS14 1533-SS02
SD0046 1533-AS00 1533-SS03
SD0047 1533-AS01 1533-SS03
SD0048 1533-AS02 1533-SS03
SD0049 1533-AS03 1533-SS03
SD0050 1533-AS04 1533-SS03
SD0051 1533-AS05 1533-SS03
SD0052 1533-AS06 1533-SS03
SD0053 1533-AS07 1533-SS03
SD0054 1533-AS08 1533-SS03
SD0055 1533-AS09 1533-SS03
SD0056 1533-AS10 1533-SS03
SD0057 1533-AS11 1533-SS03
SD0058 1533-AS12 1533-SS03
SD0059 1533-AS13 1533-SS03
SD0060 1533-AS14 1533-SS03
SD0061 1533-AS00 1533-SS04
SD0062 1533-AS01 1533-SS04
SD0063 1533-AS02 1533-SS04
SD0064 1533-AS03 1533-SS04
SD0065 1533-AS04 1533-SS04
SD0066 1533-AS05 1533-SS04
SD0067 1533-AS06 1533-SS04
SD0068 1533-AS07 1533-SS04
SD0069 1533-AS08 1533-SS04
SD0070 1533-AS09 1533-SS04
SD0071 1533-AS10 1533-SS04
SD0072 1533-AS11 1533-SS04
SD0073 1533-AS12 1533-SS04
SD0074 1533-AS13 1533-SS04
SD0075 1533-AS14 1533-SS04
SD0076 1533-AS00 1533-SS05
SD0077 1533-AS01 1533-SS05
SD0078 1533-AS02 1533-SS05
SD0079 1533-AS03 1533-SS05
SD0080 1533-AS04 1533-SS05
SD0081 1533-AS05 1533-SS05
SD0082 1533-AS06 1533-SS05
SD0083 1533-AS07 1533-SS05
SD0084 1533-AS08 1533-SS05
SD0085 1533-AS09 1533-SS05
SD0086 1533-AS10 1533-SS05
SD0087 1533-AS11 1533-SS05
SD0088 1533-AS12 1533-SS05
SD0089 1533-AS13 1533-SS05
SD0090 1533-AS14 1533-SS05
SD0091 1533-AS00 1533-SS06
SD0092 1533-AS01 1533-SS06
SD0093 1533-AS02 1533-SS06
SD0094 1533-AS03 1533-SS06
SD0095 1533-AS04 1533-SS06
SD0096 1533-AS05 1533-SS06
SD0097 1533-AS06 1533-SS06
SD0098 1533-AS07 1533-SS06
SD0099 1533-AS08 1533-SS06
SD0100 1533-AS09 1533-SS06
SD0101 1533-AS10 1533-SS06
SD0102 1533-AS11 1533-SS06
SD0103 1533-AS12 1533-SS06
SD0104 1533-AS13 1533-SS06
SD0105 1533-AS14 1533-SS06
SD0106 1533-AS00 1533-SS07
SD0107 1533-AS01 1533-SS07
SD0108 1533-AS02 1533-SS07
SD0109 1533-AS03 1533-SS07
SD0110 1533-AS04 1533-SS07
SD0111 1533-AS05 1533-SS07
SD0112 1533-AS06 1533-SS07
SD0113 1533-AS07 1533-SS07
SD0114 1533-AS08 1533-SS07
SD0115 1533-AS09 1533-SS07
SD0116 1533-AS10 1533-SS07
SD0117 1533-AS11 1533-SS07
SD0118 1533-AS12 1533-SS07
SD0119 1533-AS13 1533-SS07
SD0120 1533-AS14 1533-SS07
SD0121 1533-AS00 1533-SS08
SD0122 1533-AS01 1533-SS08
SD0123 1533-AS02 1533-SS08
SD0124 1533-AS03 1533-SS08
SD0125 1533-AS04 1533-SS08
SD0126 1533-AS05 1533-SS08
SD0127 1533-AS06 1533-SS08
SD0128 1533-AS07 1533-SS08
SD0129 1533-AS08 1533-SS08
SD0130 1533-AS09 1533-SS08
SD0131 1533-AS10 1533-SS08
SD0132 1533-AS11 1533-SS08
SD0133 1533-AS12 1533-SS08
SD0134 1533-AS13 1533-SS08
SD0135 1533-AS14 1533-SS08
SD0136 1533-AS00 1533-SS09
SD0137 1533-AS01 1533-SS09
SD0138 1533-AS02 1533-SS09
SD0139 1533-AS03 1533-SS09
SD0140 1533-AS04 1533-SS09
SD0141 1533-AS05 1533-SS09
SD0142 1533-AS06 1533-SS09
SD0143 1533-AS07 1533-SS09
SD0144 1533-AS08 1533-SS09
SD0145 1533-AS09 1533-SS09
SD0146 1533-AS10 1533-SS09
SD0147 1533-AS11 1533-SS09
SD0148 1533-AS12 1533-SS09
SD0149 1533-AS13 1533-SS09
SD0150 1533-AS14 1533-SS09
SD0151 1533-AS00 1533-SS01
SD0152 1533-AS01 1533-SS01
SD0153 1533-AS02 1533-SS01
SD0154 1533-AS03 1533-SS01
SD0155 1533-AS04 1533-SS01
SD0156 1533-AS05 1533-SS01
SD0157 1533-AS06 1533-SS01
SD0158 1533-AS07 1533-SS01
SD0159 1533-AS08 1533-SS01
SD0160 1533-AS09 1533-SS01
SD0161 1533-AS10 1533-SS01
SD0162 1533-AS11 1533-SS01
SD0163 1533-AS12 1533-SS01
SD0164 1533-AS13 1533-SS01
SD0165 1533-AS14 1533-SS01
SD0166 1533-AS00 1533-SS01
SD0167 1533-AS01 1533-SS01
SD0168 1533-AS02 1533-SS01
SD0169 1533-AS03 1533-SS01
SD0170 1533-AS04 1533-SS01
SD0171 1533-AS05 1533-SS01
SD0172 1533-AS06 1533-SS01
SD0173 1533-AS07 1533-SS01
SD0174 1533-AS08 1533-SS01
SD0175 1533-AS09 1533-SS01
SD0176 1533-AS10 1533-SS01
SD0177 1533-AS11 1533-SS01
SD0178 1533-AS12 1533-SS01
SD0179 1533-AS13 1533-SS01
SD0180 1533-AS14 1533-SS01
SD0181 1533-AS00 1533-SS02
SD0182 1533-AS01 1533-SS02
SD0183 1533-AS02 1533-SS02
SD0184 1533-AS03 1533-SS02
SD0185 1533-AS04 1533-SS02
SD0186 1533-AS05 1533-SS02
SD0187 1533-AS06 1533-SS02
SD0188 1533-AS07 1533-SS02
SD0189 1533-AS08 1533-SS02
SD0190 1533-AS09 1533-SS02
SD0191 1533-AS10 1533-SS02
SD0192 1533-AS11 1533-SS02
SD0193 1533-AS12 1533-SS02
SD0194 1533-AS13 1533-SS02
SD0195 1533-AS14 1533-SS02
SD0196 1533-AS00 1533-CfinSS
SD0197 1533-AS01 1533-CfinSS
SD0198 1533-AS02 1533-CfinSS
SD0199 1533-AS03 1533-CfinSS
SD0200 1533-AS04 1533-CfinSS
SD0201 1533-AS05 1533-CfinSS
SD0202 1533-AS06 1533-CfinSS
SD0203 1533-AS07 1533-CfinSS
SD0204 1533-AS08 1533-CfinSS
SD0205 1533-AS09 1533-CfinSS
SD0206 1533-AS10 1533-CfinSS
SD0207 1533-AS11 1533-CfinSS
SD0208 1533-AS12 1533-CfinSS
SD0209 1533-AS13 1533-CfinSS
SD0210 1533-AS14 1533-CfinSS
SD0211 1533-CfinAS 1533-SS00
SD0212 1533-CfinAS 1533-SS01
SD0213 1533-CfinAS 1533-SS02
SD0214 1533-CfinAS 1533-SS03
SD0215 1533-CfinAS 1533-SS04
SD0216 1533-CfinAS 1533-SS05
SD0217 1533-CfinAS 1533-SS06
SD0218 1533-CfinAS 1533-SS07
SD0219 1533-CfinAS 1533-SS08
SD0220 1533-CfinAS 1533-SS09
SD0221 1533-CfinAS 1533-SS10
SD0222 1533-CfinAS 1533-SS11
SD0223 1533-CfinAS 1533-SS12
SD0224 1533-CfinAS 1533-SS13
SD0225 1533-CfinAS 1533-SS14
SD0226 1533-CfinAS 1533-SS15
SD0227 1533-CfinAS 1533-SS16
SD0228 1533-CfinAS 1533-SS17
SD0229 1533-CfinAS 1533-SS18
SD0230 1533-CfinAS 1533-SS19
SD0231 1533-CfinAS 1533-SS20
SD0232 1533-AS00 1533-SS12
SD0233 1533-AS01 1533-SS12
SD0234 1533-AS02 1533-SS12
SD0235 1533-AS03 1533-SS12
SD0236 1533-AS04 1533-SS12
SD0237 1533-AS05 1533-SS12
SD0238 1533-AS06 1533-SS12
SD0239 1533-AS07 1533-SS12
SD0240 1533-AS08 1533-SS12
SD0241 1533-AS09 1533-SS12
SD0242 1533-AS10 1533-SS12
SD0243 1533-AS11 1533-SS12
SD0244 1533-AS12 1533-SS12
SD0245 1533-AS13 1533-SS12
SD0246 1533-AS14 1533-SS12
SD0247 1533-AS00 1533-SS13
SD0248 1533-AS01 1533-SS13
SD0249 1533-AS02 1533-SS13
SD0250 1533-AS03 1533-SS13
SD0251 1533-AS04 1533-SS13
SD0252 1533-AS05 1533-SS13
SD0253 1533-AS06 1533-SS13
SD0254 1533-AS07 1533-SS13
SD0255 1533-AS08 1533-SS13
SD0256 1533-AS09 1533-SS13
SD0257 1533-AS10 1533-SS13
SD0258 1533-AS11 1533-SS13
SD0259 1533-AS12 1533-SS13
SD0260 1533-AS13 1533-SS13
SD0261 1533-AS14 1533-SS13
SD0262 1533-AS00 1533-SS14
SD0263 1533-AS01 1533-SS14
SD0264 1533-AS02 1533-SS14
SD0265 1533-AS03 1533-SS14
SD0266 1533-AS04 1533-SS14
SD0267 1533-AS05 1533-SS14
SD0268 1533-AS06 1533-SS14
SD0269 1533-AS07 1533-SS14
SD0270 1533-AS08 1533-SS14
SD0271 1533-AS09 1533-SS14
SD0272 1533-AS10 1533-SS14
SD0273 1533-AS11 1533-SS14
SD0274 1533-AS12 1533-SS14
SD0275 1533-AS13 1533-SS14
SD0276 1533-AS14 1533-SS14
SD0277 1533-AS00 1533-SS15
SD0278 1533-AS01 1533-SS15
SD0279 1533-AS02 1533-SS15
SD0280 1533-AS03 1533-SS15
SD0281 1533-AS04 1533-SS15
SD0282 1533-AS05 1533-SS15
SD0283 1533-AS06 1533-SS15
SD0284 1533-AS07 1533-SS15
SD0285 1533-AS08 1533-SS15
SD0286 1533-AS09 1533-SS15
SD0287 1533-AS10 1533-SS15
SD0288 1533-AS11 1533-SS15
SD0289 1533-AS12 1533-SS15
SD0290 1533-AS13 1533-SS15
SD0291 1533-AS14 1533-SS15
SD0292 1533-AS00 1533-SS16
SD0293 1533-AS01 1533-SS16
SD0294 1533-AS02 1533-SS16
SD0295 1533-AS03 1533-SS16
SD0296 1533-AS04 1533-SS16
SD0297 1533-AS05 1533-SS16
SD0298 1533-AS06 1533-SS16
SD0299 1533-AS07 1533-SS16
SD0300 1533-AS08 1533-SS16
SD0301 1533-AS09 1533-SS16
SD0302 1533-AS10 1533-SS16
SD0303 1533-AS11 1533-SS16
SD0304 1533-AS12 1533-SS16
SD0305 1533-AS13 1533-SS16
SD0306 1533-AS14 1533-SS16
SD0307 1533-AS00 1533-SS17
SD0308 1533-AS01 1533-SS17
SD0309 1533-AS02 1533-SS17
SD0310 1533-AS03 1533-SS17
SD0311 1533-AS04 1533-SS17
SD0312 1533-AS05 1533-SS17
SD0313 1533-AS06 1533-SS17
SD0314 1533-AS07 1533-SS17
SD0315 1533-AS08 1533-SS17
SD0316 1533-AS09 1533-SS17
SD0317 1533-AS10 1533-SS17
SD0318 1533-AS11 1533-SS17
SD0319 1533-AS12 1533-SS17
SD0320 1533-AS13 1533-SS17
SD0321 1533-AS14 1533-SS17
SD0322 1533-AS00 1533-SS18
SD0323 1533-AS01 1533-SS18
SD0324 1533-AS02 1533-SS18
SD0325 1533-AS03 1533-SS18
SD0326 1533-AS04 1533-SS18
SD0327 1533-AS05 1533-SS18
SD0328 1533-AS06 1533-SS18
SD0329 1533-AS07 1533-SS18
SD0330 1533-AS08 1533-SS18
SD0331 1533-AS09 1533-SS18
SD0332 1533-AS10 1533-SS18
SD0333 1533-AS11 1533-SS18
SD0334 1533-AS12 1533-SS18
SD0335 1533-AS13 1533-SS18
SD0336 1533-AS14 1533-SS18
SD0337 1533-AS00 1533-SS19
SD0338 1533-AS01 1533-SS19
SD0339 1533-AS02 1533-SS19
SD0340 1533-AS03 1533-SS19
SD0341 1533-AS04 1533-SS19
SD0342 1533-AS05 1533-SS19
SD0343 1533-AS06 1533-SS19
SD0344 1533-AS07 1533-SS19
SD0345 1533-AS08 1533-SS19
SD0346 1533-AS09 1533-SS19
SD0347 1533-AS10 1533-SS19
SD0348 1533-AS11 1533-SS19
SD0349 1533-AS12 1533-SS19
SD0350 1533-AS13 1533-SS19
SD0351 1533-AS14 1533-SS19
SD0352 1532-AS00 1532-SS00
SD0353 1532-AS01 1532-SS00
SD0354 1532-AS02 1532-SS00
SD0355 1532-AS03 1532-SS00
SD0356 1532-AS04 1532-SS00
SD0357 1532-AS05 1532-SS00
SD0358 1532-AS06 1532-SS00
SD0359 1532-AS07 1532-SS00
SD0360 1532-AS08 1532-SS00
SD0361 1532-AS09 1532-SS00
SD0362 1532-AS10 1532-SS00
SD0363 1532-AS11 1532-SS00
SD0364 1532-AS12 1532-SS00
SD0365 1532-AS13 1532-SS00
SD0366 1532-AS00 1532-SS01
SD0367 1532-AS01 1532-SS01
SD0368 1532-AS02 1532-SS01
SD0369 1532-AS03 1532-SS01
SD0370 1532-AS04 1532-SS01
SD0371 1532-AS05 1532-SS01
SD0372 1532-AS06 1532-SS01
SD0373 1532-AS07 1532-SS01
SD0374 1532-AS08 1532-SS01
SD0375 1532-AS09 1532-SS01
SD0376 1532-AS10 1532-SS01
SD0377 1532-AS11 1532-SS01
SD0378 1532-AS12 1532-SS01
SD0379 1532-AS13 1532-SS01
SD0380 1532-AS00 1532-SS02
SD0381 1532-AS01 1532-SS02
SD0382 1532-AS02 1532-SS02
SD0383 1532-AS03 1532-SS02
SD0384 1532-AS04 1532-SS02
SD0385 1532-AS05 1532-SS02
SD0386 1532-AS06 1532-SS02
SD0387 1532-AS07 1532-SS02
SD0388 1532-AS08 1532-SS02
SD0389 1532-AS09 1532-SS02
SD0390 1532-AS10 1532-SS02
SD0391 1532-AS11 1532-SS02
SD0392 1532-AS12 1532-SS02
SD0393 1532-AS13 1532-SS02
SD0394 1532-AS00 1532-SS03
SD0395 1532-AS01 1532-SS03
SD0396 1532-AS02 1532-SS03
SD0397 1532-AS03 1532-SS03
SD0398 1532-AS04 1532-SS03
SD0399 1532-AS05 1532-SS03
SD0400 1532-AS06 1532-SS03
SD0401 1532-AS07 1532-SS03
SD0402 1532-AS08 1532-SS03
SD0403 1532-AS09 1532-SS03
SD0404 1532-AS10 1532-SS03
SD0405 1532-AS11 1532-SS03
SD0406 1532-AS12 1532-SS03
SD0407 1532-AS13 1532-SS03
SD0408 1532-AS00 1532-SS04
SD0409 1532-AS01 1532-SS04
SD0410 1532-AS02 1532-SS04
SD0411 1532-AS03 1532-SS04
SD0412 1532-AS04 1532-SS04
SD0413 1532-AS05 1532-SS04
SD0414 1532-AS06 1532-SS04
SD0415 1532-AS07 1532-SS04
SD0416 1532-AS08 1532-SS04
SD0417 1532-AS09 1532-SS04
SD0418 1532-AS10 1532-SS04
SD0419 1532-AS11 1532-SS04
SD0420 1532-AS12 1532-SS04
SD0421 1532-AS13 1532-SS04
SD0422 1532-AS00 1532-SS05
SD0423 1532-AS01 1532-SS05
SD0424 1532-AS02 1532-SS05
SD0425 1532-AS03 1532-SS05
SD0426 1532-AS04 1532-SS05
SD0427 1532-AS05 1532-SS05
SD0428 1532-AS06 1532-SS05
SD0429 1532-AS07 1532-SS05
SD0430 1532-AS08 1532-SS05
SD0431 1532-AS09 1532-SS05
SD0432 1532-AS10 1532-SS05
SD0433 1532-AS11 1532-SS05
SD0434 1532-AS12 1532-SS05
SD0435 1532-AS13 1532-SS05
SD0436 1532-AS00 1532-SS06
SD0437 1532-AS01 1532-SS06
SD0438 1532-AS02 1532-SS06
SD0439 1532-AS03 1532-SS06
SD0440 1532-AS04 1532-SS06
SD0441 1532-AS05 1532-SS06
SD0442 1532-AS06 1532-SS06
SD0443 1532-AS07 1532-SS06
SD0444 1532-AS08 1532-SS06
SD0445 1532-AS09 1532-SS06
SD0446 1532-AS10 1532-SS06
SD0447 1532-AS11 1532-SS06
SD0448 1532-AS12 1532-SS06
SD0449 1532-AS13 1532-SS06
SD0450 1532-AS00 1532-SS07
SD0451 1532-AS01 1532-SS07
SD0452 1532-AS02 1532-SS07
SD0453 1532-AS03 1532-SS07
SD0454 1532-AS04 1532-SS07
SD0455 1532-AS05 1532-SS07
SD0456 1532-AS06 1532-SS07
SD0457 1532-AS07 1532-SS07
SD0458 1532-AS08 1532-SS07
SD0459 1532-AS09 1532-SS07
SD0460 1532-AS10 1532-SS07
SD0461 1532-AS11 1532-SS07
SD0462 1532-AS12 1532-SS07
SD0463 1532-AS13 1532-SS07
SD0464 1532-AS00 1532-SS08
SD0465 1532-AS01 1532-SS08
SD0466 1532-AS02 1532-SS08
SD0467 1532-AS03 1532-SS08
SD0468 1532-AS04 1532-SS08
SD0469 1532-AS05 1532-SS08
SD0470 1532-AS06 1532-SS08
SD0471 1532-AS07 1532-SS08
SD0472 1532-AS08 1532-SS08
SD0473 1532-AS09 1532-SS08
SD0474 1532-AS10 1532-SS08
SD0475 1532-AS11 1532-SS08
SD0476 1532-AS12 1532-SS08
SD0477 1532-AS13 1532-SS08
SD0478 1532-AS00 1532-SS09
SD0479 1532-AS01 1532-SS09
SD0480 1532-AS02 1532-SS09
SD0481 1532-AS03 1532-SS09
SD0482 1532-AS04 1532-SS09
SD0483 1532-AS05 1532-SS09
SD0484 1532-AS06 1532-SS09
SD0485 1532-AS07 1532-SS09
SD0486 1532-AS08 1532-SS09
SD0487 1532-AS09 1532-SS09
SD0488 1532-AS10 1532-SS09
SD0489 1532-AS11 1532-SS09
SD0490 1532-AS12 1532-SS09
SD0491 1532-AS13 1532-SS09
SD0492 1532-AS00 1532-SS10
SD0493 1532-AS01 1532-SS10
SD0494 1532-AS02 1532-SS10
SD0495 1532-AS03 1532-SS10
SD0496 1532-AS04 1532-SS10
SD0497 1532-AS05 1532-SS10
SD0498 1532-AS06 1532-SS10
SD0499 1532-AS07 1532-SS10
SD0500 1532-AS08 1532-SS10
SD0501 1532-AS09 1532-SS10
SD0502 1532-AS10 1532-SS10
SD0503 1532-AS11 1532-SS10
SD0504 1532-AS12 1532-SS10
SD0505 1532-AS13 1532-SS10
SD0506 1532-AS00 1532-SS11
SD0507 1532-AS01 1532-SS11
SD0508 1532-AS02 1532-SS11
SD0509 1532-AS03 1532-SS11
SD0510 1532-AS04 1532-SS11
SD0511 1532-AS05 1532-SS11
SD0512 1532-AS06 1532-SS11
SD0513 1532-AS07 1532-SS11
SD0514 1532-AS08 1532-SS11
SD0515 1532-AS09 1532-SS11
SD0516 1532-AS10 1532-SS11
SD0517 1532-AS11 1532-SS11
SD0518 1532-AS12 1532-SS11
SD0519 1532-AS13 1532-SS11
SD0520 1532-AS00 1532-SS12
SD0521 1532-AS01 1532-SS12
SD0522 1532-AS02 1532-SS12
SD0523 1532-AS03 1532-SS12
SD0524 1532-AS04 1532-SS12
SD0525 1532-AS05 1532-SS12
SD0526 1532-AS06 1532-SS12
SD0527 1532-AS07 1532-SS12
SD0528 1532-AS08 1532-SS12
SD0529 1532-AS09 1532-SS12
SD0530 1532-AS10 1532-SS12
SD0531 1532-AS11 1532-SS12
SD0532 1532-AS12 1532-SS12
SD0533 1532-AS13 1532-SS12
SD0534 1532-AS00 1532-SS13
SD0535 1532-AS01 1532-SS13
SD0536 1532-AS02 1532-SS13
SD0537 1532-AS03 1532-SS13
SD0538 1532-AS04 1532-SS13
SD0539 1532-AS05 1532-SS13
SD0540 1532-AS06 1532-SS13
SD0541 1532-AS07 1532-SS13
SD0542 1532-AS08 1532-SS13
SD0543 1532-AS09 1532-SS13
SD0544 1532-AS10 1532-SS13
SD0545 1532-AS11 1532-SS13
SD0546 1532-AS12 1532-SS13
SD0547 1532-AS13 1532-SS13
SD0548 1532-AS00 1532-SS14
SD0549 1532-AS01 1532-SS14
SD0550 1532-AS02 1532-SS14
SD0551 1532-AS03 1532-SS14
SD0552 1532-AS04 1532-SS14
SD0553 1532-AS05 1532-SS14
SD0554 1532-AS06 1532-SS14
SD0555 1532-AS07 1532-SS14
SD0556 1532-AS08 1532-SS14
SD0557 1532-AS09 1532-SS14
SD0558 1532-AS10 1532-SS14
SD0559 1532-AS11 1532-SS14
SD0560 1532-AS12 1532-SS14
SD0561 1532-AS13 1532-SS14
SD0562 1532-AS00 1532-SS15
SD0563 1532-AS01 1532-SS15
SD0564 1532-AS02 1532-SS15
SD0565 1532-AS03 1532-SS15
SD0566 1532-AS04 1532-SS15
SD0567 1532-AS05 1532-SS15
SD0568 1532-AS06 1532-SS15
SD0569 1532-AS07 1532-SS15
SD0570 1532-AS08 1532-SS15
SD0571 1532-AS09 1532-SS15
SD0572 1532-AS10 1532-SS15
SD0573 1532-AS11 1532-SS15
SD0574 1532-AS12 1532-SS15
SD0575 1532-AS13 1532-SS15
SD0576 1532-AS00 1532-SS16
SD0577 1532-AS01 1532-SS16
SD0578 1532-AS02 1532-SS16
SD0579 1532-AS03 1532-SS16
SD0580 1532-AS04 1532-SS16
SD0581 1532-AS05 1532-SS16
SD0582 1532-AS06 1532-SS16
SD0583 1532-AS07 1532-SS16
SD0584 1532-AS08 1532-SS16
SD0585 1532-AS09 1532-SS16
SD0586 1532-AS10 1532-SS16
SD0587 1532-AS11 1532-SS16
SD0588 1532-AS12 1532-SS16
SD0589 1532-AS13 1532-SS16
SD0590 1532-AS00 1532-SS17
SD0591 1532-AS01 1532-SS17
SD0592 1532-AS02 1532-SS17
SD0593 1532-AS03 1532-SS17
SD0594 1532-AS04 1532-SS17
SD0595 1532-AS05 1532-SS17
SD0596 1532-AS06 1532-SS17
SD0597 1532-AS07 1532-SS17
SD0598 1532-AS08 1532-SS17
SD0599 1532-AS09 1532-SS17
SD0600 1532-AS10 1532-SS17
SD0601 1532-AS11 1532-SS17
SD0602 1532-AS12 1532-SS17
SD0603 1532-AS13 1532-SS17
SD0604 1532-AS00 1532-SS18
SD0605 1532-AS01 1532-SS18
SD0606 1532-AS02 1532-SS18
SD0607 1532-AS03 1532-SS18
SD0608 1532-AS04 1532-SS18
SD0609 1532-AS05 1532-SS18
SD0610 1532-AS06 1532-SS18
SD0611 1532-AS07 1532-SS18
SD0612 1532-AS08 1532-SS18
SD0613 1532-AS09 1532-SS18
SD0614 1532-AS10 1532-SS18
SD0615 1532-AS11 1532-SS18
SD0616 1532-AS12 1532-SS18
SD0617 1532-AS13 1532-SS18
SD0618 1532-AS00 1532-SS19
SD0619 1532-AS01 1532-SS19
SD0620 1532-AS02 1532-SS19
SD0621 1532-AS03 1532-SS19
SD0622 1532-AS04 1532-SS19
SD0623 1532-AS05 1532-SS19
SD0624 1532-AS06 1532-SS19
SD0625 1532-AS07 1532-SS19
SD0626 1532-AS08 1532-SS19
SD0627 1532-AS09 1532-SS19
SD0628 1532-AS10 1532-SS19
SD0629 1532-AS11 1532-SS19
SD0630 1532-AS12 1532-SS19
SD0631 1532-AS13 1532-SS19
SD0632 1532-AS00 1532-SS20
SD0633 1532-AS01 1532-SS20
SD0634 1532-AS02 1532-SS20
SD0635 1532-AS03 1532-SS20
SD0636 1532-AS04 1532-SS20
SD0637 1532-AS05 1532-SS20
SD0638 1532-AS06 1532-SS20
SD0639 1532-AS07 1532-SS20
SD0640 1532-AS08 1532-SS20
SD0641 1532-AS09 1532-SS20
SD0642 1532-AS10 1532-SS20
SD0643 1532-AS11 1532-SS20
SD0644 1532-AS12 1532-SS20
SD0645 1532-AS13 1532-SS20
SD0646 1532-AS00 1532-SS21
SD0647 1532-AS01 1532-SS21
SD0648 1532-AS02 1532-SS21
SD0649 1532-AS03 1532-SS21
SD0650 1532-AS04 1532-SS21
SD0651 1532-AS05 1532-SS21
SD0652 1532-AS06 1532-SS21
SD0653 1532-AS07 1532-SS21
SD0654 1532-AS08 1532-SS21
SD0655 1532-AS09 1532-SS21
SD0656 1532-AS10 1532-SS21
SD0657 1532-AS11 1532-SS21
SD0658 1532-AS12 1532-SS21
SD0659 1532-AS13 1532-SS21
SD0660 1532-AS00 1532-SS22
SD0661 1532-AS01 1532-SS22
SD0662 1532-AS02 1532-SS22
SD0663 1532-AS03 1532-SS22
SD0664 1532-AS04 1532-SS22
SD0665 1532-AS05 1532-SS22
SD0666 1532-AS06 1532-SS22
SD0667 1532-AS07 1532-SS22
SD0668 1532-AS08 1532-SS22
SD0669 1532-AS09 1532-SS22
SD0670 1532-AS10 1532-SS22
SD0671 1532-AS11 1532-SS22
SD0672 1532-AS12 1532-SS22
SD0673 1532-AS13 1532-SS22
SD0674 1532-AS00 1532-SS23
SD0675 1532-AS01 1532-SS23
SD0676 1532-AS02 1532-SS23
SD0677 1532-AS03 1532-SS23
SD0678 1532-AS04 1532-SS23
SD0679 1532-AS05 1532-SS23
SD0680 1532-AS06 1532-SS23
SD0681 1532-AS07 1532-SS23
SD0682 1532-AS08 1532-SS23
SD0683 1532-AS09 1532-SS23
SD0684 1532-AS10 1532-SS23
SD0685 1532-AS11 1532-SS23
SD0686 1532-AS12 1532-SS23
SD0687 1532-AS13 1532-SS23
SD0688 1532-AS00 1532-SS24
SD0689 1532-AS01 1532-SS24
SD0690 1532-AS02 1532-SS24
SD0691 1532-AS03 1532-SS24
SD0692 1532-AS04 1532-SS24
SD0693 1532-AS05 1532-SS24
SD0694 1532-AS06 1532-SS24
SD0695 1532-AS07 1532-SS24
SD0696 1532-AS08 1532-SS24
SD0697 1532-AS09 1532-SS24
SD0698 1532-AS10 1532-SS24
SD0699 1532-AS11 1532-SS24
SD0700 1532-AS12 1532-SS24
SD0701 1532-AS13 1532-SS24
SD0702 1532-AS14 1532-SS00
SD0703 1532-AS15 1532-SS00
SD0704 1532-AS16 1532-SS00
SD0705 1532-AS17 1532-SS00
SD0706 1532-AS18 1532-SS00
SD0707 1532-AS19 1532-SS00
SD0708 1532-AS20 1532-SS00
SD0709 1532-AS21 1532-SS00
SD0710 1532-AS22 1532-SS00
SD0711 1532-AS23 1532-SS00
SD0712 1532-AS24 1532-SS00
SD0713 1532-AS25 1532-SS00
SD0714 1532-AS26 1532-SS00
SD0715 1532-AS27 1532-SS00

In some embodiments, an LPA RNAi agent comprises an antisense strand comprising the nucleotide sequence of SEQ ID NO:1242 (TCGUAUAACAAUAAGGGGC). In some embodiments, an LPA RNAi agent comprises an antisense strand comprising the nucleotide sequence of SEQ ID NO:1244 (UCGUAUAACAAUAAGGGG). In some embodiments, an LPA RNAi agent comprises an antisense strand comprising the nucleotide sequence of SEQ ID NO:1246 (UCGUAUAACAAUAAGGG). In some embodiments, an LPA RNAi agent comprises an antisense strand comprising the nucleotide sequence of SEQ ID NO:1248 (TGAGAAUGAGCCUCGAUAA). In some embodiments, an LPA RNAi agent comprises an antisense strand comprising the nucleotide sequence of SEQ ID NO:1250 (UGAGAAUGAGCCUCGAUA). In some embodiments, an LPA RNAi agent comprises an antisense strand comprising the nucleotide sequence of SEQ ID NO:1252 (UGAGAAUGAGCCUCGAU). In some embodiments, an LPA RNAi agent comprises an antisense strand comprising the nucleotide sequence of SEQ ID NO:1254 (UGUAUAACAAUAAGGGG). In some embodiments, an LPA RNAi agent comprises an antisense strand comprising the nucleotide sequence of SEQ ID NO:1280 (CGUAUAACAAUAAGGGGC). In some embodiments, an LPA RNAi agent comprises an antisense strand comprising the nucleotide sequence of SEQ ID NO:1281 (GAGAAUGAGCCUCGAUAA). In some embodiments, an LPA RNAi agent comprises an antisense strand comprising the nucleotide sequence of SEQ ID NO:1282 (UCGUAUAACAAUAAGGGGC). In some embodiments, an LPA RNAi agent comprises an antisense strand comprising the nucleotide sequence of SEQ ID NO:1283 (UGAGAAUGAGCCUCGAUAA). In some embodiments, one or more of the nucleotides is modified.

In some embodiments, an LPA RNAi agent comprises a sense strand comprising the nucleotide sequence of SEQ ID NO:1243 (GCCCCUUAUUGUUAUACGA). In some embodiments, an LPA RNAi agent comprises a sense strand comprising the nucleotide sequence of SEQ ID NO:1245 (CCCCUUAUUGUUAUACGA). In some embodiments, an LPA RNAi agent comprises a sense strand comprising the nucleotide sequence of SEQ ID NO:1247 (CCCUUAUUGUUAUACGA). In some embodiments, an LPA RNAi agent comprises a sense strand comprising the nucleotide sequence of SEQ ID NO:1249 (UUAUCGAGGCUCAUUCUCA). In some embodiments, an LPA RNAi agent comprises a sense strand comprising the nucleotide sequence of SEQ ID NO:1251 (UAUCGAGGCUCAUUCUCA). In some embodiments, an LPA RNAi agent comprises a sense strand comprising the nucleotide sequence of SEQ ID NO:1253 (AUCGAGGCUCAUUCUCA). In some embodiments, an LPA RNAi agent comprises a sense strand comprising the nucleotide sequence of SEQ ID NO:1255 (CCCCUUAUUGUUAUACA). In some embodiments, an LPA RNAi agent comprises a sense strand comprising the nucleotide sequence of SEQ ID NO:1284 (GCCCCUUAUUGUUAUACG). In some embodiments, an LPA RNAi agent comprises a sense strand comprising the nucleotide sequence of SEQ ID NO:1285 (UUAUCGAGGCUCAUUCUC). In some embodiments, one or more of the nucleotides is modified.

In some embodiments, an LPA RNAi agent comprises an antisense strand comprising the nucleotide sequence of SEQ ID NO:1242 and a sense strand comprising the nucleotide sequence of SEQ ID NO:1243. In some embodiments, an LPA RNAi agent comprises an antisense strand comprising the nucleotide sequence of SEQ ID NO:1244 and a sense strand comprising the nucleotide sequence of SEQ ID NO:1245. In some embodiments, an LPA RNAi agent comprises an antisense strand comprising the nucleotide sequence of SEQ ID NO:1246 and a sense strand comprising the nucleotide sequence of SEQ ID NO:1247. In some embodiments, an LPA RNAi agent comprises an antisense strand comprising the nucleotide sequence of SEQ ID NO:1248 and a sense strand comprising the nucleotide sequence of SEQ ID NO:1249. In some embodiments, an LPA RNAi agent comprises an antisense strand comprising the nucleotide sequence of SEQ ID NO:1250 and a sense strand comprising the nucleotide sequence of SEQ ID NO:1251. In some embodiments, an LPA RNAi agent comprises an antisense strand comprising the nucleotide sequence of SEQ ID NO:1252 and a sense strand comprising the nucleotide sequence of SEQ ID NO:1253. In some embodiments, an LPA RNAi agent comprises an antisense strand comprising the nucleotide sequence of SEQ ID NO:1254 and sense strand comprising the nucleotide sequence of SEQ ID NO:1255. In some embodiments, an LPA RNAi agent comprises an antisense strand comprising the nucleotide sequence of SEQ ID NO:1280 and a sense strand comprising the nucleotide sequence of SEQ ID NO:1284. In some embodiments, an LPA RNAi agent comprises an antisense strand comprising the nucleotide sequence of SEQ ID NO:1281 and a sense strand comprising the nucleotide sequence of SEQ ID NO: 1285. In some embodiments, an LPA RNAi agent comprises an antisense strand comprising the nucleotide sequence of SEQ ID NO:1282 and a sense strand comprising the nucleotide sequence of SEQ ID NO:1259. In some embodiments, an LPA RNAi agent comprises an antisense strand comprising the nucleotide sequence of SEQ ID NO:1283 and a sense strand comprising the nucleotide sequence of SEQ ID NO: 1249. In some embodiments, one or more of the nucleotides is modified.

In some embodiments, an LPA RNAi agent comprises an antisense strand comprising the nucleotide sequence of SEQ ID NO. 156, 164, or 188. In some embodiments, an LPA RNAi agent comprises a sense strand comprising the nucleotide sequence of SEQ ID NO. 310, 357, 384, or 376. In some embodiments, an LPA RNAi agent comprises an antisense strand and a sense strand comprising the nucleotide sequences of SEQ ID NOs:156/310, SEQ ID NOs:164/357, SEQ ID NOs:188/384, SEQ ID NOs:164/376, or SEQ ID NOs:164/384. In some embodiments, one or more of the nucleotides is modified.

In some embodiments, an LPA RNAi agent comprises an antisense strand comprising the nucleotide sequence of SEQ ID NO. 637, 709, 790, 787, or 788. In some embodiments, an LPA RNAi agent comprises a sense strand comprising the nucleotide sequence of SEQ ID NO:1132, 1135, 1189, 1191, or 1186. In some embodiments, an LPA RNAi agent comprises an antisense strand and a sense strand comprising the nucleotide sequences of SEQ ID NOs:637/1132, SEQ ID NOs:709/1135, SEQ ID NOs:790/1189, SEQ ID NOs:787/1191, or SEQ ID NOs:788/1186.

In some embodiments, an LPA RNAi agent comprises SEQ ID NO. 637, 709, 790, 787, or 788. In some embodiments, an LPA RNAi agent comprises SEQ ID NO:1132, 1135, 1189, 1191, or 1186. In some embodiments, an LPA RNAi agent comprises SEQ ID NOs:637/1132, SEQ ID NOs:709/1135, SEQ ID NOs:790/1189, SEQ ID NOs:787/1191, or SEQ ID NOs:788/1186.

In some embodiments, an LPA RNAi agent consists of SEQ ID NO. 637, 709, 790, 787, or 788. In some embodiments, an LPA RNAi agent consists of SEQ ID NO:1132, 1135, 1189, 1191, or 1186. In some embodiments, an LPA RNAi agent consists of SEQ ID NOs:637/1132, SEQ ID NOs:709/1135, SEQ ID NOs:790/1189, SEQ ID NOs:787/1191, or SEQ ID NOs:788/1186.

In some embodiments, an LPA RNAi agent comprises an antisense strand and a sense strand having the nucleotide sequences of any of the antisense strand/sense strand duplexes of Table 3A or 3B.

In some embodiments, an LPA RNAi agent comprises an antisense strand and a sense strand having the nucleotide sequences of any of the antisense strand/sense strand duplexes of Table 3A or 3B, and further comprises an asialoglycoprotein receptor ligand targeting group.

In some embodiments, an LPA RNAi agent comprises an antisense strand and a sense strand having the nucleotide sequences of any of the antisense strand/sense strand duplexes of Table 3A or 3B, and further comprises a targeting group selected from the group consisting of (C11PEG3NAG3), (C11-PEG5-NAG5), (C6-PEG4-NAG3), (NAG 3), (NAG4), (NAG5-1AA2), (NAG5-Palm), (NAG13), (NAG18), (NAG24), (NAG25), (NAG25)s, (NAG26), (NAG27), (NAG28), (NAG29), (NAG30), (NAG30)s, (NAG31), (NAG13), (NAG31s), (NAG32), (NAG33), (NAG34), (NAG35), (NAG36), and (NAG37).

In some embodiments, an LPA RNAi agent comprises an antisense strand and a sense strand having the modified nucleotide sequences of any of the antisense strand/sense strand duplexes of Table 3A or 3B.

In some embodiments, an LPA RNAi agent comprises an antisense strand and a sense strand having the modified nucleotide sequences of any of the antisense strand/sense strand duplexes of Table 3A or 3B, and further comprises an asialoglycoprotein receptor ligand targeting group.

In some embodiments, an LPA RNAi agent comprises an antisense strand and a sense strand having the modified nucleotide sequences of any of the antisense strand/sense strand duplexes of Table 3A or 3B, and further comprises a targeting group selected from the group consisting of (C11-PEG5-NAG5), (C11-PEG5-NAG5), (C6-PEG4-NAG3), (NAG 3), (NAG4), (NAG3-AA2), (NAG5-Palm), (NAG13), (NAG18), (NAG24), (NAG25), (NAG25)s, (NAG26), (NAG27), (NAG28), (NAG29), (NAG30), (NAG30)s, (NAG31), (NAG13), (NAG31s), (NAG32), (NAG33), (NAG34), (NAG35), (NAG36), and (NAG37).

In some embodiments, an LPA RNAi agent comprises any of the duplexes of Table 3A or 3B.

In some embodiments, an LPA RNAi agent consists of any of the duplexes of Table 3A or 3B.

In some embodiments, an LPA RNAi agent comprises an antisense strand and a sense strand having the nucleotide sequences AD03460, AD03536, AD03581, AD03583, AD3847, or AD04110.

In some embodiments, an LPA RNAi agent comprises an antisense strand and a sense strand having the nucleotide sequences AD03460, AD03536, AD03581, AD03583, AD3847, or AD04110, and further comprises an asialoglycoprotein receptor ligand targeting group.

In some embodiments, an LPA RNAi agent comprises an antisense strand and a sense strand having the nucleotide sequences AD03460, AD03536, AD03581, AD03583, AD3847, or AD04110, and further comprises a targeting group selected from the group consisting of (C11-PEG5-NAG5), (C11-PEG5-NAG5), (C6-PEG4-NAG3), (NAG 3), (NAG4), (NAG3-AA2), (NAG5-Palm), (NAG13), (NAG18), (NAG24), (NAG25), (NAG25)s, (NAG26), (NAG27), (NAG28), (NAG29), (NAG30), (NAG30)s, (NAG31), (NAG13), (NAG31s), (NAG32), (NAG33), (NAG34), (NAG35), (NAG36), and (NAG37).

In some embodiments, an LPA RNAi agent comprises an antisense strand and a sense strand having the modified nucleotide sequences AD03460, AD03536, AD03581, AD03583, AD3847, or AD04110.

In some embodiments, an LPA RNAi agent comprises an antisense strand and a sense strand having the modified nucleotide sequences AD03460, AD03536, AD03581, AD03583, AD3847, or AD04110, and further comprises an asialoglycoprotein receptor ligand targeting group.

In some embodiments, an LPA RNAi agent comprises an antisense strand and a sense strand having the modified nucleotide sequences AD03460, AD03536, AD03581, AD03583, AD3847, or AD04110, and further comprises a targeting group selected from the group consisting of (C11-PEG5-NAG5), (C11-PEG5-NAG5), (C6-PEG4-NAG3), (NAG5), (NAG4), (NAG3-AA2), (NAG5-Palm), (NAG13), (NAG18), (NAG24), (NAG25), (NAG25)s, (NAG26), (NAG27), (NAG28), (NAG29), (NAG30), (NAG30)s, (NAG31), (NAG13), (NAG31s), (NAG32), (NAG33), (NAG34), (NAG35), (NAG36), and (NAG37).

In some embodiments, an LPA RNAi agent comprises AD03460, AD03536, AD03581, AD03583, AD3847, or AD04110.

In some embodiments, an LPA RNAi agent consists of AD03460, AD03536, AD03581, AD03583, AD3847, or AD04110.

Non-Nucleotide Group

In some embodiments, an LPA RNAi agent contains or is conjugated to one or more non-nucleotide groups including, but not limited to a targeting group, linking group, delivery polymer, or a delivery vehicle. The non-nucleotide group can enhance targeting, delivery or attachment of the RNAi agent. Examples of targeting groups and linking groups are provided in Table 4. The non-nucleotide group can be covalently linked to the 3′ and/or 5′ end of either the sense strand and/or the antisense strand. In some embodiments, an LPA RNAi agent contains a non-nucleotide group linked to the 3′ and/or 5′ end of the sense strand. In some embodiments a non-nucleotide group is linked to the 5′ end of an LPA RNAi agent sense strand. A non-nucleotide group may linked directly or indirectly to the RNAi agent via a linker/linking group. In some embodiments a non-nucleotide group is linked to the RNAi agent via a labile, cleavable, or reversible bond or linker.

In some embodiments, a non-nucleotide group enhances the pharmacokinetic or biodistribution properties of an RNAi agent or conjugate to which it is attached to improve cell- or tissue-specific distribution and cell-specific uptake of the conjugate. In some embodiments, a non-nucleotide group enhances endocytosis of the RNAi agent.

Targeting Group

A targeting group can be monovalent, divalent, trivalent, tetravalent, or have higher valency. Representative targeting groups include, without limitation, compounds with affinity to cell surface molecule, cell receptor ligands, hapten, antibodies, monoclonal antibodies, antibody fragments, and antibody mimics with affinity to cell surface molecules. In some embodiments, a targeting group is linked to an RNAi agent using a linker, such as a PEG linker or one, two, or three abasic and/or ribitol groups. In some embodiments, a targeting group comprises a galactose cluster.

The LPA RNAi agents described herein may be synthesized having a reactive group, such as an amine group, at the 5′-terminus. The reactive group may be used to subsequently attach a targeting moiety using methods typical in the art.

In some embodiments, a targeting group comprises an asialoglycoprotein receptor ligand. In some embodiments, an asialoglycoprotein receptor ligand includes or consists of one or more galactose derivatives or galactose clusters. As used herein, the term galactose derivative includes both galactose and derivatives of galactose having affinity for the asialoglycoprotein receptor that is equal to or greater than that of galactose. Galactose derivatives include, but are not limited to: galactose, galactosamine, N-formylgalactosamine, N-acetyl-galactosamine, N-propionyl-galactosamine, N-n-butanoyl-galactosamine, and N-iso-butanoylgalactos-amine (see for example: Iobst, S. T. and Drickamer, K. J.B.C. 1996, 271, 6686). Galactose derivatives and galactose clusters that are useful for in vivo targeting of oligonucleotides and other molecules to the liver are known in the art (see, for example, Baenziger and Fiete, 1980, Cell, 22, 611-620; Connolly et al., 1982, J. Biol. Chem., 257, 939-945). Galactose derivatives have been used to target molecules to hepatocytes in vivo through their binding to the asialoglycoprotein receptor (ASGPr) expressed on the surface of hepatocytes. Binding of ASGPr ligands to the ASGPr(s) facilitates cell-specific targeting to hepatocytes and endocytosis of the molecule into hepatocytes. The galactose cluster may be attached to the 3′ or 5′ end of the RNAi polynucleotide using methods known in the art.

As used herein, a galactose cluster comprises a molecule having two to four terminal galactose derivatives. A terminal galactose derivative is attached to a molecule through its C-1 carbon. In some embodiments, the galactose cluster is a galactose derivative trimer, tri-antennary galactose derivative, or tri-valent galactose derivative. In some embodiments, the galactose cluster is comprises N-acetylgalactosamines (GalNAc). In some embodiments, the galactose cluster comprises a tri-valent N-acetyl-galactosamine. In some embodiments, the galactose cluster is a galactose derivative tetramer, tetra-antennary galactose derivative, or tetra-valent galactose derivative. In some embodiments, the galactose cluster comprises a tetra-valent N-acetyl-galactosamine

As used herein, a galactose trimer contains three galactose derivatives, each linked to a central branch point. As used herein, a galactose derivative tetramer contains four galactose derivatives, each linked to a central branch point. The galactose derivatives can be attached to the central branch point through the C-1 carbons of the saccharides. In some embodiments, the galactose derivatives are linked to the branch point via linkers or spacers. In some embodiments, the linker or spacer is a flexible hydrophilic spacer, such as a PEG group (see, for example, U.S. Pat. No. 5,885,968; Biessen et al. J. Med. Chem. 1995 Vol. 39 p. 1538-1546). In some embodiments, the PEG spacer is a PEG3 spacer. The branch point can be any small molecule which permits attachment of the three galactose derivatives and further permits attachment of the branch point to the RNAi agent. An example of branch point group is a di-lysine or di-glutamate. Attachment of the branch point to the RNAi agent can occur through a linker or spacer. In some embodiments, the linker or spacer comprises a flexible hydrophilic spacer, such as, but not limited to: a PEG spacer. In some embodiments, a PEG spacer is a PEG3 spacer (three ethylene units). In other embodiments, the PEG spacer has 1 to 20 ethylene units (PEG1 to PEG20). In some embodiments, a galactose derivative comprises an N-acetylgalactosamine (GalNAc or NAG). In some embodiments, the galactose cluster is comprised of a galactose derivative tetramer, which can be, for example, an N-acetyl-galactosamine tetramer.

In some embodiments, pharmaceutical compositions for delivering an LPA RNAi agent to a liver cell in vivo are described. Such pharmaceutical compositions can include, for example, an LPA RNAi agent conjugated to a galactose cluster. In some embodiments, the galactose cluster is comprised of a galactose derivative trimer, which can be, for example, an N-acetyl-galactosamine trimer, or galactose derivative tetramer, which can be, for example, an N-acetyl-galactosamine tetramer.

Targeting groups include, but are not limited to, (Chol-TEG), (TEG-Chol), (C11-PEG5-NAG5), (Cm-PEGn-NAG3), (Cx-PEGz-NAG3), (NAG 3), (NAG4), (NAG3-AA2), (NAG3-Palm), (NAG13), (NAG18), (NAG24), (NAG25), (NAG25)s, (NAG26), (NAG27), (NAG28), (NAG29), (NAG30), (NAG30)s, (NAG31), (NAG13), (NAG31s), (NAG32), (NAG33), (NAG34), (NAG35), (NAG36), and (NAG37).

Linking Group

In some embodiments, a linking group is conjugated to the RNAi agent. The linking group facilitates covalent linkage of the agent to a targeting group or delivery polymer or delivery vehicle. The linking group can be linked to the 3′ or the 5′ end of the RNAi agent sense strand or antisense strand. In some embodiments, the linking group is linked to the RNAi agent sense strand. In some embodiments, the linking group is conjugated to the 5′ or 3′ end of an RNAi agent sense strand. In some embodiments a linking group is conjugated to the 5′ end of an RNAi agent sense strand. Examples of linking groups, include, but are not limited to: Alk-SMPT-C6, Alk-SS-C6, DBCO-TEG, Me-Alk-SS-C6, and C6-SS-Alk-Me, reactive groups such a primary amines and alkynes, alkyl groups, abasic ribose, ribitol, and/or PEG groups.

A linker or linking group is a connection between two atoms that links one chemical group (such as an RNAi agent) or segment of interest to another chemical group (such as a targeting group or delivery polymer) or segment of interest via one or more covalent bonds. A labile linkage contains a labile bond. A linkage may optionally include a spacer that increases the distance between the two joined atoms. A spacer may further add flexibility and/or length to the linkage. Spacers may include, but are not be limited to, alkyl groups, alkenyl groups, alkynyl groups, aryl groups, aralkyl groups, aralkenyl groups, and aralkynyl groups; each of which can contain one or more heteroatoms, heterocycles, amino acids, nucleotides, and saccharides. Spacer groups are well known in the art and the preceding list is not meant to limit the scope of the description.

Linking groups include, but are not limited to, Alkyl, PEG, (C6-PEGn-Alk), (Cn-SMPT-Alk), and (Cn-SS-Alk-Me).

Any of the LPA RNAi agents listed in Tables 2A and 2B which contains a 3′ or 5′ targeting group or linking group, may alternatively contain no 3′ or 5′ targeting group or linking group, or may contain a different 3′ or 5′ targeting group or linking group including, but not limited to, those depicted in Table 4. Any of the LPA RNAi agent nucleotide sequences listed in Tables 1, 2A and 2B, whether modified or unmodified, may contain 3′ or 5′ targeting group or linking group, including, but not limited to, those depicted in Table 4. Any of the LPA RNAi agent duplexes listed in Tables 3A and 3B, whether modified or unmodified, may further comprise a targeting group or linking group, including, but not limited to, those depicted in Table 4, and the targeting group or linking group may be attached to the 3′ or 5′ terminus of either the sense strand or the antisense strand of the LPA RNAi agent duplex.

TABLE 4
Structures representing various modified nucleotides, targeting groups, and linking
groups.

In each of the above structures, NAG comprises an N-Acetyl-Galactosamine or another ASGPR ligand. Each (NAGx) may be attached to an LPA RNAi agent via a phosphate group (as in (NAG25), (NAG30), and (NAG31)), or a phosphorothioate group, (as is (NAG25)s, (NAG30)s, and (NAG31)s), or another linking group. Alternatively, other linking groups known in the art may be used.

Delivery Vehicles

In some embodiments, a delivery vehicle may be used to deliver an RNAi agent to a cell or tissue. A delivery vehicle is a compound that improves delivery of the RNAi agent to a cell or tissue. A delivery vehicle can include, or consist of, but is not limited to: a polymer, such as an amphipathic polymer, a membrane active polymer, a peptide, a melittin peptide, a melittin-like peptide (MLP), a lipid, a reversibly modified polymer or peptide, or a reversibly modified membrane active polyamine

In some embodiments, the RNAi agents can be combined with lipids, nanoparticles, polymers, liposomes, micelles, DPCs or other delivery systems available in the art. The RNAi agents can also be chemically conjugated to targeting groups, lipids (including, but not limited to cholesterol and cholesteryl derivatives), nanoparticles, polymers, liposomes, micelles, DPCs (see, for example WO 2000/053722, WO 2008/0022309, WO 2011/104169, and WO 2012/083185, WO 2013/032829, WO 2013/158141, each of which is incorporated herein by reference), or other delivery systems available in the art.

Pharmaceutical Compositions

Described herein are methods for delivering LPA RNAi agents to liver cells in a mammal in vivo. In some embodiments, a delivery vehicle may be used. A delivery vehicle is a compound which improves delivery of the RNAi agent to the cell. A delivery vehicle can be, but is not limited to: a polymer, such as an amphipathic polymer, membrane active polymer, a peptide, such as a melittin or melittin-like peptide, a reversibly modified polymer or peptide, or a lipid. In some embodiments, an LPA RNAi agent is linked to a targeting ligand that comprises an asialoglycoprotein ligand. In some embodiments, an LPA RNAi agent is linked to a targeting ligand that comprises or consists of a galactose cluster.

An LPA RNAi agent can be used to inhibit expression of LPA in a cell, group of cells, or a tissue, e.g., in a subject. In some embodiments, an LPA RNAi agent is used to formulate a composition, i.e. a pharmaceutical composition or medicament, for administering to a subject. As used herein, a pharmaceutical composition or medicament comprises a pharmacologically effective amount of at least one of the described LPA RNAi agents and one or more pharmaceutically acceptable excipients. Pharmaceutically acceptable excipients (excipients) are substances other than the Active Pharmaceutical ingredient (API, therapeutic product, e.g., LPA RNAi agent) that have been appropriately evaluated for safety and are intentionally included in the drug delivery system. Excipients do not exert or are not intended to exert a therapeutic effect at the intended dosage. Excipients may act to a) aid in processing of the drug delivery system during manufacture, b) protect, support or enhance stability, bioavailability or patient acceptability of the API, c) assist in product identification, and/or d) enhance any other attribute of the overall safety, effectiveness, of delivery of the API during storage or use. A pharmaceutically acceptable excipient may or may not be an inert substance.

Excipients include, but are not limited to: absorption enhancers, anti-adherents, anti-foaming agents, anti-oxidants, binders, binders, buffering agents, carriers, coating agents, colors, delivery enhancers, delivery polymers, dextran, dextrose, diluents, disintegrants, emulsifiers, extenders, fillers, flavors, glidants, humectants, lubricants, oils, polymers, preservatives, saline, salts, solvents, sugars, suspending agents, sustained release matrices, sweeteners, thickening agents, tonicity agents, vehicles, water-repelling agents, and wetting agents.

A pharmaceutical composition can contain other additional components commonly found in pharmaceutical compositions. Such additional components include, but are not limited to: anti-pruritics, astringents, local anesthetics, or anti-inflammatory agents (e.g., antihistamine, diphenhydramine, etc.). It is also envisioned that cells, tissues or isolated organs that express or comprise the herein defined RNAi agents may be used as “pharmaceutical compositions”. As used herein, “pharmacologically effective amount,” “therapeutically effective amount,” or simply “effective amount” refers to that amount of an RNAi agent to produce the intended pharmacological, therapeutic or preventive result.

In some embodiments, a described LPA RNAi agent is combined one or more additional therapeutics or treatments including, but not limited to: a second LPA RNAi agent or other RNAi agent, a small molecule drug, an antibody, an antibody fragment, and/or a vaccine. Examples of additional therapeutics include, but are not limited to, HMg Co-A reductase inhibitors (statins), ezetimibe, PCSK-9 inhibitors, CTEP inhibitors, therapies targeting ANGPTL3, therapies targeting APOC3, and niacin.

The described RNAi agents and pharmaceutical compositions comprising LPA RNAi agents disclosed herein may be packaged or included in a kit, container, pack, or dispenser. The LPA RNAi agents and pharmaceutical compositions comprising said LPA RNAi agents may be packaged in pre-filled syringes or vials.

In some embodiments, pharmaceutical compositions comprising at least one of the described LPA RNAi agents are contemplated. These pharmaceutical compositions are useful in the inhibition of the expression of the LPA gene in a cell, a tissue, or an organism. In some embodiments, the described pharmaceutical compositions are used to treat a subject having a disease, condition, or disorder that would benefit from reduction or inhibition in LPA expression. In some embodiments, the described pharmaceutical compositions are used to treat a subject at risk of developing a disease, condition, or disorder that would benefit from reduction or inhibition in LPA expression. Diseases, conditions, or disorders that would benefit from reduction or inhibition in LPA expression include, but are not limited to: Berger's disease, peripheral artery disease, coronary artery disease, metabolic syndrome, acute coronary syndrome, aortic valve stenosis, aortic valve regurgitation, aortic dissection, retinal artery occlusion, cerebrovascular disease, mesenteric ischemia, superior mesenteric artery occlusion, renal artery stenosis, stable/unstable angina, acute coronary syndrome, heterozygous or homozygous familial hypercholesterolemia, hyperapobetalipoproteinemia, cerebrovascular atherosclerosis, cerebrovascular disease, and venous thrombosis. In some embodiments, the subject is a mammal, including, but not limited to, a human patient.

Cells, tissues, and non-human organisms that include at least one of the LPA RNAi agents described herein is contemplated. The cell, tissue, or non-human organism is made by delivering the RNAi agent to the cell, tissue, or non-human organism by any means available in the art. In some embodiments, the cell is a mammalian cell, including, but not limited to, a human cell. The cell, tissue, or non-human organisms are useful for research or as research tools (e.g., drug testing or diagnoses).

Method of Treatment

In some embodiments, the LPA RNAi agents described herein are used to treat a subject having a disease, condition, or disorder or at risk of having a disease, condition, or disorder that would benefit from reduction or inhibition in LPA expression. Treatment of a subject that would benefit from a reduction and/or inhibition of LPA gene expression includes therapeutic and/or prophylactic treatment. Examples of diseases, conditions, or disorders, include, but not limited to: Berger's disease, peripheral artery disease, coronary artery disease, metabolic syndrome, acute coronary syndrome, aortic valve stenosis, aortic valve regurgitation, aortic dissection, retinal artery occlusion, cerebrovascular disease, mesenteric ischemia, superior mesenteric artery occlusion, renal artery stenosis, stable/unstable angina, acute coronary syndrome, heterozygous or homozygous familial hypercholesterolemia, hyperapobetalipoproteinemia, cerebrovascular atherosclerosis, cerebrovascular disease, and venous thrombosis. In some embodiments, the method comprises administering a composition, such as a pharmaceutical composition, comprising an LPA RNAi agent described herein to a mammal to be treated.

In some embodiments, a therapeutically effective amount of one or more of the described LPA RNAi agents is administered to a subject, thereby inhibiting expression of LPA in the subject (e.g., an amount effective to inhibit expression of LPA in the subject). In some embodiments, one or more of the LPA RNAi agents described herein are used to treat a subject having a disease or disorder that would benefit from reduction or inhibition in LPA expression. In some embodiments, the described LPA RNAi agents are used to treat or prevent at least one symptom in a subject having a disease or disorder that would benefit from reduction or inhibition in LPA expression. The subject is administered a therapeutically effective amount of any one or more of the described RNAi agents thereby treating the symptom. In some embodiments, the subject is administered a prophylactically effective amount of any one or more of the described RNAi agents thereby preventing the at least one symptom.

In some embodiments, an LPA RNAi agent is used to treat or manage a clinical presentation wherein a subject in need of such treatment, prevention, or management is administered a therapeutically or prophylactically effective amount of one or more of the LPA RNAi agents or LPA RNAi agent-containing compositions described herein. In some embodiments, the method comprises administering a composition comprising an LPA RNAi agent described herein to a mammal to be treated.

In some embodiments, the methods further comprise the step of administering a second therapeutic or treatment. In some embodiments, the second therapeutic is another LPA RNAi agent (e.g., a LPA RNAi agent which targets a different sequence within the LPA target). In other embodiments, the second therapeutic can be selected from the group comprising: small molecule drug, antibody, antibody fragment, and vaccine.

The route of administration is the path by which an RNAi agent is brought into contact with the body. In general, methods of administering drugs and nucleic acids for treatment of a subject are well known in the art and can be applied to administration of the compositions described herein. The compounds described herein can be administered via any suitable route in a preparation appropriately tailored to the particular route. Thus, the compounds described herein can be administered by injection, for example, intravenously, intramuscularly, intracutaneously, subcutaneously, or intraperitoneally.

In some embodiments, the LPA RNAi agents or compositions described herein can be delivered to a cell, group of cells, tissue, or subject using oligonucleotide delivery technologies known in the art. In general, any suitable method recognized in the art for delivering a nucleic acid molecule (in vitro or in vivo) can be adapted for use with an LPA RNAi agent described herein. For example, delivery can be by local administration, (e.g., direct injection, implantation, or topical administering), systemic administration, or subcutaneous, intravenous, oral, intraperitoneal, or parenteral routes, including intracranial (e.g., intraventricular, intraparenchymal and intrathecal), intramuscular, transdermal, airway (aerosol), nasal, rectal, or topical (including buccal and sublingual) administration, In certain embodiments, the compositions are administered by subcutaneous or intravenous infusion or injection.

In some embodiments, the RNAi agents can be combined with lipids, nanoparticles, polymers, liposomes, micelles, DPCs or other delivery systems available in the art. The RNAi agents can also be chemically conjugated to targeting groups, lipids (including, but not limited to cholesterol and cholesteryl derivatives), nanoparticles, polymers, liposomes, micelles, DPCs (se e.g., WO 2000/053722, WO 2008/0022309, WO 2011/104169, and WO 2012/083185, each of which is incorporated herein by reference), or other delivery systems available in the art. An LPA RNAi agent can be conjugated to a delivery polymer. In some embodiments, the delivery polymer is a reversibly masked/modified amphipathic membrane active polyamine

Inhibition of Expression

As used herein, the terms “silence,” “reduce,” “inhibit,” “down-regulate,” or “knockdown gene expression,” when referring to an LPA gene, mean that the expression of the gene, as measured by the level of RNA transcribed from the gene or the level of polypeptide, protein, or protein subunit translated from the mRNA in a cell, group of cells, or tissue, in which the LPA gene is transcribed, is reduced when the cell, group of cells, or tissue, is treated with the described LPA RNAi agents as compared to a second cell, group of cells, or tissue that has or has not been so treated or compared to the same cell, group of cells, or tissue, prior to administration of the LPA RNAi agent.

In some embodiments, the gene expression level and/or mRNA level of LPA in a subject to whom a described LPA RNAi agent is administered is reduced by at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 98% relative to the subject prior to being administered the LPA RNAi agent or to a subject not receiving the LPA RNAi agent. The gene expression level and/or mRNA level in the subject may be reduced in a cell, group of cells, and/or tissue of the subject. In some embodiments, the protein level of LPA in a subject to whom a described LPA RNAi agent has been administered is reduced by at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 98% relative to the subject prior to being administered the LPA RNAi agent or to a subject not receiving the LPA RNAi agent. The protein level in the subject may be reduced in a cell, group of cells, tissue, blood, and/or other fluid of the subject. A reduction in gene expression, mRNA, or protein levels can be assessed by any methods known in the art. Reduction or decrease in LPA mRNA level and/or protein level are collectively referred to herein as a reduction or decrease in LPA or inhibiting or reducing the expression of LPA.

Introducing into a cell, when referring to an RNAi agent, means functionally delivering the RNAi agent into the cell. By functional delivery, it is meant that the RNAi agent is delivered to the cell and has the expected biological activity, (e.g., sequence-specific inhibition of gene expression).

Cells and Tissues and Non-Human Organisms

Cells, tissues, and non-human organisms that include at least one of the LPA RNAi agents described herein is contemplated. The cell, tissue, or non-human organism is made by delivering the RNAi agent to the cell, tissue, or non-human organism.

The above provided embodiments and items are now illustrated with the following, non-limiting examples.

EXAMPLES

Example 1. RNAi Agent Synthesis

A) Synthesis. LPA RNAi agents were synthesized according to phosphoramidite technology on solid phase used in oligonucleotide synthesis. Depending on the scale either a MerMade96E (Bioautomation) or a MerMadel2 (Bioautomation) was used. Syntheses were performed on a solid support made of controlled pore glass (CPG, 500 Å or 600 Å, obtained from Prime Synthesis, Aston, Pa., USA). All DNA, 2′-modified RNA, and UNA phosphoramidites were purchased from Thermo Fisher Scientific (Milwaukee, Wis., USA). Specifically, the following 2′-O-Methyl phosphoramidites were used: (5′-O-dimethoxytrityl-N6-(benzoyl)-2′-O-methyl-adenosine-3′-O-(2-cyanoethyl-N,N-diisopropy-lamino) phosphoramidite, 5′-O-dimethoxy-trityl-N4-(acetyl)-2′-O-methyl-cytidine-3′-O-(2-cyanoethyl-N,N-diisopropyl-amino) phosphoramidite, (5′-O-dimethoxytrityl-N2-(isobutyryl)-2′-O-methyl-guanosine-3′-O-(2-cyano-ethyl-N,N-diisopropylamino)phosphoramidite, and 5′-O-dimethoxy-trityl-2′-O-methyl-uridine-3′-O-(2-cyanoethyl-N,N-diisopropylamino)phosphoramidite. The 2′-Deoxy-2′-fluoro-phosphor-amidites carried the same protecting groups as the 2′-O-methyl RNA amidites. The following UNA phosphoramidites were used: 5′-(4,4′-Dimethoxytrityl)-N-benzoyl-2′,3′-seco-adenosine, 2′-benzoyl-3′-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphor-amidite, 5′-(4,4′-Dimethoxytrityl)-N-acetyl-2,3′-seco-cytosine, 2′-benzoyl-3′-[(2-cyanoethyl)-(N,N-diiso-propyl)]-phosphoramidite, 5′-(4,4′-Dimethoxytrityl)-N-isobutyryl-2′,3′-seco-guanosine, 2′-benzoyl-3′-[(2-cyanoethyl)-(N,N-diisopropyl)l-phosphoramidite, and 5′-(4,4′-Dimethoxy-trityl)-2′,3′-seco-uridine, 2′-benzoyl-3′-[(2-cyanoethyl)-(N,N-diiso-propyl)]-phosphoramidite. All amidites were dissolved in anhydrous acetonitrile (50 mM) and molecular sieves (3A) were added. In order to introduce the TEG-Cholesterol at the 5′-end of the oligomers, the 1-Dimethoxytrityloxy-3-O-(N-cholesteryl-3-aminopropyl)-triethyleneglycol-glyceryl-2-O-(2-cyanoethyl)-(N,N-diisopropyl)-phosphoramidite from Glen Research (Sterling, Va., USA) was employed. The 5′-modifications were introduced without any modification of the synthesis cycle. 5-Benzylthio-1H-tetrazole (BTT, 250 mM in acetonitrile) was used as activator solution. Coupling times were 10 mM (RNA), 180 sec (Cholesterol), 90 sec (2′OMe and UNA), and 60 sec (2′F and DNA). In order to introduce phosphorothioate linkages, a 100 mM solution of 3-phenyl 1,2,4-dithiazoline-5-one (POS, obtained from PolyOrg, Inc., Leominster, Mass., USA) in anhydrous Acetonitrile was employed. See Tables 1, 2A, and 2B for specific sequences.

B. Cleavage and Deprotection of Support Bound Oligomer.

After finalization of the solid phase synthesis, the dried solid support was treated with a 1:1 volume solution of 40 wt. % methylamine in water and 28% ammonium hydroxide solution (Aldrich) for two hours at 30° C. The solution was evaporated and the solid residue was reconstituted in water (see below).

C. Purification.

Crude Cholesterol containing oligomers were purified by reverse phase HPLC using a Waters XBridge BEH300 C4 5u Prep column and a Shimadzu LC-8 system. Buffer A was 100 mM TEAA, pH 7.5 and contained 5% Acetonitrile and buffer B was 100 mM TEAA and contained 95% Acetonitrile. UV traces at 260 nm were recorded. Appropriate fractions were then run on size exclusion HPLC using a GE Healthcare XK 16/40 column packed with Sephadex G-25 medium with a running buffer of 100 mM ammonium bicarbonate, pH 6.7 and 20% Acetonitrile. Other crude oligomers were purified by anionic exchange HPLC using a TKSgel SuperQ-5PW 13u column and Shimadzu LC-8 system. Buffer A was 20 mM Tris, 5 mM EDTA, pH 9.0 and contained 20% Acetonitrile and buffer B was the same as buffer A with the addition of 1.5 M sodium chloride. UV traces at 260 nm were recorded. Appropriate fractions were pooled then run on size exclusion HPLC as described for cholesterol containing oligomers.

D. Annealing.

Complementary strands were mixed by combining equimolar solutions (sense and antisense) in 0.2×PBS (Phosphate-Buffered Saline, lx, Corning, Cellgro) to form the RNAi agents. This solution was placed into a thermomixer at 70° C., heated to 95° C., held at 95° C. for 5 mM, and cooled to room temperature slowly. Some RNAi agents were lyophilized and stored at −15 to −25° C. Duplex concentration was determined by measuring the solution absorbance on a UV-Vis spectrometer in 0.2×PBS. The solution absorbance at 260 nm was then multiplied by a conversion factor and the dilution factor to determine the duplex concentration. Unless otherwise stated, all conversion factor was 0.037 mg/(mL·cm). For some experiments, a conversion factor was calculated from an experimentally determined extinction coefficient.

Example 2. Primary In Vitro Analysis of LPA RNAi Agents

Candidate sequences identified as human and non-human primate cross-reactive by in silico analysis were screened. 108 in silico-identified potential LPA RNAi agents were synthesized and screened for efficacy in vitro in three groups. For screening purposes, the human LPA cDNA sequence (accession # NM_005577.1) was sub-cloned from a commercially available mammalian expression vector (Origene, Rockville, Md.) into a commercially-available, reporter-based screening plasmid, psiCHECK2 (Promega, Madison, Wis.) which generated a Renilla luciferase/LPA fusion mRNA. For LPA RNAi agent efficacy in the human background, Hep3B cells, a human hepatocellular carcinoma line, were plated at −10,000 cells per well in 96-well format. Each of the 108 LPA RNAi agents was co-transfected at two or three concentrations (1 nM and 0.1 nM, or 0.02, 0.2 and 2 nM) with 50-100 ng LPA-psiCHECK2 plasmid DNA per well and 0.2 μL LipoFectamine 2000 per well. Gene knockdown was determined by measuring Renilla luciferase levels normalized to the levels of constitutively-expressed firefly luciferase, also present on the psiCHECK2 plasmid, using the Dual Luciferase Reporter Assay (Promega, Madison, Wis.) (Tables 5A and 5B).

TABLE 5A
In vitro analyses of LPA RNAi agents,
inhibition of LPA expression.
Relative Rluc-LPA expression
Duplex 1 nM 0. 1 nM
ID# Average SD Average SD
AD00571 1.012 0.146 1.107 0.174
AD00572 0.776 0.062 1.075 0.089
AD00573 0.708 0.054 0.708 0.134
AD00574 0.441 0.028 0.525 0.056
AD00575 0.242 0.038 0.365 0.035
AD00576 0.166 0.047 0.341 0.073
AD00577 0.702 0.115 0.934 0.036
AD00578 0.272 0.008 0.599 0.200
AD00579 0.290 0.031 0.447 0.066
AD00580 0.825 0.145 0.991 0.123
AD00581 0.654 0.095 0.986 0.127
AD00582 0.610 0.178 0.791 0.244
AD00583 0.824 0.208 0.845 0.240
AD00584 0.800 0.150 0.683 0.077
AD00585 0.387 0.059 0.488 0.151
AD00586 0.754 0.116 0.927 0.103
AD00587 0.921 0.074 0.923 0.052
AD00588 0.763 0.203 0.954 0.169
AD00589 0.838 0.115 1.026 0.216
AD00590 0.959 0.091 0.991 0.285
AD00591 0.970 0.172 0.984 0.244
AD00592 0.600 0.060 0.886 0.069
AD00593 0.555 0.097 0.883 0.130
AD00594 0.645 0.056 0.567 0.008
AD00595 0.812 0.132 1.076 0.285
AD00596 0.658 0.116 0.787 0.153
AD00597 0.999 0.120 1.083 0.143
AD00598 0.501 0.067 0.631 0.036
AD00599 0.890 0.098 0.871 0.143
AD00600 0.393 0.018 0.729 0.172
AD00601 0.896 0.180 1.142 0.140
AD00602 0.653 0.134 0.955 0.062
AD00603 0.730 0.118 0.799 0.187
AD00604 0.892 0.058 0.956 0.107
AD00605 1.006 0.193 1.006 0.146
AD00606 0.509 0.039 0.570 0.054
AD00607 0.816 0.091 0.906 0.068
AD00608 0.883 0.111 1.158 0.054
AD00609 0.515 0.079 0.691 0.137
AD00610 0.628 0.057 0.748 0.090
AD00611 1.320 0.066 1.116 0.046
AD00612 1.103 0.193 1.100 0.052
AD00613 0.910 0.094 0.878 0.040
AD00614 1.101 0.111 1.097 0.043
AD00615 1.051 0.140 0.898 0.161
AD00616 0.898 0.101 1.029 0.042
AD00617 0.715 0.023 0.802 0.150
AD00618 0.434 0.073 0.441 0.199
AD00619 0.758 0.003 0.820 0.165
AD00620 0.984 0.124 0.926 0.080
AD00621 0.308 0.033 0.267 0.044
AD00622 0.493 0.072 0.790 0.009
AD00623 0.641 0.081 0.599 0.014
AD00624 0.795 0.019 0.985 0.123
AD00625 0.768 0.121 0.944 0.117
AD00626 0.981 0.081 1.036 0.036
AD00627 0.943 0.163 0.936 0.038
AD00628 0.765 0.069 0.995 0.090
AD00629 1.001 0.184 1.199 0.064
AD00630 0.963 0.149 1.154 0.141
AD00631 0.979 0.084 1.038 0.088
AD00632 0.781 0.048 0.858 0.101
AD00633 0.817 0.072 1.027 0.143
AD00634 0.807 0.087 0.978 0.256
AD00635 0.496 0.073 0.377 0.023
AD00636 0.615 0.102 0.748 0.072
AD00637 0.792 0.056 1.070 0.048

TABLE 5B
In vitro analyses of LPA RNAi agents,
inhibition of LPA expression.
Relative Rluc-LPA expression
Duplex 2 nM 0.2 nM 0.02 nM
ID# Average SD Average SD Average SD
AD01068 0.780 0.110 0.792 0.326 0.861 0.138
AD01069 0.483 0.345 1.062 0.181 0.869 0.112
AD01070 0.747 0.441 1.010 0.015 1.015 0.319
AD01071 1.014 0.254 0.850 0.251 0.857 0.284
AD01072 0.919 0.107 1.137 0.345 0.727 0.124
AD01073 0.539 0.224 1.066 0.195 1.180 0.356
AD01074 0.713 0.545 0.953 0.419 0.841 0.077
AD01075 0.703 0.379 0.913 0.204 0.965 0.216
AD01076 1.145 0.485 1.027 0.287 0.647 0.154
AD01077 0.672 0.074 1.166 0.384 0.703 0.106
AD01078 0.575 0.192 0.847 0.237 0.908 0.071
AD01079 0.863 0.673 1.093 0.187 1.004 0.086
AD01328 0.623 0.089 1.205 0.367 1.238 0.089
AD01329 0.467 0.068 1.161 0.159 1.115 0.102
AD01330 1.158 0.124 0.920 0.143 1.156 0.107
AD01331 1.476 0.225 1.092 0.269 1.304 0.320
AD01332 1.145 0.109 1.100 0.454 0.941 0.510
AD01333 0.829 0.011 1.382 0.252 1.338 0.303
AD01334 0.653 0.122 1.323 0.183 1.095 0.109
AD01335 0.858 0.089 1.632 0.318 1.201 0.159
AD01336 1.019 0.081 1.724 0.353 1.008 0.072
AD01337 0.834 0.143 1.494 0.657 1.130 0.309
AD01338 1.276 0.340 0.719 0.118 0.896 0.118
AD01339 1.240 0.298 1.114 0.287 0.960 0.104
AD01340 1.055 0.423 1.272 0.136 1.338 0.299
AD01341 1.206 0.438 1.510 0.315 1.046 0.143
AD01342 1.243 0.324 1.137 0.298 1.159 0.047
AD01343 1.113 0.140 1.045 0.151 1.108 0.094
AD01344 0.931 0.182 1.317 0.244 1.328 0.037
AD01345 0.795 0.233 0.799 0.032 1.418 0.184
AD01346 1.095 0.224 1.045 0.073 1.465 0.109
AD01347 1.122 0.021 1.209 0.161 1.153 0.159
AD01348 1.022 0.068 1.228 0.244 1.097 0.049
AD01349 0.934 0.151 1.217 0.080 1.068 0.149
AD01350 0.871 0.295 1.318 0.225 0.942 0.395
AD01351 1.414 0.065 1.121 0.180 1.029 0.049
AD01352 0.868 0.088 1.024 0.385 1.049 0.176
AD01353 1.150 0.478 1.164 0.276 0.898 0.175
AD01354 0.999 0.119 1.378 0.292 1.507 0.289
AD01355 0.943 0.092 1.066 0.268 1.411 0.113
AD01356 1.116 0.351 1.072 0.196 1.000 0.145

TABLE 5C
In vitro analyses of 10 mM LPA
RNAi agents, inhibition of LPA expression.
Duplex No. LPA levels
AD01803 0.77 ± 0.06
AD01805 0.77 ± 0.02
AD01806 1.01 ± 0.02
AD01807 0.97 ± 0.09
AD01808 0.78 ± 0.12
AD01809 1.06 ± 0.13
AD01810 1.06 ± 0.05
AD01811 0.86 ± 0.05
AD01812 1.08 ± 0.04
AD01813 0.99 ± 0.13
AD01814 0.57 ± 0.05
AD01815 0.65 ± 0.00
AD01816 0.84 ± 0.08
AD01817 0.75 ± 0.10
AD01818 0.94 ± 0.07
AD01819 1.21 ± 0.08
AD01820 1.22 ± 0.12
AD01821 1.16 ± 0.01
AD01822 1.22 ± 0.04
AD01823 0.91 ± 0.05
AD01824 1.22 ± 0.13
AD01825 1.25 ± 0.05
AD01826 1.18 ± 0.15
AD01827 1.23 ± 0.07
AD01828 1.02 ± 0.09
AD01829 1.05 ± 0.07
AD01830 1.00 ± 0.35
AD01831 1.02 ± 0.07
AD01832 1.04 ± 0.06
AD01896 0.71 ± 0.14
AD01897 0.87 ± 0.10
AD01898 1.16 ± 0.03
AD01899 0.79 ± 0.11
AD01900 0.82 ± 0.06
AD01901 0.54 ± 0.04
AD01902 0.62 ± 0.00
AD01903 0.66 ± 0.08
AD01912 0.59 ± 0.01
AD01913 0.60 ± 0.04
AD01914 0.50 ± 0.03
AD01915 0.58 ± 0.08
AD01916 0.49 ± 0.04
AD01917 0.53 ± 0.04
AD01918 0.47 ± 0.04
AD01919 0.60 ± 0.02
AD01920 0.60 ± 0.03
AD01921 0.59 ± 0.06
AD01922 0.50 ± 0.04
AD01923 0.59 ± 0.04
AD01924 0.50 ± 0.02
AD01925 0.54 ± 0.05
AD01926 0.52 ± 0.05
AD01927 0.57 ± 0.04
AD01928 0.50 ± 0.06
AD01929 0.55 ± 0.04
AD01930 0.54 ± 0.06
AD01931 0.54 ± 0.07
AD01932 0.51 ± 0.01
AD01933 0.56 ± 0.06
AD01934 0.52 ± 0.08
AD01935 0.58 ± 0.03
AD01936 0.53 ± 0.02
AD01937 0.57 ± 0.04
AD01938 0.58 ± 0.03
AD01939 0.65 ± 0.05
AD01940 0.49 ± 0.03
AD01941 0.57 ± 0.02

TABLE 5D
In vitro analyses of 1 mM LPA RNAi
agents, inhibition of LPA expression.
Duplex LPA Duplex LPA Duplex LPA
No. levels No. levels No. levels
AD01760 0.10 ± 0.01 AD02330 0.37 ± 0.01 AD02090 0.68 ± 0.04
AD01722 0.14 ± 0.01 AD02243 0.37 ± 0.02 AD02161 0.68 ± 0.04
AD01757 0.15 ± 0.00 AD02255 0.38 ± 0.02 AD02324 0.68 ± 0.02
AD01719 0.15 ± 0.00 AD02257 0.38 ± 0.00 AD02177 0.69 ± 0.07
AD01738 0.18 ± 0.01 AD02169 0.38 ± 0.02 AD02179 0.69 ± 0.07
AD01755 0.19 ± 0.01 AD02081 0.38 ± 0.00 AD02527 0.69 ± 0.03
AD01741 0.20 ± 0.00 AD02186 0.38 ± 0.02 AD02305 0.69 ± 0.06
AD01759 0.23 ± 0.02 AD01744 0.38 ± 0.03 AD02092 0.70 ± 0.02
AD01747 0.23 ± 0.03 AD02075 0.38 ± 0.01 AD02535 0.70 ± 0.10
AD01752 0.24 ± 0.03 AD02135 0.38 ± 0.03 AD02376 0.71 ± 0.04
AD01736 0.24 ± 0.02 AD02114 0.38 ± 0.04 AD01743 0.71 ± 0.02
AD02311 0.25 ± 0.05 AD02188 0.38 ± 0.04 AD02289 0.71 ± 0.04
AD02201 0.25 ± 0.03 AD02318 0.38 ± 0.02 AD02530 0.71 ± 0.06
AD01750 0.25 ± 0.00 AD02388 0.38 ± 0.02 AD01709 0.71 ± 0.12
AD01756 0.25 ± 0.01 AD02115 0.38 ± 0.04 AD02249 0.71 ± 0.06
AD02291 0.25 ± 0.03 AD02133 0.38 ± 0.00 AD02534 0.71 ± 0.03
AD02292 0.26 ± 0.01 AD02183 0.38 ± 0.04 AD02213 0.71 ± 0.02
AD02266 0.26 ± 0.02 AD02116 0.38 ± 0.02 AD02529 0.71 ± 0.03
AD01763 0.26 ± 0.01 AD02132 0.39 ± 0.03 AD01711 0.71 ± 0.06
AD02259 0.26 ± 0.03 AD02400 0.39 ± 0.02 AD02341 0.72 ± 0.06
AD02327 0.26 ± 0.02 AD02338 0.39 ± 0.04 AD02233 0.72 ± 0.06
AD02274 0.27 ± 0.03 AD02112 0.39 ± 0.01 AD02342 0.73 ± 0.04
AD02297 0.27 ± 0.02 AD02354 0.39 ± 0.05 AD02395 0.73 ± 0.06
AD02147 0.27 ± 0.03 AD01749 0.40 ± 0.06 AD02306 0.73 ± 0.09
AD02365 0.27 ± 0.04 AD02312 0.40 ± 0.02 AD02344 0.73 ± 0.04
AD02260 0.27 ± 0.03 AD02240 0.40 ± 0.00 AD02145 0.74 ± 0.09
AD02368 0.27 ± 0.01 AD02313 0.40 ± 0.03 AD02326 0.74 ± 0.06
AD02265 0.28 ± 0.03 AD01710 0.40 ± 0.05 AD02414 0.74 ± 0.04
AD02293 0.28 ± 0.04 AD02301 0.40 ± 0.05 AD02379 0.74 ± 0.06
AD02350 0.28 ± 0.02 AD02425 0.40 ± 0.04 AD02532 0.75 ± 0.04
AD02202 0.28 ± 0.03 AD02099 0.41 ± 0.04 AD02178 0.75 ± 0.11
AD02203 0.28 ± 0.03 AD01723 0.41 ± 0.04 AD02195 0.75 ± 0.05
AD02258 0.28 ± 0.05 AD02391 0.41 ± 0.03 AD02123 0.76 ± 0.07
AD02295 0.28 ± 0.03 AD02392 0.41 ± 0.05 AD02164 0.77 ± 0.09
AD02363 0.28 ± 0.04 AD02083 0.41 ± 0.01 AD01726 0.77 ± 0.01
AD02273 0.28 ± 0.02 AD02155 0.41 ± 0.02 AD02231 0.77 ± 0.05
AD02386 0.28 ± 0.02 AD02082 0.41 ± 0.01 AD02180 0.77 ± 0.04
AD02309 0.28 ± 0.03 AD02336 0.41 ± 0.01 AD02412 0.77 ± 0.05
AD02382 0.29 ± 0.01 AD02101 0.41 ± 0.02 AD02251 0.77 ± 0.02
AD02256 0.29 ± 0.02 AD01728 0.42 ± 0.01 AD02396 0.78 ± 0.13
AD02367 0.29 ± 0.03 AD02424 0.42 ± 0.04 AD02160 0.78 ± 0.04
AD02275 0.29 ± 0.04 AD02175 0.42 ± 0.02 AD02533 0.78 ± 0.05
AD02206 0.29 ± 0.01 AD02225 0.42 ± 0.05 AD02290 0.78 ± 0.03
AD02332 0.29 ± 0.02 AD02086 0.43 ± 0.02 AD02378 0.78 ± 0.07
AD01717 0.29 ± 0.03 AD01725 0.43 ± 0.06 AD02394 0.79 ± 0.04
AD02296 0.29 ± 0.01 AD02374 0.43 ± 0.03 AD02415 0.79 ± 0.05
AD02264 0.29 ± 0.03 AD02390 0.43 ± 0.04 AD02181 0.79 ± 0.08
AD02278 0.29 ± 0.03 AD02227 0.43 ± 0.02 AD02492 0.79 ± 0.06
AD02385 0.29 ± 0.00 AD02137 0.43 ± 0.06 AD02397 0.79 ± 0.05
AD02205 0.29 ± 0.04 AD02085 0.43 ± 0.01 AD02398 0.79 ± 0.09
AD02149 0.29 ± 0.02 AD02407 0.43 ± 0.03 AD02416 0.79 ± 0.04
AD02239 0.30 ± 0.05 AD02100 0.44 ± 0.04 AD02144 0.79 ± 0.09
AD01748 0.30 ± 0.02 AD02406 0.44 ± 0.04 AD02531 0.79 ± 0.06
AD02404 0.30 ± 0.01 AD02136 0.44 ± 0.02 AD02489 0.80 ± 0.04
AD01721 0.30 ± 0.03 AD02209 0.44 ± 0.03 AD02307 0.80 ± 0.10
AD02277 0.30 ± 0.05 AD02154 0.44 ± 0.02 AD02308 0.80 ± 0.11
AD02152 0.30 ± 0.01 AD02171 0.44 ± 0.01 AD02182 0.80 ± 0.08
AD02237 0.30 ± 0.02 AD02261 0.45 ± 0.02 AD02198 0.80 ± 0.11
AD02098 0.30 ± 0.03 AD02271 0.45 ± 0.00 AD02199 0.80 ± 0.10
AD02381 0.30 ± 0.02 AD02371 0.45 ± 0.03 AD02200 0.80 ± 0.06
AD02315 0.30 ± 0.02 AD02173 0.45 ± 0.07 AD02125 0.81 ± 0.06
AD02366 0.30 ± 0.01 AD02319 0.45 ± 0.01 AD02141 0.81 ± 0.01
AD02242 0.31 ± 0.03 AD02176 0.46 ± 0.01 AD02516 0.81 ± 0.06
AD02294 0.31 ± 0.02 AD02428 0.46 ± 0.02 AD02127 0.81 ± 0.06
AD02346 0.31 ± 0.04 AD02410 0.46 ± 0.01 AD02380 0.81 ± 0.03
AD02329 0.31 ± 0.02 AD01746 0.46 ± 0.05 AD02124 0.81 ± 0.05
AD02348 0.31 ± 0.01 AD01732 0.46 ± 0.02 AD02197 0.81 ± 0.02
AD01714 0.31 ± 0.05 AD02157 0.47 ± 0.02 AD02159 0.81 ± 0.09
AD01724 0.31 ± 0.01 AD02372 0.47 ± 0.03 AD02485 0.82 ± 0.04
AD02170 0.31 ± 0.02 AD02427 0.47 ± 0.02 AD02142 0.82 ± 0.08
AD02352 0.31 ± 0.02 AD02370 0.47 ± 0.01 AD02126 0.82 ± 0.08
AD02093 0.31 ± 0.01 AD02172 0.47 ± 0.04 AD02254 0.82 ± 0.10
AD02383 0.31 ± 0.02 AD02158 0.47 ± 0.02 AD02232 0.82 ± 0.04
AD02284 0.31 ± 0.04 AD02270 0.48 ± 0.04 AD02146 0.82 ± 0.04
AD02219 0.31 ± 0.04 AD02426 0.48 ± 0.04 AD02490 0.82 ± 0.03
AD02279 0.31 ± 0.03 AD02361 0.48 ± 0.04 AD01745 0.82 ± 0.09
AD02299 0.31 ± 0.05 AD02245 0.48 ± 0.02 AD02162 0.83 ± 0.04
AD01740 0.31 ± 0.02 AD02373 0.48 ± 0.01 AD02471 0.83 ± 0.11
AD02417 0.32 ± 0.01 AD02084 0.48 ± 0.05 AD02487 0.83 ± 0.09
AD02364 0.32 ± 0.02 AD02194 0.48 ± 0.03 AD02523 0.83 ± 0.10
AD02262 0.32 ± 0.03 AD01753 0.48 ± 0.06 AD02483 0.83 ± 0.03
AD02369 0.32 ± 0.01 AD02320 0.48 ± 0.03 AD02128 0.84 ± 0.09
AD01731 0.32 ± 0.02 AD02268 0.48 ± 0.05 AD02143 0.84 ± 0.05
AD02349 0.32 ± 0.01 AD02226 0.49 ± 0.01 AD02214 0.84 ± 0.13
AD02095 0.32 ± 0.02 AD02156 0.49 ± 0.01 AD02217 0.84 ± 0.07
AD02281 0.32 ± 0.01 AD02409 0.49 ± 0.03 AD02250 0.84 ± 0.08
AD02224 0.32 ± 0.06 AD02244 0.49 ± 0.02 AD02163 0.85 ± 0.04
AD02148 0.32 ± 0.04 AD02189 0.49 ± 0.06 AD02525 0.85 ± 0.06
AD01718 0.33 ± 0.01 AD01764 0.50 ± 0.02 AD02481 0.85 ± 0.03
AD02333 0.33 ± 0.01 AD02174 0.50 ± 0.04 AD02235 0.85 ± 0.03
AD02403 0.33 ± 0.01 AD02117 0.50 ± 0.01 AD02539 0.86 ± 0.05
AD02317 0.33 ± 0.03 AD02208 0.50 ± 0.05 AD02470 0.86 ± 0.07
AD02399 0.33 ± 0.02 AD02104 0.51 ± 0.03 AD02469 0.86 ± 0.04
AD02222 0.33 ± 0.01 AD02408 0.51 ± 0.06 AD02480 0.86 ± 0.07
AD02310 0.33 ± 0.02 AD02272 0.51 ± 0.04 AD02488 0.87 ± 0.05
AD01733 0.33 ± 0.01 AD02122 0.51 ± 0.06 AD02511 0.87 ± 0.05
AD02131 0.33 ± 0.01 AD02140 0.51 ± 0.04 AD02482 0.87 ± 0.04
AD02353 0.33 ± 0.03 AD02362 0.51 ± 0.04 AD02519 0.87 ± 0.08
AD02263 0.33 ± 0.03 AD01739 0.52 ± 0.04 AD02491 0.88 ± 0.05
AD02204 0.33 ± 0.01 AD02121 0.52 ± 0.06 AD02216 0.88 ± 0.00
AD02080 0.33 ± 0.00 AD02138 0.52 ± 0.04 AD02215 0.88 ± 0.03
AD02298 0.33 ± 0.03 AD02358 0.52 ± 0.02 AD02468 0.88 ± 0.06
AD01737 0.33 ± 0.01 AD01734 0.53 ± 0.06 AD02526 0.88 ± 0.06
AD02220 0.33 ± 0.04 AD01713 0.53 ± 0.04 AD02234 0.88 ± 0.14
AD02302 0.33 ± 0.00 AD02285 0.53 ± 0.03 AD02518 0.89 ± 0.05
AD02097 0.33 ± 0.00 AD02102 0.53 ± 0.07 AD02218 0.89 ± 0.04
AD02328 0.33 ± 0.02 AD02303 0.53 ± 0.03 AD02515 0.89 ± 0.03
AD02221 0.33 ± 0.01 AD02212 0.53 ± 0.01 AD02536 0.89 ± 0.11
AD02421 0.33 ± 0.02 AD02139 0.53 ± 0.03 AD02537 0.89 ± 0.04
AD02420 0.33 ± 0.03 AD02230 0.54 ± 0.08 AD02465 0.89 ± 0.07
AD02347 0.33 ± 0.04 AD02103 0.54 ± 0.04 AD02196 0.90 ± 0.03
AD02134 0.34 ± 0.01 AD02191 0.54 ± 0.03 AD02253 0.90 ± 0.05
AD02078 0.34 ± 0.03 AD02429 0.54 ± 0.02 AD02484 0.90 ± 0.09
AD02151 0.34 ± 0.02 AD01716 0.54 ± 0.09 AD02467 0.91 ± 0.00
AD02238 0.34 ± 0.03 AD02360 0.54 ± 0.02 AD02538 0.91 ± 0.10
AD02168 0.34 ± 0.00 AD01762 0.54 ± 0.01 AD02478 0.91 ± 0.01
AD02096 0.34 ± 0.03 AD01735 0.55 ± 0.07 AD02479 0.92 ± 0.05
AD01758 0.34 ± 0.05 AD02248 0.55 ± 0.05 AD02540 0.92 ± 0.08
AD02077 0.34 ± 0.02 AD02193 0.55 ± 0.01 AD02524 0.92 ± 0.03
AD02345 0.34 ± 0.02 AD02119 0.55 ± 0.01 AD02466 0.92 ± 0.05
AD02384 0.34 ± 0.02 AD02287 0.55 ± 0.02 AD02520 0.92 ± 0.06
AD02094 0.34 ± 0.01 AD02357 0.56 ± 0.01 AD02498 0.92 ± 0.06
AD02419 0.34 ± 0.04 AD01708 0.57 ± 0.06 AD02472 0.92 ± 0.05
AD02401 0.34 ± 0.02 AD02247 0.57 ± 0.06 AD02106 0.93 ± 0.08
AD02402 0.34 ± 0.03 AD02430 0.58 ± 0.07 AD02486 0.93 ± 0.02
AD01712 0.34 ± 0.04 AD02339 0.58 ± 0.03 AD02236 0.93 ± 0.04
AD02276 0.34 ± 0.01 AD02321 0.59 ± 0.03 AD02543 0.93 ± 0.12
AD02150 0.34 ± 0.02 AD02269 0.59 ± 0.02 AD02517 0.94 ± 0.05
AD02166 0.34 ± 0.03 AD02210 0.59 ± 0.04 AD02505 0.94 ± 0.10
AD02351 0.34 ± 0.02 AD02211 0.60 ± 0.02 AD02464 0.94 ± 0.06
AD02241 0.35 ± 0.04 AD02091 0.60 ± 0.03 AD02499 0.94 ± 0.16
AD02282 0.35 ± 0.01 AD02120 0.60 ± 0.07 AD02500 0.94 ± 0.05
AD02130 0.35 ± 0.04 AD02229 0.60 ± 0.03 AD02544 0.95 ± 0.07
AD01751 0.35 ± 0.03 AD01727 0.60 ± 0.02 AD02541 0.95 ± 0.15
AD02356 0.35 ± 0.03 AD01730 0.60 ± 0.02 AD02509 0.95 ± 0.09
AD02405 0.35 ± 0.04 AD02190 0.60 ± 0.07 AD02508 0.95 ± 0.10
AD02129 0.35 ± 0.01 AD02411 0.60 ± 0.06 AD02510 0.95 ± 0.03
AD02355 0.35 ± 0.01 AD02322 0.61 ± 0.03 AD02521 0.96 ± 0.16
AD02423 0.35 ± 0.06 AD02433 0.61 ± 0.02 AD02507 0.96 ± 0.03
AD02316 0.35 ± 0.02 AD01761 0.62 ± 0.05 AD02105 0.96 ± 0.09
AD02331 0.35 ± 0.02 AD01720 0.62 ± 0.02 AD02495 0.96 ± 0.05
AD02335 0.35 ± 0.01 AD02228 0.62 ± 0.06 AD02504 0.97 ± 0.04
AD02187 0.35 ± 0.03 AD02393 0.62 ± 0.03 AD02493 0.97 ± 0.06
AD02314 0.36 ± 0.04 AD02359 0.62 ± 0.03 AD02542 0.97 ± 0.06
AD02300 0.36 ± 0.03 AD02323 0.62 ± 0.05 AD02503 0.98 ± 0.05
AD02387 0.36 ± 0.06 AD02118 0.63 ± 0.05 AD02107 0.98 ± 0.05
AD02337 0.36 ± 0.04 AD02286 0.63 ± 0.04 AD02477 0.98 ± 0.06
AD01729 0.36 ± 0.01 AD02087 0.63 ± 0.04 AD02501 0.98 ± 0.07
AD02283 0.36 ± 0.02 AD01715 0.63 ± 0.06 AD02497 0.98 ± 0.05
AD02185 0.36 ± 0.01 AD02192 0.63 ± 0.02 AD02494 0.98 ± 0.13
AD02167 0.36 ± 0.01 AD02431 0.64 ± 0.06 AD02475 1.00 ± 0.07
AD02076 0.36 ± 0.04 AD02340 0.64 ± 0.03 AD02514 1.00 ± 0.00
AD02418 0.36 ± 0.01 AD02432 0.64 ± 0.02 AD02474 1.00 ± 0.03
AD02422 0.36 ± 0.03 AD02089 0.65 ± 0.07 AD02502 1.01 ± 0.01
AD02111 0.36 ± 0.02 AD02267 0.65 ± 0.11 AD02522 1.01 ± 0.04
AD02079 0.37 ± 0.02 AD02246 0.65 ± 0.07 AD02476 1.01 ± 0.09
AD01754 0.37 ± 0.04 AD02325 0.65 ± 0.03 AD02513 1.02 ± 0.03
AD02334 0.37 ± 0.02 AD02343 0.66 ± 0.05 AD02109 1.02 ± 0.06
AD02280 0.37 ± 0.05 AD02375 0.66 ± 0.04 AD02252 1.02 ± 0.08
AD02113 0.37 ± 0.03 AD02288 0.66 ± 0.06 AD02496 1.04 ± 0.05
AD02389 0.37 ± 0.03 AD02088 0.66 ± 0.01 AD02473 1.05 ± 0.04
AD02223 0.37 ± 0.04 AD02413 0.66 ± 0.03 AD02506 1.05 ± 0.05
AD02184 0.37 ± 0.02 AD02377 0.67 ± 0.05 AD01742 1.07 ± 0.24
AD02153 0.37 ± 0.02 AD02528 0.67 ± 0.04 AD02110 1.08 ± 0.07
AD02165 0.37 ± 0.02 AD02434 0.67 ± 0.05 AD02512 1.09 ± 0.17
AD02207 0.37 ± 0.01 AD02304 0.67 ± 0.02 AD02108 1.11 ± 0.04

Example 3. LPA RNAi Agent EC50 Determination

Ten-point EC50 curves were generated using the same cells and transfection conditions, with LPA RNAi agent concentrations ranging from 150fM-3 nM. EC50 were determined using GraphPad Prism software (Table 6).

TABLE 6
EC50 values (nM) determined in vitro for the
indicated LPA RNAi agents.
Duplex ID# EC50 (nM)
AD00575 0.073
AD00576 0.038
AD00578 0.112
AD00579 0.083
AD00621 0.100
AD00635 0.577
AD01070 0.6388
AD01072 0.1068
AD01073 0.1154
AD01074 0.2903

Example 4. In Vitro Analysis of Structure-Activity Relationship (SAR) Designed LPA RNAi Agents

LPA RNAi agent SAR sets (364 sequences based on AD01532 and 351 sequences based on AD01533) were synthesized and screened for efficacy in vitro. For screening purposes, 2756 bp of the human LPA cDNA sequence from KIV-3 to KIV-9 (accession # NM_005577.1) was synthesized and cloned (GeneWiz, South Plainfield, N.J.) into a commercially-available, reporter-based screening plasmid, psiCHECK2 (Promega, Madison, Wis.) which generated a Renilla luciferase/LPA fusion mRNA. For LPA RNAi agent efficacy in the human background, HuH7 cells, a human hepatocellular carcinoma line, were plated at ˜7500 cells per well in 96-well format. Each of the LPA RNAi agents was co-transfected at two concentrations (1 nM and 0.1 nM, or 10 nM and 1 nM) with 25 ng LPA-psiCHECK2 plasmid DNA per well and 0.2 μL LipoFectamine 2000 per well. Gene knockdown was determined by measuring Renilla luciferase levels normalized to the levels of constitutively-expressed firefly luciferase, also present on the psiCHECK2 plasmid, using the Dual Luciferase Reporter Assay (Promega, Madison, Wis.) (Tables 7A and 7B).

TABLE 7A
Efficacy screen results of LPA RNAi agents in
vitro, as determined by dual-luciferase reporter assay.
Relative Rluc-LPA
Duplex expression
ID No. 1 nM 0.1 nM
SD0001 0.570 0.907
SD0002 0.873 1.061
SD0003 0.955 1.020
SD0004 0.845 1.007
SD0005 0.603 0.891
SD0006 0.551 0.780
SD0007 0.510 0.797
SD0008 0.544 0.892
SD0009 0.564 0.878
SD0010 0.542 1.051
SD0011 0.513 0.873
SD0012 0.533 0.963
SD0013 0.541 0.979
SD0014 0.551 0.987
SD0015 0.488 0.951
SD0016 0.588 0.868
SD0017 1.023 1.005
SD0018 0.866 0.965
SD0019 0.792 1.005
SD0020 0.633 0.860
SD0021 0.572 0.797
SD0022 0.610 0.874
SD0023 0.550 0.836
SD0024 0.597 0.859
SD0025 0.587 0.899
SD0026 0.570 0.898
SD0027 0.580 0.825
SD0028 0.612 0.885
SD0029 0.528 0.866
SD0030 0.657 0.825
SD0031 0.560 0.914
SD0032 0.664 0.976
SD0033 0.787 1.035
SD0034 0.739 1.002
SD0035 0.658 0.949
SD0036 0.554 0.896
SD0037 0.557 0.873
SD0038 0.528 0.854
SD0039 0.511 0.847
SD0040 0.554 0.976
SD0041 0.559 0.823
SD0042 0.496 0.825
SD0043 0.563 0.851
SD0044 0.476 0.861
SD0045 0.542 0.841
SD0046 0.651 0.980
SD0047 0.967 0.995
SD0048 0.694 0.936
SD0049 0.960 0.946
SD0050 0.692 0.971
SD0051 0.611 0.905
SD0052 0.657 0.849
SD0053 0.642 0.848
SD0054 0.598 0.852
SD0055 0.494 0.828
SD0056 0.524 0.885
SD0057 0.582 0.816
SD0058 0.597 0.866
SD0059 0.560 0.905
SD0060 0.594 0.849
SD0061 0.571 1.058
SD0062 0.871 1.157
SD0063 0.969 1.138
SD0064 0.555 1.019
SD0065 0.671 0.953
SD0066 0.561 0.951
SD0067 0.612 0.904
SD0068 0.573 0.938
SD0069 0.574 0.975
SD0070 0.606 1.030
SD0071 0.494 0.959
SD0072 0.557 0.892
SD0073 0.593 0.984
SD0074 0.544 0.894
SD0075 0.552 0.937
SD0076 0.513 1.058
SD0077 0.930 1.071
SD0078 0.984 1.006
SD0079 0.853 1.031
SD0080 0.577 0.942
SD0081 0.595 1.044
SD0082 0.652 0.962
SD0083 0.583 0.928
SD0084 0.540 1.049
SD0085 0.523 0.961
SD0086 0.536 0.956
SD0087 0.586 0.987
SD0088 0.563 0.892
SD0089 0.555 0.947
SD0090 0.599 0.928
SD0091 0.665 0.854
SD0092 1.002 0.917
SD0093 1.047 0.880
SD0094 0.867 0.911
SD0095 0.919 0.868
SD0096 0.666 0.887
SD0097 0.673 0.737
SD0098 0.567 0.809
SD0099 0.604 0.909
SD0100 0.557 0.880
SD0101 0.545 0.806
SD0102 0.728 0.900
SD0103 0.719 0.928
SD0104 0.766 0.955
SD0105 0.965 0.927
SD0106 1.161 1.006
SD0107 1.048 0.966
SD0108 1.066 0.985
SD0109 1.111 0.917
SD0110 1.152 0.954
SD0111 1.045 0.944
SD0112 1.089 1.019
SD0113 0.949 0.935
SD0114 0.875 1.033
SD0115 1.022 1.077
SD0116 0.947 1.028
SD0117 0.946 1.021
SD0118 0.879 0.977
SD0119 0.963 1.016
SD0120 0.967 0.948
SD0121 0.651 0.897
SD0122 1.085 1.111
SD0123 1.153 1.052
SD0124 0.955 0.936
SD0125 0.928 0.928
SD0126 1.033 0.933
SD0127 0.637 0.717
SD0128 0.630 0.653
SD0129 1.052 1.192
SD0130 1.025 1.107
SD0131 1.280 1.059
SD0132 1.094 1.024
SD0133 1.113 1.031
SD0134 0.928 0.991
SD0135 0.804 1.023
SD0136 1.028 1.104
SD0137 0.902 1.149
SD0138 0.942 1.015
SD0139 0.984 1.068
SD0140 0.953 1.091
SD0141 0.925 1.022
SD0142 0.906 0.994
SD0143 0.898 0.990
SD0144 0.858 0.972
SD0145 0.917 0.947
SD0146 0.850 0.906
SD0147 0.933 0.995
SD0148 0.856 0.994
SD0149 0.882 0.985
SD0150 0.810 1.002
SD0151 0.813 0.909
SD0152 0.963 1.031
SD0153 1.058 0.936
SD0154 0.968 0.944
SD0155 0.969 0.940
SD0156 0.933 0.807
SD0157 0.906 0.913
SD0158 0.926 0.964
SD0159 0.805 0.850
SD0160 0.895 0.965
SD0161 0.865 1.006
SD0162 0.935 1.029
SD0163 0.928 0.985
SD0164 0.920 0.957
SD0165 1.039 1.110
SD0166 1.061 1.023
SD0167 1.020 0.982
SD0168 1.053 0.989
SD0169 1.002 1.018
SD0170 1.078 0.982
SD0171 0.838 0.923
SD0172 1.025 0.934
SD0173 0.864 0.963
SD0174 1.020 1.043
SD0175 1.128 1.046
SD0176 1.009 1.110
SD0177 0.735 0.975
SD0178 0.824 1.074
SD0179 0.690 0.895
SD0180 0.572 0.914
SD0181 0.904 1.028
SD0182 1.176 1.093
SD0183 1.247 1.090
SD0184 1.097 0.974
SD0185 1.045 0.985
SD0186 0.940 0.943
SD0187 0.883 0.994
SD0188 ND ND
SD0189 0.872 0.977
SD0190 0.861 1.166
SD0191 0.779 1.044
SD0192 0.796 1.116
SD0193 0.975 1.112
SD0194 0.876 1.058
SD0195 0.747 0.970
SD0196 0.787 1.086
SD0197 1.276 1.127
SD0198 1.144 1.140
SD0199 1.136 1.101
SD0200 0.814 0.911
SD0201 0.733 0.915
SD0202 0.576 0.933
SD0203 0.593 0.824
SD0204 0.882 1.038
SD0205 0.681 1.012
SD0206 0.600 0.927
SD0207 0.738 0.974
SD0208 0.638 0.883
SD0209 0.641 0.878
SD0210 0.544 0.886
SD0211 0.702 0.920
SD0212 0.704 0.854
SD0213 0.655 0.887
SD0214 0.629 0.860
SD0215 0.598 0.850
SD0216 0.611 0.782
SD0217 0.710 0.806
SD0218 0.738 0.758
SD0219 0.664 0.809
SD0220 1.133 0.891
SD0221 0.940 0.914
SD0222 0.853 0.882
SD0223 0.691 0.889
SD0224 0.997 1.033
SD0225 0.954 0.998
SD0226 1.202 0.997
SD0227 0.948 1.017
SD0228 0.786 0.947
SD0229 0.620 0.830
SD0230 0.840 0.972
SD0231 0.904 0.890

TABLE 7B
Efficacy screen results of LPA RNAi agents
in vitro, as determined by dual-luciferase reporter assay.
Relative
Rluc-LPA
Duplex expression
ID # 10 nM 1 nM
SD0232 0.659 0.699
SD0233 0.942 1.252
SD0234 0.967 1.358
SD0235 0.910 0.890
SD0236 0.742 0.822
SD0237 0.758 0.831
SD0238 0.700 0.737
SD0239 0.645 0.765
SD0240 0.701 0.773
SD0241 0.770 0.821
SD0242 0.626 0.719
SD0243 0.759 0.848
SD0244 0.798 0.953
SD0245 0.764 0.821
SD0246 0.812 0.690
SD0247 0.786 0.844
SD0248 1.011 1.167
SD0249 1.118 1.189
SD0250 1.021 1.239
SD0251 1.041 1.151
SD0252 1.070 1.124
SD0253 1.044 1.131
SD0254 0.861 0.948
SD0255 0.751 0.829
SD0256 0.931 1.037
SD0257 1.024 1.037
SD0258 0.935 1.030
SD0259 1.089 1.081
SD0260 0.955 1.008
SD0261 0.923 0.980
SD0262 0.908 1.107
SD0263 1.060 1.449
SD0264 1.041 1.419
SD0265 1.065 1.373
SD0266 0.950 1.376
SD0267 0.963 1.214
SD0268 1.023 1.299
SD0269 0.908 1.066
SD0270 0.963 1.081
SD0271 1.088 1.189
SD0272 0.966 1.135
SD0273 0.953 1.192
SD0274 1.049 1.217
SD0275 1.006 1.206
SD0276 0.969 1.064
SD0277 0.686 0.796
SD0278 0.985 1.305
SD0279 0.985 1.301
SD0280 0.978 1.237
SD0281 1.038 1.230
SD0282 0.933 1.191
SD0283 0.930 1.152
SD0284 0.907 1.117
SD0285 0.625 0.870
SD0286 0.984 1.056
SD0287 0.906 0.965
SD0288 1.052 1.123
SD0289 0.997 1.215
SD0290 0.892 1.197
SD0291 0.907 1.065
SD0292 0.689 0.862
SD0293 0.955 1.190
SD0294 1.095 1.157
SD0295 0.851 1.004
SD0296 1.018 1.106
SD0297 0.737 0.760
SD0298 0.790 0.828
SD0299 0.721 0.713
SD0300 0.796 0.869
SD0301 0.781 0.841
SD0302 0.621 0.720
SD0303 0.684 0.852
SD0304 0.774 0.842
SD0305 0.778 0.799
SD0306 0.718 0.793
SD0307 0.982 0.883
SD0308 1.297 1.193
SD0309 1.123 1.208
SD0310 0.961 1.073
SD0311 1.168 1.019
SD0312 0.923 0.824
SD0313 0.883 0.871
SD0314 0.670 0.650
SD0315 0.988 0.958
SD0316 0.908 0.880
SD0317 0.754 0.850
SD0318 0.963 0.944
SD0319 0.945 0.862
SD0320 0.961 0.875
SD0321 0.841 0.797
SD0322 0.546 0.521
SD0323 0.581 0.895
SD0324 0.692 0.900
SD0325 0.506 0.796
SD0326 0.634 0.709
SD0327 0.522 0.592
SD0328 0.602 0.632
SD0329 0.504 0.615
SD0330 0.445 0.601
SD0331 0.457 0.579
SD0332 0.500 0.601
SD0333 0.447 0.618
SD0334 0.490 0.528
SD0335 0.421 0.555
SD0336 0.488 0.533
SD0337 1.714 0.978
SD0338 1.262 1.350
SD0339 1.259 1.357
SD0340 0.996 1.277
SD0341 1.190 1.183
SD0342 0.818 0.923
SD0343 0.803 0.855
SD0344 0.708 0.883
SD0345 1.132 0.901
SD0346 0.847 0.890
SD0347 0.659 0.780
SD0348 0.730 0.945
SD0349 0.825 0.886
SD0350 0.826 0.897
SD0351 0.730 0.842
SD0352 0.297 0.276
SD0353 0.773 0.746
SD0354 0.663 0.722
SD0355 0.620 0.626
SD0356 0.546 0.599
SD0357 0.298 0.411
SD0358 0.313 0.318
SD0359 0.273 0.282
SD0360 0.256 0.257
SD0361 0.269 0.276
SD0362 0.270 0.276
SD0363 0.350 0.272
SD0364 0.227 0.243
SD0365 0.228 0.233
SD0366 0.264 0.241
SD0367 0.262 0.252
SD0368 0.571 0.597
SD0369 0.539 0.531
SD0370 0.521 0.545
SD0371 0.302 0.319
SD0372 0.353 0.335
SD0373 0.279 0.255
SD0374 0.266 0.194
SD0375 0.246 0.238
SD0376 0.258 0.238
SD0377 0.246 0.226
SD0378 0.237 0.226
SD0379 0.262 0.226
SD0380 0.247 0.240
SD0381 0.639 0.657
SD0382 0.267 0.517
SD0383 0.473 0.547
SD0384 0.456 0.563
SD0385 0.264 0.393
SD0386 0.329 0.325
SD0387 0.186 0.231
SD0388 0.217 0.248
SD0389 0.230 0.275
SD0390 0.210 0.270
SD0391 0.247 0.224
SD0392 0.257 0.236
SD0393 0.252 0.253
SD0394 0.267 0.251
SD0395 0.594 0.675
SD0396 0.511 0.678
SD0397 0.457 0.618
SD0398 0.516 0.601
SD0399 0.261 0.389
SD0400 0.327 0.300
SD0401 0.230 0.250
SD0402 0.231 0.260
SD0403 0.237 0.221
SD0404 0.258 0.243
SD0405 0.253 0.246
SD0406 0.228 0.230
SD0407 0.228 0.215
SD0408 0.247 0.255
SD0409 0.565 0.667
SD0410 0.796 0.863
SD0411 0.633 0.646
SD0412 0.613 0.699
SD0413 0.294 0.439
SD0414 0.416 0.310
SD0415 0.275 0.238
SD0416 0.241 0.290
SD0417 0.257 0.284
SD0418 0.267 0.306
SD0419 0.249 0.229
SD0420 0.243 0.240
SD0421 0.250 0.241
SD0422 0.230 0.237
SD0423 0.555 0.684
SD0424 0.614 0.682
SD0425 0.592 0.733
SD0426 0.604 0.699
SD0427 0.281 0.449
SD0428 0.301 0.330
SD0429 0.230 0.261
SD0430 0.241 0.273
SD0431 0.232 0.255
SD0432 0.247 0.288
SD0433 0.238 0.280
SD0434 0.224 0.293
SD0435 0.249 0.240
SD0436 0.428 0.445
SD0437 0.542 0.829
SD0438 1.106 1.048
SD0439 0.930 1.096
SD0440 1.033 1.023
SD0441 0.630 0.657
SD0442 0.912 0.913
SD0443 0.392 0.375
SD0444 0.552 0.441
SD0445 0.561 0.514
SD0446 0.550 0.442
SD0447 0.415 0.362
SD0448 0.566 0.503
SD0449 0.579 0.475
SD0450 0.463 0.424
SD0451 0.925 0.929
SD0452 0.963 0.939
SD0453 0.967 0.952
SD0454 0.948 0.883
SD0455 0.746 0.645
SD0456 0.840 0.860
SD0457 0.473 0.402
SD0458 0.555 0.514
SD0459 0.566 0.472
SD0460 0.609 0.478
SD0461 0.408 0.355
SD0462 0.630 0.532
SD0463 0.631 0.497
SD0464 0.549 0.510
SD0465 0.966 0.809
SD0466 0.910 0.841
SD0467 0.904 0.878
SD0468 0.999 1.009
SD0469 0.734 0.760
SD0470 0.925 0.806
SD0471 0.559 0.482
SD0472 0.572 0.543
SD0473 0.652 0.594
SD0474 0.621 0.598
SD0475 0.564 0.472
SD0476 0.769 0.631
SD0477 0.734 0.613
SD0478 0.460 0.411
SD0479 0.713 0.802
SD0480 0.883 0.892
SD0481 0.926 0.899
SD0482 1.180 0.937
SD0483 0.805 0.986
SD0484 0.920 1.104
SD0485 0.510 0.524
SD0486 0.626 0.598
SD0487 0.628 0.640
SD0488 0.597 0.637
SD0489 0.482 0.486
SD0490 0.685 0.664
SD0491 0.650 0.662
SD0492 0.454 0.490
SD0493 1.006 1.040
SD0494 0.933 1.024
SD0495 0.927 1.016
SD0496 0.921 1.004
SD0497 0.690 0.846
SD0498 0.970 0.913
SD0499 0.448 0.399
SD0500 0.614 0.485
SD0501 0.609 0.521
SD0502 0.626 0.526
SD0503 0.493 0.410
SD0504 0.727 0.551
SD0505 0.688 0.541
SD0506 0.319 0.338
SD0507 0.927 0.897
SD0508 0.929 0.972
SD0509 0.853 0.925
SD0510 0.755 0.935
SD0511 0.480 0.559
SD0512 0.834 0.854
SD0513 0.440 0.323
SD0514 0.415 0.414
SD0515 0.442 0.343
SD0516 0.422 0.341
SD0517 0.346 0.320
SD0518 0.488 0.420
SD0519 0.435 0.390
SD0520 0.819 0.737
SD0521 1.058 0.903
SD0522 1.088 0.933
SD0523 1.075 0.948
SD0524 1.067 0.900
SD0525 0.917 0.858
SD0526 1.126 1.055
SD0527 0.832 0.776
SD0528 0.980 0.886
SD0529 1.059 0.821
SD0530 0.934 0.844
SD0531 0.832 0.883
SD0532 0.936 0.868
SD0533 0.900 0.946
SD0534 1.012 0.984
SD0535 1.041 1.095
SD0536 1.113 1.097
SD0537 1.125 0.957
SD0538 1.059 1.162
SD0539 0.901 0.963
SD0540 0.900 0.924
SD0541 1.033 0.911
SD0542 0.958 0.906
SD0543 0.870 0.816
SD0544 1.100 0.853
SD0545 0.881 0.794
SD0546 0.897 0.813
SD0547 1.005 0.785
SD0548 0.972 0.866
SD0549 1.019 1.121
SD0550 0.986 1.015
SD0551 0.966 1.033
SD0552 0.893 1.028
SD0553 0.976 0.998
SD0554 0.938 0.935
SD0555 0.886 0.875
SD0556 1.181 1.142
SD0557 1.016 0.999
SD0558 1.026 0.968
SD0559 0.928 0.844
SD0560 0.990 0.805
SD0561 0.836 0.791
SD0562 1.021 0.772
SD0563 0.886 0.946
SD0564 1.194 1.254
SD0565 1.010 1.033
SD0566 1.110 0.993
SD0567 0.995 0.895
SD0568 0.964 0.901
SD0569 0.853 0.876
SD0570 0.832 0.860
SD0571 1.036 0.959
SD0572 1.013 0.902
SD0573 0.948 0.793
SD0574 0.868 0.812
SD0575 0.946 0.712
SD0576 0.922 0.774
SD0577 0.824 0.800
SD0578 0.997 0.950
SD0579 1.048 1.143
SD0580 1.071 0.935
SD0581 0.987 0.869
SD0582 0.946 0.816
SD0583 0.932 0.789
SD0584 1.062 0.866
SD0585 1.155 0.891
SD0586 0.960 0.819
SD0587 0.934 0.832
SD0588 1.033 0.781
SD0589 0.972 0.798
SD0590 0.925 0.704
SD0591 1.061 0.915
SD0592 1.129 0.996
SD0593 0.856 0.895
SD0594 0.840 0.956
SD0595 0.882 0.857
SD0596 0.856 0.896
SD0597 0.869 0.697
SD0598 0.878 0.700
SD0599 0.808 0.857
SD0600 0.856 0.823
SD0601 0.742 0.713
SD0602 0.740 0.846
SD0603 0.808 0.816
SD0604 0.561 0.527
SD0605 0.711 0.880
SD0606 0.852 0.922
SD0607 0.695 0.887
SD0608 0.635 0.917
SD0609 0.655 0.874
SD0610 0.596 0.765
SD0611 0.482 0.508
SD0612 0.629 0.578
SD0613 0.616 0.503
SD0614 0.716 0.682
SD0615 0.570 0.491
SD0616 0.671 0.668
SD0617 0.713 0.721
SD0618 0.819 0.862
SD0619 0.925 0.968
SD0620 0.859 0.978
SD0621 0.923 1.075
SD0622 0.900 0.988
SD0623 0.908 0.969
SD0624 0.775 0.889
SD0625 0.827 0.850
SD0626 0.832 0.796
SD0627 0.916 0.796
SD0628 0.863 0.898
SD0629 0.915 0.869
SD0630 0.893 0.856
SD0631 0.940 0.848
SD0632 0.878 0.911
SD0633 0.934 1.074
SD0634 0.915 1.019
SD0635 0.911 0.912
SD0636 0.852 0.911
SD0637 0.997 0.965
SD0638 0.983 0.935
SD0639 0.806 0.823
SD0640 0.838 0.846
SD0641 0.906 0.861
SD0642 0.740 0.836
SD0643 0.739 0.725
SD0644 0.780 0.762
SD0645 0.739 0.819
SD0646 0.734 0.798
SD0647 0.789 0.913
SD0648 0.707 0.946
SD0649 0.943 1.077
SD0650 0.729 0.872
SD0651 0.666 0.879
SD0652 0.704 0.882
SD0653 0.661 0.726
SD0654 0.751 0.881
SD0655 0.727 0.822
SD0656 0.746 0.839
SD0657 0.849 0.842
SD0658 0.835 0.796
SD0659 0.972 0.830
SD0660 0.772 0.672
SD0661 0.883 0.918
SD0662 0.934 0.952
SD0663 0.974 0.891
SD0664 0.939 0.936
SD0665 1.116 0.919
SD0666 0.924 0.954
SD0667 0.780 0.744
SD0668 0.795 0.726
SD0669 0.819 0.754
SD0670 0.856 0.830
SD0671 0.844 0.758
SD0672 0.978 0.952
SD0673 0.860 0.845
SD0674 0.526 0.566
SD0675 0.661 0.961
SD0676 0.690 0.916
SD0677 0.672 0.939
SD0678 0.821 0.973
SD0679 0.943 0.952
SD0680 1.018 0.991
SD0681 0.561 0.580
SD0682 0.777 0.688
SD0683 0.654 0.639
SD0684 0.691 0.622
SD0685 0.518 0.555
SD0686 0.661 0.738
SD0687 0.722 0.644
SD0688 0.416 0.385
SD0689 0.571 0.870
SD0690 0.697 0.946
SD0691 0.616 0.840
SD0692 0.644 0.850
SD0693 0.781 0.733
SD0694 1.022 0.902
SD0695 0.458 0.448
SD0696 0.500 0.455
SD0697 0.454 0.444
SD0698 0.497 0.467
SD0699 0.369 0.416
SD0700 0.622 0.552
SD0701 0.542 0.528
SD0702 0.301 0.423
SD0703 0.376 0.367
SD0704 0.373 0.334
SD0705 0.315 0.347
SD0706 0.339 0.351
SD0707 0.245 0.263
SD0708 0.572 0.703
SD0709 0.313 0.484
SD0710 0.297 0.431
SD0711 0.284 0.397
SD0712 0.300 0.471
SD0713 0.297 0.417
SD0714 0.300 0.438
SD0715 0.280 0.430

Example 5. In Vivo Analysis of RNAi Agent Efficacy in Transiently Transgenic and Transgenic Mice

A) Administration and Sample Collection.

In order to evaluate the efficacy of LPA RNAi agents in vivo, transiently transgenic mice were used. At least 30 days prior to cholesterol-conjugated LPA RNAi agent administration, wild-type mice were injected by hydrodynamic tail vein injection with a plasmid containing the SEAP gene under the control of the mouse albumin promoter. LPA gene target sequences were cloned in the 3′ UTR of the plasmid. These mice are noted as SEAP-LPA HTV mice. Cholesterol-conjugated LPA RNAi agents were administered to mice using MLP delivery polymer on day 1 (WO 2012/083185, incorporated herein by reference; melittin was synthesized and modified with CDM-NAG to yield MLP delivery polymer as described therein). Each mouse received an intravenous (IV) injection into the tail vein of 200-250 μL solution containing a dose of LPA RNAi agent+MLP delivery polymer (1:1 w/w RNAi agent: MLP delivery polymer in most cases). In some experiments, LPA RNAi agents were directly conjugated to a delivery polymer. Polymer conjugated LPA RNAi agents were similarly injected into tail vein. The indicated LPA RNAi agent (Table 8B) was conjugated to a polyacrylate polymer, ARF1164-106A-5, having 54.4% ethoxy ethyl amino acrylate (EEAA) amine monomers and 45.6% propyl acrylate propyl monomers (MW 41962 g/mol, polymer synthesized as described in WO 2013/158141) and masked with 3×ACit-NAG, 6×ACit-PEG (polymer masked as described in WO 2012/092373 and PCT/US16/34512). Control serum (pre-treatment) samples were taken from the mice pre-injection on days −4, or −1. Post injection serum samples were taken from the mice days 4, 8, 15, 22, 29, 36, and 43. For some mice, samples were collected on day 3 or day 5, instead of day 4.

In additional experiments, LPA RNAi agents were evaluated in vivo using transiently transgenic mice expressing full length LPA. At least 30 days prior to cholesterol-targeted LPA RNAi agent administration, immune compromised (Nod.scid) mice were injected by hydrodynamic tail vein injection with a minicircle containing the LPA cDNA under the control of the mouse albumin promoter. These mice are noted as LPA mc HTV mice. Either cholesterol-targeted or NAG (also termed GalNAc)-conjugated LPA RNAi agents were administered to mice on day 1. For Cholesterol-targeted RNAi agents, each mouse received an intravenous (IV) injection into the tail vein of 200-250 μL solution containing a dose of RNAi agent+MLP delivery polymer (1:1 w/w RNAi agent:MLP delivery polymer). For NAG conjugated LPA RNAi agents, mice received a subcutaneous (SC) injection into the loose skin on the back between the shoulders of 300 μl solution containing a dose of the RNAi agent in buffered saline. For some sample, the LPA RNAi agent was administered either with or without MLP delivery peptide. RNAi agents delivered with MLP delivery peptide were administered by intravenous (IV) injection into the tail vein of 200-250 μL solution containing a dose of RNAi agent+MLP delivery polymer (1:2 w/w RNAi agent: MLP delivery polymer in most cases). Control serum (pre-treatment) samples were taken from the mice pre-injection on days −4, or −1. Post injection serum samples were taken from the mice days 4, 8, 15, 22, 29, 36, and 43. For some mice, samples were collected on day 3 or day 5, instead of day 4.

In further experiments, LPA RNAi agents were administered to apo(a) and Lp(a) transgenic mice (Frazer K A et al 1995, Nature Genetics 9:424-431). This mouse expresses human apo(a) from a YAC containing the full LPA gene (encoding apo(a) protein) with additional sequences both 5′ and 3′. Lp(a) mice were bred by crossing apo(a) YAC-containing mice to human apoB-100 expressing mice (Callow M J et al 1994, PNAS 91:2130-2134). Cholesterol-targeted RNAi agents and NAG conjugated RNAi agents were administered as described above. Control serum (pre-treatment) samples were taken from the mice pre-injection on day −1. Post injection serum samples were taken from the mice days 4, 8, 15, 22, 29, 36, 43, 50, 57 and 64.

B) LPA expression knockdown analyses. For SEAP-LPA HTV mice, SEAP protein levels in serum were monitored by assaying serum from the mice using Phospha-Light™, a chemiluminescent reporter gene assay system (Life Technologies). For normalization, SEAP level for each animal at a given time point was divided by the pre-treatment level of expression in that animal to determine the ratio of expression “normalized to pre-treatment”. Expression at a specific time point was then averaged amongst individuals within the group.

For LPA mc HTV mice and transgenic mice, human apo(a) protein levels in serum were monitored by assaying serum from mice using an ELISA for apo(a) (Abcam). For normalization, apo(a) level for each animal at a time point was divided by the pre-treatment level of expression in that animal (in this case at day 1) to determine the ratio of expression “normalized to day 1”. Expression at a specific time point was then normalized to the saline control group by dividing the “normalized to day 1” ratio for an individual animal by the mean “normalized to day 1” ratio of all mice in the saline control group. This resulted in expression for each time point normalized to that in the control group.

Lp(a) levels were determined on a Cobas Integra 400 (Roche Diagnostics) according to the manufacturer's recommendations. For normalization, apo(a) level for each animal at a time point was divided by the pre-treatment level of expression in that animal (in this case at day 1) to determine the ratio of expression “normalized to day 1”. Expression at a specific time point was then normalized to the saline control group by dividing the “normalized to day 1” ratio for an individual animal by the mean “normalized to day 1” ratio of all mice in the saline control group. This resulted in expression for each time point normalized to that in the control group.

TABLE 8A
Relative LPA levels in mouse following intravenous
administration of cholesterol-conjugated LPA RNAi
agents + MLP delivery polymer.
LPA RNAi MLP
Duplex ID agent (mg/kg) (mg/kg) Relative LPA
AD01184 2 2 0.20
AD01187 2 2 0.18
AD01190 2 2 0.17
AD01193 2 2 0.22
AD01196 2 2 0.02
AD01197 2 2 0.065
AD01198 2 2 0.051
AD01199 2 2 0.070
AD01200 2 2 0.094
AD01201 2 2 0.029
AD01202 8 8 0.14
AD01205 2 2 0.21
AD01206 2 2 0.37
AD01207 2 2 0.19
AD01208 2 2 0.35
AD01209 2 2 0.16
AD01210 2 2 0.18
AD01211 2 2 0.38
AD01212 2 2 0.26
AD01213 2 2 0.30
AD02662 2 2 0.0010
AD02663 2 2 0.010
AD02664 2 2 0.0010

TABLE 8B
Relative LPA levels in mouse following intravenous
administration of delivery polymer-conjugated LPA RNAi agents.
Duplex LPA RNAi agent
ID (mg/kg) Relative LPA
AD01462 0.5 0.38
AD01463 0.5 0.41
AD01466 0.5 0.33
AD01467 0.5 0.46

TABLE 8C
Relative LPA levels in mouse following subcutaneous
administration of NAG-conjugated LPA RNAi agents.
LPA RNAi agent
Duplex ID (mg/kg) Relative LPA
AD01529 10 0.068
AD01530 10 0.43
AD01531 10 0.62
AD01532 10 0.18
AD01533 10 0.30
AD01534 10 0.44
AD01765 10 0.14
AD01766 10 0.52
AD01767 10 0.51
AD01768 10 0.15
AD01769 10 0.56
AD01770 10 0.29
AD01772 10 0.25
AD01773 10 0.28
AD01774 10 0.24
AD01780 10 0.34
AD01804 10 0.68
AD01976 10 0.27
AD01977 10 0.27
AD01978 10 0.53
AD01979 10 0.044
AD01980 10 0.087
AD01981 10 0.074
AD01982 10 0.066
AD01983 10 0.078
AD01984 10 0.036
AD01985 10 0.0070
AD01986 10 0.019
AD01987 10 0.019
AD01988 10 0.042
AD01989 10 0.053
AD01990 10 0.017
AD02001 10 0.021
AD02003 10 0.050
AD02004 10 0.050
AD02005 10 0.040
AD02006 10 0.11
AD02007 10 0.21
AD02008 10 0.080
AD02009 10 0.090
AD02010 10 0.16
AD02011 10 0.070
AD02435 10 0.038
AD02436 10 0.027
AD02437 10 0.052
AD02438 10 0.063
AD02439 10 0.073
AD02440 10 0.13
AD02545 10 0.079
AD02546 10 0.045
AD02547 10 0.055
AD02548 10 0.13
AD02549 10 0.071
AD02550 10 0.039
AD02551 10 0.057
AD02552 10 0.033
AD02553 10 0.14
AD02554 10 0.14
AD02555 10 0.18
AD02556 10 0.10
AD02557 10 0.10
AD02558 10 0.071
AD02559 10 0.039
AD02560 10 0.058
AD02561 10 0.12
AD02609 3 0.59
AD02610 3 0.36
AD02611 3 0.35
AD02612 3 0.37
AD02613 3 0.24
AD02614 3 0.24
AD02615 3 0.14
AD02616 3 0.25
AD02617 3 0.090
AD02618 3 0.11
AD02619 3 0.020
AD02620 3 0.11
AD02682 10 0.11
AD02683 10 0.14
AD02684 10 0.79
AD02685 10 0.78
AD02686 10 0.19
AD02687 10 0.27
AD02696 3 0.050
AD02710 3 0.040
AD02711 3 0.040
AD02712 3 0.49
AD02713 3 0.040
AD02714 3 0.040
AD02715 3 0.070
AD02716 3 0.080
AD02717 3 0.12
AD02745 3 0.25
AD02746 3 0.22
AD02747 3 0.081
AD02748 3 0.17
AD02749 3 0.17
AD02750 3 0.066
AD02751 3 0.070
AD02752 3 0.044
AD02753 3 0.071
AD02819 1 0.022
AD02820 1 0.042
AD02821 1 0.038
AD02825 3 0.050
AD02826 3 0.050
AD02827 3 0.050
AD02828 3 0.050
AD02829 3 0.040
AD02830 3 0.040
AD02831 3 0.030
AD02832 3 0.030
AD02841 3 0.061
AD02842 3 0.16
AD02843 3 0.10
AD02844 3 0.11
AD02845 3 0.22
AD02846 3 0.16
AD02847 3 0.066
AD02848 3 0.055
AD02849 3 0.083
AD02850 3 0.042
AD02851 3 0.063
AD02852 3 0.11
AD02907 10 0.10
AD02908 10 0.11
AD02909 10 0.049
AD02910 10 0.23
AD02911 10 0.20
AD02912 10 0.10
AD02913 10 0.070
AD02914 10 0.050
AD02915 10 0.10
AD02916 10 0.090
AD02917 10 0.060
AD02918 10 0.020
AD02919 10 0.030
AD02920 10 0.050
AD02921 10 0.040
AD02922 10 0.080
AD02923 10 0.040
AD02924 10 0.050
AD02925 10 0.030
AD02926 10 0.17
AD02927 10 0.31
AD02928 10 0.081
AD02929 10 0.065
AD02930 10 0.15
AD02931 10 0.13
AD02932 10 0.11
AD03049 3 0.20
AD03050 3 0.087
AD03051 3 0.070
AD03052 3 0.080
AD03053 3 0.23
AD03054 3 0.050
AD03058 3 0.27
AD03059 3 0.22
AD03060 3 0.31
AD03061 3 0.16
AD03062 3 0.20
AD03063 3 0.13
AD03064 3 0.21
AD03065 3 0.085
AD03066 3 0.10
AD03067 3 0.094
AD03068 3 0.17
AD03069 3 0.077
AD03070 3 0.36
AD03071 3 0.043
AD03072 3 0.031
AD03073 3 0.019
AD03074 3 0.016
AD03075 3 0.062
AD03114 1 0.33
AD03115 1 0.30
AD03116 1 0.21
AD03117 1 0.14
AD03118 1 0.30
AD03119 1 0.10
AD03120 1 0.080
AD03121 1 0.14
AD03122 1 0.14
AD03123 1 0.34
AD03156 1 0.084
AD03157 1 0.016
AD03158 1 0.037
AD03159 1 0.63
AD03272 1 0.13
AD03273 1 0.20
AD03274 1 0.21
AD03275 1 0.15
AD03276 1 0.11
AD03277 1 0.13
AD03278 1 0.13
AD03279 1 0.21
AD03341 1 0.13
AD03421 1 0.29
AD03430 1 0.12
AD03432 1 0.16
AD03434 1 0.11
AD03436 1 0.21
AD03438 1 0.25
AD03440 1 0.21
AD03460 1 0.090
AD03462 1 0.40
AD03495 1 0.28
AD03536 1 0.14
AD03538 0.5 0.26
AD03539 0.5 0.21
AD03540 1 0.15
AD03541 0.5 0.10
AD03542 1 0.94
AD03547 1 0.19
AD03548 1 0.73
AD03549 1 0.29
AD03573 1 0.15
AD03574 1 0.15
AD03575 1 0.13
AD03576 1 0.18
AD03577 0.5 0.18
AD03578 0.5 0.38
AD03579 0.5 0.53
AD03603 1 0.083
AD03604 1 0.091
AD03605 1 0.19
AD03608 1 0.18
AD03609 1 0.16
AD03610 1 0.23
AD03611 1 0.40
AD03612 1 0.21
AD03629 1 0.11
AD03668 1 0.070
AD03705 0.5 0.11
AD03707 0.5 0.11
AD03720 0.5 0.14
AD03721 0.5 0.094
AD03722 0.5 0.19
AD03723 0.5 0.10
AD03765 1 0.080
AD03771 1 0.10
AD03801 1 0.15
AD03802 1 0.18
AD03844 1 0.17
AD03845 1 0.25
AD03848 1 0.10
AD03850 1 0.052
AD03851 1 0.076
AD03852 1 0.13
AD03853 1 0.081
AD03854 1 0.21
AD03856 1 0.32
AD03859 1 0.15
AD03862 1 0.12
AD03863 1 0.12
AD03921 1 0.17
AD03922 1 0.057
AD03923 1 0.066
AD03924 1 0.14
AD03931 1 0.34
AD03932 1 0.15
AD03933 1 0.34
AD03424 1 0.15
AD03425 1 0.21
AD03426 1 0.21
AD03427 1 0.19
AD03428 1 0.18
AD03760 0.5 0.21
AD03762 0.5 0.17
AD03763 0.5 0.21
AD03764 0.5 0.28
AD03766 0.5 0.065
AD03847 1 0.15
AD04110 1 0.070

Example 6. In Vivo Screening of LPA RNAi Agents and Time Course of SEAP Knockdown

Cholesterol-conjugated LPA RNAi agents were administered to transiently transgenic mice as described above. Each mouse received a single intravenous (IV) dose of 8 mg/kg of LPA RNAi agent with 8 mg/kg of MLP delivery polymer. SEAP protein levels in serum were monitored for up to 36 days. Knockdown levels and duration of response are shown in Table 9. A decrease in SEAP serum protein level of greater than 85% was obtained following administration of all LPA RNAi agents tested; with all but two LPA RNAi agents tested showing greater than 99.4% knockdown. AD01196 and AD01199 showed >95% knockdown at day 36.

Example 7. In Vivo Screening LPA RNAi Agents and Time Course of LPA Knockdown at Lower LPA RNAi Agent Doses

Cholesterol-conjugated LPA RNAi agents were administered to transiently transgenic mice as described above. Each mouse received a single intravenous (IV) dose of 2 mg/kg of LPA RNAi agent with 2 mg/kg of MLP delivery polymer. SEAP protein levels in serum were monitored for up to 43 days (Table 10).

Example 8. In Vivo Testing of LPA RNAi Agents in Apo(a) Transgenic (Tg) Mice

AD01196 was administered to mice as described above. Each mouse received a single intravenous (IV) dose of either 2 mg/kg of LPA RNAi agent with 2 mg/kg of MLP delivery polymer or saline. Human apo(a) (apo(a)) levels in serum were monitored for up to 64 days (Table 11). At day 15, animals in the saline group received a single IV dose of 2 mg/kg of a control mouse Factor VII (F7) RNAi agent with 2 mg/kg of MLP delivery polymer. At day 22, F7 levels were measured in all animals. F7 activity was knocked down by 99% 7 days post dosing, with no effect on serum apo(a) levels. AD01196 showed >3 log 10 knockdown of apo(a) levels at nadir, with >80% knockdown observed after 3 weeks (Table 11).

TABLE 9
Serum SEAP protein levels in SEAP-LPA HTV mice following administration of 8 mg/kg chol-RNAi
agents with 8 mg/kg MLP delivery peptide. SEAP levels were normalized to day −1 and saline control.
Day −1 Day 4 Day 8 Day 15 Day 22 Day 29 Day 36
Treatment Ave SD Ave SD Ave SD Ave SD Ave SD Ave SD Ave SD
Saline 1.00 0.24 1.00 0.34 1.00 0.13 1.00 0.33 1.00 0.09 1.00 0.18 1.00 0.44
AD01184 1.00 0.39 0.27 0.10 0.15 0.06 0.01 0.00 0.07 0.04 0.43 0.39 0.98 0.73
AD01187 1.00 0.53 0.24 0.15 0.13 0.10 0.00 0.00 0.01 0.01 0.08 0.06 0.56 0.47
AD01190 1.00 0.77 0.26 0.20 0.14 0.11 0.00 0.00 0.00 0.00 0.00 0.00 0.02 0.01
AD01193 1.00 0.99 0.25 0.26 0.15 0.17 0.01 0.01 0.00 0.00 0.01 0.01 0.02 0.01
AD01196 1.00 0.59 0.24 0.13 0.14 0.08 0.00 0.00 0.00 0.00 0.01 0.01 0.04 0.03
AD01199 1.00 0.52 0.23 0.15 0.13 0.10 0.00 0.00 0.00 0.00 0.01 0.00 0.04 0.02
AD01202 1.00 0.93 0.25 0.24 0.17 0.16 0.14 0.12 0.56 0.55 0.78 0.66 2.09 2.00

TABLE 10
Serum SEAP protein levels in SEAP-LPA HTV mice following administration of 2 mg/kg chol-RNAi
agents with 2 mg/kg MLP delivery peptide. SEAP levels were normalized to day −1 and saline control.
Day −4 Day 4 Day 9 Day 15 Day 22 Day 29 Day 36 Day 43
Treatment Ave. SD Ave. SD Ave. SD Ave. SD Ave. SD Ave. SD Ave. SD Ave. SD
Saline 1.00 0.00 1.00 0.72 1.00 0.72 1.00 0.71 1.00 0.43 1.00 0.79 1.00 0.48 1.00 0.54
AD01196 1.00 0.00 0.22 0.08 0.05 0.05 0.02 0.01 0.13 0.04 0.36 0.12 0.69 0.08 1.39 0.91
AD01199 1.00 0.00 0.27 0.28 0.07 0.06 0.17 0.17 0.59 0.51 0.74 0.74 0.83 0.82 1.01 0.58
AD01205 1.00 0.00 0.21 0.13 0.31 0.23 0.45 0.21 1.33 0.68 1.11 0.82 1.55 1.30 1.79 1.09
AD01208 1.00 0.00 0.43 0.20 0.35 0.15 0.68 0.19 1.45 0.44 1.32 0.26 1.39 0.52 0.99 0.12
AD01211 1.00 0.00 0.38 0.14 0.53 0.20 0.94 0.38 1.96 0.93 1.05 0.27 1.44 0.38 0.93 0.28
AD01184 1.00 0.00 0.26 0.07 0.20 0.05 0.61 0.17 1.28 0.14 1.21 0.51 1.39 0.80 ND ND
AD01187 1.00 0.00 0.37 0.18 0.09 0.07 0.18 0.17 0.86 0.84 0.77 0.33 1.80 0.36 ND ND
AD01190 1.00 0.00 0.26 0.08 0.17 0.07 0.36 0.13 1.16 0.37 1.39 0.69 1.96 1.64 ND ND
AD01193 1.00 0.00 0.39 0.27 0.22 0.33 0.32 0.37 0.67 0.58 0.84 0.46 1.27 0.23 ND ND

TABLE 11
Serum apo(a) protein levels in apo(a) Tg mice following administration of 2 mg/kg
cholesterol-conjugated LPA RNAi agent with 2 mg/kg MLP delivery polymer.
Apo(a) levels were normalized to day −1 and saline control.
Day −1 Day 4 Day 8 Day 15 Day 22
Treatment Ave SD Ave SD Ave SD Ave SD Ave SD
Saline 1.00 0.00 1.00 0.06 1.00 0.27 1.00 0.06 1.00 0.17
AD01196 1.00 0.00 0.00 0.00 0.00 0.00 0.01 0.00 0.15 0.08
Day 29 Day 36 Day 43 Day 50
Ave SD Ave SD Ave SD Ave SD
Saline 1.00 0.12 1.00 0.04 1.00 0.26 1.00 0.24
AD01196 0.40 0.23 0.74 0.61 0.75 0.67 0.77 0.52

Example 9. Apolipoprotein (a) (Apo(a)) Knockdown in Non-Human Primates Following LPA RNAi Agent Delivery by MLP Delivery Polymer

MLP delivery polymer and LPA RNAi agent were made and combined in a pharmaceutically acceptable buffer as described above. On day 1, two cynomolgus macaque (Macaca fascicularis) primates (both male, 5.0 kg and 8.15 kg, respectively) were injected with 2 mg/kg AD01196+2 mg/kg MLP delivery polymer. For each injection, the LPA RNAi agent+MLP delivery polymer (2 ml/kg) was injected into the saphenous vein using a 22 to 25 gauge intravenous catheter. At the indicated time points (indicated in Table 12), blood samples were drawn and analyzed for apo(a) levels, lipid levels and toxicity markers. Blood was collected from the femoral vein and primates were fasted overnight before all blood collections. Blood tests for blood urea nitrogen (BUN), alanine transaminase (ALT), aspartate aminotransferase (AST), creatinine, total cholesterol (TC) and triglycerides (TG) were performed on an automated chemistry analyzer at Meriter laboratories. Blood tests for Lipoprotein (a) (Lp(a)) and Low density lipoprotein (LDL) were measured on an automated chemistry analyzer. Serum apo(a) levels were measured by ELISA. Significant knockdown of apo(a) was observed with an average maximum knockdown of 94.5% observed at day 22. Average maximum knockdown of Lp(a) was 91.5% observed at day 15 (FIG. 3). No dose-related toxicity was observed in treated animals.

TABLE 12
Serum apo(a) protein, Lipoprotein(a) (mg/dL), Low density Lipoprotein (LDL),
Total cholesterol, and triglyceride levels in cynomolgus macaque (Macaca fascicularis)
primates following administration of 2 mg/kg AD01196 with 2 mg/kg MLP delivery
polymer. Apo(a) levels were normalized to predose.
Low Density
Serum apo(a) Lipoprotein(a) Lipoprotein Total
protein levels calculated Cholesterol Triglycerides
levels (mg/dL) (mg/dL) (mg/dL) (mg/dL)
animal animal animal animal animal animal animal animal animal animal
day 1 2 1 2 1 2 1 2 1 2
pre 1.00 1.00 77.1 126.7 48.4 84.7 95 149 41 36
3 0.47 0.55 46.0 65.0 53.6 83.5 93 143 33 28
8 0.12 0.15 9.3 16.5 53.4 75.9 101 147 36 30
15 0.10 0.10 5.0 7.3 49.8 60.9 106 136 79 34
22 0.05 0.06 7.9 10.3 47.5 63.9 97 136 34 36
29 0.08 0.11 13.4 27.0 55.7 47.5 101 116 20 36
36 0.15 0.25 22.2 50.6 56.8 73.1
43 0.19 0.23 31.4 45.5 53.8 55.7 103 138 29 39
50 0.27 0.29 46.1 67.3 52.3 70.9
57 0.27 0.3 52.7 69.7 52.1 78.6 104 157 34 39
64 0.33 0.31 68.4 73.7 52.4 75.8
71 0.50 0.4 76.8 78.6 62.4 75.0 104 149 43 47
85 0.31 0.34 63.1 75.4 50.3 68.8 102 145 41 49
99 0.27 0.29 67.9 78.8 58.7 72.5 102 150 42 52
120 0.36 0.37 91.7 119.4 53.4 79.8 100 154 43 51

TABLE 13
Urea Nitrogen, Creatinine, Alanine transaminase, and Aspartate aminotransferase
levels in cynomolgus macaque (Macaca fascicularis) primates following
administration of 2 mg/kg AD01196 with 2 mg/kg MLP delivery polymer.
Blood Urea Alanine Aspartate
Nitrogen Creatinine transaminase aminotransferase
(mg/dL) (mg/dL) (U/L) (U/L)
day animal 1 animal 2 animal 1 animal 2 animal 1 animal 2 animal 1 animal 2
predose 16 16 0.79 0.70 37 32 32 33
3 11 14 0.70 0.61 40 42 33 35
8 14 13 0.78 0.58 33 38 25 31
15 15 15 0.67 0.59 51 35 47 32
22 15 15 0.8 0.55 47 35 29 30
29 12 12 0.61 0.59 30 31 23 36
36
43 12 15 0.64 0.58 29 29 25 30
50
57 14 15 0.72 0.64 32 35 28 31
64
71 14 15 0.73 0.69 36 35 29 33
85 14 15 0.60 0.70 126 41 51 40
99 15 18 0.66 0.68 151 40 44 37
120 14 19 0.72 0.60 37 51 28 47

Example 10. In Vivo Screening of NAG-Conjugated LPA RNAi Agents and Time Course of Knockdown

NAG-conjugated LPA RNAi agents were administered to transiently transgenic mice as described above. Each mouse received either single intravenous (IV) dose of 2 mg/kg of LPA RNAi agent with 1 mg/kg of MLP delivery polymer, or a single subcutaneous (SC) dose of 10 mg/kg of the NAG-conjugated LPA RNAi agent. SEAP protein levels in serum were monitored for up to 22 days. Knockdown levels and duration of response are shown in Tables 14-15. AD01529, AD01532 and AD01533 showed >85% knockdown of SEAP levels following IV administration with MLP deliver polymer, and >60% maximum knockdown of SEAP levels following SC administration of the NAG-conjugated LPA RNAi agent alone.

TABLE 14
Serum SEAP protein levels in SEAP-LPA HTV mice following SC
administration of 10 mg/kg NAG-conjugated LPA RNAi agents.
SEAP levels were normalized to day −1 and saline control.
Day −1 Day 4 Day 8 Day 15 Day 22
Treatment Ave SD Ave SD Ave SD Ave SD Ave SD
Saline 1.00 0.00 1.00 0.14 1.00 0.14 1.00 0.66 1.00 0.27
AD01529 1.00 0.00 0.45 0.07 0.36 0.03 0.60 0.08 0.90 0.37
AD01530 1.00 0.00 0.46 0.15 0.43 0.10 0.79 0.26 0.79 0.32
AD01531 1.00 0.00 0.64 0.13 0.62 0.06 0.99 0.28 1.17 0.29
AD01532 1.00 0.00 0.41 0.12 0.37 0.11 0.99 0.34 1.33 0.11
AD01533 1.00 0.00 0.40 0.03 0.22 0.08 0.37 0.15 0.63 0.13
AD01534 1.00 0.00 0.65 0.19 0.44 0.19 0.74 0.30 1.17 0.55

TABLE 15
Serum SEAP protein levels in SEAP-LPA HTV mice following
IV administration of 1 mg/kg NAG-conjugated LPA RNAi
agents + 2 mg/kg MLP delivery polymer. SEAP levels were
normalized to day −1 and saline control.
Day −1 Day 4 Day 8 Day 15 Day 22
Treatment Ave SD Ave SD Ave SD Ave SD Ave SD
Saline 1.00 0.00 1.00 0.33 1.00 0.46 1.00 0.21 1.00 0.39
F7 Control 1.00 0.00 0.61 0.05 0.71 0.45 1.25 0.44 1.05 0.49
AD01529 1.00 0.00 0.25 0.04 0.15 0.08 0.47 0.24 0.81 0.40
AD01530 1.00 0.00 0.26 0.06 0.28 0.19 0.78 0.60 1.06 0.63
AD01531 1.00 0.00 0.22 0.07 0.26 0.06 0.72 0.21 1.04 0.12
AD01532 1.00 0.00 0.18 0.05 0.06 0.03 0.13 0.08 0.29 0.18
AD01533 1.00 0.00 0.21 0.04 0.13 0.06 0.32 0.15 0.67 0.28
AD01534 1.00 0.00 0.17 0.04 0.22 0.06 0.66 0.24 0.94 0.24

Example 11. In Vivo Screening of Modified NAG-Conjugated LPA RNAi Agents and Time Course of Knockdown

The indicated NAG-conjugated LPA RNAi agents were administered to SEAP-LPA HTV mice as described above. Each mouse received a single subcutaneous (SC) dose of 10 mg/kg of the NAG-conjugated LPA RNAi agent. SEAP protein levels in serum were monitored for up to 22 days. Knockdown levels and duration of response are shown in Tables 16-17. AD01765 and AD01768 showed 89% knockdown activity.

TABLE 16
Serum SEAP protein levels in SEAP-LPA HTV mice following
SC administration of 10 mg/kg NAG-conjugated LPA RNAi
agent. SEAP levels were normalized to day −1 and saline control.
Day −1 Day 3 Day 8 Day 15 Day 22
Treatment Ave SD Ave SD Ave SD Ave SD Ave SD
Saline 1.00 0.00 1.00 0.16 1.00 0.16 1.00 0.28 1.00 0.24
AD01533 1.00 0.00 0.41 0.08 0.22 0.02 0.47 0.20 0.66 0.29
AD01772 1.00 0.00 0.46 0.13 0.18 0.00 0.34 0.09 0.61 0.14
AD01773 1.00 0.00 0.47 0.08 0.20 0.08 0.45 0.15 0.83 0.12
AD01774 1.00 0.00 0.49 0.09 0.18 0.03 0.44 0.13 0.68 0.08
AD01780 1.00 0.00 0.52 0.13 0.25 0.09 0.44 0.26 0.65 0.37

TABLE 17
Serum SEAP protein levels in SEAP-LPA HTV mice following
SC administration of 10 mg/kg NAG-conjugated LPA RNAi agent.
SEAP levels were normalized to day −1 and saline control.
Day −1 Day 3 Day 8 Day 15 Day 22
Treatment Ave SD Ave SD Ave SD Ave SD Ave SD
Saline 1.00 0.00 1.00 0.27 1.00 0.73 1.00 0.87 1.00 0.80
AD01532 1.00 0.00 0.42 0.19 0.35 0.21 0.85 0.25 1.27 0.57
AD01765 1.00 0.00 0.35 0.02 0.11 0.08 0.25 0.14 0.47 0.19
AD01766 1.00 0.00 0.52 0.10 0.36 0.09 1.05 0.13 1.15 0.08
AD01767 1.00 0.00 0.49 0.03 0.44 0.05 1.43 0.23 1.33 0.71
AD01768 1.00 0.00 0.34 0.15 0.11 0.07 0.39 0.13 0.76 0.19
AD01769 1.00 0.00 0.54 0.17 0.46 0.14 1.32 0.12 1.38 0.37
AD01770 1.00 0.00 0.41 0.07 0.20 0.10 0.80 0.52 1.04 0.67

Example 12. In Vivo Testing of NAG-Conjugated LPA RNAi Agents in Apo(a) Tg Mice

NAG-conjugated LPA RNAi agents were administered to apo(a) Tg mice as described above. Each mouse received a single subcutaneous (SC) dose of either 10 mg/kg of LPA RNAi agent or saline. Human apo(a) (apo(a)) levels in serum were monitored for up to days (Table 18). AD01765 showed the largest knockdown of apo(a) levels at day 8 with 96% knockdown, and >74% knockdown observed 3 weeks after dosing.

TABLE 18
Serum apo(a) protein levels in apo(a) Tg mice following SC
administration of 10 mg/kg NAG-conjugated LPA RNAi agent.
Apo(a) levels were normalized to day −1 and saline control.
Day −1 Day 4 Day 8 Day 15 Day 22
Treatment Ave SD Ave SD Ave SD Ave SD Ave SD
Saline 1.00 0.00 1.00 0.10 1.00 0.16 1.00 0.42 1.00 0.21
AD01532 1.00 0.00 0.12 0.05 0.22 0.08 0.76 0.30 0.56 0.28
AD01765 1.00 0.00 0.09 0.03 0.04 0.02 0.14 0.02 0.26 0.04
AD01768 1.00 0.00 0.11 0.05 0.09 0.05 0.26 0.12 0.38 0.08

Example 13. In Vivo Testing of NAG-Conjugates LPA RNAi Agents in LPA Mc HTV Mice

Indicated NAG-conjugated LPA RNAi agents were administered to LPA mc HTV mice as described above. Each mouse received a single subcutaneous (SC) dose of either 10 mg/kg of LPA RNAi agent or saline. Human apo(a) (apo(a)) levels in serum were analyzed at day 4 (Table 19). AD02001, AD01765 and AD01768 showed >90% knockdown at day 4.

TABLE 19
Serum apo(a) protein levels in LPA mc HTV mice following SC
administration of 10 mg/kg NAG-conjugated LPA RNAi agent.
Apo(a) levels were normalized to day −1 and saline control.
Prebleed Day 4
Treatment Ave SD Ave SD
saline 1.00 0.00 1.00 0.12
AD01765 1.00 0.00 0.05 0.02
AD01768 1.00 0.00 0.07 0.01
AD01804 1.00 0.00 0.68 0.16
AD02001 1.00 0.00 0.06 0.03

Example 14. Apolipoprotein (a) (Apo(a)) Knockdown in Non-Human Primates Following LPA RNAi Agent Delivery by MLP Delivery Polymer

MLP delivery polymer and LPA RNAi agent were made and combined in a pharmaceutically acceptable buffer. On day 1 and day 71, two cynomolgus macaque (Macaca fascicularis) primates were injected with either 4 mg/kg AD01196+4 mg/kg MLP delivery polymer or 6 mg/kg AD01196+6 mg/kg MLP delivery polymer. For each injection, the LPA RNAi agent+MLP delivery polymer was injected into the saphenous vein using a 22 to 25 gauge intravenous catheter. At the indicated time points (FIG. 4), blood samples were drawn and analyzed for apo(a) levels, lipid levels and toxicity markers as previously described. Significant knockdown of apo(a) was observed after the first dose with an average maximum knockdown of 96% for 4 mg/kg dose on day 15, and 96% for 6 mg/kg dose observed at day 15. Average maximum knockdown of Lp(a) after the first dose was 98.5% for 4 mg/kg dose on day 29, and 98.5% for 6 mg/kg dose on day 22. No dose-related toxicity was observed in treated animals.

Example 15. In Vivo Testing of NAG-Conjugated LPA RNAi Agents in Lp(a) Tg Mice-Dose Response

NAG-conjugated LPA RNAi agents were administered to Lp(a) Tg mice as described above. Each mouse received a single subcutaneous (SC) dose of either LPA RNAi agent at 0.5 mg/kg or 2 mg/kg dose levels or saline. Lp(a) levels in serum were monitored up to day 43 (FIG. 1, FIG. 2). All LPA RNAi agents showed dose-response with the higher doses showing greater knockdown with nadir between days 15 and 22.

Example 16. Apolipoprotein (a) (Apo(a)) Knockdown in Non-Human Primates Following Apo(a) Specific LPA RNAi Agent Molecule Delivery

LPA RNAi agent was prepared in a pharmaceutically acceptable buffer as described herein for subcutaneous (SC) injection. On days 1, 7, and 15, two cynomolgus macaque (Macaca fascicularis) primates were injected subcutaneously with 3 mg/kg of AD02713, AD02819, AD02820, or AD02821. In addition, AD02819-treated monkeys were dosed again with 3 mg/kg of AD02819 on day 57 and day 85. Blood samples were drawn and analyzed for apo(a) levels, lipid levels and toxicity markers as previously described. Significant knockdown of Lp(a) was observed with an average maximum knockdown of 89% observed at day 43 for AD02713, 87% observed on day 36 for AD02819, 79% observed on day 36 for AD02820, and 95% observed on day 29 for AD02821 (FIG. 5). No dose-related toxicity was observed in treated animals over the time of the experiment.

Example 17. Apolipoprotein (a) (Apo(a)) Knockdown in Non-Human Primates Following LPA RNAi Agent Delivery

LPA RNAi agent was prepared in a pharmaceutically acceptable buffer as described herein for subcutaneous (SC) injection. On day 1, two cynomolgus macaque (Macaca fascicularis) primates were injected subcutaneously with 3 mg/kg of AD03272, AD03462, AD03549, AD03547, AD03668, AD03460, or AD03536. In addition, AD03460 and AD03536-treated monkeys were dosed again with 1 mg/kg of the respective LPA RNAi agent on day 48. Blood samples were drawn and analyzed for apo(a) levels, lipid levels and toxicity markers as previously described. Significant knockdown of Lp(a) was observed with an average maximum knockdown of 62% for AD03272 on day 15, 28% for AD03462 on day 15, 47% for AD03549 on day 29, 44% for AD03547 on day 15, 53% for AD03668 on day 22, 79% for AD03460 on day 29, and 71% for AD03536 on day 22 (FIG. 6). No dose-related toxicity was observed in treated animals over the time of the experiment.

Example 18. Apolipoprotein (a) (Apo(a)) Knockdown in Primate Following Apo(a) Specific LPA RNAi Agent Molecule Delivery

LPA RNAi agent was made and combined in a pharmaceutically acceptable buffer as described above for subcutaneous (SQ) injection. On day 1, cynomolgus macaque (Macaca fascicularis) primates were injected with subcutaneously with saline or 2 mg/kg of AD03460, AD03536, AD03851, AD03853, or AD04110. Blood samples were drawn and analyzed for apo(a) levels, lipid levels and toxicity markers on days 8 and 15 as previously described. Lp(a) levels were normalized to average of three predose values.

TABLE 20
Lipoprotein(a) levels in cynomolgus macaque primates
following administration of either saline or 2 mg/kg
AD03460, AD03536, AD03851, AD03853 or AD04110.
Normalized Lp(a) Normalized Lp(a)
Day 8 Day 8
Saline 1.01 ± 0.06 1.15 ± 0.07
AD03460 0.68 ± 0.12 0.40 ± 0.13
AD03536 0.54 ± 0.07 0.21 ± 0.06
AD03581 0.41 ± 0.08 0.18 ± 0.08
AD03583 0.50 ± 0.23 0.27 ± 0.17
AD04110 0.59 ± 0.13 0.43 ± 0.10

Claims

1. An LPA RNA interference (RNAi) agent comprising a sense strand and an antisense strand, wherein said antisense strand comprises the nucleotide sequence of

a) nucleotides 2-19 of any of SEQ ID NOs:1-108, or

b) any of the antisense strands of Table 1 or Table 2A.

2. The LPA RNAi agent of claim 1, wherein the sense strand comprises the nucleotide sequence of

a) nucleotides 1-19 of any of SEQ ID NOs:190-268, or

b) any of the sense strands of Table 1 or Table 2B.

3. The LPA RNAi agent of claim 1, wherein the antisense strand comprises the nucleotide sequence of any of SEQ ID NO:1246, SEQ ID NO:1242, SEQ ID NO:1244, SEQ ID NO:1248, SEQ ID NO:1250, SEQ ID NO:1252, or SEQ ID NO:1254, SEQ ID NO:1280, SEQ ID NO:1281, SEQ ID NO:1282, OR SEQ ID NO:1283.

4. The LPA RNAi agent of claim 3, wherein:

a) the antisense strand comprises the nucleotide sequence of SEQ ID NO:1246 and the sense strand comprises the nucleotide sequence of SEQ ID NO:1247;

b) the antisense strand comprises the nucleotide sequence of SEQ ID NO:1242 and the sense strand comprises the nucleotide sequence of SEQ ID NO:1243;

c) the antisense strand comprises the nucleotide sequence of SEQ ID NO:1244 and the sense strand comprises the nucleotide sequence of SEQ ID NO:1245;

d) the antisense strand comprises the nucleotide sequence of SEQ ID NO:1248 and the sense strand comprises the nucleotide sequence of SEQ ID NO:1249;

e) the antisense strand comprises the nucleotide sequence of SEQ ID NO:1250 and the sense strand comprises the nucleotide sequence of SEQ ID NO:1251;

f) the antisense strand comprises the nucleotide sequence of SEQ ID NO:1252 and the sense strand comprises the nucleotide sequence of SEQ ID NO:1253; or

g) the antisense strand comprises the nucleotide sequence of SEQ ID NO:1254 and the sense strand comprises the nucleotide sequence of SEQ ID NO:1255; or

h) the antisense strand comprises the nucleotide sequence of SEQ ID NO:1280 and the sense strand comprises the nucleotide sequence of SEQ ID NO:1260; OR

i) the antisense strand comprises the nucleotide sequence of SEQ ID NO:1281 and the sense strand comprises the nucleotide sequence of SEQ ID NO:1258; or

j) the antisense strand comprises the nucleotide sequence of SEQ ID NO:1280 and the sense strand comprises the nucleotide sequence of SEQ ID NO:1284; or

k) the antisense strand comprises the nucleotide sequence of SEQ ID NO:1281 and the sense strand comprises the nucleotide sequence of SEQ ID NO:1285; or

l) the antisense strand comprises the nucleotide sequence of SEQ ID NO:1282 and the sense strand comprises the nucleotide sequence of SEQ ID NO:1259; or

m) the antisense strand comprises the nucleotide sequence of SEQ ID NO:1283 and the sense strand comprises the nucleotide sequence of SEQ ID NO:1249.

5. The LPA RNAi agent of claim 1, wherein the sense strand and/or the antisense strand further comprises a 3′ and/or 5′ extension of 1-6 nucleotides in length.

6. The LPA RNAi agent of claim 1 wherein the antisense strand comprises a nucleotide sequence of any of SEQ ID NO:156, SEQ ID NO:164, or SEQ ID NO:188.

7. The LPA RNAi agent of claim 6, wherein:

a) the antisense strand comprises a nucleotide sequence of SEQ ID NO:156. and the sense strand comprises a nucleotide sequence of SEQ ID NO:310,

b) the antisense strand comprises a nucleotide sequence of SEQ ID NO:164. and the sense strand comprises a nucleotide sequence of SEQ ID NO:357,

c) the antisense strand comprises a nucleotide sequence of SEQ ID NO:188 and the sense strand comprises a nucleotide sequence of SEQ ID NO:384,

d) the antisense strand comprises a nucleotide sequence of SEQ ID NO:164 and the sense strand comprises a nucleotide sequence of SEQ ID NO:376, or

e) the antisense strand comprises a nucleotide sequence of SEQ ID NO:164 and the sense strand comprises a nucleotide sequence of SEQ ID NO:384.

8. The LPA RNAi agent of claim 1, wherein the sense strand and/or antisense strand independently comprises one or more modified nucleotides.

9. The LPA RNAi agent of claim 8, wherein the one or more modified nucleotides are independently selected from the group consisting of: 2′-O-methyl modified nucleotide, nucleotide comprising a 5′-phosphorothioate group, 2′-deoxy-2′-fluoro modified nucleotide, 2′-deoxy-modified nucleotide, locked nucleotide, abasic nucleotide, deoxythymidine, inverted deoxythymidine, 2′-amino-modified nucleotide, 2′-alkyl-modified nucleotide, morpholino nucleotide, and non-natural base comprising nucleotide.

10. The LPA RNAi agent of claim 1, wherein the LPA RNAi agent comprises one or more phosphorothioate internucleoside linkages.

11. The LPA RNAi agent of claim 1, wherein the LPA RNAi agent further comprises a targeting group.

12. The LPA RNAi agent of claim 11, wherein the targeting group comprises an asialoglycoprotein receptor ligand.

13. The LPA RNAi agent of claim 12, wherein the asialoglycoprotein receptor ligand comprises a galactose cluster.

14. The LPA RNAi agent of claim 13, wherein the galactose cluster is selected from the group consisting of: (C11-PEG5-NAG5), (C11-PEG5-NAG5), (C6-PEG4-NAG3), (NAG 3), (NAG4), (NAG3-AA2), (NAG5-Palm), (NAG13), (NAG18), (NAG24), (NAG25), (NAG25)s, (NAG26), (NAG27), (NAG28), (NAG29), (NAG30), (NAG30)s, (NAG31), (NAG13), (NAG31s), (NAG32), (NAG33), (NAG34), (NAG35), (NAG36), and (NAG37).

15. The LPA RNAi agent of claim 11, wherein the targeting group is conjugated to the sense strand.

16. The LPA RNAi agent of claim 15, wherein the targeting group is conjugated to the 5′ end of the sense strand.

17. The LPA RNAi agent of claim 15, wherein the targeting group is conjugated to the 3′ end of the sense strand.

18. The LPA RNAi agent of claim 1, wherein the LPA RNAi agent further comprises a linking group.

19. The LPA RNAi agent of claim 1, wherein the LPA RNAi agent comprises one or two overhangs.

20. The LPA RNAi agent of claim 1, wherein the LPA RNAi agent comprises one or two frayed ends.

21. The LPA RNAi agent of claim 1, wherein the LPA RNAi agent comprises one or two blunt ends.

22. The LPA RNAi agent of claim 1, wherein the LPA RNAi agent comprises any of the duplex sequences in Table 3A or Table 3B.

23. The LPA RNAi agent of claim 22, wherein the LPA RNAi agent comprises AD03460, AD03536, AD03581, AD03583, AD3847, or AD04110,

24. Use of the LPA RNAi agent of claim 1, for the manufacture of a medicament.

25. The LPA RNAi agent of claim 1, further comprising one or more additional therapeutics or treatments.

26. The LPA RNAi agent claim 1, further comprising a pharmaceutically acceptable excipient.

27. The LPA RNAi agent of claim 1, wherein said LPA RNAi agent is packaged in a kit, container, pack, dispenser, pre-filled syringes, or vials.

28. A method for inhibiting LPA expression in a cell, tissue, or subject comprising:

administering to said subject a therapeutically effective amount of an LPA RNAi agent of claim 1.

29. The method of claim 28, wherein the composition is administered parenterally.

30. The method of claim 28, wherein the cell is a hepatocyte.

31. An LPA RNA interference (RNAi) agent comprising a sense sequence and an antisense sequence, wherein said antisense sequence comprises a nucleotide sequence of nucleotides 1-17, 2-18, 1-19, 2-19, 1-21, 1-23, or 1-26 of any of the antisense sequences of Table 1 or Table 2A.

Resources

Images & Drawings included:

Sources:

Similar patent applications:

Recent applications in this class: