US20220204969A1
2022-06-30
17/494,047
2021-10-05
This invention relates to metabolically engineered microorganisms, such as bacterial and or fungal strains, and bioprocesses utilizing such strains. These strains enable the dynamic control of metabolic pathways, which can be used to optimize production. Dynamic control over metabolism is accomplished via a combination of methodologies including but not limited to transcriptional silencing and controlled enzyme proteolysis. These microbial strains are utilized in a multi-stage bioprocess encompassing at least two stages, the first stage in which organisms are grown and metabolism can be optimized for microbial growth and at least one other stage in which growth can be slowed or stopped, and dynamic changes can be made to metabolism to improve the production of desired product, such as a chemical or fuel.
Get notified when new applications in this technology area are published.
C12N15/111 » CPC main
Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor; Recombinant DNA-technology; DNA or RNA fragments; Modified forms thereof General methods applicable to biologically active non-coding nucleic acids
C12N2320/50 » CPC further
Applications; Uses Methods for regulating/modulating their activity
C12N2310/14 » CPC further
Structure or type of the nucleic acid; Type of nucleic acid interfering N.A.
C12N15/1137 » CPC further
Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor; Recombinant DNA-technology; DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides against enzymes
C12N15/11 IPC
Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor; Recombinant DNA-technology DNA or RNA fragments; Modified forms thereof
C12N15/63 » CPC further
Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor; Recombinant DNA-technology Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
C12N15/113 IPC
Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor; Recombinant DNA-technology; DNA or RNA fragments; Modified forms thereof Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides
C12N15/70 » CPC further
Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor; Recombinant DNA-technology; Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression Vectors or expression systems specially adapted for E. coli
This application is a continuation of U.S. application Ser. No. 16/849,441, filed Apr. 15, 2020, which is a continuation of U.S. application Ser. No. 15/317,768 which is a § 371 U.S. National Stage of International Application PCT/US2015/035306, filed Jun. 11, 2015, which claims the benefit of U.S. Provisional Application No. 62/010,574, filed Jun. 11, 2014, the entire content of which are incorporated by reference herein in their entirety.
This invention was made with government support under Federal Grant No. MCB-1445726 awarded by the National Science Foundation and Federal Contract No. HR0011-14-C-0075 awarded by the Defense Advanced Research Projects Agency of the United States Department of Defense. The government has certain rights in the invention.
This application contains a sequence listing. It has been submitted electronically via EFS-Web as an ASCII text file entitled “OLG Ref 210-44_ST25.txt”. The sequence listing is 184,352 bytes in size, and was created on Jun. 11, 2015. It is hereby incorporated by reference in its entirety.
This invention relates to metabolically engineered microorganisms, such as bacterial and or fungal strains, and bioprocesses utilizing such strains. These strains enable the dynamic control of metabolic pathways.
Petroleum is the primary feedstock, not only for the fuels we use, but the majority of the chemicals we consume as well. The chemical industry is heavily reliant on this non-renewable resource. Replacement of petroleum with renewable feedstocks ensures longer-term viability and environmental sustainability. Novel fermentation based processes to make chemicals have been a contributing technology, enabling the change to renewable feedstocks (Werpy &Peterson, Top Value Added Chemicals from Biomass. Volume I—Results of Screening for Potential Candidates from Sugars and Synthesis Gas., Yixiang et al. “Green” Chemicals from Renewable Agricultural Biomass—A Mini Review. The Open Agriculture Journal, 2008). These fermentation processes have made rapid advancements in recent years due to technology developments in the fields of fermentation science, synthetic biology, as well as metabolic and enzyme engineering (Jarboe, L. R., et al., Metabolic engineering for production of biorenewable fuels and chemicals: contributions of synthetic biology. J Biomed Biotechnol, 2010, Lee, J. W., et al., Systems metabolic engineering of microorganisms for natural and non-natural chemicals. Nat Chem Biol, 2012). Despite these substantial advances, most successful examples of rationale directed engineering approaches have also greatly relied on numerous cycles of trial and error. The field of metabolic engineering has historically been limited in predicting the behavior of complex biological systems in-vivo, from simplified models and basic in-vitro biochemical principles. Such rational approaches have required significant a priori knowledge of microbial physiology that in many cases is incomplete. This is particularly true for complex phenotypes that require an intricate balance between the activities of many seemingly unrelated gene products. In many cases it has proven much more difficult than expected to integrate a possibly well characterized production pathway into a living host and balance the complex requirements of both biomass growth and production.
One solution is the development of platform microbial strains that utilize synthetic metabolic valves (SMVs) that can decouple growth from product formation. These strains enable the dynamic control of metabolic pathways, including those that when altered have negative effects on microorganism growth. Dynamic control over metabolism is accomplished via a combination of methodologies including but not limited to transcriptional silencing and controlled enzyme proteolysis. These microbial strains are utilized in a multi-stage bioprocess encompassing as least two stages, the first stage in which microorganisms are grown and metabolism can be optimized for microbial growth and at least one other stage in which growth can be slowed or stopped, and dynamic changes can be made to metabolism to improve production of desired product, such as a chemical or fuel. The transition of growing cultures between stages and the manipulation of metabolic fluxes can be controlled by artificial chemical inducers or preferably by controlling the level of key limiting nutrients. In addition, genetic modifications may be made to provide metabolic pathways for the biosynthesis of one or more chemical or fuel products. Also, genetic modifications may be made to enable the utilization of a variety of carbon feedstocks including but not limited sugars such as glucose, sucrose, xylose, arabinose, mannose, and lactose, oils, carbon dioxide, carbon monoxide, methane, methanol and formaldehyde.
This approach allows for simpler models of metabolic fluxes and physiological demands during a production phase, turning a growing cell into a stationary phase biocatalyst. These synthetic metabolic valves can be used to turn off essential genes and redirect carbon, electrons and energy flux to product formation in a multi-stage fermentation process. One or more of the following enables these synthetic valves: 1) transcriptional gene silencing or repression technologies in combination with 2) inducible enzyme degradation and 3) nutrient limitation to induce a stationary or non-dividing cellular state. SMVs are generalizable to any pathway and microbial host. These synthetic metabolic valves allow for novel rapid metabolic engineering strategies useful for the production of renewable chemicals and fuels and any product that can be produced via whole cell catalysis.
A simplified two-stage bioprocess using synthetic metabolic valves is depicted in FIG. 1, strains are grown in a minimal media with a single limiting nutrient such as inorganic phosphate. During this growth phase cells are not producing any product other than biomass and as a result are not subject to any possible toxic or unwanted side effects of product formation. Biomass growth and yield can be optimized. As the limiting nutrient is depleted, cell growth is stopped. Simultaneously, these strains will be engineered to contain synthetic metabolic valves, which silence genes and enzymes essential for growth and redirect carbon, electrons and energy to any molecule of interest. This process utilizes a novel combination of a two-stage production and concurrent metabolic engineering strategy.
There is significant precedent in the biotechnology industry for using and scaling two stage processes similar to that described in FIG. 1. Many similar processes are routinely used for the heterologous expression of proteins. In these standard processes cells are grown to a productive or “primed” state for protein synthesis (such as mid-exponential phase in E. coli) and then induced to express a heterologous protein. In many cases, the diversion of cellular amino acids and energy to the heterologous protein has a significant effect on, if not halting, cellular growth. It is not surprising that these types of processes have not been developed for the biological production of small molecules as historically most successful efforts to metabolically engineer the production of small molecules have leveraged the power of anaerobic metabolism to couple product formation with growth.
Anaerobic growth-coupled product formation enables the use of powerful growth based selections to identify better producers. The faster the cells grow the more product they make. This has allowed for the classical selection of industrial strains for many natural products such as ethanol and isobutanol. However, the requirement for anaerobic production greatly limits the number and variety of different molecules or products that can be made using synthetic biology. Numerous products would require aerobic metabolism to supply the needed energy and cofactors to allow for a thermodynamically feasible metabolic pathway. In these cases a generic and robust aerobic production platform would greatly simplify the optimization and scale up of a diverse number of products. A controlled multi-stage process, enabled by synthetic metabolic valves, supplies such a platform.
Synthetic metabolic valves enable synthetic biologists and metabolic engineers the ability to decouple the complex metabolic and thermodynamic needs of growth from those of product formation. This decoupling also enables the removal of growth based regulatory mechanisms that may inhibit product formation and allows for the silencing of essential metabolic pathways that may detract from or interfere with production. These essential interfering metabolic pathways could include amino acid biosynthesis or the citric acid cycle as well as the biosynthesis of many secondary metabolites, and those pathways involved in maintaining intracellular redox and energy balances. These pathways have traditionally been off limits to many metabolic engineering strategies, as attempts at manipulation have led to growth defects.
According to one embodiment, the invention is directed to methods to construct controllable synthetic metabolic valves. In certain of these embodiments synthetic metabolic valves are used to controllably reduce or eliminate flux through one more metabolic pathways. In further embodiments, flux is reduced or eliminated through one or more metabolic pathways whose enzymes are essential for microbial growth in a given environment. In other embodiments, the invention is related to genetically modified microorganisms that utilize one or more synthetic metabolic valves thereby enabling dynamic control over metabolic pathways. Other embodiments of the invention are directed to multi-stage bioprocesses that utilize genetically modified microorganism that in turn utilize one or more synthetic metabolic valves that enable dynamic flux control. Still in other embodiments of the invention, the transitions between stages in multistage bioprocesses using genetically modified microorganisms are controlled by the addition of chemical inducers or by the control of key nutrient levels. Additional genetic modifications may be added to a microorganism to enable the conversion of carbon feedstocks to chemical or fuel products. In certain embodiments, carbon feedstocks can include, but are not limited to the sugars: glucose, sucrose xylose, arabinose, mannose, lactose, or alternatively carbon dioxide, carbon monoxide, methane, methanol, formaldehyde, or oils. In addition, genetic modifications to produce chemical or fuel products from various carbon feedstocks can include metabolic pathways utilizing, but not limited to, the central metabolites acetyl-CoA, malonyl-CoA, pyruvate, oxaloacetate, erthyrose-4-phosphate, xylulose-5-phosphate, alpha-ketoglutarate and citrate. Products that can be derived from these central metabolites include but are not limited to acetate, alcohols (ethanol, butanol, hexanol, and longer n-alcohols), organic acids (3-hydroxyprpionic acid, lactic acid, itaconic acid), amino acids (alanine, serine, valine), fatty acids and their derivatives (fatty acid methyl esters (FAMEs), fatty aldehydes, alkenes, alkanes) and isoprenoids.
In various embodiments, the increased production of acetate from acetyl-phosphate may occur via the increased expression of an acetate kinase. A non-limiting example is the acetate kinase from E. coli encoded by the ackA gene. Increased expression of an acetate kinase may optionally be combined with genetic modifications that result decreased activity phosphoacetyltransferase such as that encoded by the pta gene of E. coli.
In various embodiments, the increased production of ethanol from acetyl-CoA may occur via the increased expression of an oxygen tolerant ethanol dehydrogenase, such as the enzyme from E. coli encoded by the adhE gene with a mutation Glu568Lys as taught by Dellomonaco et al, AEM. August 2010, Vol. 76, No. 15, p 5067. and Holland-Staley et al. JBACs. November 2000, Vol. 182, No. 21, p 6049.
In various embodiments, the increased production of butyrate from acetyl-CoA may occur via the increased expression of butyrate pathway enzymes including an acetoacetyl-CoA thiolase, crotonase, crotonyl-CoA reductase, butyrate phospho-transferase and butyrate kinase as taught by Fischer et al, Appl Microbiol Biotechnol. 2010, September, Vol. 88, No. 1, p. 265-275. Alternatively, increased butyrate may be accomplished via the increased expression of butyrate pathway enzymes including an acetoacetyl-CoA synthase, crotonase, crotonyl-CoA reductase and butyryl-CoA thioesterase as taught by PCT/US2012/030209.
In various embodiments, the increased production of n-butanol from acetyl-CoA may occur via the increased expression of n-butanol pathway enzymes including an acetoacetyl-CoA thiolase, crotonase, crotonyl-CoA reductase, butyryl-CoA reductase and butyraldehyde reductase as taught by Atsumi et al, Metabolic Engineering. 2008. November, Vol. 10, No. 6, p. 305).
In various embodiments, the increased production of fatty acids of chain length greater than 4, from acetyl-CoA may occur via the increased expression of a fatty acid synthesis pathway enzymes including an ketoacetyl-CoA synthase, 3-hydroxyacyl-CoA dehydratase, an enoyl-CoA reductase, and a acyl-CoA thioesterase as taught by PCT/US2012/030209.
In various embodiments, the increased production of fatty acid methyl esters from acetyl-CoA may occur via the increased expression of fatty acid methyl ester synthesis pathway enzymes including an ketoacetyl-CoA synthase, 3-hydroxyacyl-CoA dehydratase, an enoyl-CoA reductase, and a acyl-CoA wax ester synthase as taught by: PCT/US2012/030209 and US 20110146142 A1.
In various embodiments, the increased production of n-hexanol from acetyl-CoA may occur via the increased expression of a fatty acid synthesis pathway enzymes including an ketoacetyl-CoA thiolases, 3-hydroxyacyl-CoA dehydratase, an enoyl-CoA reductase, and a acyl-CoA thioesterase as taught by Dekishima et al. J Am Chem Soc. 2011. August. Vol. 133, No. 30, p. 1139.
In various embodiments, the increased production of n-alcohols of chain length greater than 4, from acetyl-CoA may occur via the increased expression of a fatty acid synthesis pathway enzymes including an ketoacetyl-CoA synthase, 3-hydroxyacyl-CoA dehydratase, an enoyl-CoA reductase, as taught by PCT/US2012/030209 and a fatty acyl-CoA reductase and fatty aldehyde reductase as taught by Yan-Ning Zheng et al. Microbial Cell Factories. 2012. Vol. 11:65.
In various embodiments, the increased production of n-alkenes can be accomplished by first producing n-alcohols as described elsewhere followed by the chemical dehydration of the n-alcohol to an n-alkene by catalytic methods well known in the art.
In various embodiments, the increased production of n-alkanes can be accomplished by first producing fatty acids as described elsewhere followed by the chemical decarboxylation of the n-alcohol to an alkane by catalytic methods well known in the art.
In various embodiments, the increased production of isoprene from acetyl-CoA may occur via the increased expression of pathway enzymes including an acetoacetyl-CoA thiolase, hydroxymethylglutaryl-CoA synthase, hydroxymethylglutaryl-CoA reductase, mevalonate kinase, phosphomevalonate kinase, mevalonte diphosphate decarboxylase, isopentenyl-diphosphate isomerase and isoprene synthase as taught by US 20120276603 A1.
In various embodiments, the increased production of a product from acetyl-CoA may occur via both the increased expression of an acetyl-CoA carboxylase enzyme which can convert acetyl-CoA into malonyl-CoA and the increased expression of a production pathway comprising multiple pathway enzymes which can convert malonyl-CoA further to a product.
In various embodiments, the increased production of a product from malonyl-CoA may occur via both the increased activity of an acetyl-CoA carboxylase enzyme which can caused by mutation of one or more fatty acid synthesis enzymes such as is taught by PCT/US2012/030209, PCT/US2011/0222790 and 3. UK Patent GB2473755 and the increased expression of a production pathway comprising multiple pathway enzymes which can convert malonyl-CoA further to a product.
Within the scope of the invention are genetically modified microorganism, wherein the microorganism is capable of producing an acetyl-CoA derived product at a specific rate selected from the rates of greater than 0.05 g/gDCW-hr, 0.08 g/gDCW-hr, greater than 0.1 g/gDCW-hr, greater than 0.13 g/gDCW-hr, greater than 0.15 g/gDCW-hr, greater than 0.175 g/gDCW-hr, greater than 0.2 g/gDCW-hr, greater than 0.25 g/gDCW-hr, greater than 0.3 g/gDCW-hr, greater than 0.35 g/gDCW-hr, greater than 0.4 g/gDCW-hr, greater than 0.45 g/gDCW-hr, or greater than 0.5 g/gDCW-hr.
Within the scope of the invention are genetically modified microorganism, wherein the microorganism is capable of producing a product derived from any key metabolic intermediate including but not limited to malonyl-CoA, pyruvate, oxaloacetate, erthyrose-4-phosphate, xylulose-5-phosphate, alpha-ketoglutarate and citrate at a specific rate selected from the rates of greater than 0.05 g/gDCW-hr, 0.08 g/gDCW-hr, greater than 0.1 g/gDCW-hr, greater than 0.13 g/gDCW-hr, greater than 0.15 g/gDCW-hr, greater than 0.175 g/gDCW-hr, greater than 0.2 g/gDCW-hr, greater than 0.25 g/gDCW-hr, greater than 0.3 g/gDCW-hr, greater than 0.35 g/gDCW-hr, greater than 0.4 g/gDCW-hr, greater than 0.45 g/gDCW-hr, or greater than 0.5 g/gDCW-hr.
In various embodiments, the invention includes a culture system comprising a carbon source in an aqueous medium and a genetically modified microorganism according to any one of claims herein, wherein said genetically modified organism is present in an amount selected from greater than 0.05 gDCW/L, 0.1 gDCW/L, greater than 1 gDCW/L, greater than 5 gDCW/L, greater than 10 gDCW/L, greater than 15 gDCW/L or greater than 20 gDCW/L, such as when the volume of the aqueous medium is selected from greater than 5 mL, greater than 100 mL, greater than 0.5 L, greater than 1 L, greater than 2 L, greater than 10 L, greater than 250 L, greater than 1000 L, greater than 10,000 L, greater than 50,000 L, greater than 100,000 L or greater than 200,000 L, and such as when the volume of the aqueous medium is greater than 250 L and contained within a steel vessel.
All publications, patents, and patent applications mentioned in this specification are herein incorporated by reference to the same extent as if each individual publication, patent, or patent application was specifically and individually indicated to be incorporated by reference.
The novel features of the invention are set forth with particularity in the claims. A better understanding of the features and advantages of the present invention will be obtained by reference to the following detailed description that sets forth illustrative embodiments, in which the principles of the invention are utilized, and the accompanying drawings of which:
FIG. 1 depicts an overview of a two-phase fermentation processes utilizing a microbe with synthetic metabolic valves. Top Panel: Overview of the fermentation process. Biomass is grown in minimal media with a single limiting macronutrient, such as inorganic phosphate. As the biomass level (black line) or number of cells increases the limiting nutrient (red line) is depleted. When the limiting nutrient is completely consumed, biomass growth is halted. Simultaneously the limitation induces metabolic changes to initiate product biosynthesis through engineered synthetic valves. Lower Panel: Metabolic Changes in the Two Phase Process. In correlation with the system level changes, metabolic changes are induced upon depletion of the limiting nutrient. Specifically, genes encoding metabolic pathways essential for cellular growth “growth genes” are active in the growth phase while genes encoding product biosynthesis “product genes” are silenced. Upon entry into the production phase triggered by nutrient depletion, “growth genes” are silenced and “product genes” are activated.
FIG. 2 depicts an overview of a synthetic metabolic valve in E. coli using a combination of CRISPR interference gene silencing and controlled protein degradation. Upper Panel: (LEFT) Constructs are made to express small guide RNAs to target a gene of interest in addition to (RIGHT) the controlled induction of a cascade protein complex such as catalytically inactive Cas9 or dCas9 as well as the controlled induction of the chaperone (clpXP enhancing factor) sspB. Expression can be controlled such as by the controlled ptet promoter induced by aTc. The constructs produce dCas9 and sspB proteins in addition to a targeting sgRNA. Bottom Panel: (LEFT) The target gene/protein contains a C-terminal DAS4 tag for binding to sspB. (RIGHT) When expression is induced, dCas9 is targeted to the gene of interest by the targeting sgRNA thereby silencing transcription. Concurrently, the expression of sspB results in the binding of sspB to the DAS4 C-terminal tag of protein that has already been translated. The sspB/DAS4 complex is then targeted for degradation by the clpXP protease.
FIG. 3 depicts the production of tetrahydroxynapthalene (THN) by redirecting flux from malonyl-CoA. Upper Panel: An overview of redirecting flux from growth to product by controlling fabI (enoyl-coA reductase levels) in E. coli. In E. coli, the primary fate of the intermediate malonyl-CoA is to provide precursors for fatty acid synthesis. The key enzyme controlling the rate of lipid synthesis, acetyl-CoA carboxylase, encoded by the accABCD genes, is strongly inhibited by the fatty acid production intermediates, fatty acyl-ACPs. Removal of fab1 leads to a decrease in acyl-ACP pools and a reduction in inhibition of acetyl-CoA carboxylase allowing malonyl-CoA levels to accumulate and be used for product synthesis. The removal of fab1 limits lipid production and halts growth. Lowe Panel: One potential product from malonyl-CoA is tetrahydroxynapthalene (THN). THN is produced from 5 molecules of malonyl-CoA via the polyketide synthase, THN synthase encoded by the rppA gene of S. coelicolor.
FIG. 4 depicts increased production of tetrahydroxynapthalene from malonyl-CoA in a two stage process as a result of the controlled inactivation of a temperature sensitive fabI allele. Improved production of THN by redirecting malonyl-CoA flux, using a temperature controlled process to inactivate a temperature sensitive allele of fabI. Strains as listed BWalpdf (BW25113: ΔldhA, ΔpflB, ΔpoxB, ΔackA-pta, ΔadhE), BWalpdf-fab1(ts) (BW25113: ΔldhA, ΔpflB, ΔpoxB, ΔackA-pta, ΔadhE, fab1(F241S), gentR). Plasmids are i) pSMART-HC-Kan-yibD-THNS and ii) pSMART-HC-Kan (control).
FIG. 5 depicts increased production of tetrahydroxynapthalene from malonyl-CoA in a two stage process as a result of a combination of controlled protein degradation and gene silencing. Improved production of THN by redirecting malonyl-CoA flux, using a synthetic metabolic vlae comprising a combination of CRISPR interference gene silencing and controlled proteolysis as outlined in FIG. 2. THN production at 4 hrs and 20 hrs is compared for two strains. LEFT: Strain BW25113: ΔldhA, ΔpflB, ΔpoxB, ΔackA-pta, ΔadhE, ΔsspB, fabI::DAS4, gentR containing plasmids i) pSMART-HC-Kan-yibD-THNS ii) pdCas9-ptet-sspB and iii) pCDF-control lacking a targeting sgRNA. RIGHT: Strain BW25113: ΔldhA, ΔpflB, ΔpoxB, ΔackA-pta, ΔadhE, ΔsspB, fabI::DAS4, gentR containing plasmids i) pSMART-HC-Kan-yibD-THNS ii) pdCas9-ptet-sspB and iii) pCDF-T2-fabIsgRNA expressing a sgRNA targeting fabI.
FIG. 6 depicts the low phosphate induction of a GFP reporter with various low phosphate inducible promoters. A comparison of the low phosphate inducible expression for the following gene promoters: amn, phoA, phoB, phoE, phoH, phoU, mipA, pstS, ugpB, waaH and ydfH, is shown. An ultraviolet excitable, green fluorescent protein (GFPuv) reporter gene was used and relative fluorescent units (RFU) are plotted as a function of time. Growth stops and phosphate depletion begins at about 15-20 hrs.
FIG. 7 depicts the dynamic control over protein levels in E. coli using the CASCADE System and controlled proteolysis. Strain DLF_0025 (enabling low phosphate DAS+4 degradation) has been modified to constitutively express a mCherry protein with a C-terminal DAS+4 degradation tag. In addition the strain has been modified for the low phosphate induction of GFPuv as well as a guide RNA repressing mCherry expression. As cells grow phosphate is depleted, and cells “turn off” mCherry and “turn on” GFPuv. Biomass is plotted as grams cell dry weight per liter, GFPuv and mCherry are plotted as relative fluorescence units (RFU) which are normalized to biomass levels.
FIG. 8 depicts the production of 3-HP from malonyl-CoA and NADPH at mL scale. Average Maximal 3-HP titers are plotted for several production strains.
FIG. 9 depicts the production of 3-HP from malonyl-CoA and NADPH at L scale. Biomass and 3-HP titers are plotted as a function of time.
FIG. 10 depicts the production of alanine from pyruvate and NADPH at mL scale. Biomass and alanine titers are plotted as a function of time.
FIG. 11 depicts the production of alanine from pyruvate and NADPH at the L scale. Biomass and alanine titers are plotted as a function of time.
FIG. 12 depicts the production of 2,3-butanediol from pyruvate and NADH at mL scale. Biomass and 2,3-butanediol titers are plotted as a function of time.
FIG. 13 depicts the production of 2,3-butanediol from pyruvate and NADH at L scale. Biomass and 2,3-butanediol titers are plotted as a function of time.
FIG. 14 depicts the production of 2,3-butanediol from pyruvate and NADPH at mL scale. Biomass and 2,3-butanediol titers are plotted as a function of time.
FIG. 15 depicts the production of mevalonic acid from acetyl-CoA and NADPH at L scale. Biomass and mevalonic acid titers are plotted as a function of time.
The present invention is related to various production methods and/or genetically modified microorganisms that have utility for fermentative production of various chemical products, to methods of making such chemical products that utilize populations of these microorganisms in vessels, and to systems for chemical production that employ these microorganisms and methods. Among the benefits of the present invention is the increased ability to reduce or eliminate metabolic pathways required for microbial growth that may interfere with production.
As used in the specification and the claims, the singular forms “a,” “an,” and “the” include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to an “expression vector” includes a single expression vector as well as a plurality of expression vectors, either the same (e.g., the same operon) or different; reference to “microorganism” includes a single microorganism as well as a plurality of microorganisms; and the like.
As used herein, “reduced enzymatic activity,” “reducing enzymatic activity,” and the like is meant to indicate that a microorganism cell's, or an isolated enzyme, exhibits a lower level of activity than that measured in a comparable cell of the same species or its native enzyme. That is, enzymatic conversion of the indicated substrate(s) to indicated product(s) under known standard conditions for that enzyme is at least 10, at least 20, at least 30, at least 40, at least 50, at least 60, at least 70, at least 80, or at least 90 percent less than the enzymatic activity for the same biochemical conversion by a native (non-modified) enzyme under a standard specified condition. This term also can include elimination of that enzymatic activity. A cell having reduced enzymatic activity of an enzyme can be identified using any method known in the art. For example, enzyme activity assays can be used to identify cells having reduced enzyme activity. See, for example, Enzyme Nomenclature, Academic Press, Inc., New York 2007.
The term “heterologous DNA,” “heterologous nucleic acid sequence,” and the like as used herein refers to a nucleic acid sequence wherein at least one of the following is true: (a) the sequence of nucleic acids foreign to (i.e., not naturally found in) a given host microorganism; (b) the sequence may be naturally found in a given host microorganism, but in an unnatural (e.g., greater than expected) amount; or (c) the sequence of nucleic acids comprises two or more subsequences that are not found in the same relationship to each other in nature. For example, regarding instance (c), a heterologous nucleic acid sequence that is recombinantly produced will have two or more sequences from unrelated genes arranged to make a new functional nucleic acid, such as an nonnative promoter driving gene expression.
The term “synthetic metabolic valve,” and the like as used herein refers to either the use of controlled proteolysis, gene silencing or the combination of both proteolysis and gene silencing to alter metabolic fluxes.
The term “heterologous” is intended to include the term “exogenous” as the latter term is generally used in the art. With reference to the host microorganism's genome prior to the introduction of a heterologous nucleic acid sequence, the nucleic acid sequence that codes for the enzyme is heterologous (whether or not the heterologous nucleic acid sequence is introduced into that genome).
As used herein, the term “gene disruption,” or grammatical equivalents thereof (and including “to disrupt enzymatic function,” “disruption of enzymatic function,” and the like), is intended to mean a genetic modification to a microorganism that renders the encoded gene product as having a reduced polypeptide activity compared with polypeptide activity in or from a microorganism cell not so modified. The genetic modification can be, for example, deletion of the entire gene, deletion or other modification of a regulatory sequence required for transcription or translation, deletion of a portion of the gene which results in a truncated gene product (e.g., enzyme) or by any of various mutation strategies that reduces activity (including to no detectable activity level) the encoded gene product. A disruption may broadly include a deletion of all or part of the nucleic acid sequence encoding the enzyme, and also includes, but is not limited to other types of genetic modifications, e.g., introduction of stop codons, frame shift mutations, introduction or removal of portions of the gene, and introduction of a degradation signal, those genetic modifications affecting mRNA transcription levels and/or stability, and altering the promoter or repressor upstream of the gene encoding the enzyme.
Bio-production or Fermentation, as used herein, may be aerobic, microaerobic, or anaerobic.
When the genetic modification of a gene product, i.e., an enzyme, is referred to herein, including the claims, it is understood that the genetic modification is of a nucleic acid sequence, such as or including the gene, that normally encodes the stated gene product, i.e., the enzyme.
As used herein, the term “metabolic flux” and the like refers to changes in metabolism that lead to changes in product and/or byproduct formation, including production rates, production titers and production yields from a given substrate.
Species and other phylogenic identifications are according to the classification known to a person skilled in the art of microbiology.
Enzymes are listed here within, with reference to a Universal Protein Resource (Uniprot) identification number, which would be well known to one skilled in the art (Uniprot is maintained by and available through the UniProt Consortium).
Where methods and steps described herein indicate certain events occurring in certain order, those of ordinary skill in the art will recognize that the ordering of certain steps may be modified and that such modifications are in accordance with the variations of the invention. Additionally, certain steps may be performed concurrently in a parallel process when possible, as well as performed sequentially.
Prophetic examples provided herein are meant to be broadly exemplary and not limiting in any way.
The meaning of abbreviations is as follows: “C” means Celsius or degrees Celsius, as is clear from its usage, DCW means dry cell weight, “s” means second(s), “min” means minute(s), “h,” “hr,” or “hrs” means hour(s), “psi” means pounds per square inch, “nm” means nanometers, “d” means day(s), “μL” or “uL” or “ul” means microliter(s), “mL” means milliliter(s), “L” means liter(s), “mm” means millimeter(s), “nm” means nanometers, “mM” means millimolar, “μM” or “uM” means micromolar, “M” means molar, “mmol” means millimole(s), “p mol” or “uMol” means micromole(s)”, “g” means gram(s), “μg” or “ug” means microgram(s) and “ng” means nanogram(s), “PCR” means polymerase chain reaction, “OD” means optical density, “OD600” means the optical density measured at a photon wavelength of 600 nm, “kDa” means kilodaltons, “g” means the gravitation constant, “bp” means base pair(s), “kbp” means kilobase pair(s), “% w/v” means weight/volume percent, “% v/v” means volume/volume percent, “IPTG” means isopropyl-μ-D-thiogalactopyranoiside, “aTc” means anhydrotetracycline, “RBS” means ribosome binding site, “rpm” means revolutions per minute, “HPLC” means high performance liquid chromatography, and “GC” means gas chromatography.
I. Carbon Sources
Bio-production media, which is used in the present invention with recombinant microorganisms must contain suitable carbon sources or substrates for both growth and production stages. Suitable substrates may include, but are not limited to glucose, sucrose, xylose, mannose, arabinose, oils, carbon dioxide, carbon monoxide, methane, methanol, formaldehyde and glycerol. It is contemplated that all of the above mentioned carbon substrates and mixtures thereof are suitable in the present invention as a carbon source(s).
II. Microorganisms
Features as described and claimed herein may be provided in a microorganism selected from the listing herein, or another suitable microorganism, that also comprises one or more natural, introduced, or enhanced product bio-production pathways. Thus, in some embodiments the microorganism(s) comprise an endogenous product production pathway (which may, in some such embodiments, be enhanced), whereas in other embodiments the microorganism does not comprise an endogenous product production pathway.
The examples describe specific modifications and evaluations to certain bacterial and fungal microorganisms. The scope of the invention is not meant to be limited to such species, but to be generally applicable to a wide range of suitable microorganisms.
More particularly, based on the various criteria described herein, suitable microbial hosts for the bio-production of a chemical product generally may include, but are not limited to the organisms described in the Common Methods Section
III. Media and Culture Conditions
In addition to an appropriate carbon source, such as selected from one of the herein-disclosed types, bio-production media must contain suitable minerals, salts, cofactors, buffers and other components, known to those skilled in the art, suitable for the growth of the cultures and promotion of the enzymatic pathway necessary for chemical product bio-production under the present invention.
Another aspect of the invention regards media and culture conditions that comprise genetically modified microorganisms of the invention and optionally supplements.
Typically cells are grown at a temperature in the range of about 25° C. to about 40° C. in an appropriate medium, as well as up to 70° C. for thermophilic microorganisms. Suitable growth media are well characterized and known in the art.
Suitable pH ranges for the bio-production are between pH 2.0 to pH 10.0, where pH 6.0 to pH 8.0 is a typical pH range for the initial condition. However, the actual culture conditions for a particular embodiment are not meant to be limited by these pH ranges.
Bio-productions may be performed under aerobic, microaerobic or anaerobic conditions with or without agitation.
IV. Bio-Production Reactors and Systems
Fermentation systems utilizing methods and/or compositions according to the invention are also within the scope of the invention.
Any of the recombinant microorganisms as described and/or referred to herein may be introduced into an industrial bio-production system where the microorganisms convert a carbon source into a product in a commercially viable operation. The bio-production system includes the introduction of such a recombinant microorganism into a bioreactor vessel, with a carbon source substrate and bio-production media suitable for growing the recombinant microorganism, and maintaining the bio-production system within a suitable temperature range (and dissolved oxygen concentration range if the reaction is aerobic or microaerobic) for a suitable time to obtain a desired conversion of a portion of the substrate molecules to a selected chemical product. Bio-productions may be performed under aerobic, microaerobic, or anaerobic conditions, with or without agitation. Industrial bio-production systems and their operation are well-known to those skilled in the arts of chemical engineering and bioprocess engineering.
The following published resources are incorporated by reference herein for their respective teachings to indicate the level of skill in these relevant arts, and as needed to support a disclosure that teaches how to make and use methods of industrial bio-production of chemical product(s) produced under the invention, from sugar sources, and also industrial systems that may be used to achieve such conversion with any of the recombinant microorganisms of the present invention (Biochemical Engineering Fundamentals, 2nd Ed. J. E. Bailey and D. F. Ollis, McGraw Hill, New York, 1986, entire book for purposes indicated and Chapter 9, pages 533-657 in particular for biological reactor design; Unit Operations of Chemical Engineering, 5th Ed., W. L. McCabe et al., McGraw Hill, New York 1993, entire book for purposes indicated, and particularly for process and separation technologies analyses; Equilibrium Staged Separations, P. C. Wankat, Prentice Hall, Englewood Cliffs, N.J. USA, 1988, entire book for separation technologies teachings).
The amount of a product produced in a bio-production media generally can be determined using a number of methods known in the art, for example, high performance liquid chromatography (HPLC), gas chromatography (GC), or GC/Mass Spectroscopy (MS).
V. Genetic Modifications, Nucleotide Sequences, and Amino Acid Sequences
Embodiments of the present invention may result from introduction of an expression vector into a host microorganism, wherein the expression vector contains a nucleic acid sequence coding for an enzyme that is, or is not, normally found in a host microorganism.
The ability to genetically modify a host cell is essential for the production of any genetically modified (recombinant) microorganism. The mode of gene transfer technology may be by electroporation, conjugation, transduction, or natural transformation. A broad range of host conjugative plasmids and drug resistance markers are available. The cloning vectors are tailored to the host organisms based on the nature of antibiotic resistance markers that can function in that host. Also, as disclosed herein, a genetically modified (recombinant) microorganism may comprise modifications other than via plasmid introduction, including modifications to its genomic DNA.
More generally, nucleic acid constructs can be prepared comprising an isolated polynucleotide encoding a polypeptide having enzyme activity operably linked to one or more (several) control sequences that direct the expression of the coding sequence in a microorganism, such as E. coli, under conditions compatible with the control sequences. The isolated polynucleotide may be manipulated to provide for expression of the polypeptide. Manipulation of the polynucleotide's sequence prior to its insertion into a vector may be desirable or necessary depending on the expression vector. The techniques for modifying polynucleotide sequences utilizing recombinant DNA methods are well established in the art.
The control sequence may be an appropriate promoter sequence, a nucleotide sequence that is recognized by a host cell for expression of a polynucleotide encoding a polypeptide of the present invention. The promoter sequence may contain transcriptional control sequences that mediate the expression of the polypeptide. The promoter may be any nucleotide sequence that shows transcriptional activity in the host cell of choice including mutant, truncated, and hybrid promoters, and may be obtained from genes encoding extracellular or intracellular polypeptides either homologous or heterologous to the host cell. The techniques for modifying and utilizing recombinant DNA promoter sequences are well established in the art.
For various embodiments of the invention the genetic manipulations may be described to include various genetic manipulations, including those directed to change regulation of, and therefore ultimate activity of, an enzyme or enzymatic activity of an enzyme identified in any of the respective pathways. Such genetic modifications may be directed to transcriptional, translational, and post-translational modifications that result in a change of enzyme activity and/or selectivity under selected and/or identified culture conditions and/or to provision of additional nucleic acid sequences such as to increase copy number and/or mutants of an enzyme related to product production. Specific methodologies and approaches to achieve such genetic modification are well known to one skilled in the art.
In various embodiments, to function more efficiently, a microorganism may comprise one or more gene deletions. For example, in E. coli, the genes encoding the lactate dehydrogenase (ldhA), phosphate acetyltransferase (pta), pyruvate oxidase (poxB), pyruvate-formate lyase (pflB), methylglyoxal synthase (mgsA), acetate kinase (ackA), alcohol dehydrogenase (adhE), the clpXP protease specificity enhancing factor (sspB), the ATP-dependent Lon protease (lon), the outer membrane protease (ompT), the arcA transcriptional dual regulator (arcA), and the iclR transcriptional regulator (iclR) may be disrupted, including deleted. Such gene disruptions, including deletions, are not meant to be limiting, and may be implemented in various combinations in various embodiments. Gene deletions may be accomplished by numerous strategies well known in the art, as are methods to incorporate foreign DNA into a host chromosome.
In various embodiments, to function more efficiently, a microorganism may comprise one or more synthetic metabolic valves, composed of enzymes targeted for controlled proteolysis, expression silencing or a combination of both controlled proteolysis and expression silencing. For example, one enzyme encoded by one gene or a combination of numerous enzymes encoded by numerous genes in E. coli may be designed as synthetic metabolic valves to alter metabolism and improve product formation. Representative genes in E. coli may include but are not limited to the following: fab1, zwf, gltA, ppc, udhA, lpd, sucD, aceA, pfkA, lon, rpoS, tktA or tktB. It is appreciated that it is well known to one skilled in the art how to identify homologues of these genes and or other genes in additional microbial species.
For all nucleic acid and amino acid sequences provided herein, it is appreciated that conservatively modified variants of these sequences are included, and are within the scope of the invention in its various embodiments. Functionally equivalent nucleic acid and amino acid sequences (functional variants), which may include conservatively modified variants as well as more extensively varied sequences, which are well within the skill of the person of ordinary skill in the art, and microorganisms comprising these, also are within the scope of various embodiments of the invention, as are methods and systems comprising such sequences and/or microorganisms.
Accordingly, as described in various sections above, some compositions, methods and systems of the present invention comprise providing a genetically modified microorganism that comprises both a production pathway to make a desired product from a central intermediate in combination with synthetic metabolic valves to redistribute flux.
Aspects of the invention also regard provision of multiple genetic modifications to improve microorganism overall effectiveness in converting a selected carbon source into a selected product. Particular combinations are shown, such as in the Examples, to increase specific productivity, volumetric productivity, titer and yield substantially over more basic combinations of genetic modifications.
In addition to the above-described genetic modifications, in various embodiments genetic modifications, including synthetic metabolic valves also are provided to increase the pool and availability of the cofactor NADPH and/or NADH which may be consumed in the production of a product.
More generally, and depending on the particular metabolic pathways of a microorganism selected for genetic modification, any subgroup of genetic modifications may be made to decrease cellular production of fermentation product(s) other than the desired fermentation product, selected from the group consisting of acetate, acetoin, acetone, acrylic, malate, fatty acid ethyl esters, isoprenoids, glycerol, ethylene glycol, ethylene, propylene, butylene, isobutylene, ethyl acetate, vinyl acetate, other acetates, 1,4-butanediol, 2,3-butanediol, butanol, isobutanol, sec-butanol, butyrate, isobutyrate, 2-OH-isobutryate, 3-OH-butyrate, ethanol, isopropanol, D-lactate, L-lactate, pyruvate, itaconate, levulinate, glucarate, glutarate, caprolactam, adipic acid, propanol, isopropanol, fused alcohols, and 1,2-propanediol, 1,3-propanediol, formate, fumaric acid, propionic acid, succinic acid, valeric acid, maleic acid and poly-hydroxybutyrate. Gene deletions may be made as disclosed generally herein, and other approaches may also be used to achieve a desired decreased cellular production of selected fermentation products other than the desired products.
VI. Synthetic Metabolic Valves
In particular the invention describes the construction of synthetic metabolic valves comprising one or more or a combination of the following: controlled gene silencing and controlled proteolysis. It is appreciated that one well skilled in the art is aware of several methodologies for gene silencing and controlled proteolysis. An example of the combination of CRISPR interference based gene silencing and controlled proteolysis is illustrated in FIG. 2.
VI.A Gene Silencing
In particular the invention describes the use of controlled gene silencing to help enable the control over metabolic fluxes in controlled multi-stage fermentation processes. There are several methodologies known in the art for controlled gene silencing, including but not limited to mRNA silencing or RNA interference, silencing via transcriptional repressors and CRISPR interference. Methodologies and mechanisms for RNA interference are taught by Agrawal et al. “RNA Interference: Biology, Mechanism, and Applications” Microbiology and Molecular Biology Reviews, December 2003; 67(4) p 657-685. DOI: 10.1128/MMBR.67.657-685.2003. Methodologies and mechanisms for CRISRPR interference are taught by Qi et al. “Repurposing CRISPR as an RNA-guided platform for sequence-specific control of gene expression” Cell February 2013; 152(5) p 1173-1183. DOI: 10.1016/j.cell.2013.02.022. In addition, methodologies and mechanisms for CRISRPR interference using the native E. coli CASCADE system are taught by Luo et al. “Repurposing endogenous type I CRISPR-Cas systems for programmable gene repression” NAR. October 2014; DOI: 10.1093. In additional numerous transcriptional repressor systems are well known in the art and can be used to turn off gene expression.
VI.B Controlled Proteolysis
In particular the invention describes the use of controlled protein degradation or proteolysis to help enable the control over metabolic fluxes in controlled multi-stage fermentation processes. There are several methodologies known in the art for controlled protein degradation, including but not limited to targeted protein cleavage by a specific protease and controlled targeting of proteins for degradation by specific peptide tags. Systems for the use of the E. coli clpXP protease for controlled protein degradation are taught by McGinness et al, “Engineering controllable protein degradation”, Mol Cell. June 2006; 22(5) p 701-707. This methodology relies upon adding a specific C-terminal peptide tag such as a DAS4 (or DAS+4) tag. Proteins with this tag are not degraded by the clpXP protease until the specificity enhancing chaperone sspB is expressed. sspB induces degradation of DAS4 tagged proteins by the clpXP protease. In additional numerous site specific protease systems are well known in the art. Proteins can be engineered to contain a specific target site of a given protease and then cleaved after the controlled expression of the protease. In some embodiments the cleavage can be expected lead to protein inactivation or degradation. For example Schmidt et al, “ClpS is the recognition component for Escherichia coli substrates of the N-end rule degradation pathway” Molecular Microbiology March 2009. 72(2), 506-517. doi:10.1111, teaches that an N-terminal sequence can be added to a protein of interest in enable clpS dependent clpAP degradation. In addition, this sequence can further be masked by an additional N-terminal sequence, which can be controllable cleaved such as by a ULP hydrolase. This allows for controlled N-rule degradation dependent on hydrolase expression. It is therefore possible to tag proteins for controlled proteolysis either at the N-terminus or C-terminus. The preference of using an N-terminal vs. C-terminal tag will largely depend on whether either tag affects protein function prior to the controlled onset of degradation.
The invention describes the use of controlled protein degradation or proteolysis to help enable the control over metabolic fluxes in controlled multi-stage fermentation processes, in E. coli. There are several methodologies known in the art for controlled protein degradation in other microbial hosts, including a wide range of gram-negative as well as gram-positive bacteria, yeast and even archaea. In particular, systems for controlled proteolysis can be transferred from a native microbial host and used in a non-native host. For example Grilly et al, “A synthetic gene network for tuning protein degradation in Saccharomyces cerevisiae” Molecular Systems Biology 3, Article 127. doi:10.1038, teaches the expression and use of the E. coli clpXP protease in the yeast Saccharomyces cerevisiae. Such approaches can be used to transfer the methodology for synthetic metabolic valves to any genetically tractable host.
VI.C Synthetic Metabolic Valve Control
In particular the invention describes the use of synthetic metabolic valves to control metabolic fluxes in multi-stage fermentation processes. There are numerous methodologies known in the art to induce expression that can be used at the transition between stages in multi-stage fermentations. These include but are not limited to artificial chemical inducers including: tetracycline, anhydrotetracycline, lactose, IPTG (isopropyl-beta-D-1-thiogalactopyranoside), arabinose, raffinose, tryptophan and numerous others. Systems linking the use of these well known inducers to the control of gene expression silencing and/or controlled proteolysis can be integrated into genetically modified microbial systems to control the transition between growth and production phases in multi-stage fermentation processes.
In addition, it may be desirable to control the transition between growth and production in multi-stage fermentations by the depletion of one or more limiting nutrients that are consumed during growth. Limiting nutrients can include but are not limited to: phosphate, nitrogen, sulfur and magnesium. Natural gene expression systems that respond to these nutrient limitations can be used to operably link the control of gene expression silencing and/or controlled proteolysis to the transition between growth and production phases in multi-stage fermentation processes.
VII. Disclosed Embodiments are Non-Limiting
While various embodiments of the present invention have been shown and described herein, it is emphasized that such embodiments are provided by way of example only. Numerous variations, changes and substitutions may be made without departing from the invention herein in its various embodiments. Specifically, and for whatever reason, for any grouping of compounds, nucleic acid sequences, polypeptides including specific proteins including functional enzymes, metabolic pathway enzymes or intermediates, elements, or other compositions, or concentrations stated or otherwise presented herein in a list, table, or other grouping (such as metabolic pathway enzymes shown in a figure), unless clearly stated otherwise, it is intended that each such grouping provides the basis for and serves to identify various subset embodiments, the subset embodiments in their broadest scope comprising every subset of such grouping by exclusion of one or more members (or subsets) of the respective stated grouping. Moreover, when any range is described herein, unless clearly stated otherwise, that range includes all values therein and all sub-ranges therein.
Also, and more generally, in accordance with disclosures, discussions, examples and embodiments herein, there may be employed conventional molecular biology, cellular biology, microbiology, and recombinant DNA techniques within the skill of the art. Such techniques are explained fully in the literature. (See, e.g., Sambrook and Russell, “Molecular Cloning: A Laboratory Manual,” Third Edition 2001 (volumes 1-3), Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.; Animal Cell Culture, R. I. Freshney, ed., 1986.) These published resources are incorporated by reference herein for their respective teachings of standard laboratory methods found therein. Such incorporation, at a minimum, is for the specific teaching and/or other purpose that may be noted when citing the reference herein. If a specific teaching and/or other purpose is not so noted, then the published resource is specifically incorporated for the teaching(s) indicated by one or more of the title, abstract, and/or summary of the reference. If no such specifically identified teaching and/or other purpose may be so relevant, then the published resource is incorporated in order to more fully describe the state of the art to which the present invention pertains, and/or to provide such teachings as are generally known to those skilled in the art, as may be applicable. However, it is specifically stated that a citation of a published resource herein shall not be construed as an admission that such is prior art to the present invention. Also, in the event that one or more of the incorporated published resources differs from or contradicts this application, including but not limited to defined terms, term usage, described techniques, or the like, this application controls. Subject matter in the Examples is incorporated into this section to the extent not already present.
The examples herein provide some examples, not meant to be limiting. All reagents, unless otherwise indicated, are obtained commercially. Species and other phylogenic identifications are according to the classification known to a person skilled in the art of microbiology, molecular biology and biochemistry.
The names and city addresses of major suppliers are provided herein.
This example describes the increased production of tetrahydroxynaphtalene (THN) in E. coli from the intermediate malonyl-CoA using the controlled inactivation of fabI via a temperature sensitive allele. Briefly, strain BWapldf (BW25113: ΔldhA, ΔpflB, ΔpoxB, ΔackA-pta, ΔadhE) was further genetically modified so that the fab1 gene was mutated to contain both a temperature sensitive (ts) mutation (F241S) as well as to incorporate gentamicin resistance cassette a the C-terminus of the fab1 gene. This was accomplished using standard recombineering protocols. The strain was further modified to express the tetrahydroxynapthalene (THN) synthase gene (rppA from Streptomyces coelicolor) under phosphate limiting conditions by transformation with the plasmid pSMART-HC-Kan-yibD-THNS (SEQ ID NO:1). Control strains were made with a control empty vector pSMART-HC-Kan (Genbank Accession #AF532107.1), obtained from Lucigen. This high copy plasmid conferring kanamycin resistance was constructed using routine molecular biology methods utilizing the pSMART-HC-Kan kit obtained from Lucigen. The rppA gene under the control of the promoter of low phosphate induced yibD(waaH) gene of E. coli. This strain, as well as controls, were evaluated for THN production using the two-stage protocol as outline in the Common Methods section “Shake Flask Protocol-1”. Relative THN production was quantified by measuring the absorbance of the supernatant at 340 nm. FIG. 4 summarizes the results.
This example describes the increased production of tetrahydroxynaphtalene (THN) in E. coli from the intermediate malonyl-CoA using the controlled repression of fab1 using synthetic metabolic valve technology. In this example a combination of CRISPR interference gene silencing technology and controlled protein degradation was used in a two-stage process. Briefly, strain BWapldf (BW25113: ΔldhA, ΔpflB, ΔpoxB, ΔackA-pta, ΔadhE) was further genetically modified so that the fab1 gene was tagged to contain a C-terminal DAS4 tag as well as to incorporate gentamicin resistance cassette a the C-terminus of the fab1 gene. The C-terminal nucleotide sequence encoding the DAS4 tag was integrated as the following sequence: 5′-GCGGCCAACGATGAAAACTATTCTGAAAACTATGCGGATGCGTCT-34 (SEQ ID NO: 48). This was accomplished using standard recombineering protocols. In addition, the strain was further modified so as to delete the sspB gene. This was also performed with standard recombineering methods. In addition, these strains were still further modified to contain three plasmids, the first plasmid expresses the tetrahydroxynapthalene (THN) synthase gene, pSMART-HC-Kan-yibD-THNS (SEQ ID NO:1), as described above. The second plasmid was constructed to express a small guide RNA targeting the fab1 gene from a high copy spectinomycin resistance plasmid derived from pCDF-1b, which was obtained from EMD Millipore Biosciences. The plasmid, pCDF-T2-fabIsgRNA (SEQ ID NO:2), expresses a small guide RNA to use with S. pyogenes dCas9. The specific fab1 T2 targeting sequence is given by 5′-CAGCCGCTCCGGTCGGACCG-3′ (SEQ ID NO:47). A control plasmid was also made missing any targeting sequence as described by Qi et al. Cell February 2013; 152(5) p 1173-1183. DOI: 10.1016/j.cell.2013.02.022. The last plasmid, pdCas9-ptet-sspB (SEQ ID NO:3), was derived from the plasmid pdCas9-bacteria, from Qi et al, which was obtained from Addgene (Cambridge, Mass. 02139; Plasmid ID 44249). Briefly, pdCas9-bacteria was linearized and the sspB gene was introduced under the control of an additional ptet promoter at the 3′ of the catalytically inactive dcas9 gene. The addition of anhydrotetracycline (aTc) will induce expression of both dCas9 as well as sspB from this Chloramphenicol resistance conferring plasmid. All plasmids were constructed using standard molecular biology methods and sequences confirmed by DNA sequencing. These strains, as well as controls, were evaluated for THN production using the two-stage protocol as outline in the Common Methods section “Shake Flask Protocol-2”. Relative THN production was quantified by measuring the absorbance of the supernatant at 340 nm. FIG. 5 summarizes the results.
Numerous microbial strains, such as any of the strains listed in the Common Methods Section, may be genetically modified to express enzymes for the biosynthesis of a product. In addition these modified microbial strains can be further modified to contain a controllable synthetic metabolic valve for the dynamic reduction in enzyme activity of one or more metabolic pathways including those required for growth. These valves may utilize one or a combination of methods including gene silencing and controlled proteolysis. Further these modified strains may be used in a multistage fermentation process wherein transition between stages is concurrent with controlled activation of these valves. Specifically, any of these microbial strains may also be further engineered to express a heterologous production pathway enabling the product formation.
Briefly, strain BWapldf (BW25113: ΔldhA, ΔpflB, ΔpoxB, ΔackA-pta, ΔadhE) was further genetically modified for the deletion of the following genes: arcA, iclR and sspB, to construct strain DLF_0002. This was also performed with standard scarless recombineering methods. To construct a strain capable of both crispr based gene silencing using the native CASCADE system in E. coli as well as controlled proteolysis, the cas3 gene of E. coli was first deleted. This gene was replaced with a sequence to enable both constitutive expression of the casABCDE-cas1,2 operon enabling CASCADE based gene silencing, as well as a construct allowing for the low phosphate induction of the sspB chaperone. The DNA sequence integrated was ordered as a single synthetic construct: SEQ ID NO:4, and integrated using standard recombineering methodologies. In the place of the cas3 gene, this construct integrates a transcriptional terminator, followed by the low phosphate inducible E. coli ugpB gene promoter and the sspB gene. The sspB gene is followed by another transcriptional terminator and a subsequent constitutive proB promoter adapted from (Davis, J H., Rubin, A J., and Sauer, R T. NAR. February 2011; 39(3) p 1131-1141. DOI: 10.1093) to drive constant expression of the CASCADE operon. The resulting strain is termed DLF_0025.
A derivative of E. coli strain DLF_0025 was constructed to utilize a non-PTS dependent glucose uptake system. PTS (phosphotransferase system) based sugar uptake is well known in the art and links the phosphorylation of glucose to the production of pyruvate. Alternative uptake has been previously described in E. coli, (Hernandez-Montalvo, V., et al., Biotechnol Bioeng. September 2003; 83(6) p 687-694.), and relies on the overexpression of the E. coli galP permease and glucokinase (glk gene) along with the deletion of the E. coli ptsG gene. The ptsG gene was deleted and replaced with a constitutively expressed glucokinase construct, this construct was ordered as a single synthetic linear DNA construct (SEQ ID NO:5) and integrated according to standard methodologies. In addition, the galP promoter was also replaced via chromosomal replacement using another single synthetic linear DNA construct (SEQ ID NO:6), the resulting strain was called DLF_0286. In both cases the proC promoter was used to drive constitutive expression (Davis, J H., Rubin, A J., and Sauer, R T. NAR. February 2011; 39(3) p 1131-1141. DOI: 10.1093).
E. coli strains DLF_0025 and DLF_0286 were further modified for the controlled proteolysis of key enzymes in central metabolism including: 1) enoyl-ACP reductase encoded by the fab1 gene, involved in fatty acid biosynthesis, 2) citrate synthase encoded by the gltA gene, involved in citric acid cycle, 3) soluble transhydrogenase encoded by the udhA gene, involved in NADPH metabolism, 4) glucose-6-phosphate-1-dehydrogenase encoded by the zwf gene, involved in the pentose phosphate pathway and 5) the lipoamide dehydrogenase or E3 component of the pyruvate dehydrogenase complex encoded by lpd gene. C-terminal DAS+4 tags enabling sspB controlled proteolysis were integrated at the 3′ end of each of the above genes as the following sequence: 5′-GCGGCCAACGATGAAAACTATTCTGAAAACTATGCGGATGCGTCT-3′ (SEQ ID NO:48). This was accomplished by the insertion of single DNA cassettes containing the DAS4 tags, targeting sequences as well as a downstream antibiotic resistance cassette. The fabI-DAS4 tag and lpd-DAS4 tag were followed by a gentamicin resistance cassette, the gltA-DAS4 tag was followed by a zeocin resistance cassette, and the udhA-DAS4 and zwf-DAS4 tags were both followed by a blasticidin resistance cassette. The integrated sequences used for the C-terminal tagging fabI, lpd, gltA, udhA and zwf are SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9 SEQ ID NO:10 and SEQ ID NO:11 respectively. Strains with single and combinations of DAS4 tagged enzymes were constructed. Host strain genotypes are listed in Table 1.
| TABLE 1 |
| E. coli Host Strains |
| Strain ID | Genotype |
| BW25113 | F-, λ-, Δ(araD-araB)567, ΔlacZ4787(::rrnB-3), rph-1, Δ(rhaD- |
| rhaB)568, hsdR514 | |
| BWapldf | F-, λ-, Δ(araD-araB)567, ΔlacZ4787(::rrnB-3), rph-1, Δ(rhaD- |
| rhaB)568, hsdR514, ΔldhA::frt, ΔpoxB::frt, ΔpflB::frt, ΔackA-pta::frt, | |
| ΔadhE::frt | |
| DLF_0002 | F-, λ-, Δ(araD-araB)567, ΔlacZ4787(::rrnB-3), rph-1, Δ(rhaD- |
| rhaB)568, hsdR514, ΔldhA::frt, ΔpoxB::frt, ΔpflB::frt, ΔackA-pta::frt, | |
| ΔadhE::frt, ΔiclR, ΔarcA, ΔsspB | |
| DLF_0025 | F-, λ-, Δ(araD-araB)567, ΔlacZ4787(::rrnB-3), rph-1, Δ(rhaD- |
| rhaB)568, hsdR514, ΔldhA::frt, ΔpoxB::frt, ΔpflB::frt, ΔackA-pta::frt, | |
| ΔadhE::frt, ΔiclR, ΔarcA, ΔsspB, Δcas3::ugpBp-sspB-proB | |
| DLF_0286 | F-, λ-, Δ(araD-araB)567, AlacZ4787(::rrnB-3), rph-1, Δ(rhaD- |
| rhaB)568, hsdR514, ΔldhA::frt, ΔpoxB::frt, ΔpflB::frt, ΔackA-pta::frt, | |
| ΔadhE::frt, ΔiclR, ΔarcA, ΔsspB, Δcas3::ugpBp-sspB-pro, | |
| ΔptsG::proC-glk, proC-galP | |
| DLF_0043 | F-, λ-, Δ(araD-araB)567, ΔlacZ4787(::rrnB-3), rph-1, Δ(rhaD- |
| rhaB)568, hsdR514, ΔldhA::frt, ΔpoxB::frt, ΔpflB::frt, ΔackA-pta::frt, | |
| ΔadhE::frt, ΔiclR, AarcA, AsspB, Acas3::ugpBp-sspB-proB, gltA- | |
| DAS+4:zeoR | |
| DLF_0028 | F-, λ-, Δ(araD-araB)567, ΔlacZ4787(::rrnB-3), rph-1, Δ(rhaD- |
| rhaB)568, hsdR514, ΔldhA::frt, ΔpoxB::frt, ΔpflB::frt, ΔackA-pta::frt, | |
| ΔadhE::frt, ΔiclR, ΔarcA, ΔsspB, Δcas3::ugpBp-sspB-proB, fabI- | |
| DAS+4:gentR | |
| DLF_0031 | F-, λ-, Δ(araD-araB)567, ΔlacZ4787(::rrnB-3), rph-1, Δ(rhaD- |
| rhaB)568, hsdR514, ΔldhA::frt, ΔpoxB::frt, ΔpflB::frt, ΔackA-pta::frt, | |
| ΔadhE::frt, ΔiclR, ΔarcA, ΔsspB, Δcas3::ugpBp-sspB-proB, lpd- | |
| DAS+4:gentR | |
| DLF_0038 | F-, λ-, Δ(araD-araB)567, AlacZ4787(::rrnB-3), rph-1, Δ(rhaD- |
| rhaB)568, hsdR514, ΔldhA::frt, ΔpoxB::frt, ΔpflBxfrt, ΔackA-pta::frt, | |
| ΔadhE::frt, ΔiclR, ΔarcA, ΔsspB, Δcas3::ugpBp-sspB-proB, fabI- | |
| DAS+4:gentR, udhA-DAS+4:bsdR | |
| DLF_0040 | F-, λ-, Δ(araD-araB)567, AlacZ4787(::rrnB-3), rph-1, Δ(rhaD- |
| rhaB)568, hsdR514, ΔldhA::frt, ΔpoxB::frt, ΔpflB::frt, ΔackA-pta::frt, | |
| ΔadhE::frt, ΔiclR, ΔarcA, ΔsspB, Δcas3::ugpBp-sspB-proB, fabI- | |
| DAS+4:gentR zwf-DAS+4:bsdR | |
| DLF_0039 | F-, λ-, Δ(araD-araB)567, ΔlacZ4787(::rrnB-3), rph-1, Δ(rhaD- |
| rhaB)568, hsdR514, ΔldhA::frt, ΔpoxB::frt, ΔpflB::frt, ΔackA-pta::frt, | |
| ΔadhE::frt, ΔiclR, ΔarcA, ΔsspB, Δcas3::ugpBp-sspB-proB, fabI- | |
| DAS+4:gentR, gltA-DAS+4:zeoR | |
| DLF_0047 | F-, λ-, Δ(araD-araB)567, ΔlacZ4787(::rrnB-3), rph-1, Δ(rhaD- |
| rhaB)568, hsdR514, ΔldhA::frt, ΔpoxB::frt, ΔpflB::frt, ΔackA-pta::frt, | |
| ΔadhE::frt, ΔiclR, ΔarcA, ΔsspB, Δcas3::ugpBp-sspB-proB, fabI- | |
| DAS+4:gentR, gltA-DAS+4:zeoR, udhA-DAS+4:bsdR | |
| DLF_0167 | F-, λ-, Δ(araD-araB)567, AlacZ4787(::rrnB-3), rph-1, Δ(rhaD- |
| rhaB)568, hsdR514, ΔldhA::frt, ΔpoxB::frt, ΔpflB::frt, ΔackA-pta::frt, | |
| ΔadhE::frt, ΔiclR, ΔarcA, ΔsspB, Δcas3::ugpBp-sspB-proB, fabI- | |
| DAS+4:gentR gltA-DAS+4:zeoR zwf-DAS+4:bsdR | |
| DLF_0041 | F-, λ-, Δ(araD-araB)567, ΔlacZ4787(::rrnB-3), rph-1, Δ(rhaD- |
| rhaB)568, hsdR514, ΔldhA::frt, ΔpoxB::frt, ΔpflB::frt, ΔackA-pta::frt, | |
| ΔadhE::frt, ΔiclR, ΔarcA, ΔsspB, Δcas3::ugpBp-sspB-proB, lpd- | |
| DAS+4:gentR, gltA-DAS+4:zeoR, | |
| DLF_0165 | F-, λ-, Δ(araD-araB)567, ΔlacZ4787(::rrnB-3), rph-1, Δ(rhaD- |
| rhaB)568, hsdR514, ΔldhA::frt, ΔpoxB::frt, ΔpflB::frt, ΔackA-pta::frt, | |
| ΔadhE::frt, ΔiclR, ΔarcA, ΔsspB, Δcas3::ugpBp-sspB-proB, lpd- | |
| DAS+4:gentR, zwf-DAS+4:bsdR | |
| DLF_0042 | F-, λ-, Δ(araD-araB)567, ΔlacZ4787(::rrnB-3), rph-1, Δ(rhaD- |
| rhaB)568, hsdR514, ΔldhA::frt, ΔpoxB::frt, ΔpflB::frt, ΔackA-pta::frt, | |
| ΔadhE::frt, ΔiclR, ΔarcA, ΔsspB, Δcas3::ugpBp-sspB-proB, lpd- | |
| DAS+4:gentR, udhA-DAS+ 4:bsdR | |
| DLF_0049 | F-, λ-, Δ(araD-araB)567, ΔlacZ4787(::rrnB-3), rph-1, Δ(rhaD- |
| rhaB)568, hsdR514, ΔldhA::frt, ΔpoxB::frt, ΔpflB::frt, ΔackA-pta::frt, | |
| ΔadhE::frt, ΔiclR, ΔarcA, ΔsspB, Δcas3::ugpBp-sspB-proB, lpd- | |
| DAS+4:gentR, gltA-DAS+4:zeoR, udhA-DAS+4:bsdR | |
| DLF_0048 | F-, λ-, Δ(araD-araB)567, ΔlacZ4787(::rrnB-3), rph-1, Δ(rhaD- |
| rhaB)568, hsdR514, ΔldhA::frt, ΔpoxB::frt, ΔpflB::frt, ΔackA-pta::frt, | |
| ΔadhE::frt, ΔiclR, ΔarcA, ΔsspB, Δcas3::ugpBp-sspB-proB, lpd- | |
| DAS+4:gentR, gltA-DAS+4:zeoR, zwf-DAS+4:bsdR | |
| DLF_0045 | F-, λ-, Δ(araD-araB)567, ΔlacZ4787(::rrnB-3), rph-1, Δ(rhaD- |
| rhaB)568, hsdR514, ΔldhA::frt, ΔpoxB::frt, ΔpflBxfrt, ΔackA-pta::frt, | |
| ΔadhE::frt, ΔiclR, ΔarcA, ΔsspB, Δcas3::ugpBp-sspB-proB, gltA- | |
| DAS+4:zeoR, udhA-DAS+4:bsdR | |
| DLF_0044 | F-, λ-, Δ(araD-araB)567, ΔlacZ4787(::rrnB-3), rph-1, Δ(rhaD- |
| rhaB)568, hsdR514, ΔldhA::frt, ΔpoxB::frt, ΔpflB::frt, ΔackA-pta::frt, | |
| ΔadhE::frt, ΔiclR, ΔarcA, ΔsspB, Δcas3::ugpBp-sspB-proB, gltA- | |
| DAS+4:zeoR, zwf-DAS+4:bsdR | |
| DLF_0287 | F-, λ-, A(araD-araB)567, ΔlacZ4787(::rrnB-3), rph-1, Δ(rhaD- |
| rhaB)568, hsdR514, ΔldhA::frt, ΔpoxB::frt, ΔpflB::frt, ΔackA-pta::frt, | |
| ΔadhE::frt, ΔiclR, ΔarcA, ΔsspB, Δcas3::ugpBp-sspB-pro, | |
| ΔptsG::proC-glk, proC-galP, gltA-DAS+4:zeoR | |
| DLF_0288 | F-, λ-, Δ(araD-araB)567, ΔlacZ4787(::rrnB-3), rph-1, Δ(rhaD- |
| rhaB)568, hsdR514, ΔldhA::frt, ΔpoxB::frt, ΔpflB::frt, ΔackA-pta::frt, | |
| ΔadhE::frt, ΔiclR, ΔarcA, ΔsspB, Δcas3::ugpBp-sspB-pro, | |
| ΔptsG::proC-glk, proC-galP, gltA-DAS+4:zeoR, zwf-DAS+4:bsdR | |
| DLF_0289 | F-, λ-, Δ(araD-araB)567, ΔlacZ4787(::rrnB-3), rph-1, Δ(rhaD- |
| rhaB)568, hsdR514, ΔldhA::frt, ΔpoxB::frt, ΔpflB::frt, ΔackA-pta::frt, | |
| ΔadhE::frt, ΔiclR, ΔarcA, ΔsspB, Δcas3::ugpBp-sspB-pro, | |
| ΔptsG::proC-glk, proC-galP, gltA-DAS+4:zeoR, udhA-DAS+4:bsdR | |
| DLF_0290 | F-, λ-, Δ(araD-araB)567, ΔlacZ4787(::rrnB-3), rph-1, Δ(rhaD- |
| rhaB)568, hsdR514, ΔldhA::frt, ΔpoxB::frt, ΔpflBxfrt, ΔackA-pta::frt, | |
| ΔadhE::frt, ΔiclR, ΔarcA, ΔsspB, Δcas3::ugpBp-sspB-pro, | |
| ΔptsG::proC-glk, proC-galP, gltA-DAS+4:zeoR, zwf-DAS+4:bsdR, | |
| fabI-DAS+4:gentR | |
| DLF_0291 | F-, λ-, Δ(araD-araB)567, ΔlacZ4787(::rrnB-3), rph-1, Δ(rhaD- |
| rhaB)568, hsdR514, ΔldhA::frt, ΔpoxB::frt, ΔpflB::frt, ΔackA-pta::frt, | |
| ΔadhE::frt, ΔiclR, ΔarcA, ΔsspB, Δcas3::ugpBp-sspB-pro, | |
| ΔptsG::proC-glk, proC-galP, gltA-DAS+4:zeoR, udhA-DAS+4:bsdR, | |
| fabI-DAS+4:gentR | |
In order to evaluate different low phosphate induction schemes to control synthetic metabolic valves, several known low phosphate inducible promoters form E. coli were evaluated with a ultraviolet excitable, green fluorescent protein (GFPuv) reporter gene. These gene promoters included those for the following genes: amn, phioA, phoB, phioE, phioH, phoU, mipA, pstS, ugpB, waaH and ydfH, were evaluated for low phosphate induction. Reporter plasmids linking each promoter to a GFPuv gene reporter were constructed and sequences are as follows: pSMART-amnp-GFPuv (SEQ ID N0:36), pSMART-phoAp-GFPuv (SEQ ID N0:37), pSMART-phoBp-GFPuv (SEQ ID N0:38), pSMART-phoEp-GFPuv (SEQ ID N0:38), pSMART-phoHp-GFPuv (SEQ ID NO:40), pSMART-phoUp-GFPuv (SEQ ID NO:41), pSMART-mipAp-GFPuv (SEQ ID NO:42), pSMART-pstSp-GFPuv (SEQ ID NO:43), pSMART-ugpBp-GFPuv (SEQ ID NO:12), pSMART-waaHp-GFPuv (SEQ ID NO:44), and pSMART-ydtH-p-GFPuv (SEQ ID NO:45). Briefly, plasmids were transformed into E. coli strain BWapldf (Refer to Example 4). Colonies were used to inoculate 4 mL of SM3 media with kanamycin (Refer to Common Methods Section) and incubated overnight at 37 degrees Celsius and a shaking speed of 225 rpm. After overnight growth, cells were normalized to an optical density at 600 nm of 5, and 40 μL of normalized culture was used to inoculate 760 μL of fresh FGM3 (Refer to Common Methods Section) medium with kanamycin in wells of a 48 well FlowerPlate™ B which was transferred into a BioLector Microbioreactor both obtained from M2P Labs (Baesweiler, Germany). The BioLector Microbioreactor can continuously measure fluorescence. Cells were incubated in the Microreactor at 37 degrees Celsius and a shaking speed of 1200 rpm for 60 hrs. Growth stopped and phosphate depletion begins at about 15-20 hrs (data not shown for clarity). Fluorescence results for each reporter construct as well as an empty vector control are reported as relative fluorescence units (R.F.U) in FIG. 6. All plasmids were constructed using standard Gibson Assembly methodology (Gibson Assembly Master Mix, obtained from New England Biolabs, Ipswich, Mass., USA), and synthetic linear double stranded DNA provided as Gblocks™ (Integrated DNA Technology, Coralville, Iowa, USA). Eton Bioscience (Research Triangle Park, N.C., USA) was used for plasmid DNA sequence confirmations. Standard codon optimization was performed to optimize constructs for expression in E. coli.
pCASCADE-control (SEQ ID NO:13) was prepared by swapping the tetracycline inducible promoter in pcrRNA plasmid (Luo et al. “Repurposing endogenous type I CRISPR-Cas systems for programmable gene repression” NAR. October 2014; DOI: 10.1093.) with an insulated ugpB promoter. The plasmid was constructed using standard Gibson Assembly methodology (Gibson Assembly Master Mix, obtained from New England Biolabs, Ipswich, Mass., USA), and synthetic linear double stranded DNA provided as Gblocks™ (Integrated DNA Technology, Coralville, Iowa, USA). Eton Bioscience (Research Triangle Park, N.C., USA) was used for plasmid DNA sequence confirmations.
Additional pCASCADE plasmids with single RNA guides were prepared via Q5 site-directed mutagenesis (New England Biolabs, Ipswich, Mass., USA)) following manufacturer's protocol, except that 5% v/v DMSO was added to the Q5 PCR reaction. For example pCASCADE-gltA2 (SEQ ID NO:14) was prepared using pCASCADE-control as template and the following primers: gltA2-FOR 5′-GGGACAGTTATTAGTTCGAGTTCCCCGCGCCA GCGGGGATAAACCGAAAAAAAAACCCC-3′ (SEQ ID NO:49) and gltA2-REV 5′-GAATGAATTGGTCAATACGGTTTATCCCCGCTGGCGCGGGGAACTCGAGGTGGT ACCAGATCT-3′ (SEQ ID NO:50). Additional pCASCADE plasmids including pCASCADE-fabI (SEQ ID NO:15), pCASCADE-udhA, (SEQ ID NO:16), pCASCADE-zwf (SEQ ID NO:17) and pCASCADE-gltA1 (SEQ ID NO:18) were prepared in a similar manner by exchanging the guide RNA targeting sequence using Q5 mutagenesis.
Additional pCASCADE plasmids with multiple RNA guides were prepared as follows. For example pCASCADE-gltA2-udhA (SEQ ID NO:19) plasmid was prepared by amplifying gltA2 guide half and udhA guide half from pCASCADE-gltA2 and pCASCADE-udhA respectively using Q5 High-Fidelity 2× Master Mix (NEB, MA). The primers used: G2U-FOR1: 5′-CCGGATGAGCATTCATCAGGCGGGCAAG-3′ (SEQ ID NO:51), REV1: 5′-CGGTTTATCCCCGCTGGCGCGGGGAACTCGAACTTCATAACTTTTAC-3′ (SEQ ID NO:52) and FOR2: 5′-GCGCCAGCGGGGATAAACCGTTACCATTCTGTTG-3′ (SEQ ID NO:53) and REV2: 5′-CTTGCCCGCCTGATGAATGCTCATCCGG-3′ (SEQ ID NO:54). PCR products were purified by gel-extraction and were then used for Gibson Assembly (NEB, MA). pCASCADE-fabI-udhA (SEQ ID NO:20), pCASCADE-fabI-gltA1 (SEQ ID NO:21), pCASCADE-fabI-gltA2 (SEQ ID NO:22), pCASCADE-fabI-zwf (SEQ ID NO:23), pCASCADE-gltA1-udhA (SEQ ID NO:24), pCASCADE-gltA2-udhA (SEQ ID NO:25), pCASCADE-gltA1-zwf (SEQ ID NO:26), pCASCADE-gltA2-zwf (SEQ ID NO:27), were all prepared in a similar way by amplification of each guide and part of the vector backbone followed by Gibson Assembly. All plasmid sequences were confirmed by DNA sequencing (Eton Bioscience, Research Triangle Park, N.C., USA).
All plasmids were constructed using standard Gibson Assembly methodology (Gibson Assembly Master Mix, obtained from New England Biolabs, Ipswich, Mass., USA), and synthetic linear double stranded DNA provided as Gblocks™ (Integrated DNA Technology, Coralville, Iowa, USA). Eton Bioscience (Research Triangle Park, N.C., USA) was used for plasmid DNA sequence confirmations. Standard codon optimization was performed to optimize constructs for expression in E. coli. First a plasmid expressing a low phosphate inducible (utilizing the low phosphate inducible waaH gene promoter from E. coli), ultraviolet excitable, green fluorescent protein (GFPuv) was constructed using standard cloning techniques and called pSMART-waaHp-GFPuv (SEQ ID NO:12). Secondly, a compatible vector with the constitutive expression of a red fluorescent protein (mCherry), tagged with a DAS+4 tag enabling controlled proteolysis was constructed pBT1-mCherry-DAS+4 (SEQ ID NO:28). Constitutive expression was achieved using a proD promoter (Davis, J H., Rubin, A J., and Sauer, R T. NAR. February 2011; 39(3) p 1131-1141. DOI: 10.1093). Lastly, another compatible vector enabling the low phosphate expression (utilizing the low phosphate inducible ugpB gene promoter from E. coli) expression of a gene silencing guide RNA targeting the proD promoter was constructed (Refer to Example 6 for methods) and called pCASCADE-proD (SEQ ID NO:29). These plasmids were transformed into several host strains as described in Example 4, including strain DLF_0025 to create several strains. Colonies were used to inoculate 4 mL of SM3 media with kanamycin (Refer to Common Methods Section) and incubated overnight at 37 degrees Celsius and a shaking speed of 225 rpm. After overnight growth, cells were normalized to an optical density at 600 nm of 5, and 40 μL of normalized culture was used to inoculate 760 μL of fresh FGM3 (Refer to Common Methods Section) medium with kanamycin in wells of a 48 well FlowerPlate™ B which was transferred into a BioLector Microbioreactor both obtained from M2P Labs (Baesweiler, Germany). The BioLector Microbioreactor can continuously measure fluorescence and biomass levels. Cells were incubated in the Microreactor at 37 degrees Celsius and a shaking speed of 1200 rpm for 60 hrs. Fluorescence results for each reporter construct as well as an empty vector control are reported as relative fluorescence units (R.F.U) normalized to biomass levels are depicted in FIG. 7. All plasmids were constructed using standard Gibson Assembly methodology (Gibson Assembly Master Mix, obtained from New England Biolabs, Ipswich, Mass., USA), and synthetic linear double stranded DNA provided as Gblocks™ (Integrated DNA Technology, Coralville, Iowa, USA). Eton Bioscience (Research Triangle Park, N.C., USA) was used for plasmid DNA sequence confirmations. Standard codon optimization was performed to optimize constructs for expression in E. coli.
All production plasmids were constructed using standard Gibson Assembly methodology (Gibson Assembly Master Mix, obtained from New England Biolabs, Ipswich, Mass., USA), and synthetic linear double stranded DNA provided as Gblocks™ (Integrated DNA Technology, Coralville, Iowa, USA). Eton Bioscience (Research Triangle Park, N.C., USA) was used for plasmid DNA sequence confirmations. Standard codon optimization was performed to optimize constructs for expression in E. coli.
A plasmid expressing an NADPH dependent 3-hydroxypropionic acid (3-HP) production pathway was constructed as an operon of two genes. The mcr gene from Chloroflexus auranticus (CaMCR), encoding a malonyl-CoA reductase (Uniprot #A9WIU3), and the ydfG gene from E. coli, encoding an NADPH dependent 3-HP dehydrogenase (Uniprot #P39831) were used. Only the C-terminal end (residues 550-1219) of the mcr enzyme encoding the malonyl-CoA reductase domain was utilized (Liu, C., Wang, Q., Ding., Y and Zhao, Gu., PLOS One. September 2013. DOI: 10.1371). The operon was assembled into the pSMART-HC-Kan vector, resulting in plasmid pSMART-3HP1, (SEQ ID NO:30).
A plasmid expressing a malonic acid production pathway was constructed from a single gene encoding a triple mutant (E95N/Q384A/F304R) Pseudomonas fulva (strain 12-X) isobutyryl-CoA thioesterase (Uniprot #F6AA82), with altered specificity (Steen, E., Patent Application PCT/US2014/047645). This gene was cloned behind the phosphate dependent waaH gene promoter from E. coli. The gene was then assembled into the pSMART-HC-Kan vector (Lucigen, Middleton Wis.), resulting in plasmid pSMART-F6AA82M, (SEQ ID NO:31).
A plasmid expressing an NADPH dependent L-alanine production pathway was constructed from a single gene encoding a double mutant (Leu197Arg Asp196Ala) Bacillus subtilis alanine dehydrogenase (AlaDH) (Uniprot #Q08352), with NADPH cofactor specificity (Haas, T., et al. Patent Application PCT/EP2013/057855). This gene was cloned behind the phosphate dependent waaH gene promoter from E. coli. The gene was then assembled into the pSMART-HC-Kan vector (Lucigen, Middleton Wis.), resulting in plasmid pSMART-Ala1, (SEQ ID NO:32). A additional plasmid expressing the same NADPH dependent L-alanine production pathway was constructed using the phosphate dependent ugpB gene promoter from E. coli. The gene was then assembled into the pSMART-HC-Kan vector (Lucigen, Middleton Wis.), resulting in plasmid pSMART-Ala2, (SEQ ID NO:46).
A plasmid expressing a mevalonate production pathway was constructed from two genes assembled into two transcriptional units. First, the mvaE gene from Enterococcus faecalis encoding a bifunctional acetoacetyl-CoA thiolase, and NADPH dependent HMG-CoA reductase (Uniprot #Q9FD70) was cloned behind an insulated version of the phosphate dependent waaH gene promoter from E. coli. Additionally, the mvaS gene, also from E. faecalis, encoding a hydroxymethylglutaryl-CoA synthase (Uniprot #Q9FD71) was cloned behind an insulated version of the phosphate dependent mipA gene promoter from E. coli. The mvaS expression construct was cloned behind the mvaE construct and both assembled into the pSMART-HC-Kan vector, resulting in plasmid pSMART-Mev1, (SEQ ID NO:33).
A plasmid expressing an NADH dependent 2,3-butanediol production pathway was constructed as an operon of three genes. The budA, budB and budC genes from Enterobacter cloacae subsp. dissolvens SDM, encoding an α-acetolactate decarboxylase, an acetolactate synthase and acetoin reductase, respectively, were cloned behind the phosphate dependent waaH gene promoter from E. coli. The operon was assembled into the pSMART-HC-Kan vector, resulting in plasmid pSMART-2,3-BDO1, (SEQ ID NO:34).
A plasmid expressing an NADPH dependent 2,3-butanediol production pathway was constructed as an operon of three genes. The budA, budB genes from Enterobacter cloacae subsp. dissolvens SDM, encoding an α-acetolactate decarboxylase, an acetolactate synthase, and a Glu221Ser/Ile222Arg/Ala223Ser triple mutant bdh1 gene from S. cerevisiae, encoding an NADPH dependent acetoin reductase (Ehsani, M., Fernandez, M R., Biosca J A and Dequin, S. Biotechnol Bioeng. 2009 Oct. 1; 104(2):381-9. doi: 10.1002) respectively, were cloned behind the phosphate dependent waaH gene promoter from E. coli. The operon was assembled into the pSMART-HC-Kan vector, resulting in plasmid pSMART-2,3-BDO2 (SEQ ID NO:35).
Several E. coli strains were constructed utilizing a combination of host strains as described in Example 5, production pathway plasmids as described in Example 8 and CASCADE based gene silencing constructs such as those described in Example 6. Strains were then evaluated for product formation using the standard 96 well plate evaluation protocol “96 Well Plate Protocol-1” as described in the Common Methods Section. Products levels were then measured using the analytical methods as described in the Common Methods Section. These strains and the associated production data are given in Table 2.
| TABLE 2 |
| 3-HP Production from malonyl-CoA and NADPH in 96 well plates |
| Final 3- | Final 3- | ||||
| HP | HP | ||||
| pCASCADE | Production | Titer | Std | ||
| Strain | Host Strain | plasmid | Plasmid | (g/L) | Deviation |
| 1 | DLF_0028 | 0 | 0 | ||
| 2 | DLF_0043 | 0 | 0 | ||
| 3 | DLF_0038 | 0 | 0 | ||
| 4 | DLF_0040 | 0 | 0 | ||
| 5 | DLF_0049 | 0 | 0 | ||
| 6 | DLF_0045 | 0 | 0 | ||
| 7 | DLF_0039 | 0 | 0 | ||
| 8 | DLF_0167 | 0 | 0 | ||
| 9 | DLF_0047 | 0 | 0 | ||
| 10 | DLF_0286 | 0 | 0 | ||
| 11 | DLF_0286 | Empty | 0 | 0 | |
| vector | |||||
| 12 | DLF_0039 | pSMART- | 0 | 0 | |
| 3HP1 | |||||
| 13 | DLF_0028 | pCASCADE- | pSMART- | 0 | 0 |
| fabI | 3HP1 | ||||
| 14 | DLF_0028 | pCASCADE- | pSMART- | 0 | 0 |
| fabI-zwf | 3HP1 | ||||
| 15 | DLF_0043 | pCASCADE- | pSMART- | 0 | 0 |
| fabI | 3HP1 | ||||
| 16 | DLF_0025 | pCASCADE- | pSMART- | 0.02 | 0.03 |
| fabI | 3HP1 | ||||
| 17 | DLF_0045 | pCASCADE- | pSMART- | 0.11 | 0.06 |
| udhA-gltA2 | 3HP1 | ||||
| 18 | DLF_0025 | pSMART- | 0.16 | 0.14 | |
| 3HP1 | |||||
| 19 | DLF_0043 | pCASCADE- | pSMART- | 0.19 | 0.06 |
| gltA2 | 3HP1 | ||||
| 20 | DLF_0025 | pCASCADE- | pSMART- | 0.36 | 0.18 |
| fabI-udhA | 3HP1 | ||||
| 21 | DLF_0046 | pSMART- | 0.41 | 0.14 | |
| 3HP1 | |||||
| 22 | DLF_0039 | pCASCADE- | pSMART- | 0.45 | 0.29 |
| fabI-gltA2 | 3HP1 | ||||
| 23 | DLF_0028 | pSMART- | 0.55 | 0.24 | |
| 3HP1 | |||||
| 24 | DLF_0025 | pCASCADE- | pSMART- | 0.57 | 0.14 |
| udhA | 3HP1 | ||||
| 25 | DLF_0046 | pCASCADE- | pSMART- | 0.58 | 0.09 |
| fabI-udhA | 3HP1 | ||||
| 26 | DLF_0025 | pCASCADE- | pSMART- | 0.66 | 0.26 |
| fabI-zwf | 3HP1 | ||||
| 27 | DLF_0046 | pCASCADE- | pSMART- | 0.89 | 0.11 |
| fabI-zwf | 3HP1 | ||||
| 28 | DLF_0047 | pCASCADE- | pSMART- | 1.00 | 1.74 |
| fabI-gltA1 | 3HP1 | ||||
| 29 | DLF_0038 | pCASCADE- | pSMART- | 1.58 | 0.32 |
| fabI-udhA | 3HP1 | ||||
| 30 | DLF_0039 | pCASCADE- | pSMART- | 1.66 | 0.34 |
| gltA1 | 3HP1 | ||||
| 31 | DLF_0047 | pCASCADE- | pSMART- | 1.82 | 0.41 |
| fabI | 3HP1 | ||||
| 32 | DLF_0047 | pCASCADE- | pSMART- | 2.05 | 0.16 |
| fabI-zwf | 3HP1 | ||||
| 33 | DLF_0038 | pSMART- | 2.09 | 0.34 | |
| 3HP1 | |||||
| 34 | DLF_0047 | pCASCADE- | pSMART- | 2.28 | 0.39 |
| fabI-udhA | 3HP1 | ||||
| 35 | DLF_0047 | pCASCADE- | pSMART- | 2.33 | 1.30 |
| udhA | 3HP1 | ||||
| 36 | DLF_0291 | pCASCADE- | pSMART- | 3.17 | 0.93 |
| gltA2 | 3HP1 | ||||
| 37 | DLF_0291 | pCASCADE- | pSMART- | 4.95 | 2.18 |
| udhA-gltA2 | 3HP1 | ||||
Several E. coli strains were constructed utilizing a combination of host strains as described in Example 5, production pathway plasmids as described in Example 6 and CASCADE based gene silencing constructs such as those described in Example 7. Strains were then evaluated for product formation using the standard mL scale evaluation protocol “Micro24 Protocol-1” as described in the Common Methods Section. Products levels were then measured using the analytical methods as described in the Common Methods Section. Summary metrics are listed in Table 3 and shown in FIG. 8.
| TABLE 3 |
| 3-HP Summary Production metrics for 3-HP produced |
| from malonyl-CoA and NADPH at mL scale. |
| pCASCADE | Production | Final 3-HP | ||
| Strain | Host Strain | plasmid | Plasmid | Titer (g/L) |
| 18 | DLF_0025 | pSMART- | Below Detection | |
| 3HP1 | ||||
| 13 | DLF_0028 | pCASCADE- | pSMART- | 1.48 ± 0.91 |
| fabI | 3HP1 | |||
| 38 | DLF_0038 | pCASCADE- | pSMART- | 4.19 ± 1.39 |
| fabI | 3HP1 | |||
| 39 | DLF_0038 | pCASCADE- | pSMART- | 5.07 ± 1.03 |
| udhA | 3HP1 | |||
| 29 | DLF_0038 | pCASCADE- | pSMART- | 1.17 ± 0.44 |
| fabI-udhA | 3HP1 | |||
| 34 | DLF_0047 | pCASCADE- | pSMART- | 8.71 ± 0.28 |
| fabI-udhA | 3HP1 | |||
E. coli strain 39 from Example 10, was evaluated at 1 L scale using the standard evaluation protocol “1 L Fermentation Protocol-1” as described in the Common Methods Section. Products levels were then measured using the analytical methods as described in the Common Methods Section. Biomass growth and 3-HP production are shown in FIG. 9.
Several E. coli strains were constructed utilizing a combination of host strains as described in Example 5, production pathway plasmids as described in Example 8 and CASCADE based gene silencing constructs such as those described in Example 6. Strains were then evaluated for product formation using the standard 96 well plate evaluation protocol “96 Well Plate Protocol-1” as described in the Common Methods Section. Products levels were then measured using the analytical methods as described in the Common Methods Section. These strains and the associated production data are given in Table 4.
| TABLE 4 |
| Malonic Acid Production from malonyl-CoA in 96 well plates |
| Final | Final | ||||
| Malonic | Malonic | ||||
| Acid | Acid | ||||
| pCASCADE | Production | Titer | Std | ||
| Strain | Host Strain | plasmid | Plasmid | (g/L) | Deviation |
| 1 | DLF_0028 | 0 | 0 | ||
| 2 | DLF_0043 | 0 | 0 | ||
| 3 | DLF_0038 | 0 | 0 | ||
| 4 | DLF_0040 | 0 | 0 | ||
| 5 | DLF_0049 | 0 | 0 | ||
| 6 | DLF_0045 | 0 | 0 | ||
| 7 | DLF_0039 | 0 | 0 | ||
| 8 | DLF_0167 | 0 | 0 | ||
| 9 | DLF_0047 | 0 | 0 | ||
| 10 | DLF_0286 | 0 | 0 | ||
| 11 | DLF_0286 | Empty | 0 | 0 | |
| vector | |||||
| 40 | DLF_0025 | pCASCADE- | Empty | 0 | 0 |
| control | vector | ||||
| 41 | DLF_0025 | pCASCADE- | pSMART- | 0 | 0 |
| control | F6AA82M | ||||
| 42 | DLF_0028 | pCASCADE- | pSMART- | 0.19 | 0.095 |
| control | F6AA82M | ||||
| 43 | DLF_0039 | pCASCADE- | pSMART- | 0 | 0 |
| control | F6AA82M | ||||
| 44 | DLF_0039 | pCASCADE- | pSMART- | 0 | 0 |
| gltA1 | F6AA82M | ||||
| 45 | DLF_0039 | pCASCADE- | pSMART- | 0 | 0 |
| gltA2 | F6AA82M | ||||
| 46 | DLF_0039 | pCASCADE- | pSMART- | 0 | 0 |
| zwf | F6AA82M | ||||
| 47 | DLF_0290 | pCASCADE- | pSMART- | 0.017 | 0.029 |
| control | F6AA82M | ||||
| 48 | DLF_0167 | pCASCADE- | pSMART- | 0.45 | 0.04 |
| control | F6AA82M | ||||
Several E. coli strains were constructed utilizing a combination of host strains as described in Example 5, production pathway plasmids as described in Example 8 and CASCADE based gene silencing constructs such as those described in Example 6. Strains were then evaluated for product formation using the standard 96 well plate evaluation protocol “96 Well Plate Protocol-1” as described in the Common Methods Section. Products levels were then measured using the analytical methods as described in the Common Methods Section. These strains and the associated production data are given in Table 5.
| TABLE 5 |
| Alanine Production from pyruvate and NADPH in 96 well plates |
| Final | Final | ||||
| Alanine | Alanine | ||||
| pCASCADE | Production | Titer | Std | ||
| Strain | Host Strain | plasmid | Plasmid | (g/L) | Deviation |
| 1 | DLF_0028 | 0 | 0 | ||
| 2 | DLF_0043 | 0 | 0 | ||
| 3 | DLF_0038 | 0 | 0 | ||
| 4 | DLF_0040 | 0 | 0 | ||
| 5 | DLF_0049 | 0 | 0 | ||
| 6 | DLF_0045 | 0 | 0 | ||
| 7 | DLF_0039 | 0 | 0 | ||
| 8 | DLF_0167 | 0 | 0 | ||
| 9 | DLF_0047 | 0 | 0 | ||
| 49 | DLF_0042 | pSMART- | 2.62 | 0.069 | |
| Ala1 | |||||
| 50 | DLF_0043 | pCASCADE- | pSMART- | 0 | 0 |
| udhA-gltAl | Ala2 | ||||
| 51 | DLF_0041 | pCASCADE- | pSMART- | 0.23 | 0.075 |
| udhA-gltAl | Ala2 | ||||
| 52 | DLF_0041 | pSMART- | 0.71 | 0.256 | |
| Ala1 | |||||
| 53 | DLF_0049 | pCASCADE- | pSMART- | 1.26 | 0.737 |
| udhA-gltA2 | Ala2 | ||||
| 54 | DLF_0025 | pSMART- | 1.39 | 0.338 | |
| Ala1 | |||||
| 55 | DLF_0049 | pSMART- | 1.48 | 0.136 | |
| Ala1 | |||||
| 56 | DLF_0031 | pSMART- | 1.62 | 0.245 | |
| Ala1 | |||||
| 57 | DLF_0042 | pCASCADE- | pSMART- | 1.63 | 0.190 |
| udhA | Ala2 | ||||
| 58 | DLF_0043 | pSMART- | 1.64 | 0.104 | |
| Ala1 | |||||
| 59 | DLF_0043 | pCASCADE- | pSMART- | 1.72 | 0.355 |
| gltA2 | Ala2 | ||||
| 60 | DLF_0049 | pCASCADE- | pSMART- | 2.42 | 0.105 |
| udhA | Ala2 | ||||
| 61 | DLF_0045 | pCASCADE- | pSMART- | 2.44 | 0.125 |
| udhA-gltA2 | Ala2 | ||||
| 62 | DLF_0049 | pCASCADE- | pSMART- | 2.74 | 0.551 |
| gltA2 | Ala2 | ||||
| 63 | DLF_0041 | pCASCADE- | pSMART- | 3.32 | 1.501 |
| gltA2 | Ala2 | ||||
| 64 | DLF_0045 | pSMART- | 3.65 | 0.441 | |
| Ala1 | |||||
| 65 | DLF_0043 | pCASCADE- | pSMART- | 4.03 | 0.202 |
| udhA-gltA2 | Ala2 | ||||
E. coli strain 49 from Example 13, was evaluated at mL scale using the standard evaluation protocol “Micro24 Protocol-1” as described in the Common Methods Section. Products levels were then measured using the analytical methods as described in the Common Methods Section. Biomass growth and alanine production are shown in FIG. 10.
E. coli strain 60 from Example 13, was evaluated at 1 L scale using the standard evaluation protocol “1 L Fermentation Protocol-1” as described in the Common Methods Section. Products levels were then measured using the analytical methods as described in the Common Methods Section. Biomass growth and alanine production are shown in FIG. 11.
An E. coli strain was made by transforming host strain DLF_00165 with both plasmid pSMART-2,3-BDO1 and pCASCADE-zwf (Refer to Examples 4, 6 and 8). This strain was evaluated at mL scale using the standard evaluation protocol “Micro24 Protocol-1” as described in the Common Methods Section. Products levels were then measured using the analytical methods as described in the Common Methods Section. Biomass growth and alanine production are shown in FIG. 12.
An E. coli strain was made by transforming host strain DLF_00165 with both plasmid pSMART-2,3-BDO1 and pCASCADE-zwf (Refer to Examples 4, 6 and 8). This strain was evaluated at 1 L scale using the standard evaluation protocol “1 L Fermentation Protocol-1” as described in the Common Methods Section. Products levels were then measured using the analytical methods as described in the Common Methods Section. Biomass growth and alanine production are shown in FIG. 13.
An E. coli strain was made by transforming host strain DLF_00049 with both plasmid pSMART-2,3-BDO2 and pCASCADE-udhA (Refer to Examples 4, 6 and 8). This strain was evaluated at mL scale using the standard evaluation protocol “Micro24 Protocol-1” as described in the Common Methods Section. Products levels were then measured using the analytical methods as described in the Common Methods Section. Biomass growth and alanine production are shown in FIG. 14.
An E. coli strain was made by transforming host strain DLF_0004 with plasmid pSMART-Mev1 (Refer to Examples 4 and 8). This strain was evaluated at 1 L scale using the standard evaluation protocol “1 L Fermentation Protocol-1” as described in the Common Methods Section. Products levels were then measured using the analytical methods as described in the Common Methods Section. Biomass growth and alanine production are shown in FIG. 15.
Common Methods Section
All methods in this Section are provided for incorporation into the Examples where so referenced.
Subsection I. Microorganism Species and Strains, Cultures, and Growth Media
Microbial species, that may be utilized as needed, are as follows:
Acinetobacter calcoaceticus (DSMZ #1139) is obtained from the German Collection of Microorganisms and Cell Cultures (Braunschweig, Germany) as a vacuum dried culture. Cultures are then resuspended in Brain Heart Infusion (BHI) Broth (RPI Corp, Mt. Prospect, Ill., USA). Serial dilutions of the resuspended A. calcoaceticus culture are made into BHI and are allowed to grow for aerobically for 48 hours at 37° C. at 250 rpm until saturated.
Bacillus subtilis is a gift from the Gill lab (University of Colorado at Boulder) and is obtained as an actively growing culture. Serial dilutions of the actively growing B. subtilis culture are made into Luria Broth (RPI Corp, Mt. Prospect, Ill., USA) and are allowed to grow for aerobically for 24 hours at 37° C. at 250 rpm until saturated.
Chlorobium limicola (DSMZ #245) is obtained from the German Collection of Microorganisms and Cell Cultures (Braunschweig, Germany) as a vacuum dried culture. Cultures are then resuspended using Pfennig's Medium I and II (#28 and 29) as described per DSMZ instructions. C. limicola is grown at 25° C. under constant vortexing.
Citrobacter braakii (DSMZ #30040) is obtained from the German Collection of Microorganisms and Cell Cultures (Braunschweig, Germany) as a vacuum dried culture. Cultures are then resuspended in Brain Heart Infusion (BHI) Broth (RPI Corp, Mt. Prospect, Ill., USA). Serial dilutions of the resuspended C. braakii culture are made into BHI and are allowed to grow for aerobically for 48 hours at 30° C. at 250 rpm until saturated.
Clostridium acetobutylicum (DSMZ #792) is obtained from the German Collection of Microorganisms and Cell Cultures (Braunschweig, Germany) as a vacuum dried culture. Cultures are then resuspended in Clostridium acetobutylicum medium (#411) as described per DSMZ instructions. C. acetobutylicum is grown anaerobically at 37° C. at 250 rpm until saturated.
Clostridium aminobutyricum (DSMZ #2634) is obtained from the German Collection of Microorganisms and Cell Cultures (Braunschweig, Germany) as a vacuum dried culture. Cultures are then resuspended in Clostridium aminobutyricum medium (#286) as described per DSMZ instructions. C. aminobutyricum is grown anaerobically at 37° C. at 250 rpm until saturated.
Clostridium kluyveri (DSMZ #555) is obtained from the German Collection of Microorganisms and Cell Cultures (Braunschweig, Germany) as an actively growing culture. Serial dilutions of C. kluyveri culture are made into Clostridium kluyveri medium (#286) as described per DSMZ instructions. C. kluyveri is grown anaerobically at 37° C. at 250 rpm until saturated.
Corynebacterium glutamicum (DSMZ #1412) is obtained from the German Collection of Microorganisms and Cell Cultures (Braunschweig, Germany) as an actively growing culture. Serial dilutions of C. glutamicum culture are made into C. glutamicum medium (#1) as described per DSMZ instructions. C. glutamicum is grown aerobically or anaerobically at 37° C. at 250 rpm until saturated.
Cupriavidus metallidurans (DMSZ #2839) is obtained from the German Collection of Microorganisms and Cell Cultures (Braunschweig, Germany) as a vacuum dried culture. Cultures are then resuspended in Brain Heart Infusion (BHI) Broth (RPI Corp, Mt. Prospect, Ill., USA). Serial dilutions of the resuspended C. metallidurans culture are made into BHI and are allowed to grow for aerobically for 48 hours at 30° C. at 250 rpm until saturated.
Cupriavidus necator (DSMZ #428) is obtained from the German Collection of Microorganisms and Cell Cultures (Braunschweig, Germany) as a vacuum dried culture. Cultures are then resuspended in Brain Heart Infusion (BHI) Broth (RPI Corp, Mt. Prospect, Ill., USA). Serial dilutions of the resuspended C. necator culture are made into BHI and are allowed to grow for aerobically for 48 hours at 30° C. at 250 rpm until saturated. As noted elsewhere, previous names for this species are Alcaligenes eutrophus and Ralstonia eutrophus.
Desulfovibrio fructosovorans (DSMZ #3604) is obtained from the German Collection of Microorganisms and Cell Cultures (Braunschweig, Germany) as a vacuum dried culture. Cultures are then resuspended in Desulfovibrio fructosovorans medium (#63) as described per DSMZ instructions. D. fructosovorans is grown anaerobically at 37° C. at 250 rpm until saturated.
Escherichia coli strain BW25113 is obtained from the Yale Genetic Stock Center (New Haven, Conn. 06520) and is obtained as an actively growing culture. Serial dilutions of the actively growing E. coli K12 culture are made into Luria Broth (RPI Corp, Mt. Prospect, Ill., USA) and are allowed to grow for aerobically for 24 hours at 37° C. at 250 rpm until saturated.
Escherichia coli strain BWapldf is a generous gift from George Chen from Tsinghua University in China. Serial dilutions of the actively growing E. coli BWapldf is culture are made into Luria Broth (RPI Corp, Mt. Prospect, Ill., USA) and are allowed to grow for aerobically for 24 hours at 37° C. at 250 rpm until saturated.
Halobacterium salinarum (DSMZ #1576) is obtained from the German Collection of Microorganisms and Cell Cultures (Braunschweig, Germany) as a vacuum dried culture. Cultures are then resuspended in Halobacterium medium (#97) as described per DSMZ instructions. H. salinarum is grown aerobically at 37° C. at 250 rpm until saturated.
Lactobacillus delbrueckii (#4335) is obtained from WYEAST USA (Odell, Oreg., USA) as an actively growing culture. Serial dilutions of the actively growing L. delbrueckii culture are made into Brain Heart Infusion (BHI) broth (RPI Corp, Mt. Prospect, Ill., USA) and are allowed to grow for aerobically for 24 hours at 30° C. at 250 rpm until saturated.
Metallosphaera sedula (DSMZ #5348) is obtained from the German Collection of Microorganisms and Cell Cultures (Braunschweig, Germany) as an actively growing culture. Serial dilutions of M. sedula culture are made into Metallosphaera medium (#485) as described per DSMZ instructions. M. sedula is grown aerobically at 65° C. at 250 rpm until saturated.
Methylococcus capsulatus Bath (ATCC #33009) is obtained from the American Type Culture Collection (ATCC) (Manassas, Va. 20108 USA) as a vacuum dried culture. Cultures are then resuspended in ATCC® Medium 1306: Nitrate mineral salts medium (NMS) under a 50% air 50% methane atmosphere (ATCC, Manassas, Va. 20108 USA) and are allowed to grow at 45° C.
Methylococcus thermophilus IMV 2 Yu T is obtained. Cultures are then resuspended in ATCC® Medium 1306: Nitrate mineral salts medium (NMS) under a 50% air 50% methane atmosphere (ATCC, Manassas, Va. 20108 USA) and are allowed to grow at 50° C.
Methylosinus tsporium (ATCC #35069) is obtained from the American Type Culture Collection (ATCC) (Manassas, Va. 20108 USA) as a vacuum dried culture. Cultures are then resuspended in ATCC® Medium 1306: Nitrate mineral salts medium (NMS) under a 50% air 50% methane atmosphere (ATCC, Manassas, Va. 20108 USA) and are allowed to grow at 30° C.
Pichia pastoris (Komagataella pastoris) (DSMZ #70382) is obtained from the German Collection of Microorganisms and Cell Cultures (Braunschweig, Germany) as a vacuum dried culture. Cultures are then resuspended in YPD-medium (#393) as described per DSMZ instructions. Pichia pastoris is grown aerobically at 30° C. at 250 rpm until saturated.
Propionibacterium freudenreichii subsp. shermanii (DSMZ #4902) is obtained from the German Collection of Microorganisms and Cell Cultures (Braunschweig, Germany) as a vacuum dried culture. Cultures are then resuspended in PYG-medium (#104) as described per DSMZ instructions. P. freudenreichii subsp. shermanii is grown anaerobically at 30° C. at 250 rpm until saturated.
Pseudomonas putida is a gift from the Gill lab (University of Colorado at Boulder) and is obtained as an actively growing culture. Serial dilutions of the actively growing P. putida culture are made into Luria Broth (RPI Corp, Mt. Prospect, Ill., USA) and are allowed to grow for aerobically for 24 hours at 37° C. at 250 rpm until saturated.
Saccharomyces cerevisiae strains can be obtained from the American Type Culture Collection (ATCC) (Manassas, Va. 20108 USA) as a vacuum dried culture. Cultures are then resuspended in YPD Media and allowed to grow at 30° C.
Streptococcus mutans (DSMZ #6178) is obtained from the German Collection of Microorganisms and Cell Cultures (Braunschweig, Germany) as a vacuum dried culture. Cultures are then resuspended in Luria Broth (RPI Corp, Mt. Prospect, Ill., USA). S. mutans is grown aerobically at 37° C. at 250 rpm until saturated.
Yarrowia lipolytica (DSMZ #1345) is obtained from the German Collection of Microorganisms and Cell Cultures (Braunschweig, Germany) as a vacuum dried culture. Cultures are then resuspended in YPD-medium (#393) as described per DSMZ instructions Yarrowia lipolytica is grown aerobically at 37° C. at 250 rpm until saturated.
Subsection II. Molecular Biology Techniques—DNA Cloning
In addition to the above or below specific examples, this example is meant to describe a non-limiting approach to genetic modification of a selected microorganism to introduce, remove or alter a nucleic acid sequence of interest. Alternatives and variations are provided within this general example. The methods of this example are conducted to achieve a combination of desired genetic modifications in a selected microorganism species, such as a combination of genetic modifications as described in sections herein, and their functional equivalents, such as in other bacterial and other microorganism species.
A gene or other nucleic acid sequence segment of interest is identified in a particular species (such as E. coli as described herein) and a nucleic acid sequence comprising that gene or segment is obtained.
Based on the nucleic acid sequences at the ends of or adjacent the ends of the segment of interest, 5′ and 3′ nucleic acid primers are prepared. Each primer is designed to have a sufficient overlap section that hybridizes with such ends or adjacent regions. Such primers may include enzyme recognition sites for restriction digest of transposase insertion that could be used for subsequent vector incorporation or genomic insertion. These sites are typically designed to be outward of the hybridizing overlap sections. Numerous contract services are known that prepare primer sequences to order (e.g., Integrated DNA Technologies, Coralville, Iowa USA).
Once primers are designed and prepared, polymerase chain reaction (PCR) is conducted to specifically amplify the desired segment of interest. This method results in multiple copies of the region of interest separated from the microorganism's genome. The microorganism's DNA, the primers, and a thermophilic polymerase are combined in a buffer solution with potassium and divalent cations (e.g., Mg or Mn) and with sufficient quantities of deoxynucleoside triphosphate molecules. This mixture is exposed to a standard regimen of temperature increases and decreases. However, temperatures, components, concentrations, and cycle times may vary according to the reaction according to length of the sequence to be copied, annealing temperature approximations and other factors known or readily learned through routine experimentation by one skilled in the art.
In an alternative embodiment the segment of interest may be synthesized, such as by a commercial vendor, and prepared via PCR, rather than obtaining from a microorganism or other natural source of DNA.
The nucleic acid sequences then are purified and separated, such as on an agarose gel via electrophoresis. Optionally, once the region is purified it can be validated by standard DNA sequencing methodology and may be introduced into a vector. Any of a number of vectors may be used, which generally comprise markers known to those skilled in the art, and standard methodologies are routinely employed for such introduction. Commonly used vector systems are well known in the art. Similarly, the vector then is introduced into any of a number of host cells. Commonly used host cells are E. coli strains. Some of these vectors possess promoters, such as inducible promoters, adjacent the region into which the sequence of interest is inserted (such as into a multiple cloning site). The culturing of such plasmid-laden cells permits plasmid replication and thus replication of the segment of interest, which often corresponds to expression of the segment of interest.
Various vector systems comprise a selectable marker, such as an expressible gene encoding a protein needed for growth or survival under defined conditions. Common selectable markers contained on backbone vector sequences include genes that encode for one or more proteins required for antibiotic resistance as well as genes required to complement auxotrophic deficiencies or supply critical nutrients not present or available in a particular culture media. Vectors also comprise a replication system suitable for a host cell of interest.
The plasmids containing the segment of interest can then be isolated by routine methods and are available for introduction into other microorganism host cells of interest. Various methods of introduction are known in the art and can include vector introduction or genomic integration. In various alternative embodiments the DNA segment of interest may be separated from other plasmid DNA if the former will be introduced into a host cell of interest by means other than such plasmid.
While steps of the general prophetic example involve use of plasmids, other vectors known in the art may be used instead. These include cosmids, viruses (e.g., bacteriophage, animal viruses, plant viruses), and artificial chromosomes (e.g., yeast artificial chromosomes (YAC) and bacteria artificial chromosomes (BAC)).
Host cells into which the segment of interest is introduced may be evaluated for performance as to a particular enzymatic step, and/or tolerance or bio-production of a chemical compound of interest. Selections of better performing genetically modified host cells may be made, selecting for overall performance, tolerance, or production or accumulation of the chemical of interest.
It is noted that this procedure may incorporate a nucleic acid sequence for a single gene (or other nucleic acid sequence segment of interest), or multiple genes (under control of separate promoters or a single promoter), and the procedure may be repeated to create the desired heterologous nucleic acid sequences in expression vectors, which are then supplied to a selected microorganism so as to have, for example, a desired complement of enzymatic conversion step functionality for any of the herein-disclosed metabolic pathways. However, it is noted that although many approaches rely on expression via transcription of all or part of the sequence of interest, and then translation of the transcribed mRNA to yield a polypeptide such as an enzyme, certain sequences of interest may exert an effect by means other than such expression.
The specific laboratory methods used for these approaches are well-known in the art and may be found in various references known to those skilled in the art, such as Sambrook and Russell, Molecular Cloning: A Laboratory Manual, Third Edition 2001 (volumes 1-3), Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (hereinafter, Sambrook and Russell, 2001).
As an alternative to the above, other genetic modifications may also be practiced, such as a deletion of a nucleic acid sequence of the host cell's genome. One non-limiting method to achieve this is by use of Red/ET recombination, known to those of ordinary skill in the art and described in U.S. Pat. Nos. 6,355,412 and 6,509,156, issued to Stewart et al. and incorporated by reference herein for its teachings of this method. Material and kits for such method are available from Gene Bridges (Gene Bridges GmbH, Dresden, Germany), and the method may proceed by following the manufacturer's instructions. Targeted deletion of genomic DNA may be practiced to alter a host cell's metabolism so as to reduce or eliminate production of undesired metabolic products. This may be used in combination with other genetic modifications such as described herein in this general example.
In addition to the above, longer purified double stranded DNA fragments can now be specified and ordered from a variety of vendors. These DNA pieces can easily be assembled together into plasmid vectors as well as longer synthetic DNA constructs using Gibson Assembly methodologies as taught by Gibson, D. G., et al. “Enzymatic assembly of DNA molecules up to several hundred kilobases” Nature Methods. May 2009. Vol(6) p. 343-345. doi:10.1038.
In addition to the above, once synthetic genetic parts such as open reading frames, promoters and terminators have been synthesized, it is well known in the art, that these parts can easily be shuffled into numerous different combinations using numerous variant assembly technologies, such as Golden Gate Assembly taught by Engler, C., Kandzia, R., and Marillonnet, S., “A one pot, one step, precision cloning method with high throughput capability”. PLoS ONE 2008; 3(11):e3647. doi: 10.1371.
Subsection III. Molecular Biology Techniques—Chromosomal Modifications in E. coli
Chromosomal modifications can be made to E. coli using one of many methods including phage transduction and recombineering. It is appreciated that one skilled in the art is well versed in these methods. Of particular use are scarless recombineering methods, which allow for the precise deletion or addition of sequences to the chromosome without any unneeded sequences remaining such as that taught by Li, X., et al. “Positive and negative selection using the tetA-sacB cassette: recombineering and P1 transduction in Escherichia coli”. Nucleic Acids Res. December 2013. 41(22) doi: 10.1093.
Subsection IV. Molecular Biology Techniques—Chromosomal Modifications in Saccharomyces cerevisiae.
Chromosomal modifications can be made to many yeast strains including Saccharomyces cerevisiae. using methods well known in the art for homologous recombination. It is appreciated that one skilled in the art is well versed in these methods.
Subsection V: Media for E. coli
GM25 media: GM25 minimal growth media for E. coli contained per liter: 736 mL sterile distilled, deionized water, 2.0 mL of 100× Trace Metals Stock, 100 mL of 10×GM phosphate salts, 2.0 mL of 2M MgSO4, 50 mL of 500 g/L glucose, 100 mL of 1 M MOPS buffer, pH 7.4, and 10.0 mL of 100 g/L Yeast Extract. The 100× Trace Metal Stock was prepared in 1.0 L of distilled, deionized water with 10.0 mL of concentrated HCl with 5.0 g CaCl2)*2H2O, 1.00 g FeCl3*6H2O, 0.05 g CoCl2*6H2O, 0.3 g CuCl2*2H2O, 0.02 g ZnCl2, 0.02 g Na2MoO4*2H2O, 0.01 g H3BO3, and 0.04 g MnCl2*4H2O and 0.2 μm sterile-filtered. The 10×GM Phosphate Salts were prepared in 1.0 L of distilled, deionized water with 3 g K2HPO4, 2 g KH2PO4, 30 g (NH4)2SO4, and 1.5 g Citric Acid (anhydrous) and autoclaved. The 2M MgSO4 was prepared in 1.0 L of distilled, deionized water with 240.0 g of anhydrous MgSO4 and 0.2 μm sterile-filtered. The 500 g/L Glucose solution was prepared in 1.0 L of heated distilled, deionized water and 500 g of anhydrous dextrose and 0.2 μm sterile-filtered. The 1 M 4-Morpholinopropanesulfonic acid (MOPS) buffer was prepared in 700.0 mL of distilled, deionized water with 210.0 g MOPS and 30.0 mL 50% KOH solution. The pH was measured with stirring and final adjustments made to pH 7.4 by slowly adding 50% KOH and Q.S. to a final volume of 1.0 L. The final pH 7.4 solution was 0.2 μm sterile-filtered.
PM25 media: PM25 minimal production media for E. coli contained per liter: 636 mL sterile distilled, deionized water, 2.0 mL of 100× Trace Metals Stock, 100 mL of 10×PM phosphate-free salts, 2.0 mL of 2M MgSO4, 50 mL of 500 g/L glucose, 200 mL of 1 M MOPS buffer, pH 7.4, and 10 mL of 1 mg/mL Thiamine. The 100× Trace Metal Stock was prepared in 1.0 L of distilled, deionized water with 10.0 mL of concentrated HCl with 5.0 g CaCl2)*2H2O, 1.00 g FeCl3*6H2O, 0.05 g CoCl2*6H2O, 0.3 g CuCl2*2H2O, 0.02 g ZnCl2, 0.02 g Na2MoO4*2H2O, 0.01 g H3BO3, and 0.04 g MnCl2*4H2O and 0.2 μm sterile-filtered. The 10× PM Phosphate-Free Salts were prepared in 1.0 L of distilled, deionized water with 30 g (NH4)2SO4 and 1.5 g Citric Acid (anhydrous) and autoclaved. The 2M MgSO4 was prepared in 1.0 L of distilled, deionized water with 240.0 g of anhydrous MgSO4 and 0.2 μm sterile-filtered. The 500 g/L Glucose solution was prepared in 1.0 L of heated distilled, deionized water and 500 g of anhydrous dextrose and 0.2 μm sterile-filtered. The 1 M 4-Morpholinopropanesulfonic acid (MOPS) buffer was prepared in 700.0 mL of distilled, deionized water with 210.0 g MOPS and 30.0 mL 50% KOH solution. The pH was measured with stirring and final adjustments made to pH 7.4 by slowly adding 50% KOH and Q.S. to a final volume of 1.0 L. The final pH 7.4 solution was 0.2 μm sterile-filtered.
SM3 Media: SM3 minimal media for E. coli contained per liter: 596.2 mL sterile distilled, deionized water, 2.0 mL of 100× Trace Metals Stock, 100 mL of 10× Ammonium Citrate 30 Salts, 3.6 mL of Phosphate Buffer, pH=6.8, 2 mL of 40 mM Fe(II) sulfate, 1.0 mL of 2M MgSO4, 5.0 mL of 10 mM CaSO4, 90 mL of 500 g/L glucose, 200 mL of 1 M MOPS buffer, pH 7.4, and 0.2 mL of 1 mg/mL Thiamine and 10.0 mL of 100 g/L Yeast Extract. Prepare 1 liter of 10× concentrated Ammonium-Citrate 30 salts by mixing 30 g of (NH4)2SO4 and 1.5 g Citric Acid in water with stirring. Autoclave and store at room temperature. Prepare a 1 M Potassium 3-(N-morpholino)propanesulfonic Acid (MOPS) and adjust to pH 7.4 with KOH (˜40 mL). Filter sterilize (0.2 um) and store at room temperature in the dark. Prepare a 0.1 M potassium phosphate buffer, pH 6.8 by mixing 49.7 mL of 1.0 M K2HPO4 and 50.3 mL of 1.0 M KH2PO4 and adjust to a final volume of 1000 mL with ultrapure water. Filter sterilize (0.2 um) and store at room temperature. Prepare 2 M MgSO4 and 10 mM CaSO4 solutions. Filter sterilize (0.2 um) and store at room temperature. Prepare a solution of 100× Trace metals in 1000 mL of water containing 10 mL of concentrated H2SO4: 0.6 g CoSO4*7H2O, 5.0 g CuSO4*5H2O, 0.6 g ZnSO4*7H2O, 0.2 g Na2MoO4*2H2O, 0.1 g H3BO3, and 0.3 g MnSO4*H2O. Filter sterilize (0.2 um) and store at room temperature in the dark. Prepare a fresh solution of 40 mM ferrous sulfate heptahydrate in water. Filter sterilize (0.2 um) and discard after 1 day. Prepare a 50 g/L solution of thiamine-HCl. Filter sterilize (0.2 um) and store at 4 degrees Celsius. Prepare a 500 g/L solution of glucose by stirring with heat. Cool, filter sterilize (0.2 um), and store at room temperature.
SM10 Media: SM10 minimal media for E. coli contained per liter: 574.3 mL sterile distilled, deionized water, 4.0 mL of 100× Trace Metals Stock, 100 mL of 10× Ammonium Citrate 90 Salts, 10.0 mL of Phosphate Buffer, pH=6.8, 4 mL of 40 mM Fe(II) sulfate, 1.25 mL of 2M MgSO4, 6.25 mL of 10 mM CaSO4, 90 mL of 500 g/L glucose, 200 mL of 1 M MOPS buffer, pH 7.4, and 0.2 mL of 1 mg/mL Thiamine and 10.0 mL of 100 g/L Yeast Extract. Prepare 1 liter of 10× concentrated Ammonium-Citrate 90 salts by mixing 90 g of (NH4)2SO4 and 2.5 g Citric Acid Autoclave and store at room temperature. 0.1 M potassium phosphate buffer, pH 6.8 by mixing 49.7 mL of 1.0 M K2HPO4 and 50.3 mL of 1.0 M KH2PO4 and adjust to a final volume of 1000 mL with ultrapure water. Prepare a 1 M Potassium 3-(N-morpholino)propanesulfonic Acid (MOPS) and adjust to pH 7.4 with KOH (˜40 mL). Filter sterilize (0.2 um) and store at room temperature in the dark. Filter sterilize (0.2 um) and store at room temperature. Prepare 2 M MgSO4 and 10 mM CaSO4 solutions. Filter sterilize (0.2 um) and store at room temperature. Prepare a solution of 100× Trace metals in 1000 mL of water containing 10 mL of concentrated H2SO4: 0.6 g CoSO4*7H2O, 5.0 g CuSO4*5H2O, 0.6 g ZnSO4*7H2O, 0.2 g Na2MoO4*2H2O, 0.1 g H3BO3, and 0.3 g MnSO4*H2O. Filter sterilize (0.2 um) and store at room temperature in the dark. Prepare a fresh solution of 40 mM ferrous sulfate heptahydrate in water. Filter sterilize (0.2 um) and discard after 1 day. Prepare a 50 g/L solution of thiamine-HCl. Filter sterilize (0.2 um) and store at 4 degrees Celsius. Prepare a 500 g/L solution of glucose by stirring with heat. Cool, filter sterilize (0.2 um), and store at room temperature.
SM10++ Media: SM10 minimal media for E. coli contained per liter: 549.3 mL sterile distilled, deionized water, 4.0 mL of 100× Trace Metals Stock, 100 mL of 10× Ammonium Citrate 90 Salts, 10.0 mL of Phosphate Buffer, pH=6.8, 4 mL of 40 mM Fe(II) sulfate, 1.25 mL of 2M MgSO4, 6.25 mL of 10 mM CaSO4, 90 mL of 500 g/L glucose, 200 mL of 1 M MOPS buffer, pH 7.4, and 0.2 mL of 1 mg/mL Thiamine and 25.0 mL of 100 g/L Yeast Extract and 25.0 mL of 100 g/L Casamino acids. Prepare 1 liter of 10× concentrated Ammonium-Citrate 90 salts by mixing 90 g of (NH4)2SO4 and 2.5 g Citric Acid Autoclave and store at room temperature. 0.1 M potassium phosphate buffer, pH 6.8 by mixing 49.7 mL of 1.0 M K2HPO4 and 50.3 mL of 1.0 M KH2PO4 and adjust to a final volume of 1000 mL with ultrapure water. Filter sterilize (0.2 um) and store at room temperature. Prepare a 1 M Potassium 3-(N-morpholino)propanesulfonic Acid (MOPS) and adjust to pH 7.4 with KOH (˜40 mL). Filter sterilize (0.2 um) and store at room temperature in the dark. Prepare 2 M MgSO4 and 10 mM CaSO4 solutions. Filter sterilize (0.2 um) and store at room temperature. Prepare a solution of 100× Trace metals in 1000 mL of water containing 10 mL of concentrated H2SO4: 0.6 g CoSO4*7H2O, 5.0 g CuSO4*5H2O, 0.6 g ZnSO4*7H2O, 0.2 g Na2MoO4*2H2O, 0.1 g H3B03, and 0.3 g MnSO4*H2O. Filter sterilize (0.2 um) and store at room temperature in the dark. Prepare a fresh solution of 40 mM ferrous sulfate heptahydrate in water. Filter sterilize (0.2 um) and discard after 1 day. Prepare a 50 g/L solution of thiamine-HCl. Filter sterilize (0.2 um) and store at 4 degrees Celsius. Prepare a 500 g/L solution of glucose by stirring with heat. Cool, filter sterilize (0.2 um), and store at room temperature.
FGM3 Media: FGM3 media for E. coli contained per liter: 636.2 mL sterile distilled, deionized water, 2.0 mL of 100× Trace Metals Stock, 100 mL of 10× Ammonium Citrate 20 Salts, 3.6 mL of Phosphate Buffer, pH=6.8, 2 mL of 40 mM Fe(II) sulfate, 1.0 mL of 2M MgSO4, 5.0 mL of 10 mM 2M CaSO4, 50 mL of 500 g/L glucose, 200 mL of 1 M MOPS buffer, pH 7.4, and 0.2 mL of 1 mg/mL Thiamine. Prepare 1 liter of 10× concentrated Ammonium-Citrate 20 salts by mixing 20 g of (NH4)2SO4 and 1.5 g Citric Acid in water with stirring. Autoclave and store at room temperature. Prepare 1 liter of 10× concentrated Ammonium-Citrate 30 salts by mixing 30 g of (NH4)2SO4 and 1.5 g Citric Acid in water with stirring. Autoclave and store at room temperature. 0.1 M potassium phosphate buffer, pH 6.8 by mixing 49.7 mL of 1.0 M K2HPO4 and 50.3 mL of 1.0 M KH2PO4 and adjust to a final volume of 1000 mL with ultrapure water. Filter sterilize (0.2 um) and store at room temperature. Prepare 2 M MgSO4 and 10 mM CaSO4 solutions. Filter sterilize (0.2 um) and store at room temperature. Prepare a solution of 100× Trace metals in 1000 mL of water containing 10 mL of concentrated H2SO4: 0.6 g CoSO4*7H2O, 5.0 g CuSO4*5H2O, 0.6 g ZnSO4*7H2O, 0.2 g Na2MoO4*2H2O, 0.1 g H3BO3, and 0.3 g MnSO4*H2O. Filter sterilize (0.2 um) and store at room temperature in the dark. Prepare a fresh solution of 40 mM ferrous sulfate heptahydrate in water. Filter sterilize (0.2 um) and discard after 1 day. Prepare a 50 g/L solution of thiamine-HCl. Filter sterilize (0.2 um) and store at 4 degrees Celsius. Prepare a 500 g/L solution of glucose by stirring with heat. Cool, filter sterilize (0.2 um), and store at room temperature.
FGM10 Media: FGM10 media for E. coli contained per liter: 824.3 mL sterile distilled, deionized water, 4.0 mL of 100× Trace Metals Stock, 100 mL of 10× Ammonium Citrate 90 Salts, 10.0 mL of Phosphate Buffer, pH=6.8, 4 mL of 40 mM Fe(II) sulfate, 1.25 mL of 2M MgSO4, 6.25 mL of 10 mM 2M CaSO4, 50 mL of 500 g/L glucose, and 0.2 mL of 1 mg/mL Thiamine. Prepare 1 liter of 10× concentrated Ammonium-Citrate 90 salts by mixing 90 g of (NH4)2SO4 and 2.5 g Citric Acid Autoclave and store at room temperature. Prepare 1 liter of 10× concentrated Ammonium-Citrate 90 salts by mixing 90 g of (NH4)2SO4 and 2.5 g Citric Acid Autoclave and store at room temperature. 0.1 M potassium phosphate buffer, pH 6.8 by mixing 49.7 mL of 1.0 M K2HPO4 and 50.3 mL of 1.0 M KH2PO4 and adjust to a final volume of 1000 mL with ultrapure water. Filter sterilize (0.2 um) and store at room temperature. Prepare 2 M MgSO4 and 10 mM CaSO4 solutions. Filter sterilize (0.2 um) and store at room temperature. Prepare a solution of 100× Trace metals in 1000 mL of water containing 10 mL of concentrated H2SO4: 0.6 g CoSO4*7H2O, 5.0 g CuSO4*5H2O, 0.6 g ZnSO4*7H2O, 0.2 g Na2MoO4*2H2O, 0.1 g H3BO3, and 0.3 g MnSO4*H2O. Filter sterilize (0.2 um) and store at room temperature in the dark. Prepare a fresh solution of 40 mM ferrous sulfate heptahydrate in water. Filter sterilize (0.2 um) and discard after 1 day. Prepare a 50 g/L solution of thiamine-HCl. Filter sterilize (0.2 um) and store at 4 degrees Celsius. Prepare a 500 g/L solution of glucose by stirring with heat. Cool, filter sterilize (0.2 um), and store at room temperature.
96WPM Media: 96WPM media for E. coli contained per liter: 638.8 mL sterile distilled, deionized water, 2.0 mL of 100× Trace Metals Stock, 100 mL of 10× Ammonium Citrate 30 Salts, 2 mL of 40 mM Fe(II) sulfate, 2.0 mL of 2M MgSO4, 5.0 mL of 10 mM 2M CaSO4, 50 mL of 500 g/L glucose, 200 mL of 1 M MOPS buffer, pH 7.4, and 0.2 mL of 1 mg/mL Thiamine and 10.0 mL of 100 g/L Yeast Extract. Prepare 1 liter of 10× concentrated Ammonium-Citrate 30 salts by mixing 30 g of (NH4)2SO4 and 1.5 g Citric Acid in water with stirring. Autoclave and store at room temperature. Prepare a 1 M Potassium 3-(N-morpholino)propanesulfonic Acid (MOPS) and adjust to pH 7.4 with KOH (˜40 mL). Filter sterilize (0.2 um) and store at room temperature in the dark. Prepare 2 M MgSO4 and 10 mM CaSO4 solutions. Filter sterilize (0.2 um) and store at room temperature. Prepare a solution of 100× Trace metals in 1000 mL of water containing 10 mL of concentrated H2SO4: 0.6 g CoSO4*7H2O, 5.0 g CuSO4*5H2O, 0.6 g ZnSO4*7H2O, 0.2 g Na2MoO4*2H2O, 0.1 g H3B03, and 0.3 g MnSO4*H2O. Filter sterilize (0.2 um) and store at room temperature in the dark. Prepare a fresh solution of 40 mM ferrous sulfate heptahydrate in water. Filter sterilize (0.2 um) and discard after 1 day. Prepare a 50 g/L solution of thiamine-HCl. Filter sterilize (0.2 um) and store at 4 degrees Celsius. Prepare a 500 g/L solution of glucose by stirring with heat. Cool, filter sterilize (0.2 um), and store at room temperature.
Antibiotic concentrations: Unless other wise stated standard final concentrations of antibiotic in media are kanamycin (35 ug/mL), ampicillin (100 ug/ml), spectinomycin (100 ug/ml), chloramphenicol (20 ug/ml), anhydrotetracycline (50 ng/ml), gentamicin (10 ug/ml), zeocin (50 ug/ml), blasticidin (50 ug/ml). Low salt medium such as low salt LB medium is used when using blasticidin or zeocin as selective antibiotics.
Subsection VI: Protocols for Production in E. coli
Shake Flask Protocol-1
Bioproduction is demonstrated at a 50-mL scale using GM25 minimal defined media without phosphate. Cultures are started from single colonies by standard practice into 50 mL of GM25 media containing 3.2 mM phosphate plus appropriate antibiotics and grown to stationary phase overnight at 30° C. with rotation at 200 rpm. The optical density (OD600, 1 cm pathlength) of each stationary phase culture is measured and the entire culture is transferred to 50 mL conical tubes and centrifuged at 4,000 rpm for 15 minutes. A 20 optical density resuspension is generated for each culture by calculating the volume of GM25 media to add to the pellet. Two and a half mL of this resuspension is added to 50 mL of PM25 media plus appropriate antibiotic in triplicate 250-ml non-baffled flasks and incubated at 30° C., 200 rpm. To monitor cell growth and production by these cultures, samples (2 ml) are withdrawn at designated time points for optical density measurements at 600 nm (OD600, 1 cm pathlength). Samples are centrifuged at 14,000 rpm for 5 minutes and the supernatant retained at −20° C. for analyte measurements. Cultures are shifted to production by changing the temperature of the shaking incubator to 37° C. at 4 hours post-inoculation. A sample is collected at this time point as well as 6-, 8-, and 24-hours post-inoculation for optical density and product measurement.
Shake Flask Protocol-2
Bioproduction is demonstrated at a 50-mL scale in GM25 minimal defined media without phosphate. Cultures are started from single colonies by standard practice into 50 mL of GM25 media containing 3.2 mM phosphate plus appropriate antibiotic(s) and grown to stationary phase overnight at 37° C. with rotation at 200 rpm. The optical density (OD600, 1 cm pathlength) of each stationary phase culture is measured and the entire culture was transferred to 50 mL conical tubes and centrifuged at 4,000 rpm for 15 minutes. A 20 optical density resuspension is generated for each culture by calculating the volume of GM25 media to add to the pellet. Two and a half mL of this resuspension is added to 50 mL of PM25 media plus antibiotics in triplicate 250-ml non-baffled flasks and incubated at 37° C., 200 rpm. To monitor cell growth and production by these cultures, samples (2 ml) are withdrawn at designated time points for optical density measurements at 600 nm (OD600, 1 cm pathlength). Samples are centrifuged at 14,000 rpm for 5 minutes and the supernatant retained at −20° C. for analyte measurements. Cultures are shifted to production by inducing the cultures using 50 ng/mL of anhydrotetracycline (aTc) at inoculation. A sample was collected at this time point as well as 4 and 20-hours post-inoculation for optical density and product measurement.
96 Well Plate Protocol-1
Bioproduction is demonstrated at μL in minimal medium. Colonies were used to inoculate individual wells in standard 96 well plates, filled with 150 μL of SM10++ medium with the appropriate antibiotics as needed. Plates were covered with sandwich covers (Model #CR1596 obtained from EnzyScreen, Haarlam, The Netherlands). These covers ensure minimal evaporative loss during incubation. To ensure adequate aeration, the inoculated 96 well plates and sandwich covers were clamped into place into a Mini Shaking Incubator (VWR Catalog #12620-942, VWR International LLC., Radnor, Pa., USA.) at a temperature set to 37 degrees Celsius and a shaking speed of 1100 rpm. The plate clamps used were obtained from Enzyscreen (Model #CR1600, EnzyScreen, Haarlam, The Netherlands). Importantly, the shaker used had an orbit of 0.125 inches or 3 mm. This combination of orbit and minimal shaking speed is required to obtain needed mass transfer coefficient and enable adequate culture oxygenation. Cultures were grown for 16 hours.
After 16 hours of growth, 10 μL samples were taken to measure the optical density at 600 nm (OD(600 nm)). This was done using a plate spectrophotometer. Overnight cell densities at this point often range from 5-15 OD(600 nm). Cells from 100 μL of overnight growth in each well were pelleted by centrifugation, excess media was removed and cells were resuspended in 150 μL of 96WPM, which contains no phosphate. Subsequently cells were once again pelleted and again excess media was removed. Using the overnight measured optical densities, enough fresh 96WPM was added to each well, so upon re-suspension a final OD(600 nm) of 20 was obtained. 7.5 μL of the normalized and washed cultures of OD(600 nm)=20, was used to inoculate 150 μL of fresh 96WPM, plus appropriate antibiotics, in wells of a new standard 96 well plate. Plates were covered with sandwich covers (Model #CR1596 obtained from EnzyScreen, Haarlam, The Netherlands) and clamped into place into a Mini Shaking Incubator (VWR Catalog #12620-942, VWR International LLC., Radnor, Pa., USA.) at a temperature set to 37 degrees Celsius and a shaking speed of 1100 rpm. The plate clamps used were obtained from Enzyscreen (Model #CR1600, EnzyScreen, Haarlam, The Netherlands). Cultures were incubated for 24 hours. After 16-24 hours of production, 100 μL samples from each well were pelleted by centrifugation and the supernatant collected for subsequent analytical analyses.
Micro24 Protocol-1
Bioproduction is demonstrated at mL scale in minimal medium. Seeds were prepared as follows. Colonies were used to inoculate 4 mL of SM10 medium, with appropriate antibiotics as needed, into a sterile 14 mL culture tube. Culture tubes were incubated overnight at 37 degrees Celsius in a standard floor model shaking incubator at 225 rpm. After overnight growth, 2.5 mL of these cultures were used to inoculate 50 mL of fresh SM10 medium, plus appropriate antibiotics as needed, in a 250 mL volume disposable and sterile rectangular cell culture flask, such as a Cellstar™ Cell Culture Flask (VWR Catalog #82050-856, VWR International LLC., Radnor, Pa., USA.). These seed cultures were incubated at 37 degrees Celsius in a standard floor model shaking incubator at 225 rpm. Samples were taken every few hours to measure the growth by optical density (OD(600 nm)), until they reached at an OD(600 nm) in the range of 4-10. At this point, cells were harvested by centrifugation, excess media removed and resuspended in fresh SM10 media to obtain a final OD(600 nm) of 10. 500 μL of washed and normalized cells was added to 500 μL of 30% sterile glycerol in water, mixed and frozen in cryovial (seed vials) at minus 80 degrees Celsius in a ultralow temperature freezer.
The Micro-24™ Microreactor system (Pall Corporation, Exton, Pa., USA) was used to evaluate strains at the mL scale. Pall 24-well PERC cassettes (Catalogue #MRT-PRC) were used for cell growth and production along with stainless steel check valve caps (Catalogue #MRT-CAP-E24). The experimental protocol was set up with an initial volume of 3 mL of FGM3 medium, with appropriate antibiotics as needed, and an agitation of 1000 rpm. pH control was initially turned off. The temperature was controlled at 37 degrees Celsius, with an environmental temperature of 35 degrees Celsius. Oxygen control was initially turned off with monitoring enabled. Frozen seed vials were thawed on ice and 150 μL was used to inoculate each 3 mL culture in each Micro24 cassette well. Samples were collected at inoculation and at regular intervals. Optical density of samples was measured at 600 nm, glucose using a YSI biochemistry analyzer was measured as described below. In addition, supernatants were collected for subsequent analytical analyses. pH control was turned on for each well at the point at which the culture's optical densities as measured at 600 nm was greater than 1.0. pH control was achieved with pressured ammonium hydroxide gas. In addition, oxygen control was turned on for each well when the dissolved oxygen reached below 60%. Glucose boluses of 10 g/L were added both 24 and 48 hours post inoculation using a sterile 500 g/L stock solution.
1 L Fermentation Protocol-1
Bioproduction is demonstrated at L scale in minimal medium. Seeds were prepared as follows. Colonies were used to inoculate 4 mL of SM10 medium, with appropriate antibiotics as needed, into a sterile 14 mL culture tube. Culture tubes were incubated overnight at 37 degrees Celsius in a standard floor model shaking incubator at 225 rpm. After overnight growth, 2.5 mL of these cultures were used to inoculate 50 mL of fresh SM10 medium, plus appropriate antibiotics as needed, in a 250 mL volume disposable and sterile rectangular cell culture flask, such as a Cellstar™ Cell Culture Flask (VWR Catalog #82050-856, VWR International LLC., Radnor, Pa., USA.). These seed cultures were incubated at 37 degrees Celsius in a standard floor model shaking incubator at 225 rpm. Samples were taken every few hours to measure the growth by optical density (OD(600 nm)), until they reached at an OD(600 nm) in the range of 4-10. At this point, cells were harvested by centrifugation, excess media removed and resuspended in fresh SM10 media to obtain a final OD(600 nm) of 10. 3.5 mL of washed and normalized cells was added to 3.5 mL of 30% sterile glycerol in water, mixed and frozen in cryovial (seed vials) at minus 80 degrees Celsius in a ultralow temperature freezer.
An Infors-HT Multifors (Laurel, Md., USA) parallel bioreactor system was used to perform 1 L fermentations, including three gas connection mass flow controllers configured for air, oxygen and nitrogen gases. Vessels used had a total volume of 1400 mL and a working volume of up to 1 L. Online pH and PO2 monitoring and control were accomplished with Hamilton probes. Offgas analysis was accomplished with a multiplexed Blue-in-One BlueSens gas analyzer (BlueSens. Northbrook, Ill., USA). Culture densities were continually monitored using Optek 225 mm OD probes, (Optek, Germantown, Wis., USA). The system used was running IrisV6.0 command and control software and integrated with a Seg-flow automated sampling system (Flownamics, Rodeo, Calif. USA), including FISP cell free sampling probes, a Segmod 4800 and FlowFraction 96 well plate fraction collector.
Tanks were filled with 800 mL of FGM10 Medium, with enough phosphate to target a final E. coli biomass concentration close to 10 g dry cell weight per liter. Antibiotics were added as appropriate. Frozen seed vials were thawed on ice and 7 mL of seed culture was used to inoculate the tanks. After inoculation, tanks were controlled at 37 degrees Celsius and pH 6.8 using a 10M solution of sodium hydroxide solution as a titrant. The following oxygen control scheme was used to maintain a dissolved oxygen set point of 25%. First gas flow rate was increased from a minimum of 0.3 L/min of air to 0.8 L/min of air, subsequently, if more aeration was needed, agitation was increased from a minimum of 300 rpm to a maximum of 1000 rpm. Finally if more oxygen was required to achieve a 25% set point, oxygen supplementation was included using the integrated mass flow controllers. A constant concentrated sterile filtered glucose feed (500 g/L) was added to the tanks at a rate of 2 mL/hr, once agitation reached 800 rpm. Fermentation runs were extended for up to 70 hrs and samples automatically withdrawn every 2-4 hrs. Samples were saved for subsequent analytical analysis.
Subsection VII: Analytical Methods
Analytical Methods have been developed for all anticipated metabolites and products.
Quantification of Organic and Amino Acids
A reverse phase UPLC-MS/MS method was developed for the simultaneous quantification of organic and amino acids. Chromatographic separation was performed using an Acquity CSH C18 column (100 mm×2.1 i.d., 1.7 μm; Waters Corp., Milford, Mass., USA) at 45 degrees C. The following eluents were used: solvent A: H2O, 0.2% formic acid and 0.05% ammonium (v/v); solvent B: MeOH, 0.1% formic acid and 0.05% ammonium (v/v). The gradient elution was as follows: 0-0.2 min isocratic 5% B, 0.2-1.0 min linear from 5% to 90% B, 1.0-1.5 min isocratic 90% B, and 1.5-1.8 min linear from 90% to 5% B, with 1.8-3.0 min for initial conditions of 5% B for column equilibration. The flow rate remained constant at 0.4 ml/min. A 5 μl sample injection volume was used. UPLC method development was carried out using standard aqueous stock solutions of analytes. Separations were performed using an Acquity H-Class UPLC integrated with a Xevo™ TQD Mass spectrometer (Waters Corp., Milford, Mass. USA). MS/MS parameters including MR transitions were tuned for each analyte and are listed in Table 6 below. Adipic acid at a concentration of 36 mg/L was used as an internal standard for normalization in all samples. Peak integration and further analysis was performed using Mass Lynx v4.1 software. The linear range for all metabolites was 2-50 mg/L. Samples were diluted as needed to be within the accurate linear range.
| TABLE 6 |
| MS/MS parameters |
| Reten- | |||||
| tion | Cone | Col- | |||
| Time | ESI | MRM | Volt- | lision | |
| Analyte | (min) | Mode | Transition(s) | age | Energy |
| 3-hydroxypropionic | 1.04 | − | 88.94→ 59.09 | 22 | 8 |
| Acid | |||||
| Alanine | 0.63 | + | 89.95→ 44.08 | 15 | 9 |
| α-ketoglutaric | 1.97 | − | 144.80→ 56.90 | 13 | 11 |
| Acid | |||||
| Citric Acid | 1.76 | − | 190.87→ 110.92 | 25 | 11 |
| Fumaric Acid | 1.91 | − | 114.72→ 70.94 | 21 | 7 |
| Glutamic Acid | 0.67 | − | 145.89→ 102.02 | 29 | 11 |
| Glyoxylic Acid | 0.83 | − | 72.84→ 44.98 | 33 | 7 |
| Lactic Acid | 1.18 | − | 88.94→ 43.08 | 26 | 8 |
| Malic Acid | 1.06 | − | 132.80→ 70.98 | 27 | 13 |
| Malonic Acid | 1.45 | − | 102.85→ 59.09 | 15 | 9 |
| Mevalonic Acid | 1.85 | − | 146.91→ 59.03 | 23 | 11 |
| Pyruvic Acid | 1.81 | − | 87.00→ 43.05 | 20 | 7 |
| Succinic Acid | 1.72 | − | 116.74→ 72.96 | 25 | 11 |
| Itaconic Acid | 1.86 | + | 130.87→84.98 | 20 | 12 |
| Adipic Acid | 2.0 | + | 144.77→82.96 | 32 | 12 |
Quantification of 2,3 Butanediol using Mass Spectrometry
A rapid UPLC-MS/MS method was developed for the quantification of 2,3 butanediol (2,3-BDO). Chromatographic separation was performed using an Acquity UPLC BEH C18 column (50 mm×2.1 i.d., 1.7 μm; Waters Corp., Milford, Mass., USA) at 45 degrees C. Isopropanol with 0.1% formic acid and 0.05% ammonium (v/v) was used in an isocratic separation. A 5 μl sample injection volume was used. UPLC method development was carried out using standard aqueous stock solutions of analytes. Separations were performed using an Acquity H-Class UPLC integrated with a Xevo™ TQD Mass spectrometer (Waters Corp., Milford, Mass. USA). An MRM transition for 2,3-BDO of 90.972→55.074 was used along with a cone voltage of 16V and Collision Energy of 10V, operating in ESI+ mode. Adipic acid at a concentration of 36 mg/L was used as an internal standard for normalization in all samples. The Adipic acid was measured in ESI− mode with an MRM transition of 144.77→82.96, a cone voltage of 32V and collision energy of 12 V. Both 2,3-BDO and adipic acid eluted at 0.38 minutes. Peak integration and further analysis was performed using Mass Lynx v4.1 software.
Quantification of Diols Using Refractive Index
A confirmatory HPLC method was developed for the quantification of 2,3 butanediol stereoisomers. Chromatographic separation was performed using a Biorad Aminex HPX-87H column (300×7.8 mm, 1.7 μm; Biorad, Hercules, Calif. USA). The isocratic separation was run at room temperature with 5 mM sulfuric acid as the mobile phase. The flow rate remained constant at 0.4 ml/min for 40 minutes after an injection. A 10 μl sample injection volume was used. Method development was carried out using standard aqueous stock solutions of analytes. Separations were performed using an Acquity H-Class UPLC integrated with an ESAT/IN refractive index (RI) detector. (Waters Corp., Milford, Mass. USA). Meso-2,3-butanediol eluted at 24.9 minutes, while (R,R)-2,3-butanediol eluted at 26.3 minutes. Peaks were integrated using Masslynx Software v4.1.
Quantification of Glucose
A YSI biochemistry analyzer, model 2950M (YSI Incorporated, Yellow Springs Ohio, USA) was used to routinely measure glucose concentrations as well as ethanol. The instrument was used according to manufacturer's instructions, using all reagents as supplied from YSI.
1.-77. (canceled)
78. A genetically modified microorganism comprising:
a production pathway comprising at least one enzyme for the production of a product, and
at least one synthetic metabolic valve comprising controlled transcriptional gene silencing of a gene encoding an enzyme that is one of: enoyl-ACP reductase (fabI), citrate synthase (gltA), soluble transhydrogenase (udhA), glucose-6-phosphate-l-dehydrogenase (zwf), lipoamide dehydrogenase (lpd), or combinations thereof;
wherein transcriptional gene silencing comprises expression of small guide RNAs specific for the gene;
wherein depletion of the limiting nutrient from a growth media in which the genetically modified microorganism is growing will inducing a stationary or non-dividing cellular state;
wherein the synthetic metabolic valve of the microorganism may be conditionally activated.
79. The genetically modified microorganism of claim 78, wherein transcriptional gene silencing further comprises expression of a gene encoding a dCas9 protein.
80. The genetically modified microorganism of claim 78, wherein a single plasmid expresses small guide RNAs for two or more genes.
81. The genetically modified microorganism of claim 78, wherein the synthetic metabolic valve directed to controlled transcriptional gene silencing further comprises conditional expression of a proteolysis chaperone protein.
82. The genetically modified microorganism of claim 81, wherein the chaperone protein is a sspB protein.
83. The genetically modified microorganism of claim 78 wherein the genetically modified microorganism is characterized by disruption or deletion of a gene naturally occurring in the genetically modified microorganism, the naturally occurring gene one of a gene encoding lactate dehydrogenase (ldhA), phosphate acetyltransferase (pta), pyruvate oxidase (poxB), pyruvate-formate lyase (pflB), the methylglyoxal synthase (mgsA), acetate kinase (ackA), alcohol dehydrogenase (adhE), ATP-dependent Lon protease (ion), outer membrane protease (ompT), arcA transcriptional dual regulator (arcA), iclR transcriptional regulator (icR), cas3, sspB or combinations thereof.
84. The genetically modified microorganism of claim 81 further comprising a synthetic metabolic valve comprising controlled proteolysis of an enzyme that is one of: enoyl-ACP reductase (fabI), citrate synthase (gltA), soluble transhydrogenase (udhA), glucose-6-phosphate-l-dehydrogenase (zwf), lipoamide dehydrogenase (lpd), or combinations thereof.
85. A bioprocess for production of a product from the genetically modified microorganism of claim 78, the bioprocess comprising:
in a first stage, growing the genetically modified microorganism in a medium and
in a second stage, reducing the genetically modified microorganism growth of the first stage and expressing a heterologous enzyme of the product production pathway,
wherein, a transition from the first stage to the second stage is at least partially controlled by depletion of a level of a limiting nutrient from the media and, as the limiting nutrient is depleted from the media growth of the genetically modified microorganism is stopped, and the transition comprising activation of the synthetic metabolic valve.
86. The bioprocess of claim 85, wherein the product is one of an alcohol, a diol, a polyol, an organic acid, an amino acid, a fatty acid, a fatty acid derivative, an ester, an alkane, or an alkene.
87. The bioprocess of claim 85, wherein the limiting nutrient comprises inorganic phosphate.
88. The bioprocess of claim 85, wherein the genetically modified microorganism is characterized by disruption or deletion of a gene naturally occurring in the genetically modified microorganism, the naturally occurring gene one of a gene encoding lactate dehydrogenase (idhA), phosphate acetyltransferase (pta), pyruvate oxidase (poxB), pyruvate-formate lyase (pflB), the methylglyoxal synthase (mgsA), acetate kinase (ackA), alcohol dehydrogenase (adhE), ATP-dependent Lon protease (Ion), outer membrane protease (ompT), arcA transcriptional dual regulator (arcA), iclR transcriptional regulator (icR), or combinations thereof.
89. The bioprocess of claim 85, further comprising a second synthetic metabolic valve controlling at least one enzyme essential for growth of the genetically modified microorganism that is one of: sucD, aceA, pfkA, Ion, rpoS, tktA or tktB.